HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 36, 33153-33163, September 6, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/36/33153    most recent M200246200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pawliczak, R. Articles by Wu, T. Search for Related Content PubMed PubMed Citation Articles by Pawliczak, R. Articles by Wu, T. Social Bookmarking                      What's this?

85-kDa Cytosolic Phospholipase A₂ Mediates Peroxisome Proliferator-activated Receptor  Activation in Human Lung Epithelial Cells^*

Rafal Pawliczak^§, Chang Han^¶, Xiu-Li Huang, A. Jake Demetris^¶, James H. Shelhamer, and Tong Wu^¶

From the ^¶ Department of Pathology, University of Pittsburgh School of Medicine, Pittsburgh, Pennsylvania 15213,  Critical Care Medicine Department, Clinical Center, National Institutes of Health, Bethesda, Maryland 20892, and the ^§ Department of Allergy and Clinical Immunology, Medical University of Lodz, Lodz 92213, Poland

Received for publication, January 9, 2002, and in revised form, June 19, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The 85-kDa cytosolic phospholipase A₂ (cPLA₂) plays an important role in the control of arachidonic acid metabolism. This study was designed to investigate the possible contributions of cPLA₂ and group IIA secretory phospholipase A₂ (sPLA₂) in the regulation of peroxisome proliferator-activated receptor (PPAR)-mediated gene transcription in human airway epithelial cells. Primary normal human bronchial epithelial cells and human lung epithelial cell lines BEAS 2B, A549, and NCI-H292 all express PPAR and -. Overexpression of cPLA₂ in BEAS 2B cells and primary bronchial epithelial cells resulted in a significant increase of PPAR-mediated reporter activity. In contrast, overexpression of group IIA sPLA₂ had no effect on PPAR activation. The PPAR activity in A549 cells was significantly inhibited by the cPLA₂ inhibitor arachidonyltrifluoromethyl ketone but not by the sPLA₂ inhibitor LY311727 and the iPLA₂ inhibitor HELSS. Activation of cPLA₂ by the calcium ionophore, A23187, induced a dose-dependent increase of PPAR activity in normal human bronchial epithelial cells and in the A549 cells. Electrophoretic mobility shift assays show that the binding between PPAR isolated from A549 cells and peroxisome proliferator response element (PPRE) is enhanced by A23187 but partially blocked by the cPLA₂ inhibitors arachidonyltrifluoromethyl ketone and methyl arachidonyl fluorophosphate. Finally, NS 398, a COX-2 inhibitor, partially blocked the A23187 effect on PPAR activity and binding to the PPRE suggesting involvement of COX-2 metabolites in PPRE activation. The above results demonstrate a novel function of cPLA₂ in the control of PPAR activation in human lung epithelial cells.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Arachidonic acid (AA)¹ metabolism plays an important role in the pathogenesis of inflammation and in the regulation of intracellular signal transduction. Cytosolic phospholipase A₂ (cPLA₂) is a rate-limiting key enzyme controlling the release of AA from membrane phospholipids (1-9). Despite the well documented function of AA metabolites in inflammation, the role of cPLA₂ and AA in intracellular signal transduction remains incompletely defined. Recent studies (10-14) have shown that AA and its metabolites can activate the nuclear proteins peroxisome proliferator-activated receptors (PPARs). For example, leukotriene B₄, a lipoxygenase product of AA, is a natural ligand for PPAR (15), and 15-deoxy-^12,14 prostaglandin J₂, a cyclooxygenase pathway product, is a potent ligand for PPAR (16, 17). In addition to the known effect of prostaglandins and leukotrienes, arachidonic acid itself also activates PPARs (10). These findings suggest a potentially important role of AA metabolism in the regulation of intracellular signal events through activation of PPARs.

Altered arachidonic acid metabolism has been implicated in the pathogenesis of lung diseases characterized by chronic airway inflammation, including asthma, chronic bronchitis, cystic fibrosis, and bronchiectasis (18, 19), as well as lung injury and sepsis (20). The airway epithelium plays an active role in initiating and modulating airway inflammation (21, 22). The airway epithelial cells are able to generate and release AA in response to various stimuli (23-34). Previous studies (35-38) have demonstrated that cPLA₂ participates in the regulation of airway inflammation by controlling the release of AA from airway epithelial cells. The critical role of cPLA₂ in AA metabolism is supported by the characteristics of this enzyme including its selectivity for substrate AA and its regulation by phosphorylation, physiologically relevant concentrations of calcium, and induction of enzyme synthesis. One of the intriguing characteristics of cPLA₂ is its preferential translocation from cytoplasm to the membranes including the nuclear envelope in response to increased intracellular calcium (7, 39-42). However, the physiological significance of this phenomenon remains unknown.

Based on the important role of cPLA₂ in AA release, the documented nuclear targeting of cPLA₂, and the activation of PPARs by AA in nuclei, we hypothesized that translocation of cPLA₂ to the nuclear envelope upon activation may lead to increased production of AA in the nuclei for PPAR activation in airway epithelial cells. This study was thus designed to document the potential role of cPLA₂ in PPAR-mediated gene transcription in human airway epithelial cells, and this effect was compared with the effect of group IIA sPLA₂.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- The lung epithelial cell lines BEAS 2B, A549, and H292 were obtained from the American Type Culture Collection (Manassas, VA). Frozen vials of primary normal human bronchial epithelial cells (NHBE) and the bronchial epithelial cell growth media (BEGM) were obtained from Clonetics (San Diego, CA). LHC-8 medium was obtained from BIOSOURCE International (Rockville, MD). Ham's F12K medium, RPMI 1640 medium, fetal bovine serum, glutamine, antibiotics, and the LipofectAMINE Plus^TM reagent were purchased from Invitrogen. Chloramphenicol acetyltransferase (CAT) enzyme assay system was purchased from Promega (Madison, WI). Chemiluminescent reporter assay for -galactosidase was purchased from Tropix (Bedford, MA). The sPLA₂ inhibitor LY311727 was a generous gift from Dr. E. Mihelich at Lilly Research Laboratories (Indianapolis, IN). The cPLA₂ inhibitor arachidonyltrifluoromethyl ketone (AACOCF₃), iPLA₂ inhibitor haloenol lactone suicide substrate (HELSS), and ionophore A23187 were obtained from Calbiochem. Methyl arachidonyl fluorophosphate (MAFP) and the antibody for human group IIA sPLA₂ were obtained from Cayman Chemicals (Ann Arbor, MI). [³H]Chloramphenicol and [³H]arachidonic acid were purchased from PerkinElmer Life Sciences and Amersham Biosciences. Plasmid purification reagents were from Qiagen (Valencia, CA). The antibodies for human cPLA₂, PPAR-, -, and - were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Horseradish peroxidase-linked streptavidin and chemiluminescence detection reagents were obtained from Amersham Biosciences. IL-1 was obtained from R & D Systems (Minneapolis, MN). Unless indicated otherwise, all other chemicals were from Sigma. The cPLA₂ expression plasmid was kindly provided by Drs. J. Clark and J. Knopf at the Genetics Institute, Cambridge, MA (43). The PPRE reporter construct was kindly provided by Dr. W. Wahli, Switzerland. This vector contains the CAT coding sequence driven by a promoter consisting of two copies of the CYP4A6 PPRE (2× AGGTCAAAGGTCA) in the upstream of the thymidine kinase minimal promoter (15).

