|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 36, 33105-33114, September 6, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Cellular and Molecular Biology Program and the Department
of Horticulture, University of Wisconsin,
Madison, Wisconsin 53706
Received for publication, May 13, 2002, and in revised form, June 14, 2002
The vacuole/lysosome serves an important
recycling function during starvation and senescence in eukaryotes via a
process called autophagy. Here bulk cytosolic constituents and
organelles become sequestered in specialized autophagic vesicles, which
then deliver their cargo to the vacuole for degradation. In yeasts,
genetic screens have identified two novel post-translational
modification pathways remarkably similar to ubiquitination that are
required for autophagy. From searches of the Arabidopsis
genome, we have identified gene families encoding proteins related to
both the APG8 and Plants, like other organisms, have developed sophisticated
mechanisms for recycling intracellular constituents during periods of
growth, developmental remodeling, and nutrient-limiting conditions (1,
2). Especially critical is the degradation of protein, given the
importance of reused amino acids to the nitrogen and carbon economy.
Selective protein removal is accomplished primarily by the ubiquitin
(Ub)1/26 S proteasome
pathway (3, 4). In this pathway, the covalent attachment of Ubs is used
as a signal to target specific proteins for degradation by the 26 S
proteasome. Another major recycling system employs the vacuole, or its
animal equivalent, the lysosome, as a lytic organelle (5, 6). Here
cytosolic proteins are delivered to the vacuole and then degraded by a
wide variety of vacuolar proteases. In some situations, entire
organelles can be targets (7). Unlike the Ub/26 S proteasome pathway,
vacuolar proteolysis is for the most part non-selective, thus targeting proteins indiscriminately. As a consequence protein turnover by the
vacuole is thought to play less of a role in cellular regulation and a
more prominent role under conditions when rapid remobilization and
resorption of nutrients are crucial. These conditions include nutrient
deprivation and environmental stress and developmental periods that
require extensive cell and organ remodeling such as senescence and
programmed cell death (5, 6).
The vacuole degrades cytoplasm by three unique but overlapping
mechanisms, chaperone-assisted import, microautophagy, and macroautophagy (6-9). Chaperone-assisted import is activated during
starvation; it employs Hsp70-related proteins that help transport
individual proteins directly into the vacuole without the use of a
vesiculated intermediate (9). Microautophagy defines the sequestration
of cytosol by invaginations of the tonoplast, thus forming small
intravacuolar vesicles. These vesicles and their cargo are then broken
down by resident vacuole hydrolases (7). In methylotrophic yeasts for
example, microautophagy is important for removing peroxisomes in a
process called pexophagy, as the cells switch from methanol to glucose
metabolism (6, 7). Macroautophagy involves the engulfment of large
portions of cytoplasm by vesicles called autophagosomes (5, 6, 8). These vesicles appear to arise from the endoplasmic reticulum as
provacuole tubules; as the tubules elongate, they form long threaded
structures that eventually encircle portions of cytoplasm in a
cage-like structure. Autophagosomes are then created when these threads
fuse to seal completely the region in a double-membrane compartment.
The outer membrane of the autophagosome fuses with the tonoplast thus
releasing the internal vesicle into the vacuole where its cargo is
degraded in a process similar to microautophagy.
Although both macro- and microautophagy have been observed and their
morphological characteristics have been described in plants (10-16),
the molecular mechanisms underpinning these processes are not
understood. One of the main barriers has been the paucity of molecular
markers for autophagic vesicles and lack of mutants that impair their
assembly and delivery. To date, the only known plant vacuole mutant is
vacuoleless-1, which encodes an essential gene required for
organelle assembly (17). However, substantial progress has been made
recently with yeasts using genetic screens to identify
autophagy-deficient mutants. These include mutants in
Saccharomyces cerevisiae sensitive to starvation
(autophagy or apg (18,
19)) or defective in cytoplasm to vacuolar
targeting (cvt (20)), and the isolation of
mutants in the methylotrophic yeast Pichia pastoris blocked
in pexophagy (glucose-stimulated autophagy or gsa (21)). Many of the
apg/cvt/gsa mutants simultaneously abrogate microautophagy, macroautophagy, and pexophagy, indicating that
the corresponding proteins participate in steps common to each of these
processes. However, the mutants still retain functioning vacuoles
indicating that they do not alter vacuolar ontogeny.
Characterizations of a subset of yeast
apg/cvt/gsa mutants have identified
two novel protein conjugation pathways required for autophagy (22, 23).
In S. cerevisiae, the tags are APG8 and Orthologs for several yeast APG proteins have been discovered recently
in animals, suggesting that this autophagic system is present in all
eukaryotes (21, 25, 26). As a consequence, we attempted to find similar
proteins in plants through searches of available genome sequences. Here
we report that potential orthologs for all components of the APG8 and
Identification and Sequence Analysis of APG Genes--
The
A. thaliana genomic and expressed sequence tag (EST) data
bases (genome-www.stanford.edu/Arabidopsis/) were searched by BLAST
(27) for potential APG genes using the sequences of yeast and human proteins as queries. A full-length cDNA for
AtAPG12a (162B16T7) and a genomic BAC fragment (T14L9)
containing AtAPG7 were obtained from the
Arabidopsis Biological Resource Center (Ohio State
University, Columbus). The complete coding sequence of APG7
was determined from a reverse-transcribed (RT) PCR clone generated with
Pfu polymerase and the primers
CATATGCACCATCATCATCATCACATGGCTGAGAAAGAAACTCCAGCA (predicted start codon underlined) and
GAAGCCACCTAGTGAATATAGTCTATGGAC using A. thaliana Col-0 RNA as the template. The forward primer was
designed to add codons for an N- terminal His6 tag. The
product was first ligated into the EcoRV site of
pBluescript; the NdeI-Acc65I fragment of this
plasmid was isolated and cloned into the corresponding sites of pET32
(Novagen, Madison, WI) for expression of recombinant APG7 protein in
Escherichia coli (see below). The complete coding sequences for AtAPG8a and AtAPG8h were determined
from RT-PCR clones generated with the primers
TCGCATATGGCTAAGAGTTCCTTCAAGATCTCT and
GTGAGCTCAAGCAACGGTAAGAGATCCAAAGT, and
TCGCATATGAAATCGTTCAAGGAACAATACA and
GTGAGCTCAACCAAAGGTTTTCTCACTGCTA, respectively
(predicted start and stop codons underlined). DNA sequences were
determined by the PCR-based dideoxy method (PerkinElmer Life Sciences).
Intron/exon boundaries were identified by comparing cDNA and EST
sequences with their respective genomic DNA sequences or predicted by
comparing related genes. Amino acid sequence comparisons and phylogenic analyses were performed using MACBOXSHADE (Institute of Animal Health,
Pirbright, UK) and ClustalW (www.ebi.ac.uk/clustalw), respectively.
The GenBankTM accession numbers for the sequences
described in this article are AF492761 (AtAPG7), P38862
(ScAPG7), NP_006386 (HsAPG7), AF492759
(AtAPG8a), AF492760 (AtAPG8h),
NP_009475 (ScAPG8), NP_009216 (HsAPG8), AF492758
(AtAPG12a), P38316 (ScAPG12), and O94817
(HsAPG12).
Isolation and Complementation of apg7-1--
The
apg7-1 insertion mutant was identified by a PCR screen of a
T-DNA-transformed population of A. thaliana ecotype WS
generated by Dr. Kenneth Feldman (DuPont) using the
5'-CAATCTCTCAGAAAGATAAGATCAGCCATG or
3'-GAAGCCACCTAGTGAATATAGTCTATGGAC gene-specific primers in combination with either a left border or right border T-DNA-specific primer (28). The presence of this T-DNA in subsequent generations was
followed by PCR and by kanamycin resistance conferred by the T-DNA. The
apg7-1 mutant was backcrossed 3 times to the wild-type WS
ecotype to help eliminate secondary mutations and then the homozygous apg7-1 mutant was obtained by segregation analysis.
For complementation of apg7-1, a 7.5-kb KpnI
genomic DNA fragment from BAC T14L9 encompassing the APG7
gene was ligated into the KpnI site of pCAMBIA 1301 (Medical
Research Council Laboratory of Molecular Biology, Cambridge, UK). The
APG7C-S mutant with the Cys-558 codon substituted for that
encoding Ser was generated by the QuickChange method (Stratagene, La
Jolla, CA) using the primers
CGAACTCTAGACCAACAAAGCACTGTTACACGCC and
GGCGTGTAACAGTGCTTTGTTGGTCTAGAGTTCG (altered nucleotides
underlined) and a 1.5-kb BamHI-EcoRV fragment of
APG7 cloned into pBluescript as the template. The presence of the desired mutation and the absence of secondary mutations were
confirmed by DNA sequencing. Both pCAMBIA1301 APG7
constructs were introduced into Agrobacterium tumefaciens
strain C81 (pMP90) and then transformed into hemizygous
apg7-1 plants using the floral dip method (29). Transformed
seedlings (T1) were selected on medium containing 15 mg/liter
hygromycin B. T2 plants homozygous for both the apg7-1
allele and the APG7 transgene were identified by testing
progeny for growth on 25 mg/liter kanamycin and 15 mg/liter hygromycin
B and confirmed by PCR. T3 seeds were used for the phenotypic analyses.