Cell Culture-- Four types of human lung epithelial cells were utilized in this study (BEAS 2B, A549, H292, and primary normal human bronchial epithelial cells). Passages 4-20 of the above three cell lines were used for experiments. The BEAS 2B cells were seeded on flasks or plates coated with a thin layer of type I rat tail collagen and cultured in serum-free and hormonally defined culture medium LHC. The A549 cells were cultured on uncoated culture flasks or plates and cultured in Ham's F12K medium containing 2 mM L-glutamine and 10% of fetal bovine serum. The H292 cells were cultured on uncoated culture flasks or plates and cultured in RPMI 1640 medium containing 10 mM HEPES, 2 mM L-glutamine, and 10% fetal bovine serum. The NHBE cells were expanded and cultured according to the protocol provided by Clonetics. Passages 3-7 NHBE cells were seeded on 6-well plates or T-25 culture flasks (2 × 10⁴ cells/cm²) and cultured in the complete BEGM (modified LHC-9 media supplemented with 5 µg/ml insulin, 0.5 µg/ml hydrocortisone, 10 µg/ml transferrin, 6.5 ng/ml triiodothyronine, 0.5 µg/ml epinephrine, 5 ng/ml human epidermal growth factor, 0.1 ng/ml retinoic acid, 50 µg/ml gentamicin, and 0.4% bovine pituitary extract; Clonetics).

Plasmid Construction-- To construct the group IIA sPLA₂ expression plasmid, we first obtained full-length human group IIA sPLA₂ cDNA using reverse transcription-PCR of human lung RNA. The primer pair was constructed according to the cDNA sequence (44). It amplified an 823-bp product and was composed of the following sequences: 5' primer, ⁸CAACTCTGGAGTCCTCTGAGAGAGCC³³; 3' primer, ⁸³⁰GCTAATTGCTTTATTCAGAAGAGAC⁸⁰⁶. The amplified full-length human group IIA sPLA₂ cDNA was then cloned in sense orientation into the mammalian expression vector pcDNA3.1 (Invitrogen). The identity and orientation of this construct was confirmed by DNA sequencing.

Transient Transfection of cPLA₂ and Group IIA sPLA₂ Expression Plasmids-- The BEAS 2B and NHBE cells were used for transfection experiments. The cells were seeded on 6-well plates coated with a thin layer of type I rat tail collagen (LHC-8 medium for BEAS 2B cells and BEGM medium for NHBE cells). Transfection was performed when the cells reached ~80% confluence. The cells were co-transfected with 1.5 µg each of PLA₂ expression plasmids (cPLA₂ in pMT-2 and group IIA sPLA₂ in pcDNA3.1) or vectors (pMT-2 and pcDNA3.1) and 1.5 µg of PPRE reporter plasmid expressing the chloramphenicol acetyltransferase (CAT) gene using LipofectAMINE PLUS^TM reagent. An internal control reporter plasmid expressing the -galactosidase gene (pIGP lacZ) was used to normalize the transfection efficiency (0.2 µg in each transfection). After exposure to the mixture of transfection reagents and plasmids for 3 (for NHBE cells) or 4 h (for BEAS 2B cells), the cultures were maintained in medium for 24 h. The cells were then incubated with or without A23187 (10⁶ M) for 2 h and washed twice with phosphate-buffered saline, and the cell lysates were prepared for Western blot analysis of cPLA₂ and group IIA sPLA₂ as well as for measurement of CAT reporter activity.

Experimental Designs-- Different time points were used throughout the study in order to investigate different signal transduction events. One hour of incubation was used to investigate PPAR binding to PPREs in the EMSA experiments. A 2-h incubation after A23187 stimulation was used for reporter gene experiments where cells transfected with overexpression vectors were used. A 4-h incubation was used for quiescent cells transfected with PPRE reporter gene only and stimulated with A23187. In these experiments, AACOCF₃ was added 30 min and MAFP or NS 398 was added 2 h prior to initiation of the experiments. The 24-h time point was used for cells incubated with inhibitors without A23187 or co-transfection with expression vectors. In these particular experiments, cells were incubated with various PLA₂ inhibitors immediately after the transfection in order to prevent exposure of the PPRE reporter gene to AA products derived from PLA₂ activity.

Arachidonic Acid Release from Human Lung Epithelial Cells-- Human lung cells (A549, BEAS 2B, or NHBE) were grown to 90% confluence in 6-well dishes. Cells were labeled for 16 h with 1 µCi/ml [5,6,8,9,11,12,14,15-³H]arachidonic acid ([³H]AA) (214 Ci/mmol; Amersham Biosciences) in media. Subsequently, after three washes with warm 1× PBS, 1 ml of calcium ionophore A23187 (Calbiochem) at the specified concentrations in media was added to some wells on a 6-well plate and incubated for 30 min. Cells incubated with Me₂SO (vehicle) served as a control. Medium was collected and centrifuged at 1000 × g for 5 min at 4 °C, and 0.9 ml of medium from each sample was transferred to a scintillation vial containing 10 ml of Bio-Safe II scintillation fluid (Research International Products Inc., Mount Prospect, IL) and counted in a scintillation counter (Beckman Instruments, Columbia, MD). Data are expressed as mean dpm ± S.E.

Cytosolic Phospholipase A₂ and Secreted Phospholipase A₂ Activity Assays-- cPLA₂ activity was determined as described previously (35). Data are presented as [¹⁴C]arachidonic acid release in dpm/µg of cellular protein/h ± S.E. Secreted phospholipase A₂ activity was measured in cell supernatants using the same system as for cPLA₂ with modifications allowing detection of sPLA₂ activity. sPLA₂ activity was obtained as a difference between the PLA₂ activity from cells supernatant untreated with dithiothreitol and the PLA₂ activity from supernatant treated with 1 mM dithiothreitol. The activity assay for sPLA₂ was performed in the presence of 5 mM Ca²⁺. Data are presented as [¹⁴C]arachidonic acid release in dpm/µg of cellular protein/h ± S.E.

Reporter Activity Assessment-- The CAT reporter activity in cell extract was determined using the CAT enzyme assay system (Promega, Madison, WI) according to the manufacturer's protocol. The -galactosidase activity was measured with the chemiluminescent reporter assay (Tropix, Bedford, MA) according to the manufacturer's protocol.

Immunoblotting Analysis-- For immunoblotting analysis of cPLA₂, group IIA sPLA₂, PPAR, PPAR, and PPAR, the cell lysates from human airway epithelial cells were prepared using lysis buffer containing protease inhibitor mixture tablets (Roche Diagnostics). Samples containing 10 µg of cellular protein were separated on 4-20 or 16% Tris glycine gels (NOVEX, San Diego, CA) using Tris glycine SDS running buffer. The separated proteins were then electrophoretically transferred onto nitrocellulose membranes (NOVEX). Nonspecific binding was blocked with 3% non-fat milk in phosphate-buffered saline containing 0.05% Tween 20 (PBS-T) at room temperature for 1 h. The membranes were then incubated with primary antibodies (1:200 dilution of mouse anti-human cPLA₂ monoclonal antibody, 1:200 dilution of rabbit anti-human group IIA sPLA₂ polyclonal antiserum, and 1:500 dilutions of rabbit anti-human PPAR-, -, and - polyclonal antibodies) in PBS-T containing 3% non-fat milk. After overnight incubation at 4 °C, the membranes were washed three times with PBS-T and then incubated at room temperature for 1 h with 1:5000 dilution of the corresponding horseradish peroxidase-conjugated secondary antibodies in PBS-T containing 3% non-fat milk. Following washing three times with PBS-T, the protein bands were visualized with the ECL Western blotting detection system according to the manufacturer's instructions.

Cytosolic Phospholipase A₂ Intracellular Localization during Exposure to A23187-- A549 cells were grown in chamber slides (Lab-Tek II, Nalge Nunc, Naperville, IL) until 60% confluent. Cells were transfected with full-length cPLA₂ tagged with GFP (EGFP-FL) vector, which was a generous gift from Drs. J. Evans and C. Leslie from National Jewish Medical and Research Center, Denver, CO (45). After 16 h cells were washed twice with PBS and were incubated with media containing Me₂SO (vehicle) or with A23187 (1 µM) for 60 s. Afterward, cells were fixed in 3.7% EM grade formaldehyde obtained from Polyscience (Warrington, PA) for 10 min. After 3 washes in PBS in a vertical shaker, cells were fixed using ProLong Antifade Kit from Molecular Probes (Eugene, OR). Slides were analyzed using Nikon Eclipse E800 microscope (Nikon, Japan) and Scion Image software (Scion Corp., Frederick, MD).