Plant Growth Conditions--
Wild-type WS, apg7-1,
apg7-1/APG7, and
apg7-1/APG7C-S seeds were surface-sterilized in
50% bleach, placed on Gamborg B5 (Invitrogen) agar or liquid medium,
and incubated at 4 °C for 2 days. The plates or flasks were then
incubated at 21 °C in 16-h light/8-h dark photoperiod for long days,
8-h light/16-h dark photoperiod for short days, or in continuous light.
Two weeks after germination, plants growing in a short-day photoperiod
were transferred to soil and grown until seed maturation. Seeds
collected from individual plants were weighed and counted. One-week-old
plants growing in liquid medium under continuous light were washed two
times with modified Murashige and Skoog medium lacking nitrogen and
sucrose (nitrogen/carbon (N/C)-free medium: Murashige and Skoog
micronutrient salts (Invitrogen), 3 mM CaCl2,
1.5 mM MgSO4, 1.25 mM
KH2PO4, 5 mM KCl, 2 mM
MES (pH 5.7)) and then grown in this N/C-free medium. One-week-old
plants grown on Gamborg B5 agar were transferred to N/C-free agar
medium for further growth and subsequently transferred back to Gamborg B5 agar. For the detached leaf assay, first and second true leaves were
detached with a sharp blade from 2-week-old plants grown under a
long-day photoperiod on Gamborg B5 medium and placed in the dark with
their abaxial sides down on 3MM paper wetted with 3 mM MES
(pH 5.7) with or without 1 µM kinetin (Sigma). Leaves were collected at the indicated times, blotted dry, frozen in liquid
nitrogen, and used for chlorophyll, protein, and RNA isolation.
Chlorophyll Extraction and Measurement--
Chlorophyll was
extracted from frozen leaves into 1 ml of 96% EtOH by overnight
incubation at 4 °C and quantified spectrophotometrically (30).
Values given were per leaf and were expressed as a percentage of the
maximum chlorophyll level for each set of treatments.
Protein Isolation and Immunoblot Analysis--
Total soluble
protein was isolated from detached leaves or soil-grown plants by
homogenization in 50 mM Tris (pH 8.0), 1 mM Na4EDTA, 1% Triton X-100, 100 mM KCl, and 30 mM Na2S2O5, and the extracts were clarified by low speed centrifugation (31). Proteins were
subjected to SDS-PAGE and either stained with silver or transferred to
Hybond-C Extra membranes (Amersham Biosciences) for immunoblot analysis
using alkaline phosphatase-labeled goat anti-rabbit immunoglobulins (Kirkegaard & Perry Laboratories, Gaithersburg, MD) for detection. Sample sizes were adjusted to reflect a per leaf basis. For production of anti-APG7 antibodies, pET32His6APG7 was introduced into
E. coli BL21 Codon Plus (Stratagene) for expression of
recombinant APG7. Following a 3-h induction of log phase cells with 1 mM isopropyl- RNA Isolation and Analysis--
RNA was isolated from detached
leaves or soil-grown plants using Trizol reagent (Invitrogen). RNA for
RT-PCR was treated with DNase RQI (Promega, Madison, WI) prior to the
synthesis of first-strand cDNA by Moloney murine leukemia
virus-reverse transcriptase (Promega). The primer was either the
APG7 3' gene-specific primer
GAAGCCACCTAGTGAATATAGTCTATGGAC (primer 2, Fig. 5)
or the primer ATTGAATCCTGAGGTGCAA (primer 4, Fig. 5). PCR included 41 cycles with Ex-Taq polymerase (Panvera, Madison, WI), the
first strand synthesis primer, and either the APG7 5'
gene-specific primer CAATCTCTCAGAAAGATAAGATCAGCCATG
(primer 1, Fig. 5) or the primer GTTTCTTCTGATTCAAAAGC (primer 3, Fig. 5). Products were visualized following 0.8% agarose gel
electrophoresis and EtBr staining. For RNA gel blot
analysis, total RNA (sample size adjusted to reflect an equal leaf
number) was size-separated by electrophoresis through 1.5%
agarose-formaldehyde gels and transferred to Hybond-XL membranes
(Amersham Biosciences) using 20× SSC (1× = 0.15 M NaCl
and 0.015 M Na3citrate). RNA probes were
synthesized at 37 °C from linearized pGEMT (Promega) or pBluescript (Stratagene) cDNA constructs using the appropriate RNA polymerase (T3, T7, or SP6) and [ Protoplast Isolation, Staining, and Microscopy--
Ten-day-old
Arabidopsis seedlings were plasmolysed in 0.5 M
mannitol, 10 mM CaCl2, 20 mM
NH4NO3, 30 mM sucrose, 1 mM KNO3, 2 mM KH2PO4, 1 mM MgSO4, 0.3 mM
polyvinylpyrrolidone-40, 5 mM MES (pH 5.7) for 1 h
before overnight digestion in 10 ml/g fresh weight of Protoplast
Isolation Enzyme Solution II (Sigma). Protoplasts were collected and
stained with 3.5 mM neutral red (NR) (35) or 50 µM monochlorobimane (MCB, Molecular Probes, Eugene, OR) (13) dissolved in the plasmolysis solution. Staining with NR was
observed by light microscopy, and staining with MCB was visualized by
fluorescence microscopy using 365 nm excitation and 395 nm emission filters.
Detection of the APG Genes in Arabidopsis--
By reiterative
BLAST searches, we attempted to find counterparts to many of the yeast
APG/CVT/GSA genes (6, 24) in the near-complete genome data base of Arabidopsis
(www.arabidopsis.org/BLAST). Remarkably, potential orthologs for almost
all loci were discovered including APG1-10,
Importantly, a collection of Arabidopsis genes predicted to
encode all components of the APG8 and
Two Arabidopsis genes were identified that encode 94- and
96-amino acid proteins related to yeast APG12 (Fig. 3A). A
full-length EST was identified in the data bases for only
APG12a, which was used to verify the correct coding region.
No ESTs were available for APG12b; its gene structure was
predicted by alignment with APG12a and its yeast and animal
orthologs. The predicted amino acid sequences for APG12a and -b are
95% similar to each other and 36-45% similar to their yeast and
human orthologs (22, 36). Both Arabidopsis isoforms end in
the C-terminal glycine essential for conjugation, indicating that
post-translational processing is not needed to generate active APG12
proteins. The human and yeast orthologs of Arabidopsis
APG12a and -b are substantially larger, due to the presence of long
hydrophilic N-terminal extensions of 45 and 90 residues, respectively
(22, 36). The function of these extensions is not yet known.
The yeast APG8 and Isolation of the apg7-1 Mutant--
To help determine whether the
APG8/12 conjugation pathways function in plants, we searched the
available Arabidopsis T-DNA mutant populations for
insertions affecting APG7 given its predicted central and
essential role in both pathways (see Fig. 1). One useful allele was
apg7-1 which contains a T-DNA sequence within the gene (Fig.
5A). Sequence analysis of the T-DNA-APG7
junctions indicated that the element inserted into the 10th and final
intron of the gene and created a 20-bp deletion. A left border sequence was present at both ends of the T-DNA, and a right border sequence was
present at the 3' end internal to the left border. Kanamycin resistance
conferred by the NPTII coding region associated with the
T-DNA segregated in a 3:1 pattern, demonstrating that a single insert
was present. Despite the presence of the T-DNA, we could still detect
by RT-PCR an APG7 transcript in homozygous apg7-1 plants (Fig. 5B). The apg7-1 mRNA could be
amplified by a primer pair upstream of the insertion site but not by a
primer pair in which one was downstream of the insertion site
indicating that a truncated APG mRNA was expressed.
Despite its apparent synthesis we could not detect the transcript by
RNA gel blot analysis, suggesting that the truncated form is unstable
(Fig. 5C). Because the T-DNA was predicted to affect only a
short section of the coding sequence and was downstream of the codons
for the active-site cysteine and the putative nucleotide-binding
domain, it was possible that an active protein could still be
expressed. However, we could not detect by immunoblot analysis a
shorter protein of the expected size (70 kDa) in homozygous
apg7-1 seedlings (Fig. 5D). Taken together, it
appears that the apg7-1 allele severely impairs accumulation of the APG7 protein.
The apg7-1 Mutant Senesces Early and Is Hypersensitive to
Nutrient-limiting Conditions--
Despite the absence of
detectable APG7 protein, homozygous apg7-1 seedlings
underwent normal embryogenesis, germination, and seedling development
(Fig. 6A and data not shown).
They also grew at the same rate as wild-type and flowered at the same
time under both short- and long-day photoperiods when we used standard
nutrient-rich media and soil conditions. Collectively, the data
indicated that the APG7 protein, and by inference the APG8/12
conjugation pathways, are not essential for Arabidopsis
growth and development.
However following bolting, the apg7-1 plants showed
accelerated senescence, characterized by premature chlorosis of the
mature rosette leaves (Fig. 6B). This phenomenon could be
seen for apg7-1 plants grown under either short- or long-day
photoperiods on well fertilized soil but was dramatically enhanced when
the plants were grown under short days on soil deficient or depleted in
nitrogen. These early senescent plants also displayed reduced
fecundity. The mutant plants developed fewer inflorescence branches,
and a lower proportion of the siliques expanded and became filled with
seeds when grown on nutrient-depleted soils under a short-day photoperiod (Fig. 6, C and D).
Young apg7-1 seedlings were also hypersensitive to
nutrient-limiting growth conditions. When grown under continuous light in liquid medium free of nitrogen and carbon, the
apg7-1 plants slowly lost chlorophyll and ceased growing,
whereas the WT plants remained green and continued to grow, albeit at a
reduced rate (Fig. 7A). When
young seedlings were grown on N/C-free agar medium, accelerated
chlorosis was also evident. Whereas wild-type seedlings retained some
chlorophyll and continued to generate new leaves, the apg7-1
seedlings dramatically slowed their growth rate, bleached completely,
and accumulated anthocyanins in the apex within 2 weeks on such poor
growth conditions (Fig. 7B). This slower growth could be
observed by measuring root elongation. After 3 weeks growth on N/C-free
agar medium, the primary root of wild-type seedlings averaged 11.6 cm
in length as compared with 4.3 cm for apg7-1 seedlings.
Wild-type plants could be rescued from such nutrient deprivation by
transfer back to N/C-rich medium; even after exposure for up to 40 days
to such poor conditions, 80% of the plants resumed growth upon
retransfer (Fig. 7C). In contrast, the apg7-1
plants were irreversibly affected, and when transferred back to
N/C-rich media, they often did not recover. A time course of the effect
showed a sharp transition between survival and death; only 20% of
apg7-1 seedlings survived incubations on N/C-free medium
longer than 14 days (Fig. 7C).
Given a possible role of APG7 in vacuolar ontogeny and structure
through its presumed role in the APG8/12 conjugation system (8, 24), we
examined microscopically if the apg7-1 mutation affected
gross vacuolar morphology. As can be seen in Fig.
8, the size and shape of the central
vacuoles of apg7-1 plants were indistinguishable to
wild-type as determined by staining protoplasts with two vacuolar dyes,
neutral red (NR) and monochlorobimane (MCB) (13, 35). Swanson et
al. (13) reported the detection of lytic vacuoles as well as the
central vacuole when barley aleurone protoplasts were stained with MCB.
Here we failed to see these smaller lytic vacuoles and thus were unable
to determine whether the apg7-1 mutant affected their
production or distribution.
Complementation of apg7-1--
Proof that the apg7-1
phenotypes were directly caused by a reduction in APG7 protein activity
was obtained by complementation. apg7-1 plants were
transformed with a genomic fragment encoding either wild-type
APG7 or a mutant where the active-site cysteine was replaced
by a serine (APG7C-S) and expressed under the control of the native
APG7 promoter. Transformed plants were identified by the
hygromycin resistance gene, which was co-transformed with the
APG7 transgene. The T1 plants were allowed to
self-pollinate, and progenies homozygous for both the apg7-1
allele and the APG7 transgene were identified by PCR. As
shown in Fig. 5, C and D, high levels of
APG7 mRNAs and proteins were apparent. When
transformed plants were examined phenotypically, those harboring the
APG7C-S construction behaved like apg7-1 plants
(i.e. accelerated senescence, reduced seed production, and
hypersensitivity to N/C-free media), whereas those transformed with the
unmodified APG7 construction behaved like wild-type plants
(Figs. 6 and 7). These combined results not only proved that loss of
APG7 was the direct cause of the phenotypes but also implied that the
E1 activity of the protein was required for successful complementation.
Molecular Analysis of the Accelerated Senescence Phenotype of
apg7-1 Plants--
To help define at the molecular level the
accelerated senescence phenotype conferred by the apg7-1
mutation, we used a detached leaf assay (38). Here young leaves were
collected from 2-week-old Arabidopsis seedlings and
incubated in the dark. As shown in Fig. 9, wild-type leaves senesced within a
week, exemplified by the loss of chlorophyll and total protein.
Immunoblot analysis of individual proteins showed a concomitant
reduction in two photosynthetic markers, Rubisco and magnesium
protoporphyrin chelatase (32) (Fig. 9B). Surprisingly,
numerous proteins were relatively resistant to such degradation
including two subunits of the 26 S proteasome, PBA1-encoding a
The continued accumulation of APG7 protein in senescing leaves of
wild-type plants despite an overall loss of chlorophyll and total
protein suggested that the APG8/12 conjugation pathways are
up-regulated during senescence. To test this possibility, we extracted
total RNA from detached WT and apg7-1 leaves undergoing dark-induced senescence and subjected it to RNA gel blot analysis. To
better reflect the actual levels of RNA in the leaves, we equalized the
loads of total RNA based on the same number of leaves. As can be seen
in Fig. 10, rRNAs (as detected by EtBr
staining) were degraded during senescence, and this breakdown was
exacerbated by the apg7-1 mutation. In fact by day 7, most
of the rRNAs were converted into smaller degradation intermediates in
the apg7-1 leaves. A parallel loss of CDC2a
mRNA, (encoding a cyclin-dependent kinase (41)) was
also observed. This suggested that other mRNAs were also degraded
as senescence progressed, the rate being enhanced by the
apg7-1 mutation (Fig. 10). As expected CAB
mRNA also rapidly disappeared following the dark incubation
consistent with the instability of the CAB mRNA and the
light requirement for continued CAB transcription (42).
Conversely, levels of the senescence-associated SEN1
mRNA increased during the senescence time course. Similar to the
observations of Weaver et al. (38) SEN1
transcript levels increased substantially in wild-type leaves well
before detectable chlorosis (2.5 days) and then decreased gradually as
senescence progressed. For the apg7-1 plants, a higher basal
level of SEN1 mRNA was detected before leaf detachment.
This level increased further during the senescence process followed by
a substantial loss of transcript that paralleled the loss of total
RNA.
Like SEN1, transcript abundance for APG7 and
Effect of Cytokinins on the apg7-1 Phenotype--
Cytokinins have
been well described as inhibitors of leaf senescence which can
effectively block the chlorosis of detached leaves at micromolar
concentrations (43). To test if cytokinins can antagonize the effects
of the apg7-1 mutation, we treated detached leaves senescing
in the dark with various concentrations of kinetin, and we examined the
rate of senescence by chlorophyll and protein measurements. For
wild-type leaves, 1 µM kinetin retarded the loss of
chlorophyll and Rubisco but had a minimal effect of the
magnesium-protoporphyrin chelatase (Fig.
11 and data not shown). For the
apg7-1 leaves, the inhibitory effect of kinetin was
substantially diminished but still evident. Although delayed slightly,
detached leaves treated with 1 and 10 µM kinetin still
lost chlorophyll and both photosynthetic proteins, suggesting that
cytokinins cannot fully override the effects of the apg7-1
mutation (Fig. 11 and data not shown). Kinetin treatment had little
effect on the levels of PBA1 and RPT2 and APG7 (Fig. 11B and
data not shown). Only a slight decrease in APG7 protein was evident
when wild-type plants were treated with 1 µM kinetin.
Vacuolar autophagy has long been considered to be an important
route for recycling various cellular constituents in yeasts and
animals, especially during times of starvation and programmed cell
death (6-8). Ultrastructural analyses suggest a similar role for
autophagy in plants (10-16), but its exact functions have remained
elusive given the paucity of molecular markers and mutants currently
available. One of the essential components of the autophagic system in
yeasts is a pair of conjugation pathways that attach the polypeptide
tags APG8 and Here, we show that plants likely have a conjugation system related to
yeast APG8 and The comparable phenotypes of Arabidopsis, S. cerevisiae, and P. pastoris mutants disrupted in their
respective APG7 loci (see Refs. 21, 22, and this report)
suggest that the encoded proteins and by inference the associated
APG8/12 conjugation pathways function in a similar fashion in plants.
Thus, it is reasonable to propose that the Arabidopsis
apg7-1 plants like their yeast counterparts are compromised
in autophagic process(es) activated under nutrient limiting conditions
(6, 8). Clearly, proof of this connection will require an
ultrastructural analysis of autophagy in apg7-1 and other
Arabidopsis apg mutant lines. In both yeasts and
Arabidopsis, APG7 is not essential. Provided the
apg7-1 plants were grown in nutrient-rich conditions, their
phenotype was indistinguishable from wild type for most of their life
cycle. Thus under normal physiological conditions, the
Arabidopsis APG8/12 system likely contributes little to the
N/C supply or that the plants can recycle cellular constituents by
other routes when the APG8/12 system is compromised. These other routes
could include the Ub/26 S proteasome pathway, other cytosolic and
organellar proteolytic pathways (2), and/or possibly chaperone-assisted
vacuolar import (9), a pathway that remains to be demonstrated in
plants. In this regard, we note that levels of two 26 S proteasome
subunits (PBA1 and RPT2) remain stable during Arabidopsis
leaf senescence, suggesting that the entire proteolytic complex remains
active throughout the process.