Nuclear Protein Isolation from A549 Cells-- A549 cells were grown in T-150 flasks to 90% confluence. Cells were exposed to A23187 (1 µM) for the specified times. In some cases cells were pretreated with AACOCF₃, MAFP, or NS 398 for 2 h prior to treatment with A23187. Culture medium was removed, and cells were washed 3 times with ice-cold PBS, harvested by scraping into 4 ml of PBS, and centrifuged (500 × g, 5 min). The pellet was dispersed in 5 packed cell volumes of hypo-osmotic buffer (10 mM HEPES-KOH, pH 7.9, 10 mM KCl, 1.5 mM MgCl₂, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, aprotinin, pepstatin, and leupeptin, each 2 mg/ml). After 15 min on ice, Nonidet P-40 was added to a final concentration of 0.6% (v/v), and the nuclei were pelleted by centrifugation (5000 × g, 5 min). The pelleted nuclei were dispersed in a high salt buffer (20 mM HEPES-KOH, pH 7.9, 420 mM NaCl, 1.5 mM MgCl₂, 0.2 mM EDTA, 25% glycerol, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, aprotinin, pepstatin, and leupeptin, each 2 mg/ml) to solubilize DNA-binding proteins. The suspended nuclei were gently shaken horizontally for 30 min at 4 °C and centrifuged in a microcentrifuge (12,000 × g, 20 min). The supernatants containing nuclear proteins were stored at 70 °C until used for EMSA. Protein concentrations were determined using a BCA assay kit (Pierce) with bovine serum albumin as a standard.

EMSA-- Double-stranded PPRE oligonucleotides (CAAAACTAGGTCAAAGGTCA) were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). The PPRE probes were labeled with [-³²P]ATP (Amersham Biosciences) using T4 polynucleotide kinase (Promega) and purified on G-50 columns (Amersham Biosciences). Nuclear extracts (3 µg) were incubated with the ³²P-labeled PPRE oligonucleotide probe (0.5-1 × 10⁶ cpm) in binding buffer (10 mM HEPES, pH 7.8, 5% glycerol, 0.3 mM MgCl₂, 50 mM KCl, 0.1 mM ZnCl₂, 0.04 mM EDTA, 1 mM dithiothreitol, 40 mg/ml bovine serum albumin) for 20 min at room temperature. The samples were subjected to electrophoresis through 6% DNA-retardation gels (Invitrogen) in 0.5× Tris borate-EDTA buffer at room temperature at 200 V. The gels were dried at 75 °C and autoradiographed at 70 °C overnight or until an adequate signal was developed. As a control for specificity, 200-fold molar excess of cold PPRE oligonucleotide (Santa Cruz Biotechnology) or TFIID consensus oligonucleotide (Promega), respectively, were preincubated with nuclear extracts for 20 min at room temperature prior to addition of labeled PPRE probe.

Statistics-- The data were analyzed with a two-tailed independent Student's t test. The level of significance was defined as p < 0.05. The dose-dependent effects of A23187 and arachidonic acid on PPRE reporter activity and arachidonic acid release were analyzed by one-way ANOVA.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Human Airway Epithelial Cells Express Both PPAR and PPAR but Not PPAR-- To determine the expression profile of PPARs in human airway epithelial cells, we first performed Western blot analysis for the three PPAR isoforms (PPAR, -, and -) in primary cultures of human bronchial epithelial cells, and in cell lines BEAS 2B, A549, and H292. As shown in Fig. 1, although PPAR is highly expressed in human hepatocytes, it is not detected in human airway epithelial cells by Western blot analysis. In contrast, PPAR and PPAR are expressed in all four types of human airway epithelial cells. The primary human bronchial epithelial cells express higher levels of PPAR than the cell lines BEAS 2B, A549, and H292, which is consistent with the hypothesis that PPAR may play a role in the differentiation of airway epithelial cells (46). Two isoforms of PPAR (PPAR1 and PPAR2, which are produced by alternative splicing of the same PPAR gene) are present in all four types of human bronchial epithelial cells. Whereas primary normal human bronchial epithelial cells contain higher PPAR2 than PPAR1, the three human airway epithelial cell lines express slightly higher levels of PPAR1 than PPAR2. As expression of PPAR is detected in all the four types of human airway epithelial cells, we examined the contribution of cPLA₂ to PPAR-mediated gene transcription by using a PPRE reporter construct containing the CAT coding sequence driven by a promoter consisting of two copies of the CYP4A6 PPRE upstream of the thymidine kinase minimal promoter (15) (Fig. 2). Although this PPRE-response element can be activated by either PPAR or PPAR, the absence of PPAR in human airway epithelial cells suggests that this construct likely reflects the activation of PPAR.

View larger version (47K): [in this window] [in a new window]   Fig. 1.   Protein expression of PPAR-, -, and - and cPLA2 in human airway epithelial cells. A, Western blot analyses for PPAR isoforms in four types of human airway epithelial cells including NHBE, BEAS 2B, A549, and H292 cells. Equal amounts of cellular proteins (10 µg) isolated from human airway epithelial cells were utilized. Cell lysates from primary human hepatocytes (HH) and a hepatoma cell line, HepG2 cells, were used as positive controls for PPAR-. B, cPLA2 protein levels in four types of human lung epithelial cells including NHBE, BEAS 2B, A549, and H292 cells. Equal amounts of cellular proteins (10 µg) were utilized.

View larger version (7K): [in this window] [in a new window]   Fig. 2.   Structure of the PPRE reporter construct used in this study. It contains the CAT coding sequence driven by a promoter consisting of two copies of the CYP4A6 PPRE in the upstream region of the thymidine kinase (TK) minimal promoter (15).

Overexpression of cPLA₂ Increases PPAR-mediated Gene Transcription in Human Airway Epithelial Cells-- BEAS 2B cells were transfected with pMT-2 expression vector containing cPLA₂-coding sequence or with empty pMT-2. Western blot analysis of cells transfected with the cPLA₂ expression vector demonstrated increased cPLA₂ protein expression as compared with cells transfected with empty vector (Fig. 3A). BEAS 2B cells transfected with the cPLA₂ expression vector demonstrated increased [³H]arachidonic acid release after stimulation with calcium ionophore suggesting increased calcium-dependent phospholipase activity as compared with cells transfected with an empty vector (Fig. 3B). In order to determine whether the increased cellular arachidonate release is due to increased expression of cPLA₂, an assay of cellular lysate for cPLA₂ activity was performed. In cells transfected with the cPLA₂ expression vector, cPLA₂ activity was significantly increased compared with cells transfected with an empty vector (Fig. 3C). In order to determine whether an increase in cPLA₂ activity was associated with an increase in PPRE binding, cells were co-transfected with the PPRE reporter gene and then were stimulated with calcium ionophore A23187 for 2 h to allow PPAR binding to PPRE and transcription and translation of CAT protein. Similarly, cells transfected with an empty vector were also co-transfected with the PPRE reporter gene. These cells were also stimulated with A23187. Based on the previously documented calcium-induced cPLA₂ translocation to nuclear envelope (7, 39-42), we predicted that cells with cPLA₂ overexpression would likely have increased AA and eicosanoid production in the nuclei for PPAR activation in response to the calcium-mobilizing agents. Cells transfected with the cPLA₂ expression vector exhibited greater PPRE reporter gene activity (Fig. 3D) as compared with cells transfected with control vector. Similar data were obtained from normal human bronchial cells (Fig. 4, A and B).