Aberrant phenotypes did become evident when the apg7-1
plants were starved for nitrogen and carbon, leaves of
apg7-1 plants were detached and incubated in the dark or
after bolting when the mature rosette leaves of apg7-1
plants senesced prematurely. Ohsumi and co-workers (44) recently
observed similar effects for an Arabidopsis tDNA mutant of
APG9,2 an
autophagy-associated protein of unknown function, suggesting that
mutations in many of the APG loci will elicit a similar
phenotype. All of the apg7-1 phenotypes can be explained by
a common response, i.e. attempting to maintain the supply of
nitrogen and carbon for continued survival. They are also
consistent with the hypersensitivity to nutrient limiting conditions
exhibited by yeast apg/cvt/gsa mutants blocked in
microautophagy, macroautophagy, and pexophagy (18). Based on the
premises that chloroplasts can be removed by autophagy (45) and that
apg7-1 plants have impaired autophagy, it was possible that
the apg7-1 plants would exhibit a slower rate of chlorosis.
Instead we observed more rapid chlorosis and loss of chloroplast
enzymes, indicating that chloroplast protein turnover was accelerated.
This suggests that chloroplasts are not substrates of a proteolytic
system dependent on APG7. In support, Ono et al. (46)
recently showed that during wheat leaf senescence, the number and size
of chloroplasts did not change dramatically until the last stage of
senescence just before cell autolysis. A more likely scenario is that
the apg7-1 plants accelerate chloroplast protein turnover by
other mechanisms including the activation of Clp and other chloroplast
proteases, some of which are known to be up-regulated during leaf
senescence (38, 47).
The preferential accumulation of APG7 and Compared with the APG8/12 pathways in yeasts, their counterparts in
Arabidopsis may be more elaborate given the presence of multiple loci encoding many components in the predicted conjugation cascade. Especially interesting is the presence of multiple isoforms of
APG8 that phylogenically cluster into two distinct clades. An
intriguing possibility is that these isoforms have distinct functions,
targets, and/or expression patterns. For example, because APG8h and -i
lack extra amino acids beyond their C-terminal glycines, they
presumably can enter the conjugation cascade without processing by APG4
(see Fig. 1). In mammalian species, three different APG8 proteins have
been identified that work with the E2 APG3 (51). Interaction studies
showed that each can bind specifically to a different set of proteins,
suggesting that specific APG8 isoforms can perform unique functions
(52-54).
The identification of Arabidopsis orthologs for the yeast
APG8/12 conjugation system now expands the potential repertoire of
small polypeptide tags operating in plants to five, with Ub, RUB1/NEDD8, and SUMO being the others (3, 55). In all these cases, the
respective conjugation pathways appear more complex than in yeast,
implying that plants have increased their reliance on these
post-translational modifiers. Coincidentally, most if not all likely
participate directly or indirectly in protein turnover. By using the
APG genes and proteins identified here, a detailed genetic,
molecular, and cytological understanding of the APG8/12 conjugation
system and its proposed role in plant autophagy is now possible.
*
This work was supported by United States Department of
Agriculture Grant NRICGP 00-35301-9040 (to R. D. V.), a National
Institutes of Health postdoctoral fellowship (to J. H. D. ), and a
University of Wisconsin Graduate School fellowship (to A. R. T. ).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, June 17, 2002, DOI 10.1074/jbc.M204630200
2
H. Hanaoka, T. Noda and Y. Ohsumi, unpublished observations.
The abbreviations used are:
Ub, ubiquitin;
EST, expressed sequence tag;
MCB, monochlorobimane;
NR, neutral red;
RT, reverse-transcribed;
WT, wild type;
PE, phosphatidylethanolamine;
UTR, untranslated region;
MES, 2-(N-morpholino)ethanesulfonic
acid;
Rubisco, ribulose-bisphosphate carboxylase/oxygenase;
E1, tag-activating enzyme;
E2, tag-conjugating enzyme.
The APG8/12-activating Enzyme APG7 Is Required for
Proper Nutrient Recycling and Senescence in Arabidopsis
thaliana*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
12 polypeptide tags and orthologs for all
components required for their attachment. A single APG7
gene encodes the ATP-dependent activating enzyme that
initiates both conjugation pathways. Phenotypic analysis of an
APG7 disruption indicates that it is not essential for
normal growth and development in Arabidopsis. However, the
apg7-1 mutant is hypersensitive to nutrient limiting
conditions and displays premature leaf senescence. mRNAs for both
APG7 and APG8 preferentially accumulate as leaves senesce, suggesting
that both conjugation pathways are up-regulated during the senescence
syndrome. These findings show that the APG8/12 conjugation pathways
have been conserved in plants and may have important roles in
autophagic recycling, especially during situations that require
substantial nitrogen and carbon mobilization.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
12, small proteins
of 117 and 186 amino acids, respectively. Although bearing little
sequence similarity to Ub, APG8 and 12 become attached to other
cellular factors by an enzymatic cascade remarkably similar to
ubiquitination (8, 24). As shown in Fig.
1, the first step of each pathway
requires the activity of APG7 (also known as CVT2 and GSA7). This E1
activates both APG8 and 12 by first directing the formation of a
phosphoanhydride bond between the AMP moiety of ATP and the C-terminal
glycine of the tag. Then APG7 becomes linked to the tag via a high
energy thiol ester bond between the glycine moiety of the tag and a
unique cysteine in APG7. APG7 subsequently donates the activated tag via transesterification to a unique cysteine within an E2. For APG8 and
12, this E2 activity is provided by APG3 and 10, respectively. The
E2-bound tag is then donated to appropriate targets. In yeast, APG12
becomes attached to a single target, APG5, via an isopeptide bond
between the C-terminal glycine of APG12 and a single lysine (Lys-149)
in APG5 (22). In contrast, APG8 is bound to phosphatidylethanolamine (PE) via an amide bond between the C-terminal glycine of APG8 and the
terminal amino group in this lipid (23). By an unknown sequence of
events, production of the APG12-APG5 and APG8-PE conjugates then
promotes the formation of autophagic vesicles and their subsequent delivery to the vacuole. The yeast APG8 pathway also requires an
additional protease step directed by APG4, which removes an extra
C-terminal amino acid (arginine) in the APG8 precursor to expose the
glycine essential for conjugation (Fig. 1).
View larger version (27K):
[in a new window]
Fig. 1.
Description of the APG conjugation pathways
in yeast. By ATP-dependent reaction cascades involving
an E1 and E2s, APG12 and APG8 become covalently attached to their
respective targets APG5 and phosphatidylethanolamine (PE).
Prior to activation, the APG8 precursor is processed by the APG4
protease to remove the extra C-terminal residues and thus expose the
penultimate glycine. Both APG12 and 8 are activated by the E1-APG7
and become bound to APG7 by a thiol ester bond. The activated tags are
then donated to their respective E2s, APG10 and APG3 by
transesterification, and finally attached to their targets by an amide
bond. For APG5, a specific lysine (K) is involved which
forms an isopeptide bond with APG12. For PE, the amide group of
ethanolamine is used for attachment to APG8.
12 conjugation pathways are present in Arabidopsis
thaliana (see Fig. 1). An Arabidopsis T-DNA mutant that
interferes with the accumulation of APG7, the ortholog of the yeast E1
required for both APG8 and 12 conjugation, is phenotypically normal
under non-stressed conditions, suggesting that these two pathways are
not essential in plants. However, the mutant plants show accelerated
senescence and are highly sensitive to nutrient-limiting growth
conditions, suggesting that these conjugation pathways become important
when carbon and nitrogen remobilization is essential. The discovery of
these APG genes/proteins may now provide important new tools to dissect
the autophagic process in plants at the genetic, cytological, and
biochemical levels.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-D-thiogalactoside, inclusion
bodies were collected, solubilized in urea, and injected into rabbits
(Polyclonal Antibody Service, Madison, WI). Antibodies against the
large subunit of spinach Rubisco and the CH-42 subunit of pea
magnesium-protoporphyrin chelatase (32) were provided by Drs. Archie
Portis and Tanya Falbel, respectively. The anti-PBA1 and RPT2
antibodies were as described (33).
-32P]UTP. Membranes were
hybridized overnight at 65 °C and washed according to Ref. 34 prior
to autoradiography.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
12-13 (Figs.
2-4
and data not shown). For clarity, we have adopted the same nomenclature
developed by Ohsumi (24) for these APG loci. Unlike yeast
where each protein is encoded by a single gene (24), many of the
Arabidopsis proteins are encoded by two or more loci,
suggesting a greater complexity of the APG system in plants. However,
not all loci were detected; notably absent were obvious counterparts to
APG14, 16, and 17, suggesting that
they have substantially diverged during evolution. Multiple cDNAs
for many of the APG genes were also detected in various EST
collections from Arabidopsis, rice, soybeans,
Medicago, tomato, potato, corn, barley, wheat, sorghum, and
Chlamydomonas to name a few, implying that this autophagic
system may be active in all plants.
View larger version (58K):
[in a new window]
Fig. 2.