View larger version (18K): [in this window] [in a new window]   Fig. 3.   Overexpression of cPLA2 increases PPRE reporter activity in human airway epithelial cells. A, immunoblot analysis for cPLA2 protein expression. Equal amounts of cellular proteins (10 µg) isolated from the BEAS 2B cells transfected with the cPLA2 expression vector (cPLA2 in pMT-2) or control vector (pMT-2) were used for Western blot analysis. The cells transfected with the cPLA2 expression vector showed significantly increased cPLA2 protein expression. The blot shown is representative for three separate experiments with similar results. B, arachidonate release from cells transfected with the cPLA2 expression vector (closed bars) or control vector (open bars). BEAS 2B cells were transfected with the cPLA2 expression vector or control vector and labeled with [3H]AA as described under the "Experimental Procedures." Cells were incubated with Me2SO (vehicle) or A23187 (106 M) for 30 min. Supernatants were collected and counted in a scintillation counter. Data are expressed as dpm ± S.E.; *, p < 0.05 as compared with cells transfected with control vector, n = 6. C, specific cPLA2 activity detected in whole cell lysate from cells transfected with the cPLA2 expression vector or control vector. 24 h after transfection, cells were collected and processed as described under the "Experimental Procedures." Data are expressed as [14C]arachidonate release in dpm/µg of protein/h; *, p < 0.05 as compared with cells transfected with control vector; n = 4. D, PPRE reporter activity with or without overexpression of cPLA2 in cells stimulated with or without A23187. BEAS 2B cells were transfected with the cPLA2 expression vector (closed bars) or with the control vector (open bars) with co-transfection of the PPRE reporter plasmid. Following transfection, the cells were cultured in medium without serum for 24 h and then stimulated with A23187 (106 M), media alone, or Me2SO (vehicle) for 2 h. The cell extracts were then prepared and processed to measure the CAT reporter activity as described under "Experimental Procedures." The cells transfected with the cPLA2 expression vector show significantly increased CAT reporter activity when compared with the cells transfected with control vector (*, p < 0.05, n = 6). A23187 exposure significantly increases PPRE reporter activity in cells transfected with cPLA2 expression vector as compared with cells exposed to media or Me2SO (, p < 0.05, n = 6).

View larger version (26K): [in this window] [in a new window]   Fig. 4.   Overexpression of cPLA2 increases PPRE reporter activity in NHBE cells. A, immunoblot analysis for cPLA2 protein expression. Equal amounts of cellular proteins isolated from the NHBE cells transfected with the cPLA2 expression vector or control vector were used for Western blot analysis. The cells transfected with the cPLA2 expression vector showed significantly increased cPLA2 protein expression. The blot shown is representative of three separate experiments with similar results. B, PPRE reporter activity in cells with or without overexpression of cPLA2. The NHBE cells were transfected with the cPLA2 expression vector (cPLA2 in pMT-2) or the control vector (pMT-2) with transfection of the PPRE reporter plasmid. Following transfection, the cells were cultured in medium without serum for 24 h and then stimulated with A23187 (106 M) for 2 h. The cell extracts were then prepared and processed to measure the CAT reporter activity as described under "Experimental Procedures." The cells transfected with the cPLA2 expression vector show significantly increased CAT reporter activity when compared with the cells transfected with control vector (p < 0.01, n = 4).

Overexpression of Type IIA sPLA₂ Failed to Increase PPAR-mediated Gene Transcription in Human Airway Epithelial Cells-- We examined the possible effect of transient overexpression of group IIA sPLA₂ on PPAR activation by using a similar approach. Western blot analysis of the cell lysate collected 24 h after transfection showed that the cells transfected with the group IIA sPLA₂ expression plasmid exhibited significantly increased levels of group IIA sPLA₂ protein (Fig. 5A). Overexpression of type IIA sPLA₂ increased arachidonate release as compared with cells transfected with an empty vector (Fig. 5B). In order to examine if this effect is mediated by group IIA sPLA₂, specific sPLA₂ activity was measured in the cellular supernatant from resting transfected cells and after stimulation with IL-1. IL-1 is a well known factor influencing sPLA₂ IIA activity and releases the enzyme into the extracellular space. Cells transfected with the sPLA₂ expression vector produced more sPLA₂ activity compared with cells transfected with control vector (Fig. 5C). This effect was consistent when the cells were incubated with IL-1. As the activity of group IIA sPLA₂ might be increased in the presence of calcium, the cells co-transfected with the sPLA₂ expression plasmid and the reporter plasmid were also stimulated with calcium ionophore A23187 for 2 h. As shown in Fig. 5D, group IIA sPLA₂ overexpression failed to increase PPRE reporter activity in response to calcium ionophore stimulation. Similar results were obtained when experiments were performed in the absence of calcium ionophore A23187 stimulation and in primary human bronchial epithelial cells (data not shown). As shown on Fig. 5E stimulation of lung cells with IL-1 produced a small change in PPRE reporter gene activity. The change did not reach statistical significance. Therefore, the above experiments with overexpression of PLA₂s demonstrated an important role of cPLA₂, but not group IIA sPLA₂, in the production of AA metabolites for PPAR activation in human airway epithelial cells.

View larger version (19K): [in this window] [in a new window]   Fig. 5.   Overexpression of group IIA sPLA2 failed to increase PPRE reporter activity in human airway epithelial cells. A, immunoblot analysis for group IIA sPLA2 protein expression in BEAS 2B and A549 cells. Equal amounts of cellular proteins (10 µg) isolated from the BEAS 2B cells transfected with the group IIA sPLA2 expression vector (sPLA2 in pcDNA3.1) or control vector (empty pcDNA3.1) were used for Western blot analysis. The cells transfected with the group IIA sPLA2 expression vector showed significantly increased group IIA sPLA2 protein expression. The blot shown is representative for three separate experiments with identical results. B, arachidonate release from cells transfected with the group IIA sPLA2 expression vector (closed bars) or control vector (open bars). BEAS 2B cells were transfected with the sPLA2 expression vector or control vector and labeled with [3H]AA as described under the "Experimental Procedures." Cells were incubated with Me2SO or A23187 (106 M). Supernatants were collected and counted in a scintillation counter. Data expressed as dpm ± S.E.; *, p < 0.05 as compared with cells transfected with control vector, n = 4-6. C, specific sPLA2 activity detected in supernatants from cells transfected with the type IIA sPLA2 expression vector or control vector. Twenty four hours after transfection, cells were incu- bated for 24 h with media or with IL-1 (1 ng/ml) for 24 or 4 h. Supernatants were collected and processed as described under the "Experimental Procedures." Data are expressed as [14C]arachidonate release in dpm/µg of protein/h ± S.E.; *, p < 0.05 compared with cells transfected with control vector; n = 4. D, PPRE reporter activity in cells with or without group IIA sPLA2 overexpression. The BEAS 2B cells were transfected with the group IIA sPLA2 expression vector or the control vector with co-transfection of the PPRE reporter plasmid. Following transfection, the cells were cultured for 24 h and then stimulated with A23187 (106 M) for 2 h. The cell extracts were then prepared and processed to measure the CAT reporter activity as described under "Experimental Procedures." The cells with group IIA sPLA2 overexpression failed to show increased CAT reporter activity when compared with the control cells (n = 4). E, the influence of sPLA2 on the PPRE reporter gene was assessed after IL-1 stimulation. After transfection with control vector (open bars) or with type IIA sPLA2 expression vector (closed bars) cells were incubated with IL-1 (1 ng/ml) for 4 or 24 h. Cells incubated with media served as a control. Cells were collected, and CAT and -galactosidase activity were measured as described under "Experimental Procedures." There were no differences between groups regarding PPRE reporter gene activity; n = 5-6.

Inhibitors of cPLA₂, but Not Group IIA sPLA₂, Block the PPAR-mediated Gene Transcription in Human Lung Epithelial Cells-- In addition to overexpression of PLA₂ isoforms, we then tested the potential effect of cPLA₂ and sPLA₂ inhibitors on the PPRE reporter activities. The sPLA₂ inhibitor LY311727, the cPLA₂ inhibitor AACOCF₃, and the iPLA₂ inhibitor HELSS were used in the experiments. As A549 cells express higher levels of cPLA₂ and exhibit higher PPRE reporter activity than other cell lines (Fig. 1B), these cells were selected for experiments with the PLA₂ inhibitors. As shown in Fig. 6A, the PPRE reporter activity in A549 cells was significantly decreased by the cPLA₂ inhibitor AACOCF₃ but not by the sPLA₂ inhibitor LY311727 and iPLA₂ HELSS. Treatment of A549 cells with the cPLA₂ inhibitor AACOCF₃ resulted in a dose-dependent inhibition of the PPRE reporter activity (Fig. 6B). Therefore, the above data with the PLA₂ inhibitors also demonstrated the essential role of cPLA₂, but not sPLA₂, in PPAR activation in human airway epithelial cells.

View larger version (16K): [in this window] [in a new window]   Fig. 6.   The cPLA2 inhibitor AACOCF3 blocks the PPRE reporter activity in human lung epithelial cells. A, the effect of various PLA2 inhibitors on PPRE reporter activity. The A549 cells were transfected with the PPRE reporter plasmid and the -galactosidase expression vector. Following transfection, the cells were cultured in the presence of different PLA2 inhibitors as indicated for 24 h. The cells were then lysed, and the cell extracts were obtained for measurement of CAT reporter activity. Although there was no significant difference in the measured CAT reporter activity between control cells and cells treated with the sPLA2 inhibitor LY311727 and iPLA2 inhibitor HELSS, the CAT reporter activity in cells treated with the cPLA2 inhibitors AACOCF3 was significantly decreased when compared with that in control cells (*, p < 0.05). The data were expressed as mean ± S.E. from four experiments. B, the dose-response effect of AACOCF3 on PPRE reporter gene activity. The A549 cells transfected with the PPRE reporter plasmid were cultured in the presence of different concentrations of the cPLA2 inhibitor AACOCF3 (10, 25, and 50 µM) for 24 h. AACOCF3 induced a dose-dependent inhibition of the PPRE reporter activity in A549 cells (p < 0.01). The results were obtained from four separate experiments.

The Calcium Ionophore, A23187, Induces cPLA₂ Translocation from Cytoplasm to the Nuclear Envelope-- Several groups have confirmed that an increase in intracellular calcium concentration induces cPLA₂ translocation from the cytoplasm to the nuclear envelope, endoplasmic reticulum, and Golgi apparatus. Recent work by Evans and colleagues (45) provided convincing evidence regarding this matter. By using a plasmid system developed by this group, we have shown that in A549 cells, stimulation by A23187 (10⁶ M) caused transient cPLA₂ accumulation predominantly in the perinuclear region (Fig. 7, A and B) suggesting that cPLA₂-derived metabolites might play an important role in gene transcription.

View larger version (87K): [in this window] [in a new window]   Fig. 7.   A23187 induces cPLA2 translocation to the perinuclear space in A549 cells. A549 cells were grown to 60% confluence on a glass surface in plastic chambers and were transfected with 2 µg of full-length cPLA2-GFP (EGFP-FL) as described under the "Experimental Procedures." Twenty four hours after transfection, cells were incubated for 60 s with A23187 106 M (B) or PBS (A) and processed as described under "Experimental Procedures." Photomicrographs are representative for 20 cells examined. Original magnification is ×600.

The Calcium Ionophore A23187 Increases Arachidonate Release and the PPAR-mediated Gene Transcription in Human Lung Epithelial Cells-- Because cPLA₂ is translocated from cytoplasm to the nuclear envelope in response to an intracellular calcium increase, we hypothesized that treatment of cells with ionophore A23187 would lead to nuclear translocation and activation of cPLA₂ and thus increase AA release in the nuclei for PPAR activation. To test this hypothesis, A549 cells (with a higher level of cPLA₂ protein expression) were transfected with the PPRE reporter construct and then stimulated with A23187 (10⁸, 10⁷, and 10⁶ M) for 4 h. The cell lysates were collected, and the PPRE CAT reporter activity was measured. Fig. 8A represents arachidonate release from [³H]AA-labeled cells upon stimulation with A23187 (10⁸, 10⁷, and 10⁶ M). This stimulation induced a dose-dependent arachidonate release from primary bronchial epithelial cells (data not shown) and A549 cells (Fig. 8A). As shown in Fig. 8, B and C, A23187 induced a dose-dependent increase of PPRE reporter activity in A549 cells and primary bronchial epithelial cells, respectively. This result further supports the role of calcium-mediated cPLA₂ activation in PPAR-mediated gene transcription in airway epithelial cells.

View larger version (18K): [in this window] [in a new window]   Fig. 8.   A23187 increases PPRE reporter activity in human lung epithelial cells. A, A23187 induces a dose-dependent arachidonate release from A549 cells. A549 cells were grown on 6-well plates until 90% confluent. Cells were labeled with [3H]AA for 16 h, and after three washes with warm PBS were exposed to A23187 (108, 107, and 106 M) (closed bars) for 30 min. Cells exposed to respective doses of Me2SO (open bars) served as control. Supernatants were collected and counted as described under "Experimental Procedures." Data are expressed as [3H]AA release in dpm ± S.E.; p < 0.05, by ANOVA; n = 5-6. B, A549 cells were grown on 6-well plates until 90% confluent. Cells were transfected with 1.8 µg of the PPAR reporter gene and 0.2 µg of cytomegalovirus/-galactosidase vector as described under "Experimental Procedures." After 24 h, the cells were exposed to A23187 (108, 107, and 106 M) for 4 h. Cells were collected, and the PPRE CAT reporter activity and -galactosidase activity were measured. Data are expressed as the mean ± S.E. of percentage of control reporter activity (cells exposed to vehicle, Me2SO) from six independent experiments. A23187 significantly increased the PPRE reporter activity. This effect was dose-dependent (p < 0.05, by ANOVA). C, NHBE cells were grown on 6-well plates until 90% confluent. Cells were transfected with 1.8 µg of the PPAR reporter gene and 0.2 µg of cytomegalovirus/-galactosidase vector as described under "Experimental Procedures." After 24 h, the cells were exposed to A23187 (108, 107, and 106 M) for 4 h. Cells were collected, and the PPRE CAT reporter activity and/-galactosidase activity were measured. Data are expressed as the mean ± S.E. of percentage of control (cells exposed to vehicle, Me2SO) reporter activity from six independent experiments. A23187 significantly increased the PPRE reporter activity. This effect was dose-dependent (p < 0.05, by ANOVA).

Incubation of A549 Cells with Arachidonic Acid Failed to Induce PPRE Reporter Gene Activity-- Several reports suggested that extracellular delivery of arachidonic acid may induce PPRE-dependent gene transcription. Cells transfected with the PPRE reporter gene were incubated for 4 h with arachidonate in three concentrations of 10⁵, 10⁶, and 10⁷ M. Although a trend to increased PPRE reporter gene activity was observed, it failed to reach significance as shown on Fig. 9. These data suggested that, at least in this experimental model and within this dose range, extracellular delivery of arachidonate might not influence transcription of PPRE-dependent genes.