Description of the Arabidopsis
APG8 gene family. A, diagrams of
representative APG8 genes, APG8a and
APG8h. Lines represent introns. Boxes
represent exons; black represents coding regions, and
white represents 5'- and 3'-UTRs. The nucleotide lengths of
the coding region exons are indicated. B, amino acid
sequence comparison of the Arabidopsis (At) APG8
family with their human (Hs) and yeast (Sc)
orthologs. Identical and similar amino acids are shown in reverse
type and gray boxes, respectively. Numbers
at the end indicate the amino acid length. The
arrowhead marks the expected APG4 protease cleavage sites to
expose the C-terminal glycine in the APG8a-g precursors. C,
phylogenic comparison of the AtAPG8a-i protein family with
yeast APG8 (ScAPG8). The bar represents the
number of changes/residue.
View larger version (70K):
[in a new window]
Fig. 3.
Description of the Arabidopsis
APG12 gene family. A, diagrams of
APG12a and APG12b. Lines represent introns.
Boxes represent exons; black represents coding
regions, and white represents 5'- and 3'-UTRs. The
nucleotide lengths of the coding region exons are indicated.
B, amino acid sequence comparison of the
Arabidopsis (At) APG12 family with their human
(Hs) and yeast (Sc) orthologs. Identical and
similar amino acids are shown in reverse type and gray
boxes, respectively. Numbers at the end
indicate the amino acid length.
View larger version (79K):
[in a new window]
Fig. 4.
Description of the Arabidopsis
APG7 gene and detection of the corresponding protein.
A, amino acid sequence comparison of the
Arabidopsis (At) APG7 protein with its human
(Hs) and yeast (Sc) orthologs. Identical and
similar amino acids are shown in reverse type and gray
boxes, respectively. Numbers at the end
indicate the amino acid length. The arrowhead and
dashed line mark the active-site cysteine (Cys-558) and
putative nucleotide-binding site GXGXXG,
respectively. B, immunoblot detection of the APG7 protein in
Arabidopsis. Crude soluble extracts were prepared from
various tissues and subjected to immunoblot analysis with
anti-AtAPG7 antibodies. Grn, green seedlings.
Etiol, etiolated seedlings. Recombinant His6-APG7 (rAPG7) is
included on the left.
12 conjugation pathways was
identified (8, 24). These include loci for APG8 and 12, the E1-APG7,
the E2s-APG3 and 10, the target APG5, and the protease APG4 (see Fig.
1). In all cases, the positionally important amino acids necessary for
enzymatic activity and/or function are present. Nine loci encode a
family of APG8 proteins with 69-96% amino acid sequence similarity to
each other and 73-90% similarity to yeast APG8 (Fig. 2B).
Intron/exon arrangements are also similar among the
Arabidopsis gene family, indicating that this family arose from a common progenitor (Fig. 2A). Like yeast and human
APG8 (23, 26), seven of the Arabidopsis APG8 proteins
(APG8a-g) contain additional residues beyond the predicted mature C
terminus that presumably must be removed post-translationally by APG4
to expose the glycine necessary for conjugation. Phylogenic analysis of
the APG8 family revealed that APG8a-g cluster into one clade of
84-96% amino acid sequence similarity that also includes yeast APG8
(Fig. 2C). APG8h and -i grouped into a separate clade;
they are only 69-75% similar to members of the other clade and lack extra residues that protect the C-terminal glycine. ESTs are available for seven of the nine APG8 genes, the exceptions being
APG8f and APG8i, indicating that most are expressed.
12 conjugation pathways both require an E1
activity directed by APG7 (21, 22, 26, 37) (Fig. 1). In
Arabidopsis, we detected a single APG7 gene. It
contains 10 introns and 11 exons and encodes a 697-amino acid protein
with 56 and 62% similarity to yeast and human APG7, respectively
(Figs. 4A and 5A).
Consistent with its predicted enzymatic activity, the
Arabidopsis APG7 protein contains the positionally conserved cysteine (Cys-558) expected to form the thiol ester linkage with APG8
and 12 (21, 22), and the consensus nucleotide-binding site
(364GXGXXG369) possibly
required for either binding ATP or the activated AMP tag intermediate
(Fig. 4A). By using antibodies directed against recombinant
APG7, we could detect a protein of the expected size (76 kDa) in crude
extracts from various Arabidopsis tissues of both etiolated
and green seedlings (Fig. 4B). This distribution suggests
that APG7 and the corresponding APG8 and 12 conjugation pathways are
active in all cell/tissue types.
View larger version (32K):
[in a new window]
Fig. 5.
Description of the Arabidopsis
apg7-1 mutation. A, diagram of the
Arabidopsis APG7 gene. Lines represent
introns. Boxes represent exons; black represents
coding regions, and white represents 5'- and 3'-UTRs.
Arrowheads locate the active-site cysteine (Cys-558) and the
putative nucleotide-binding site (Nt). The location of the
T-DNA in the apg7-1 mutant is shown. Arrows show
the location of the primers used in B. B, RT-PCR
analysis of the apg7-1 mutant. Total RNA isolated from
wild-type (WT), apg7-1, and apg7-1
complemented with either APG7 or the APG7
active-site mutant (C-S) was subjected to RT-PCR using
either the 1 + 2 primer pair or the 3 + 4 primer pair. As a control,
genomic DNA from WT was included. Failure to detect the product of the
1 + 2 primer pair in apg7-1 showed that the last exon was
absent in mutant APG7 mRNA. C, RNA gel blot
analysis of WT, apg7-1, and apg7-1 complemented
with either APG7 or the APG7 active-site mutant
C-S to detect transcripts of APG7. Ten µg of
total RNA isolated from young seedlings was separated by denaturing gel
electrophoresis, transferred to a membrane, and hybridized with coding
region probes for APG7 and CDC2a. D,
immunoblot analysis with anti-APG7 antibodies of WT, apg7-1,
and apg7-1 complemented with either APG7 or the
APG7 active-site mutant (C-S). Total soluble
protein was isolated from young seedlings and separated by SDS-PAGE.
Recombinant His6-tagged APG7 is included on the
right.
View larger version (28K):
[in a new window]
Fig. 6.
Phenotypic analysis of the
Arabidopsis apg7-1 mutant. Plant lines
include wild-type (WT), apg7-1, and
apg7-1 complemented with either APG7 or the
APG7 active-site mutant (C-S). A,
3-week-old seedlings grown under a short day photoperiod on nutrient
rich soil. B, plants grown for 5 months under a short-day
photoperiod on nutrient-rich soil. C, inflorescences of
plants grown under a short-day photoperiod in nutrient poor soil.
D, seed yield of plants grown under a short-day photoperiod
in nutrient-poor soil.
View larger version (34K):
[in a new window]
Fig. 7.
Enhanced sensitivity of apg7-1
plants to low nitrogen and carbon (N and C)
growth conditions. Plant lines include wild-type (WT),
apg7-1, and apg7-1 complemented with either
APG7 or the APG7 active-site mutant
(C-S). A, plants were grown for 1 week in N- and
C-rich liquid medium (0 days) and then transferred to N- and
C-free liquid medium for an additional 32 days. B, plants
were grown for 1 week on N/C-rich agar medium and then transferred for
2 weeks growth on N/C-free agar medium. C, survival of
plants grown for 1 week on N/C-rich agar medium and then transferred to
N/C-free agar medium for various lengths of time before transfer back
to N/C-rich agar medium. The percentage of plants that survived this
regime as determined by resumption of growth is plotted
versus days grown on N- and C-free medium.
View larger version (58K):
[in a new window]
Fig. 8.
Vacuoles appear normal in the
apg7-1 mutant. Protoplasts from young leaves of
2-week-old wild-type (WT) and apg7-1 seedlings
were either stained with NR and visualized by light microscopy or with
monochlorobimane (MCB) and visualized by fluorescence
microscopy. The light microscopic images of the MCB-stained protoplasts
are shown to the left.
subunit of the 20 S proteolytic core, and RPT2-encoding an AAA-ATPase
of the 19 S regulatory particle (39, 40). The apg7-1 mutant
senesced faster, as detected by an accelerated loss of chlorophyll and
the two photosynthetic markers (Fig. 9, A and B).
Complementation of the apg7-1 plants with wild-type APG7
protein but not the APG7C-S mutant reversed all the effects
as defined by a slower loss of chlorophyll, Rubisco, and magnesium
protoporphyrin chelatase (data not shown). During the time course of
senescence, the levels of APG7 did not decrease and, in fact,
appeared to increase slightly in the detached leaves. This effect was
seen both for wild-type plants and for apg7-1 plants
complemented with the APG7 gene under control of its own
promoter (apg7-1/APG7) (Fig. 9B).
View larger version (29K):
[in a new window]
Fig. 9.
The apg7-1 mutation
accelerates dark-induced senescence in detached
leaves. Leaves from 2-week-old wild-type (WT) and
apg7-1 Arabidopsis seedlings were detached and
incubated in the dark on 3 mM MES (pH 5.7). At the various
times, leaves were collected and assayed for chlorophyll and soluble
protein. A, top panel, representative pictures of
the leaves. Bottom panel, levels of chlorophyll.
B, levels of total protein as detected by silver staining
and representative proteins as detected by immunoblot analysis
following SDS-PAGE of total clarified leaf extracts. RBC,
large subunit of Rubisco; Chel, magnesium protoporphyrin
chelatase; PBA1, subunit A of the 26 S proteasome;
RPT2, triple A-ATPase subunit 2 of the 26 S proteasome; and
APG7. For APG7, leaves from WT and the apg7-1 mutant
complemented with the wild-type APG7 gene are shown.
Arrowheads identify the migration positions of the large and
small subunit of Rubisco in the silver-stained gels.
View larger version (81K):
[in a new window]
Fig. 10.
rRNA and mRNA abundance during the
senescence of detached apg7-1 Arabidopsis
leaves. Leaves from 2-week-old wild-type (WT) and
apg7-1 Arabidopsis seedlings were incubated in
the dark on 3 mM MES (pH 5.7). At various times, leaves
were collected, and total RNA was extracted. RNA from an equal number
of leaves at each time point was subjected to denaturing agarose gel
electrophoresis and either stained with ethidium bromide
(EthBr) or transferred to nylon membranes and subjected to
RNA gel blot analysis with coding region probes for CDC2a,
CAB, SEN1, APG7, or
APG8a.
8 increased markedly during detached leaf senescence
although not as rapidly (Fig. 10). (Given the high nucleotide identity
among the nine Arabidopsis APG8 genes, we assume
that the APG8a probe used here recognized most if not all of
the transcripts from this gene family.) Although the increase in
APG7 mRNA was evident by day 5, the increase in APG8 mRNAs was evident as early as day 2.5, suggesting
that APG8 mRNA levels respond more rapidly to the dark
incubation. The highest amounts of APG7 and 8
transcripts were detected between days 5 and 7 of the senescence time
course of wild-type leaves. For apg7-1 leaves, the maximum
for the APG8 mRNAs was at day 5, which was then followed
by a rapid loss that paralleled the catabolism of rRNAs and the
CDC2a mRNA.
View larger version (33K):
[in a new window]
Fig. 11.
Effect of the cytokinin-kinetin on the
accelerated senescence of detached apg7-1 leaves.
Leaves from 2-week-old wild-type (WT) and apg7-1
Arabidopsis seedlings were detached and incubated in the
dark on 3 mM MES (pH 5.7) with or without 1 µM kinetin. At the various times, leaves were collected
and assayed spectrophotometrically for chlorophyll (A) and
immunologically for the large subunit of Rubisco (RBC) and
APG7 (B). Open symbols, without kinetin;
black symbols, with 1 µM kinetin.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
12 to the lipid PE and the protein APG5, respectively.
By an unknown mechanism these modifications trigger autophagosome
assembly and/or fusion of the vesicles with the vacuole.
12 with the discovery of a similar set of
APG genes in Arabidopsis. This set includes small
gene families encoding the APG8 and 12 tags and one or more genes
encoding the target of APG12 (APG5) or the enzymes required for the
following: (i) processing of the APG8 precursor (APG4), (ii) the
ATP-dependent activation of both APG8 and 12 (APG7), and
(iii) conjugation of the tags to their respective targets (APG3 and
10) (see Fig. 1). All important catalytic domains in the yeast APG
components are conserved in their Arabidopsis counterparts,
strongly suggesting that the Arabidopsis pathways have
similar mechanisms of catalysis. This possibility is further supported
by our observations that complementation of the apg7-1
phenotype was successful with wild-type APG7 but not with a mutant
version predicted to be enzymatically inactive (APG7C/S). Final proof
will require demonstration that the various APG components have the
proposed enzymatic activities and can produce the expected APG8-PE and
APG12-APG5 conjugates in planta. Unfortunately, we have been
unable thus far to generate enzymatically active Arabidopsis
APG7 by recombinant methods to begin this analysis (data not shown).
Attempts are now underway to detect the APG8 and 12 conjugates in
crude plant extracts.
8
transcripts during detached leaf senescence further supports a role for
the APG8/12 system in the senescence syndrome. In fact, their
accumulation would have appeared even more dramatic than shown with the
RNA gel blots in Fig. 10 if the amount of RNA loaded for each time point was equal instead of adjusted for an equal amount of tissue. As a
consequence, the APG system can now be added to a growing list of
"senescence-associated" processes up-regulated during senescence
(38, 48). Compared with the accumulation of SEN1 mRNA,
accumulation of APG7 and 8 mRNAs was
delayed, suggesting that the APG system functions later than other
senescence-associated components. In yeast, the levels of the
APG8 transcript increase dramatically during starvation, but
those of the APG7 transcript are unaffected (49, 50).
Cytokinins, known regulators of the senescence program in leaves (43),
were unable to fully reverse the effects of the apg7-1
mutation as measured by retention of chlorophyll and the two
photosynthetic proteins, Rubisco and magnesium protoporphyrin
chelatase. Therefore, cytokinins likely function either upstream of the
APG8/12 pathway or in a parallel pathway that ultimately promotes leaf
survival. Cytokinin treatment slightly decreased the levels of the APG7
protein; it will be interesting to see if a concomitant decrease in the
APG7 and 8 mRNAs occurs as well.
FOOTNOTES
To whom correspondence should be addressed: Dept. of Horticulture,
1575 Linden Dr., University of Wisconsin, Madison, WI 53706.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Callis, J.
(1995)
Plant Cell
7,
845-857[CrossRef][Medline]
[Order article via Infotrieve]
2.
Vierstra, R. D.
(1996)
Plant Mol. Biol.
32,
275-302[CrossRef][Medline]
[Order article via Infotrieve]
3.
Callis, J.,
and Vierstra, R. D.
(2000)
Curr. Opin. Plant Biol.
3,
381-386[CrossRef][Medline]
[Order article via Infotrieve]
4.
Hershko, A.,
and Ciechanover, A.
(1998)
Annu. Rev. Biochem.
67,
425-479[CrossRef][Medline]
[Order article via Infotrieve]
5.
Marty, F.
(1999)
Plant Cell
11,
587-600 6.
Kim, J.,
and Klionsky, D. J.
(2000)
Annu. Rev. Biochem.
69,
303-342[CrossRef][Medline]
[Order article via Infotrieve]
7.
Dunn, W. A. J.
(1994)
Trends Cell Biol.
4,
139-143[CrossRef][Medline]
[Order article via Infotrieve]
8.
Klionsky, D. J.,
and Emr, S. D.
(2000)
Science
290,
1717-1721 9.
Cuervo, A. M.,
and Dice, J. F.
(1998)
J. Mol. Med.
76,
6-12[CrossRef][Medline]
[Order article via Infotrieve]
10.
Van Der Wilden, W.,
Herman, E. M.,
and Chrispeels, M. J.
(1980)
Proc. Natl. Acad. Sci. U. S. A.
77,
428-432 11.
Herman, E. M.,
Baumgartner, B.,
and Chrispeels, M. J.
(1981)
Eur. J. Cell Biol.
24,
226-235[Medline]
[Order article via Infotrieve]
12.
Toyooka, K.,
Okamoto, T.,
and Minamikawa, T.
(2001)
J. Cell Biol.
154,
973-982 13.
Swanson, S. J.,
Bethke, P. C.,
and Jones, R. L.
(1998)
Plant Cell
10,
685-698 14.
Moriyasu, Y.,
and Ohsumi, Y.
(1996)
Plant Physiol.
111,
1233-1241[Abstract]
15.
Di Sansebastiano, G. P.,
Paris, N.,
Marc-Martin, S.,
and Neuhaus, J. M.
(2001)
Plant Physiol.
126,
78-86 16.
Aubert, S.,
Gout, E.,
Bligny, R.,
Marty-Mazars, D.,
Barrieu, F.,
Alabouvette, J.,
Marty, F.,
and Douce, R.
(1996)
J. Cell Biol.
133,
1251-1263 17.
Rojo, E.,
Gillmor, C. S.,
Kovaleva, V.,
Somerville, C. R.,
and Raikhel, N. V.
(2001)
Dev. Cell
1,
303-310[CrossRef][Medline]
[Order article via Infotrieve]
18.
Tsukada, M.,
and Ohsumi, Y.
(1993)
FEBS Lett.
333,
169-174[CrossRef][Medline]
[Order article via Infotrieve]
19.
Noda, T.,
Matsuura, A.,
Wada, Y.,
and Ohsumi, Y.
(1995)
Biochem. Biophys. Res. Commun.
210,
126-132[CrossRef][Medline]
[Order article via Infotrieve]
20.
Harding, T. M.,
Morano, K. A.,
Scott, S. V.,
and Klionsky, D. J.
(1995)
J. Cell Biol.
131,
591-602 21.
Yuan, W.,
Stromhaug, P. E.,
and Dunn, W. A., Jr.
(1999)
Mol. Biol. Cell
10,
1353-1366 22.
Mizushima, N.,
Noda, T.,
Yoshimori, T.,
Tanaka, Y.,
Ishii, T.,
George, M. D.,
Klionsky, D. J.,
Ohsumi, M.,
and Ohsumi, Y.
(1998)
Nature
395,
395-398[CrossRef][Medline]
[Order article via Infotrieve]
23.
Ichimura, Y.,
Kirisako, T.,
Takao, T.,
Satomi, Y.,
Shimonishi, Y.,
Ishihara, N.,
Mizushima, N.,
Tanida, I.,
Kominami, E.,
Ohsumi, M.,
Noda, T.,
and Ohsumi, Y.