View larger version (18K): [in this window] [in a new window]   Fig. 9.   Extracellular arachidonate failed to increase the PPRE reporter gene activity in A549 cells. A549 cells were grown on 6-well plates until 90% confluent. Cells were transfected with 1.8 µg of the PPRE reporter gene and 0.2 µg of cytomegalovirus/-galactosidase vector as described under "Experimental Procedures." After 24 h, the cells were exposed to arachidonic acid (105, 106, and 107 M) (closed bars) for 4 h. Cells incubated with the respective dose of ethanol (vehicle) served as controls (open bars). Cells were collected and the CAT reporter activity, and -galactosidase activity was measured as described under the "Experimental Procedures." Data are expressed as the mean ± S.E., n = 6. No significant difference between cells incubated with arachidonate and control cells were observed. A significant dose-related effect was not observed.

PPAR in Human Lung Epithelial Cells Directly Binds to PPRE Oligonucleotide-- The above results with a PPRE reporter construct demonstrated an important role of cPLA₂ in the activation of PPAR in human airway epithelial cells. We then utilized EMSA to examine the direct interaction between PPAR and PPRE. As shown in Fig. 10A, PPAR in the A549 cell nuclear protein is able to bind the PPRE probe. The binding specificity was confirmed by inhibition of binding with an excess of unlabeled PPRE probe and no inhibition with an excess of irrelevant oligonucleotide (TFIID consensus sequence). This result presents a direct interaction between airway epithelial cell-derived PPAR and PPRE consensus sequence.

View larger version (37K): [in this window] [in a new window]   Fig. 10.   A23187 enhances PPAR binding to PPRE. This effect is blocked by cPLA2 inhibitors AACOCF3 and MAFP. A, PPAR from human lung epithelial cells binds specifically to PPRE oligonucleotide (Oligo). Nuclear protein isolated from A549 cells was used for EMSA. From each sample, 3 µg of nuclear protein were incubated with 32P-labeled PPRE consensus oligonucleotide. The specificity of the binding reaction was assessed by addition of a 200-fold excess of unlabeled PPAR or and a 100-fold excess of an irrelevant (TFIID consensus sequence) oligonucleotide 20 min before addition of the labeled probe. The arrow indicates protein-DNA complexes. The autoradiograph is representative of three separate experiments. B, A549 cells were incubated with A23187 (106 M) for 30, 60, or 120 min. Cells incubated without A23187 served as a control. Nuclear protein was extracted for EMSA as described under "Experimental Procedures." From each sample, 3 µg of nuclear protein were incubated with 32P-labeled PPAR oligonucleotide probe. The autoradiograph shown is representative of three experiments each with similar results. The arrow indicates protein-DNA complexes. C, the effect of the cPLA2 inhibitor, AACOCF3, on PPAR binding. A549 cells were incubated with Me2SO (10 µM) or preincubated (for 30 min) with AACOCF3 (10 µM) followed by an incubation with A23187 (106 M) or media for 1 h. Cells were harvested, and nuclear protein was extracted for EMSA as described under "Experimental Procedures." From each sample, 3 µg of nuclear protein were incubated with 32P-labeled PPAR oligonucleotide probes. The arrow indicates protein-DNA complexes. The autoradiographs are representative of three separate experiments each with similar results. D, the cPLA2 inhibitor, AACOCF3, inhibits PPAR binding in a dose-dependent manner. A549 cells were incubated with Me2SO or preincubated (for 30 min) with AACOCF3 (10, 25, and 50 µM) followed by an incubation with A23187 (106 M) or media with Me2SO for 1 h. Cells were harvested, and nuclear protein was extracted for EMSA as described under "Experimental Procedures." From each sample, 3 µg of nuclear protein were incubated with 32P-labeled PPAR oligonucleotide probes. The arrow indicates protein-DNA complexes. The autoradiographs are representative of three separate experiments each with similar results. E, the effect of the cPLA2 inhibitor MAFP on PPAR binding. A549 cells were preincubated (for 2 h) with MAFP (10 µM) followed by an incubation with A23187 (106 M) or media for 1 h. Cells were harvested, and nuclear protein was extracted for EMSA as described under "Experimental Procedures." From each sample, 3 µg of nuclear protein were incubated with 32P-labeled PPAR oligonucleotide probes. The arrow indicates protein-DNA complexes. The autoradiographs are representative of three separate experiments each with similar results.

The Binding of PPAR to PPRE in Human Airway Epithelial Cells Is Increased by Ionophore A23187 but Partially Blocked by cPLA₂ Inhibitors-- To test if activation of cPLA₂ by the ionophore, A23187, alters the binding between PPAR and PPRE, EMSA was performed using nuclear protein obtained from A549 cells treated with A23187 (10⁶ M). The binding of PPAR to PPRE was enhanced after A23187 treatment, and this effect peaked after 60 min of treatment (Fig. 10B). To demonstrate further the involvement of cPLA₂-mediated AA release in the PPAR and PPRE interaction, experiments were performed using nuclear protein isolated from A549 cells treated with the cPLA₂ inhibitors, AACOCF₃, or MAFP. As shown in Fig. 10C, the A23187-induced PPAR binding was reduced by incubation with the cPLA₂ inhibitor, AACOCF₃. This effect is dose-dependent as shown in Fig. 10D. Another cPLA₂ inhibitor, MAFP, had a similar effect on PPAR binding as shown in Fig. 10E. The above results suggest a role of cPLA₂ activation in the regulation of the PPAR-PPRE interaction.

NS 398, a Cyclooxygenase-2 Inhibitor, Partially Inhibits A23187-dependent PPRE Reporter Gene Activation and Partially Blocks the Binding of PPAR to PPRE in Human Airway Epithelial Cells-- A cyclooxygenase product 15-deoxy-^12,14 prostaglandin J₂ is thought to be one of the PPRE agonists. We tested the role of cyclooxygenase-2 products in PPRE reporter gene activation and PPRE binding. NS 398 at least partially blocks A23187-dependent PPRE activation as shown on Fig. 11A. Gel shift assay (shown on Fig. 11B) revealed that NS 398 blocks A23187-dependent PPAR binding, suggesting the involvement cyclooxygenase-2 products in this process. This suggests that cyclooxygenase products at least partially derived from cPLA₂ metabolites may play a role in PPRE activation. Blocking cyclooxygenase-2 activity might influence expression of PPRE-mediated genes.

View larger version (38K): [in this window] [in a new window]   Fig. 11.   COX-2 inhibitor NS 389 inhibits cPLA2-dependent PPRE activation and binding to the PPRE. A, the influence of NS 389, a selective COX-2 inhibitor on PPRE reporter activity in cells with cPLA2 overexpression. The A549 cells were transfected with the cPLA2 expression vector (closed bars) or the control vector (opened bars) with transfection of the PPRE reporter plasmid. Following transfection, the cells were cultured for 24 h and then preincubated with NS 398 (10 µM, 2 h) followed by an incubation with A23187 (106 M) or Me2SO for 2 h. The cell extracts were then prepared and processed to measure the CAT reporter activity as described under "Experimental Procedures." Cells were collected, and CAT and -galactosidase activities were measured as described under "Experimental Procedures." *, p < 0.05 as compared with cells incubated with NS 398, n = 6. There were no differences between cells preincubated with NS 398 and then incubated with Me2SO (vehicle) and cells preincubated with NS 398 followed by incubation with A23187. B, the influence of NS 398, a selective COX-2 inhibitor on nuclear protein binding to PPRE. A549 cells were incubated with Me2SO (vehicle) or preincubated (for 2 h) with NS 398 (10 µM) followed by an incubation with A23187 (106 M) or Me2SO for 1 h. Cells were harvested, and nuclear protein was extracted for EMSA as described under "Experimental Procedures." From each sample, 3 µg of nuclear protein were incubated with 32P-labeled PPAR oligonucleotide probes. The arrow indicates protein-DNA complexes. The autoradiographs are representative of three separate experiments each with similar results.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

PPARs belong to the superfamily of ligand-activated nuclear transcription factors (11-14), which regulate the expression of target genes by binding to PPRE or by interacting with other intracellular signaling molecules AP-1, NF-B, and STAT proteins (47-49). Although PPAR and - are expressed in the lung, the cellular expression pattern of PPARs in lung epithelial cells is not known. In this study, we examined the expression pattern of PPAR isoforms in lung epithelial cells. Although PPAR is not detected in human lung epithelial cells, both PPAR and PPAR are expressed in all four types of human lung epithelial cells (primary normal human bronchial epithelial cells and cell lines BEAS 2B, A549, and H292). The primary human bronchial epithelial cells express higher levels of PPAR than the cell lines BEAS 2B, A549, and H292, which is consistent with the hypothesis that PPAR may play a role in the differentiation of airway epithelial cells (46). Although all three human lung epithelial cell lines express slightly higher levels of PPAR1 than PPAR2, the primary human bronchial epithelial cells predominantly express PPAR2. As type II pneumocytes express only PPAR1 but not PPAR2 (50), the predominant expression of PPAR1 in the lung tissue is likely due to the abundance of type II cells.

Although the physiological and pathophysiological role of PPARs in respiratory epithelial cells has not been well defined, recent evidence has demonstrated the involvement of PPARs in several important biological functions in the lung. For example, PPAR has been shown to down-regulate airway inflammation by inhibiting the expression of interleukin-8 and inducible nitric-oxide synthase in airway epithelial cells (51, 52). Activation of PPAR induces the differentiation and apoptosis in human lung cancer cells (53, 54). Consistent with the role of PPAR in adipocyte differentiation and lipid homeostasis, PPAR1 has been suggested to play a role in the differentiation and expression of lipogenic enzymes in lung type II cells (50). PPAR has also been suggested to play a role in the squamous differentiation of human tracheobronchial epithelial cells (46). In this study, we provide novel evidence for the involvement of AA metabolism in PPAR activation in human lung epithelial cells. This interaction may function as an important link between airway inflammation and PPAR-mediated pulmonary biological effects.

Phospholipase A₂s are a group of enzymes that catalyze the hydrolysis of the sn-2-ester bond of phospholipids, resulting in the release of free fatty acid for eicosanoid production. The group IV 85-kDa cPLA₂ (also termed as cPLA₂ in most recent literature in light of the cloning of two related isoforms, cPLA₂ and - (55, 56)) is a rate-limiting key enzyme in the liberation of AA from membrane phospholipids. The group IIA sPLA₂ is another key phospholipase important in the control of AA release for eicosanoid production in human cells (2, 3, 8, 9, 57). Although AA metabolites represent the natural ligands for PPAR activation, the individual enzymes involved in the control of eicosanoid production for PPAR activation were not known prior to this study. In this study, by overexpression of cPLA₂ and group IIA sPLA₂ as well as utilization of chemical inhibitors of PLA₂s, we demonstrated that activity of cPLA₂, but not the group IIA sPLA₂, played an important role in the regulation of PPAR-mediated gene transcription in human airway epithelial cells. These findings reveal a previously unrecognized function of cPLA₂, the cPLA₂-regulated production of eicosanoids, and the activation of PPARs in nuclei for gene transcription.

The trans-activation of PPRE-containing genes in cells is regulated by the level of PPAR protein, the presence of specific co-activator/co-repressor, and the availability of endogenous ligands. Activation of PPAR involves ligand-induced conformational change which subsequently alters the binding of PPAR with other nuclear proteins and the basal transcriptional machinery. In addition to the role of cPLA₂ in PPAR activation (as demonstrated by the PPRE reporter activity assay), our results also demonstrate an important role of cPLA₂ in the interaction between the PPAR and PPRE in human airway epithelial cells (as demonstrated by electrophoretic mobility shift assays). The latter finding is consistent with the observation that AA enhances the binding of PPAR to PPRE oligonucleotides in other cells including HepG2 cells (human hepatoma cell line) (58) and Caco-2 cells (human intestinal cell line) (59). Because cPLA₂ is a rate-limiting key enzyme for the release of AA from membrane phospholipids, the AA-induced PPAR-PPRE interaction and PPAR activation underscores the importance of cPLA₂ in PPAR-mediated gene transcription. We were unable to demonstrate an effect of AA on PPRE reporter gene activity using extracellular delivery of AA in A549 cells. These data taken together suggest the possibility that predominantly the intracellular pool of AA derived through cPLA₂ is involved in PPAR activation.

The different effects of cPLA₂ and group IIA sPLA₂ on PPAR activation can be explained by their different enzyme characteristics. One of the most important characteristics of cPLA₂ regulation is its calcium-dependent translocation from cytoplasm to membrane (preferentially nuclear envelope (7, 39-42)), which is mediated by its N-terminal Ca²⁺-dependent lipid binding domain (CaLB or C2 domain) (43, 60). This is in contrast with the group IIA sPLA₂, which exists either as a soluble form (located in extracellular space) or a cell-associated form (3, 8, 61, 62). Although the group IIA sPLA₂ requires Ca²⁺ for catalytic activity, it lacks the Ca²⁺-dependent membrane association. Therefore, the above unique enzyme characteristics of cPLA₂ and group IIA sPLA₂ likely explain the different regulatory roles of these two enzymes in PPAR activation. As cPLA₂ protein requires Ca²⁺ for its nuclear translocation, calcium ionophore A23187 was used in this study for maximal enzyme activation. When experiments with cPLA₂ overexpression were performed in the absence of ionophore A23187, the cPLA₂-induced increase of PPRE reporter activity was less prominent. For experiments with overexpression of group IIA sPLA₂, a similar degree of PPAR activation was observed in the presence or absence of ionophore A23187. We employed IL-1 stimulation of cells transfected with group IIA sPLA₂ in order to achieve the its maximum release and activation as shown in Fig. 5C. Even under these conditions (increasing sPLA₂ activity) PPRE reporter gene activity did not change supporting the aforementioned hypothesis. In the A549 cells (without PLA₂ overexpression), ionophore A23187 increased the PPRE reporter activity (Fig. 8) and enhanced the direct binding between PPAR and PPRE (Fig. 10). These observations again highlight the importance of calcium-mediated translocation of cPLA₂ in PPAR-mediated gene transcription. It is possible that the effect on PPAR activation might depend on expression and activity of various types of phospholipases. Enzymes which are mostly active intracellulary (like group IV) might be responsible for PPAR activation, whereas secreted PLA₂ (like group IIA and V) may not be involved in this process, although this speculation needs to be supported by experimental data. These results, along with the recent study showing the induction of cPLA₂ gene expression by PPAR in a preadipocyte cell line (63), unveil a novel feedback control between cPLA₂ and PPAR in human cells. We also demonstrated that NS 398, a COX-2 inhibitor, at least partially blocks the effect of cPLA₂-mediated PPAR activation and decreased binding to the PPRE as confirmed by a gel shift assay. It has been demonstrated that there is a functional coupling between cPLA₂ and COX-2 (62, 64, 65). Our data suggest that the effect on PPAR activation might take place through COX-2 metabolites at least in this experimental model, although further studies are needed to explore this matter.

In summary, this study demonstrates an important role of cPLA₂, but not group IIA sPLA₂, in the control of PPAR activation in human bronchial epithelial cells. As cPLA₂ plays an important role in mediating airway inflammation and PPAR has been shown to possess anti-inflammatory functions, the cPLA₂-mediated PPAR activation likely represents a novel mechanism for the feedback control of airway inflammation. Furthermore, in light of the role of PPAR in the airway epithelial cell differentiation and lung cancer cell differentiation/apoptosis, the cPLA₂-mediated PPAR activation may also provide a potential link between airway inflammation and other important aspects of airway epithelial cell biology such as differentiation and carcinogenesis. Further studies investigating the biological implications of arachidonic acid metabolism in PPAR activation in airway epithelial cells may provide important information on the pathogenesis of airway disorders.

	ACKNOWLEDGEMENTS

We thank Drs. J. E. Evans and C. C. Leslie from National Jewish Medical and Research Center, Denver, CO, for EGFP-FL plasmid; Drs. J. D. Clark and J. L. Knopf at the Genetics Institute, Boston, MA, for providing the cPLA₂ expression plasmid; and Dr. W. Wahli at Universite de Lausanne, Switzerland, for the PPRE reporter plasmid. The sPLA₂ inhibitor LY311727 was a generous gift from Dr. E. Mihelich at Lilly Research Laboratories, Indianapolis, IN.

	FOOTNOTES

^* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Pathology, University of Pittsburgh, Pittsburgh, PA 15213. E-mail: wut@msx.upmc.edu.

Published, JBC Papers in Press, June 20, 2002, DOI 10.1074/jbc.M200246200

	ABBREVIATIONS

The abbreviations used are: AA, arachidonic acid; AACOCF₃, arachidonyltrifluoromethyl ketone; CAT, chloramphenicol acetyltransferase; EMSA, electrophoretic mobility shift assays; HELSS, haloenol lactone suicide substrate; NHBE, primary normal human bronchial/tracheal epithelial cells; PLA₂, phospholipase A₂; cPLA₂, cytosolic phospholipase A₂; iPLA₂, intracellular calcium-independent PLA₂; sPLA₂, secretory PLA₂; PPAR, peroxisome proliferator activated receptor; PPRE, peroxisome proliferator response element; Me₂SO, dimethyl sulfoxide; MAFP, methyl arachidonyl fluorophosphate; PBS, phosphate-buffered saline; ANOVA, analysis of variance; GFP, green fluorescent protein; EGFP, enhanced GFP; IL, interleukin.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				R.-Y. Su, K.-H. Chi, D.-Y. Huang, M.-H. Tai, and W.-W. Lin 15-deoxy-{Delta}12,14-prostaglandin J2 up-regulates death receptor 5 gene expression in HCT116 cells: involvement of reactive oxygen species and C/EBP homologous transcription factor gene transcription Mol. Cancer Ther., October 1, 2008; 7(10): 3429 - 3440. [Abstract] [Full Text] [PDF]

				L.-Y. Chen, G. Woszczek, S. Nagineni, C. Logun, and J. H. Shelhamer Cytosolic phospholipase A2{alpha} activation induced by S1P is mediated by the S1P3 receptor in lung epithelial cells Am J Physiol Lung Cell Mol Physiol, August 1, 2008; 295(2): L326 - L335. [Abstract] [Full Text] [PDF]

				B. P. Hurley and B. A. McCormick Multiple Roles of Phospholipase A2 during Lung Infection and Inflammation Infect. Immun., June 1, 2008; 76(6): 2259 - 2272. [Full Text] [PDF]

				A. Ptasinska, S. Wang, J. Zhang, R. A. Wesley, and R. L. Danner Nitric oxide activation of peroxisome proliferator-activated receptor gamma through a p38 MAPK signaling pathway FASEB J, March 1, 2007; 21(3): 950 - 961. [Abstract] [Full Text] [PDF]

				L. Xu, C. Han, K. Lim, and T. Wu Cross-talk between Peroxisome Proliferator-Activated Receptor {delta} and Cytosolic Phospholipase A2{alpha}/Cyclooxygenase-2/Prostaglandin E2 Signaling Pathways in Human Hepatocellular Carcinoma Cells Cancer Res., December 15, 2006; 66(24): 11859 - 11868. [Abstract] [Full Text] [PDF]

				L. Xu, C. Han, and T. Wu A Novel Positive Feedback Loop between Peroxisome Proliferator-activated Receptor-{delta} and Prostaglandin E2 Signaling Pathways for Human Cholangiocarcinoma Cell Growth J. Biol. Chem., November 10, 2006; 281(45): 33982 - 33996. [Abstract] [Full Text] [PDF]

				I. Apraiz, J. Mi, and S. Cristobal Identification of Proteomic Signatures of Exposure to Marine Pollutants in Mussels (Mytilus edulis) Mol. Cell. Proteomics, July 1, 2006; 5(7): 1274 - 1285. [Abstract] [Full Text] [PDF]

				G.-H. Liu, J. Qu, and X. Shen Thioredoxin-mediated Negative Autoregulation of Peroxisome Proliferator-activated Receptor {alpha} Transcriptional Activity Mol. Biol. Cell, April 1, 2006; 17(4): 1822 - 1833. [Abstract] [Full Text] [PDF]

				S. P. Herbert, S. Ponnambalam, and J. H. Walker Cytosolic Phospholipase A2-{alpha} Mediates Endothelial Cell Proliferation and Is Inactivated by Association with the Golgi Apparatus Mol. Biol. Cell, August 1, 2005; 16(8): 3800 - 3809. [Abstract] [Full Text] [PDF]

				F. J. Schopfer, Y. Lin, P. R. S. Baker, T. Cui, M. Garcia-Barrio, J. Zhang, K. Chen, Y. E. Chen, and B. A. Freeman Nitrolinoleic acid: An endogenous peroxisome proliferator-activated receptor {gamma} ligand PNAS, February 15, 2005; 102(7): 2340 - 2345. [Abstract] [Full Text] [PDF]

				R. Pawliczak, C. Logun, P. Madara, M. Lawrence, G. Woszczek, A. Ptasinska, M. L. Kowalski, T. Wu, and J. H. Shelhamer Cytosolic Phospholipase A2 Group IV{alpha} but Not Secreted Phospholipase A2 Group IIA, V, or X Induces Interleukin-8 and Cyclooxygenase-2 Gene and Protein Expression through Peroxisome Proliferator-activated Receptors {gamma} 1 and 2 in Human Lung Cells J. Biol. Chem., November 19, 2004; 279(47): 48550 - 48561. [Abstract] [Full Text] [PDF]

				C. Han, A. J. Demetris, Y. Liu, J. H. Shelhamer, and T. Wu Transforming Growth Factor-{beta} (TGF-{beta}) Activates Cytosolic Phospholipase A2{alpha} (cPLA2{alpha})-mediated Prostaglandin E2 (PGE)2/EP1 and Peroxisome Proliferator-activated Receptor-{gamma} (PPAR-{gamma})/Smad Signaling Pathways in Human Liver Cancer Cells: A NOVEL MECHANISM FOR SUBVERSION OF TGF-{beta}-INDUCED MITOINHIBITION J. Biol. Chem., October 22, 2004; 279(43): 44344 - 44354. [Abstract] [Full Text] [PDF]

				M.A. Birrell, H.J. Patel, K. McCluskie, S. Wong, T. Leonard, M.H. Yacoub, and M.G. Belvisi PPAR-{gamma} agonists as therapy for diseases involving airway neutrophilia Eur. Respir. J., July 1, 2004; 24(1): 18 - 23. [Abstract] [Full Text] [PDF]

				S. Tashiro, T. Sumi, N. Uozumi, T. Shimizu, and T. Nakamura B-Myb-Dependent Regulation of c-Myc Expression by Cytosolic Phospholipase A2 J. Biol. Chem., April 23, 2004; 279(17): 17715 - 17722. [Abstract] [Full Text] [PDF]

				M. S. Shaik, A. Chatterjee, and M. Singh Effect of a Selective Cyclooxygenase-2 Inhibitor, Nimesulide, on the Growth of Lung Tumors and Their Expression of Cyclooxygenase-2 and Peroxisome Proliferator- Activated Receptor-{gamma} Clin. Cancer Res., February 15, 2004; 10(4): 1521 - 1529. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/36/33153    most recent M200246200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Pawliczak, R. Articles by Wu, T. Search for Related Content PubMed PubMed Citation Articles by Pawliczak, R. Articles by Wu, T. Social Bookmarking                      What's this?