(2000)
Nature
408,
488-492[CrossRef][Medline]
[Order article via Infotrieve]
24.
Ohsumi, Y.
(2001)
Nat. Rev. Mol. Cell. Biol.
2,
211-216[CrossRef][Medline]
[Order article via Infotrieve]
25.
Mizushima, N.,
Yamamoto, A.,
Hatano, M.,
Kobayashi, Y.,
Kabeya, Y.,
Suzuki, K.,
Tokuhisa, T.,
Ohsumi, Y.,
and Yoshimori, T.
(2001)
J. Cell Biol.
152,
657-668 26.
Tanida, I.,
Tanida-Miyake, E.,
Ueno, T.,
and Kominami, E.
(2001)
J. Biol. Chem.
276,
1701-1706 27.
Altschul, S. F.,
Madden, T. L.,
Schaffer, A. A.,
Zhang, J.,
Zhang, Z.,
Miller, W.,
and Lipman, D. J.
(1997)
Nucleic Acids Res.
25,
3389-3402 28.
Krysan, P. J.,
Young, J. C.,
Tax, F.,
and Sussman, M. R.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
8145-8150 29.
Clough, S. J.,
and Bent, A. F.
(1998)
Plant J.
16,
735-743[CrossRef][Medline]
[Order article via Infotrieve]
30.
Wintermans, J. F. G. M.,
and De Mots, A.
(1965)
Biochim. Biophys. Acta
109,
448-453[Medline]
[Order article via Infotrieve]
31.
Doelling, J. H.,
Yan, N.,
Kurepa, J.,
Walker, J.,
and Vierstra, R. D.
(2001)
Plant J.
27,
393-405[CrossRef][Medline]
[Order article via Infotrieve]
32.
Guo, R.,
Luo, M.,
and Weinstein, J. D.
(1998)
Plant Physiol.
116,
605-615 33.
Smalle, J.,
Kurepa, J.,
Yang, P.,
Babiychuk, E.,
Kushnir, S.,
Durski, A.,
and Vierstra, R. D.
(2002)
Plant Cell
14,
17-32 34.
Kurepa, J.,
Herouart, D.,
Van Montagu, M.,
and Inze, D.
(1997)
Plant Cell Physiol.
38,
463-470 35.
Di Sansebastiano, G. P.,
Paris, N.,
Marc-Martin, S.,
and Neuhaus, J. M.
(1998)
Plant J.
15,
449-457[CrossRef][Medline]
[Order article via Infotrieve]
36.
Mizushima, N.,
Sugita, H.,
Yoshimori, T.,
and Ohsumi, Y.
(1998)
J. Biol. Chem.
273,
33889-33892 37.
Kim, J.,
Dalton, V. M.,
Eggerton, K. P.,
Scott, S. V.,
and Klionsky, D. J.
(1999)
Mol. Biol. Cell
10,
1337-1351 38.
Weaver, L. M.,
Gan, S.,
Quirino, B.,
and Amasino, R. M.
(1998)
Plant Mol. Biol.
37,
455-469[CrossRef][Medline]
[Order article via Infotrieve]
39.
Fu, H.,
Doelling, J. H.,
Arendt, C. S.,
Hochstrasser, M.,
and Vierstra, R. D.
(1998)
Genetics
149,
677-692 40.
Fu, H.,
Doelling, J. H.,
Rubin, D. M.,
and Vierstra, R. D.
(1999)
Plant J.
18,
529-539[CrossRef][Medline]
[Order article via Infotrieve]
41.
Fobert, P. R.,
Gaudin, V.,
Lunness, P.,
Coen, E. S.,
and Doonan, J. H.
(1996)
Plant Cell
8,
1465-1476[Abstract]
42.
Buetow, D. E.,
Chen, H.,
Erdos, G.,
and Yi, L. S. H.
(1988)
Photosynth. Res.
18,
61-97
43.
Mok, D. W. S., and Mok, M. C.
(eds)
(1994)
Cytokinins: Chemistry, Activity, and Function
, CRC Press, Inc., Boca Raton, FL
44.
Noda, T.,
Kim, J.,
Huang, W. P.,
Baba, M.,
Tokunaga, C.,
Ohsumi, Y.,
and Klionsky, D. J.
(2000)
J. Cell Biol.
148,
465-480 45.
Wittenbach, V. A.,
Lin, W.,
and Habert, R. R.
(1982)
Plant Physiol.
69,
98-102 46.
Ono, K.,
Hashimoto, H.,
and Katoh, S.
(1995)
Plant Cell Physiol.
36,
9-17 47.
Nakabayashi, K.,
Ito, M.,
Kiyosue, T.,
Shinozaki, K.,
and Watanabe, A.
(1999)
Plant Cell Physiol.
40,
504-514 48.
Quirino, B. F.,
Noh, Y. S.,
Himelblau, E.,
and Amasino, R. M.
(2000)
Trends Plant Sci.
5,
278-282[CrossRef][Medline]
[Order article via Infotrieve]
49.
Huang, W. P.,
Scott, S. V.,
Kim, J.,
and Klionsky, D. J.
(2000)
J. Biol. Chem.
275,
5845-5851 50.
Kirisako, T.,
Baba, M.,
Ishihara, N.,
Miyazawa, K.,
Ohsumi, M.,
Yoshimori, T.,
Noda, T.,
and Ohsumi, Y.
(1999)
J. Cell Biol.
147,
435-446 51.
Tanida, I.,
Tanida-Miyake, E.,
Komatsu, M.,
Ueno, T.,
and Kominami, E.
(2002)
J. Biol. Chem.
277,
13739-13744 52.
Sagiv, Y.,
Legesse-Miller, A.,
Porat, A.,
and Elazar, Z.
(2000)
EMBO J.
19,
1494-1504[CrossRef][Medline]
[Order article via Infotrieve]
53.
Wang, H.,
Bedford, F. K.,
Brandon, N. J.,
Moss, S. J.,
and Olsen, R. W.
(1999)
Nature
397,
69-72[CrossRef][Medline]
[Order article via Infotrieve]
54.
Kabeya, Y.,
Mizushima, N.,
Ueno, T.,
Yamamoto, A.,
Kirisako, T.,
Noda, T.,
Kominami, E.,
Ohsumi, Y.,
and Yoshimori, T.
(2000)
EMBO J.
19,
5720-5728[CrossRef][Medline]
[Order article via Infotrieve]
55.
Vierstra, R. D.,
and Callis, J.
(1999)
Plant Mol. Biol.
41,
435-442[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  T. Yamada, K. Ichimura, M. Kanekatsu, and W. G. van Doorn Homologs of Genes Associated with Programmed Cell Death in Animal Cells are Differentially Expressed During Senescence of Ipomoea nil Petals Plant Cell Physiol., March 1, 2009; 50(3): 610 - 625. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Shibuya, T. Yamada, T. Suzuki, K. Shimizu, and K. Ichimura InPSR26, a Putative Membrane Protein, Regulates Programmed Cell Death during Petal Senescence in Japanese Morning Glory Plant Physiology, February 1, 2009; 149(2): 816 - 824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wada, H. Ishida, M. Izumi, K. Yoshimoto, Y. Ohsumi, T. Mae, and A. Makino Autophagy Plays a Role in Chloroplast Degradation during Senescence in Individually Darkened Leaves Plant Physiology, February 1, 2009; 149(2): 885 - 893. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Chung, A. Suttangkakul, and R. D. Vierstra The ATG Autophagic Conjugation System in Maize: ATG Transcripts and Abundance of the ATG8-Lipid Adduct Are Regulated by Development and Nutrient Availability Plant Physiology, January 1, 2009; 149(1): 220 - 234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Slavikova, S. Ufaz, T. Avin-Wittenberg, H. Levanony, and G. Galili An autophagy-associated Atg8 protein is involved in the responses of Arabidopsis seedlings to hormonal controls and abiotic stresses J. Exp. Bot., October 3, 2008; (2008) ern244v1. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Ishida, K. Yoshimoto, M. Izumi, D. Reisen, Y. Yano, A. Makino, Y. Ohsumi, M. R. Hanson, and T. Mae Mobilization of Rubisco and Stroma-Localized Fluorescent Proteins of Chloroplasts to the Vacuole by an ATG Gene-Dependent Autophagic Process Plant Physiology, September 1, 2008; 148(1): 142 - 155. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Kant, Y.-M. Bi, E. Weretilnyk, S. Barak, and S. J. Rothstein The Arabidopsis Halophytic Relative Thellungiella halophila Tolerates Nitrogen-Limiting Conditions by Maintaining Growth, Nitrogen Uptake, and Assimilation Plant Physiology, July 1, 2008; 147(3): 1168 - 1180. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Z. Zhang, A. Lenk, M. X. Andersson, T. Gjetting, C. Pedersen, M. E. Nielsen, M.-A. Newman, B.-H. Hou, S. C. Somerville, and H. Thordal-Christensen A Lesion-Mimic Syntaxin Double Mutant in Arabidopsis Reveals Novel Complexity of Pathogen Defense Signaling Mol Plant, May 1, 2008; 1(3): 510 - 527. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Usadel, O. E. Blasing, Y. Gibon, K. Retzlaff, M. Hohne, M. Gunther, and M. Stitt Global Transcript Levels Respond to Small Changes of the Carbon Status during Progressive Exhaustion of Carbohydrates in Arabidopsis Rosettes Plant Physiology, April 1, 2008; 146(4): 1834 - 1861. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. R. Phillips, A. Suttangkakul, and R. D. Vierstra The ATG12-Conjugating Enzyme ATG10 Is Essential for Autophagic Vesicle Formation in Arabidopsis thaliana Genetics, March 1, 2008; 178(3): 1339 - 1353. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Patschan, J. Chen, A. Polotskaia, N. Mendelev, J. Cheng, D. Patschan, and M. S. Goligorsky Lipid mediators of autophagy in stress-induced premature senescence of endothelial cells Am J Physiol Heart Circ Physiol, March 1, 2008; 294(3): H1119 - H1129. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Fujioka, N. N. Noda, K. Fujii, K. Yoshimoto, Y. Ohsumi, and F. Inagaki In Vitro Reconstitution of Plant Atg8 and Atg12 Conjugation Systems Essential for Autophagy J. Biol. Chem., January 25, 2008; 283(4): 1921 - 1928. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Picazarri, K. Nakada-Tsukui, and T. Nozaki Autophagy during Proliferation and Encystation in the Protozoan Parasite Entamoeba invadens Infect. Immun., January 1, 2008; 76(1): 278 - 288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Poustka, N. G. Irani, A. Feller, Y. Lu, L. Pourcel, K. Frame, and E. Grotewold A Trafficking Pathway for Anthocyanins Overlaps with the Endoplasmic Reticulum-to-Vacuole Protein-Sorting Route in Arabidopsis and Contributes to the Formation of Vacuolar Inclusions Plant Physiology, December 1, 2007; 145(4): 1323 - 1335. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. E. Martinez, C. G. Bartoli, V. Grbic, and J. J. Guiamet Vacuolar cysteine proteases of wheat (Triticum aestivum L.) are common to leaf senescence induced by different factors J. Exp. Bot., March 1, 2007; 58(5): 1099 - 1107. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Xiong, A. L. Contento, P. Q. Nguyen, and D. C. Bassham Degradation of Oxidized Proteins by Autophagy during Oxidative Stress in Arabidopsis Plant Physiology, January 1, 2007; 143(1): 291 - 299. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Inoue, T. Suzuki, M. Hattori, K. Yoshimoto, Y. Ohsumi, and Y. Moriyasu AtATG Genes, Homologs of Yeast Autophagy Genes, are Involved in Constitutive Autophagy in Arabidopsis Root Tip Cells Plant Cell Physiol., December 1, 2006; 47(12): 1641 - 1652. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Matsubayashi, M. Ogawa, H. Kihara, M. Niwa, and Y. Sakagami Disruption and Overexpression of Arabidopsis Phytosulfokine Receptor Gene Affects Cellular Longevity and Potential for Growth Plant Physiology, September 1, 2006; 142(1): 45 - 53. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. van der Graaff, R. Schwacke, A. Schneider, M. Desimone, U.-I. Flugge, and R. Kunze Transcription Analysis of Arabidopsis Membrane Transporters and Hormone Pathways during Developmental and Induced Leaf Senescence Plant Physiology, June 1, 2006; 141(2): 776 - 792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Inoue and Y. Moriyasu Autophagy is not a Main Contributor to the Degradation of Phospholipids in Tobacco Cells Cultured under Sucrose Starvation Conditions Plant Cell Physiol., April 1, 2006; 47(4): 471 - 480. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 O. E. Blasing, Y. Gibon, M. Gunther, M. Hohne, R. Morcuende, D. Osuna, O. Thimm, B. Usadel, W.-R. Scheible, and M. Stitt Sugars and Circadian Regulation Make Major Contributions to the Global Regulation of Diurnal Gene Expression in Arabidopsis PLANT CELL, December 1, 2005; 17(12): 3257 - 3281. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Slavikova, G. Shy, Y. Yao, R. Glozman, H. Levanony, S. Pietrokovski, Z. Elazar, and G. Galili The autophagy-associated Atg8 gene family operates both under favourable growth conditions and under starvation stresses in Arabidopsis plants J. Exp. Bot., November 1, 2005; 56(421): 2839 - 2849. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. R. Thompson, J. H. Doelling, A. Suttangkakul, and R. D. Vierstra Autophagic Nutrient Recycling in Arabidopsis Directed by the ATG8 and ATG12 Conjugation Pathways Plant Physiology, August 1, 2005; 138(4): 2097 - 2110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Yamada, A. R. Carson, I. Caniggia, K. Umebayashi, T. Yoshimori, K. Nakabayashi, and S. W. Scherer Endothelial Nitric-oxide Synthase Antisense (NOS3AS) Gene Encodes an Autophagy-related Protein (APG9-like2) Highly Expressed in Trophoblast J. Biol. Chem., May 6, 2005; 280(18): 18283 - 18290. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Galili ER-Derived Compartments Are Formed by Highly Regulated Processes and Have Special Functions in Plants Plant Physiology, November 1, 2004; 136(3): 3411 - 3413. [Full Text] [PDF]
|
|
|
|
|
|
K. Yoshimoto, H. Hanaoka, S. Sato, T. Kato, S. Tabata, T. Noda, and Y. Ohsumi Processing of ATG8s, Ubiquitin-Like Proteins, and Their Deconjugation by ATG4s Are Essential for Plant Autophagy PLANT CELL, November 1, 2004; 16(11): 2967 - 2983. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. L. Contento, S.-J. Kim, and D. C. Bassham Transcriptome Profiling of the Response of Arabidopsis Suspension Culture Cells to Suc Starvation Plant Physiology, August 1, 2004; 135(4): 2330 - 2347. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. R. Woo, J. H. Kim, H. G. Nam, and P. O. Lim The Delayed Leaf Senescence Mutants of Arabidopsis, ore1, ore3, and ore9 are Tolerant to Oxidative Stress Plant Cell Physiol., July 15, 2004; 45(7): 923 - 932. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Takatsuka, Y. Inoue, K. Matsuoka, and Y. Moriyasu 3-Methyladenine Inhibits Autophagy in Tobacco Culture Cells under Sucrose Starvation Conditions Plant Cell Physiol., March 15, 2004; 45(3): 265 - 274. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Mizushima, A. Yamamoto, M. Matsui, T. Yoshimori, and Y. Ohsumi In Vivo Analysis of Autophagy in Response to Nutrient Starvation Using Transgenic Mice Expressing a Fluorescent Autophagosome Marker Mol. Biol. Cell, March 1, 2004; 15(3): 1101 - 1111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Surpin, H. Zheng, M. T. Morita, C. Saito, E. Avila, J. J. Blakeslee, A. Bandyopadhyay, V. Kovaleva, D. Carter, A. Murphy, et al. The VTI Family of SNARE Proteins Is Necessary for Plant Viability and Mediates Different Protein Transport Pathways PLANT CELL, December 1, 2003; 15(12): 2885 - 2899. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Gan Mitotic and Postmitotic Senescence in Plants Sci. Aging Knowl. Environ., September 24, 2003; 2003(38): re7 - 7. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Chiba, H. Ishida, N. K. Nishizawa, A. Makino, and T. Mae Exclusion of Ribulose-1,5-bisphosphate Carboxylase/oxygenase from Chloroplasts by Specific Bodies in Naturally Senescing Leaves of Wheat Plant Cell Physiol., September 15, 2003; 44(9): 914 - 921. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Cuervo Autophagy and Aging--When "All You Can Eat" Is Yourself Sci. Aging Knowl. Environ., September 10, 2003; 2003(36): pe25 - 25. [Abstract] [Full Text]
|
|
|
|
 |
|
 A. Melendez, Z. Talloczy, M. Seaman, E.-L. Eskelinen, D. H. Hall, and B. Levine Autophagy Genes Are Essential for Dauer Development and Life-Span Extension in C. elegans Science, September 5, 2003; 301(5638): 1387 - 1391. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Eklund and J. Edqvist Localization of Nonspecific Lipid Transfer Proteins Correlate with Programmed Cell Death Responses during Endosperm Degradation in Euphorbia lagascae Seedlings Plant Physiology, July 1, 2003; 132(3): 1249 - 1259. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. P. Otto, M. Y. Wu, N. Kazgan, O. R. Anderson, and R. H. Kessin Macroautophagy Is Required for Multicellular Development of the Social Amoeba Dictyostelium discoideum J. Biol. Chem., May 9, 2003; 278(20): 17636 - 17645. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Kurepa, J. M. Walker, J. Smalle, M. M. Gosink, S. J. Davis, T. L. Durham, D.-Y. Sung, and R. D. Vierstra The Small Ubiquitin-like Modifier (SUMO) Protein Modification System in Arabidopsis. ACCUMULATION OF SUMO1 AND -2 CONJUGATES IS INCREASED BY STRESS J. Biol. Chem., February 21, 2003; 278(9): 6862 - 6872. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |