HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 36, 33188-33195, September 6, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/36/33188    most recent M202522200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sitaraman, S. V. Articles by Madara, J. L. Search for Related Content PubMed PubMed Citation Articles by Sitaraman, S. V. Articles by Madara, J. L. Social Bookmarking                      What's this?

The Adenosine 2b Receptor Is Recruited to the Plasma Membrane and Associates with E3KARP and Ezrin upon Agonist Stimulation^*

Shanthi V. Sitaraman^§¶, Lixin Wang, Michelle Wong, Matthias Bruewer, Michael Hobert, C-H. Yun^§, Didier Merlin, and James L. Madara

From the ^§ Division of Digestive Diseases, Department of Medicine, the  Epithelial Biology Unit, Department of Pathology, and Emory University, Atlanta, Georgia 30322

Received for publication, March 15, 2002, and in revised form, May 31, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION Materials and Methods RESULTS DISCUSSION REFERENCES

We have previously shown that adenosine is formed in the intestinal lumen during active inflammation from neutrophil-derived 5'-AMP. Acting through the adenosine A2b receptor (A2bR), the luminally derived adenosine induces vectorial chloride secretion and a polarized secretion of interleukin-6 to the intestinal lumen. Although some G protein-coupled receptors interact with anchoring or signaling molecules, not much is known in this critical area for the A2bR. We used the model intestinal epithelial cell line, T84, and Caco2-BBE cells stably transfected with GFP-A2b receptor to study the intestinal A2bR. The A2bR is present in both the apical and basolateral membranes of intestinal epithelia. Apical or basolateral stimulation of the A2bR induces recruitment of the receptor to the plasma membrane and caveolar fractions. The A2bR co-immunoprecipitates with E3KARP and ezrin upon agonist stimulation. Ezrin interacts with E3KARP and PKA and the interaction between ezrin and E3KARP is enhanced by agonist stimulation. Our data suggest that the A2bR is recruited to the plasma membrane upon apical or basolateral agonist stimulation and interacts with E3KARP and ezrin. We speculate that such an interaction may not only anchor the A2bR to the plasma membrane but may also function to stabilize the receptor in a signaling complex in the plasma membrane.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION Materials and Methods RESULTS DISCUSSION REFERENCES

Adenosine is an ubiquitous extracellular signaling molecule that is released during inflammation and acts as a paracrine factor with diverse effects on the inflammatory cascade (1-7). In the intestine, neutrophil transmigration into the lumen to form crypt abscesses is the pathologic hallmark of the active phase of many intestinal disorders, including inflammatory bowel disease. We have previously shown that neutrophils, upon transmigration into the intestinal lumen, release 5'-AMP (8, 9). Adenosine is derived from 5'-AMP when it is converted by the intestinal apical membrane 5'-ectonucleotidase (CD 73) (11) and can subsequently interact with the intestinal adenosine receptor (10). The adenosine receptor belongs to the family of the G protein-coupled group of cell surface receptors (12, 13). On the basis of initial pharmacological criteria, adenosine is known to interact with one of the four adenosine receptor subtypes A1, A2a, A2b, and A3 (3, 4, 12, 13), all of which have now been cloned. Using molecular, pharmacologic, and biochemical approaches we characterized the intestinal adenosine receptor as the A2b subtype in both T84 cells, a model intestinal epithelial cell line, and intact human intestinal epithelia (10). Furthermore, the A2bR appears to be the only adenosine receptor present in T84 cells (10, 14). In these cells, the A2bR is functionally coupled to G_s and the stimulation of the apical or basolateral surface with adenosine results in cAMP-mediated vectorial chloride secretion (9, 10, 15-17) and interleukin-6 synthesis and secretion (18).

The distribution and coupling of A2bR upon agonist stimulation with cytoplasmic structural proteins and the potential significance of this is not known. On the basis of effective coupling of minute second messenger signals to protein kinase A (PKA)¹ we hypothesized sometime ago that A2bR might be compartmentalized with signaling molecules and their targets (10). Huang et al. (19) recently provided functional evidence for such an organized complex including G_s; adenylate cyclase, PKA, and CFTR are compartmentalized in microdomains in the apical plasma membrane. Such compartmentalization of signaling networks in a multiprotein complex has been shown to result in both the stabilization of constituent proteins at the cell surface and enhanced efficiency of signaling (20). A common mechanism for establishing multiple protein complexes is via protein-protein interaction with submembrane scaffolding proteins. PSD-95/Dlg/ZO-1 (PDZ) domain proteins localized to the membrane-cytoskeletal interface have emerged as important organizing centers for regulatory complexes, and these scaffold-based regulatory proteins are often polarized to specific sites in polarized epithelial cells (20, 21). For example, ERM (ezrin-radixin-moesin)-binding protein (EBP50 or NHERF-1) and its related homolog NHE-3 kinase regulatory proteins (E3KARP or NHERF-2) appear to coordinate specific cAMP-mediated secretory responses (21). The PDZ interacting motif (S/T)XL at the C terminus of proteins such as -adrenergic receptor (22) and CFTR (23), binds to NHERF, which in turn interacts with ezrin. Ezrin is known to act as a protein kinase A anchoring protein (21) in addition to associating with the actin cytoskeleton (reviewed in Ref. 24). The interaction between NHERF, ezrin, and PKA has been shown to be critical for the functional response of transporters including CFTR (21) and NHE-3 (25).

In this study we examined the association of A2bR at rest and after stimulation with E3KARP, ezrin, and PKA. We show that the A2bR is recruited to the plasma membrane fraction upon stimulation with adenosine. The recruitment of the A2bR to the membrane is paralleled by its interaction with E3KARP and ezrin. Ezrin directly interacts with the A2bR and is activated in response to adenosine stimulation. Taken together, our data suggest that the A2bR, and its signaling complex, exists in the microdomain in the membrane, and adenosine signaling through the A2bR may be mediated by such close interaction and recruitment of the receptor to the membrane.

	Materials and Methods

TOP ABSTRACT INTRODUCTION Materials and Methods RESULTS DISCUSSION REFERENCES

Reagents-- All tissue culture supplies were obtained from Invitrogen. Adenosine and 5'-(N-ethylcarboxamido)adenosine were obtained from Research Biochemicals Int. (Natick, MA). Reagents for SDS-PAGE and nitrocellulose membranes (0.45-µm pores) were from Bio-Rad. Anti-A2bR antibody was obtained from Alpha Diagnostics Inc. (San Antonio, TX), anti-NHERF antibodies were obtained from Dr. Yun (Emory University, GA), and mouse monoclonal anti-CD 73 was a gift from Dr. Thompson (University of Oklahoma). Anti-ezrin antibody was obtained from Sigma; anti-caveolin 1, anti-₁ integrin, and anti-GFP were obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Other antibodies include fluorescein isothiocyanate-labeled goat anti-rabbit antibody and horseradish peroxidase-conjugated Ig were obtained from Jackson ImmunoResearch Laboratory (West Grove, PA) and Amersham Biosciences, respectively.

Cell Culture-- T84 cells were grown and maintained in culture as previously described (8) in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F-12 medium supplemented with penicillin (40 mg/liter), ampicillin (8 mg/liter), streptomycin (90 mg/liter), and 5% newborn calf serum. Confluent stock monolayers were subcultured by trypsinization. Experiments were done on cells plated for 7-8 days on permeable supports of 0.33 cm² or 4.5 cm² (inserts). Inserts with rat tail collagen-coated polycarbonate membrane filter (0.4-µm pore size, Costar, Cambridge, MA) rested in wells containing media until steady-state resistance was achieved, as previously described (8). This permits apical and basolateral membranes to be separately interfaced with apical and basolateral buffer, a configuration identical to that previously developed for various microassays (8). The T84 cells had a high electrical resistance (1200-1500  cm²). All experiments were performed on T84 cells between passages 69 and 83. Caco2-BBE were grown as confluent monolayers in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F-12 medium supplemented with 15 mM HEPES buffer, pH 7.5, 14 mM NaHCO₃, and 10% newborn calf serum. Transfected cell lines were maintained in the same media containing 1.2 mg/ml G418. Cell surface biotinylation studies were carried out with confluent monolayers plated on collagen-coated permeable supports. CHO cells (ATCC) were grown in Dulbecco's modified Eagle's medium containing 10% fetal bovine calf serum supplemented with penicillin and streptomycin.

Transfections-- Full-length A2bR cDNA was cloned into the pEGFP-C vector (CLONTECH) using HindIII and BamHI restriction enzymes. Point mutation was introduced into the stop codon of the wild-type human A2bR cDNA (sense primer: CGGTGTGGGCCTACTCAGTTAGGCTCTCG and antisense primer: CGAGAGCCTAGACTGAGTAGGCCCACACCG) by site-directed mutagenesis using PCR-mediated overlap extension to facilitate fusion of the cDNA sequence using the QuikChange site-directed mutagenesis kit (Stratagene). The constructed plasmid cDNA sequences were verified by sequencing. Plasmids were purified using the Qiagen Maxiprep kit. Subconfluent Caco2-BBE cells were transfected with A2b-GFP vector using Lipofectin (Invitrogen) for 20 h in serum-free medium. Serum was added for the subsequent 48 h and stable transfectants were selected in medium containing 1.2 mg/ml G418. The 10 clones selected from each construct were maintained in 1.2 mg/ml G418 and were expanded. Clones showing the highest expression were generated by repeated sorting of fluorescent clones using fluorescence-activated cell sorter. PRK vector containing full-length A2bR was a generous gift from R. J. Mrsny (Genentech Inc., San Francisco, CA).

Confocal Microscopy-- Monolayers of T84 or Caco2-BBE cells were washed in HBSS, fixed in buffered formaldehyde for 20 min, incubated with the respective primary antibodies overnight in a humidity chamber, washed with HBSS, and subsequently incubated with fluorsceinated secondary antibodies (Jackson ImmunoResearch). Monolayers were also counterstained with rhodamine/phalloidin to visualize actin. Monolayers, mounted in p-phenylenediamine/glycerol (1:1) were analyzed by confocal microscopy (Zeiss dual laser confocal microscope) as described (18). In the case of Caco2-BBE cells transfected with GFP containing vector, monolayers were directly fixed, stained with rhodamine/phalloidin, mounted on glass slides, and analyzed by confocal microscopy. Using actin staining, the apical most surface of the cell was marked as 0 µm and the basolateral surface was marked at the level of actin stress fiber (~18.7 µm from the top of the cell). xy sections taken at ~1.2 µm from the top (above the level of tight junction) and at the level of actin stress fiber was used for quantitation of apical and basolateral surfaces, respectively.

SDS-PAGE and Western Blot-- Cells were lysed with phosphate-buffered saline containing 1% Triton X-100 and 1% Nonidet P-40 (v/v), protease inhibitor mixture (Roche Molecular Biochemicals), EDTA, SDS, sodium orthovanadate, and sodium fluoride. SDS-PAGE was performed according to the Laemmli procedure using a 10% acrylamide gel. Proteins were electrotransferred to nitrocellulose membranes and probed with primary antibody (diluted 1:1000). Then membranes were incubated with corresponding peroxidase-linked secondary antibody diluted 1:2000, washed, and subsequently incubated with ECL reagents (Amersham Biosciences) before exposure to high performance chemiluminescence films (Amersham Biosciences). For M_r determination, polyacrylamide gels were calibrated using standard proteins (Bio-Rad) with M_r markers within the range 7,700 to 214,000.

Cell Surface Biotinylation and Immunoprecipitation-- Apical or basolateral sides of the filter-grown monolayers were biotinylated using sulfosuccinimidyl-biotin (s-NHS-biotin, Pierce, Rockford, IL) as previously described (26). The cell lysate was then incubated with streptavidin-agarose (Pierce) to bind biotinylated proteins. Proteins were separated by SDS-PAGE and Western blotting was done as described previously (26)

Isolation of Plasma Membrane and Caveoli-- Cell fractionation to isolate pure plasma membrane and caveolae was done as described (27) using a detergent-free method. Briefly, confluent T84 monolayers grown in 45-cm² inserts were washed with HBSS, equilibrated for 20 min at 37 °C, and stimulated with apical or basolateral adenosine (100 µM). A plasma membrane fraction was prepared from two 4.5-cm² inserts/condition. The plasma membrane fraction obtained by this method, as previously shown, was not contaminated with cytoplasm or membranes from other compartments. This approach was chosen because the detergent solubility of some proteins such as the subunit of heterotrimeric G-proteins or certain G protein-coupled receptors is well established. Caveolae were purified from the plasma membrane fraction using Opti-Prep gradient (27).

Flow Cytometry-- Adherent monolayers were detached with EDTA in HBSS (without Ca²⁺ or Mg²⁺), pelleted by centrifugation, and re-suspended in HBSS containing 1% bovine serum albumin. Cells transfected with GFP-tagged A2bR were directly analyzed with FAC-Sort flow cytometer apparatus (BD PharMingen) as described (28).

cAMP Measurements-- Measurements of cAMP were performed on ethanol extracts of cells obtained from monolayers grown on permeable supports, using the radioimmunoassay kit as described by the supplier (PerkinElmer Life Sciences). Briefly, after monolayers were washed with HBSS and incubated 10 min, baseline Isc readings were taken and then adenosine was added. Cells were lysed in the extract buffer (66% ethanol, 33% HBSS, 1 mM phosphodiesterase inhibitor 3-isobutyl-1-methylxanthine). Monolayers were compacted, centrifuged, and an aliquot (100 µl) was used for radioimmunoassay (10).

Quantitation of Western Blot and Confocal Images-- The band intensity of Western blot was quantitated using a gel documentation system (Alpha Innotech Co., San Leandro, CA). Quantitation of confocal images were performed on unprocessed images using the Metamorph Imaging System software (Universal Imaging Corp., West Chester, PA) as described (29). The average grayscale pixel intensity +1 S.D. of a small region was measured and defined as background. To subtract background, the threshold of each channel was set at the value obtained for background. The average pixel intensity +1 S.D. was measured for the threshold images. The data are presented as the mean ± S.D. Statistical analysis was performed using unpaired Student's t test. p value < 0.05 was considered statistically significant.

	RESULTS

TOP ABSTRACT INTRODUCTION Materials and Methods RESULTS DISCUSSION REFERENCES

A2bRs Are Present in Both the Apical and Basolateral Membranes of Intestinal Epithelial Cells and in the Transfected Intestinal Cell Line-- We first characterized the commercially available antibody to the second extracellular loop of the A2bR. T84 cells, which we have shown previously express the A2bR, exhibited an immunoreactive band at 42-44 kDa (Fig. 1, lane 2). In addition, membrane fractions from HEK 293 cells overexpressing A2bR also showed a similar immunoreactive band at 42-44 kDa (Fig. 1, lane 1). The immunoreactive band was competed by peptide used to raise the antibody (data not shown). CHO cells, which lack expression of A2bR mRNA and cAMP response to agonist stimulation, showed no immunoreactivity at 42-44 kDa (Fig. 1, lane 4) and as seen in lane 3, CHO cells transfected with full-length A2bR showed an immunoreactive band at 42-44 kDa similar to that seen in T84 cells and HEK 293 cells. These data demonstrate that the antibody specifically recognizes the 42-44-kDa A2bR.

View larger version (14K): [in this window] [in a new window]   Fig. 1.   Specificity of anti-A2b antibody. Whole cell detergent lysates were prepared from T84 monolayers (lane 2) and CHO cells stably transfected with PRK vector alone (lane 4) or with PRK-A2bR (lane 3). Membranes from HEK cell lines overexpressing A2bR (lane 1) were purchased from Sigma. Whole cell detergent lysates (20 µg of protein/lane) were resolved by SDS-PAGE and immunoblotted for A2bR using anti-A2b antibody.

We next examined the polarity of the A2bR. Using cell surface biotinylation, we show that the A2bR is present at both the apical and basolateral membranes of the model intestinal epithelial cells. However, as shown in Fig. 2A, the A2bR expression is significantly higher at the basolateral membrane compared with the apical membrane (apical:basolateral ratio, 1:3.1 ± 0.9, mean ± S.D., n = 6, p < 0.001). CD 73, an apically expressed protein (11), showed an apical:basolateral ratio of 5 ± 0.9:1 (mean ± S.D., n = 3, p < 0.01), whereas ₁ integrin, a basolaterally expressed protein (30) showed an apical:basoateral ratio of 1:7 ± 0.5 (relative band density mean ± S.D., n = 3, p < 0.001) (Fig. 2B). Next we examined the distribution of A2bR using confocal microscopy (Fig. 3). Consistent with our data on cell surface biotinylation, the A2bR is expressed both at the apical and basolateral surface of T84 cells (Fig. 3A). The en face (xy plane) images of the T84 epithelia were taken at the apical and basolateral membranes. To quantitate the cell surface expression of A2bR, the pixel intensity of the confocal images taken at the apical and basolateral surfaces were measured as described under "Materials Methods." As seen in Fig. 3B, the ratio of pixel intensity of apical:basolateral A2b receptor was 1:1.7 ± 0.2 (relative units mean ± S.D., n = 8, p < 0.001) compared with the CD 73 and ₁ integrin apical:basolateral ratio of 5 ± 0.2:1 and 1:3 ± 0.3, respectively (relative units, mean ± S.D., n = 3, p < 0.01).

View larger version (18K): [in this window] [in a new window]   Fig. 2.   A2bR is expressed at both the apical and basolateral membranes. A, filter-grown monolayers were subjected to cell surface biotinylation (lane 1, Ap apical domain; lane 2, Bs basolateral domain) for 30 min followed by immunoprecipitation with avidin beads. Immunoprecipitates were subjected to Western blot and detected with anti-A2b antibody, anti-CD 73, or anti-1 integrin (int). B, the intensity of bands from panel A was quantitated as described under "Materials and Methods." The bar graphs represent relative band intensity apical (A) versus basolateral (B) membrane, mean ± S.D. *, p < 0.001; **, p < 0.01.

View larger version (61K): [in this window] [in a new window]   Fig. 3.   Confocal microscopy of A2bR. A, monolayers were fixed and stained with anti-A2b antibody followed by fluoroscein isothiocyanate-conjugated secondary antibody (A2bR, anti-CD 73, or anti-1 integrin; green). Monolayers were also stained with rhodamine/phalloidin (actin, red). Vertical sections (xz) were taken off the monolayers to define the top (set at 0 µm) and bottom of the monolayer. En face sections (xy) were then generated from apical and basolateral planes in the vertical section. Shown here are en face (xy) images taken at the level of apical (at 1.2 µm, above the level of tight junction) and basolateral (at 18.7 µm, level of stress fiber) pole of the epithelial monolayer and computer reconstructed vertical section (xz) images taken through full thickness of the monolayer. B, the pixel intensity from panel A was quantitated as described under "Materials and Methods." The bar graphs represent the relative pixel intensity apical (A) versus basolateral (B) membrane, mean ± S.D.; *, p < 0.001; **, p < 0.01.

Based on its cDNA sequence, A2bR is predicted to have a molecular mass of 36 kDa. However, our data suggest that the A2bR in T84 cells is 42-44 kDa. To verify the molecular mass of the A2bR in intestinal epithelial cells we stably transfected the intestinal cell line, Caco2-BBE, with GFP-tagged A2bR. As shown in Fig. 4A, GFP-A2b-transfected Caco2-BBE cells show a shift in fluorescence compared with untransfected cells demonstrating a high level of fusion-protein expression. We then used an anti-GFP antibody to immunoprecipitate the GFP-A2bR fusion protein from whole cell lysates and detected the A2bR on a Western blot using anti-A2bR antibodies. As seen in Fig. 4B, transfected cells exhibit a ~68-70-kDa band corresponding to the GFP-A2bR fusion protein. This band was not present in the wild-type Caco2-BBE cells or in cells transfected with GFP vector alone (lanes 1 and 2, respectively). The GFP-A2b fusion protein expression was enhanced after the second and third round of fluorescence-activated cell sorting of fluorescent clones (lanes 3 and 4, respectively). We next determined the steady-state distribution of GFP-A2bR fusion protein expression using cell surface biotinylation. Similar to the T84 cells, the A2bR was present at both the apical and basolateral surface but predominant at the basolateral surface (apical to basolateral ratio of 1:6 ± 0.5, relative units from a densitometric scan, mean ± S.D., n = 3, p < 0.003) (Fig. 4C). CD 73, an apically expressed protein in Caco2-BBE cells (11, 31), showed an apical:basolateral ratio of 5 ± 0.9:1, whereas ₁ integrin (30) showed an apical:basoateral ratio of 1:6 ± 0.3 (relative units from densitometric scan, mean ± S.D., n = 3, p < 0.01 and p < 0.001, respectively, data not shown). Confocal images of transfected Caco2-BBE cells also show the expression of the A2bR at the apical and basolateral surface (Fig. 4D). To quantitate the cell surface expression of GFP-A2bR, the pixel intensity of the confocal images taken at the apical and basolateral surfaces were measured. The ratio of pixel intensity of apical:basolateral A2b receptor was 1:3 ± 0.5 (relative pixel units, mean ± S.D., n = 3, p < 0.01). CD 73 and ₁ integrin showed an apical:basolateral ratio of 4.6 ± 0.6:1 and 1:3.8 ± 0.2, respectively (relative pixel units, mean ± S.D., n = 3, p < 0.005 and p < 0.001, respectively, data not shown). To determine whether the GFP-A2bR fusion protein was functional, the cells were stimulated with adenosine and intracellular cAMP was measured 5 min after stimulation. Apical or basolateral stimulation of GFP-A2bR-transfected cells with adenosine induced an 8-fold increase in cAMP compared with cells transfected with vector alone (Fig. 4E). These data demonstrate that Caco2-BBE cells transfected with GFP-tagged A2bR has a similar molecular mass as the endogenous A2bR in T84 cells.

View larger version (39K): [in this window] [in a new window]   Fig. 4.   Expression of GFP-tagged A2bR in Caco2-BBE cells. A, analysis of transfectants by flow cytometry: untransfected Caco2-BBE cells (black histogram) or those with GFP-fused to A2bR after cell sorting of the highly fluorescent clones (open histogram). B, whole cell lysates from wild-type Caco2-BBE cells (lane 1), GFP vector (lane 2), or GFP-A2bR transfected cells (lane 3 prior to cell sorting for fluorescent clone and lane 4 post-sorting of stable transfectants) were subjected to immunoprecipitation with anti-GFP antibody and detected with anti-A2b antibody on a Western blot of the immunoprecipitates. C, filter-grown GFP-A2b transfected Caco2-BBE cells were subjected to domain-specific biotinylation (lane 1, Ap, apical; lane 2, Bs, basolateral). Biotinylated proteins were immunoprecipitated with avidin beads and subjected to Western blot and immunostained using anti-A2b antibody. Also shown in the bar graph is the relative band intensity of apical versus basolateral membrane, mean ± S.D.; n = 3; *, p < 0.001. D, confocal microscopic localization of GFP-A2bR (green) in transfected cells (xy) and computer-reconstructed vertical section (xz) images taken through the full thickness of the monolayer. Monolayers were also stained with rhodamine/phalloidin (actin, red). E, GFP vector or GFP-A2b-transfected cells were stimulated with apical or basolateral adenosine (100 µM) for 5 min. cAMP was determined in cell lysates as described under "Materials and Methods." Representative data from two individual experiments using two samples/condition are shown.

A2bR Is Recruited to the Plasma Membrane Fractions upon Apical or Basolateral Stimulation of the A2bR-- Having established the specificity of the antibody to the native receptor in T84 cells, we next studied the effect of agonist stimulation on the distribution of A2bR. Since Caco2-BBE cells are known to possess more than one type of adenosine receptor, T84 cells in which A2bR is the only adenosine receptor present were used to further characterize the A2bR. As seen in Fig. 5, there was a small amount of A2bR detected in the plasma membrane fraction in resting cells and the bulk of the receptor was present in the postnuclear supernatant. In contrast, receptor density was significantly increased in the plasma membrane 5 min after apical or basolateral stimulation with adenosine (control:apical stimulation, 1:7.4 ± 0.4; control:basolateral stimulation, 1:7.9 ± 0.6 relative units from densitometric scan, mean ± S.D., n = 3 p < 0.001). The caveolar fraction contained A2bR at rest and there was a mild but significant increase in this fraction after apical or basolateral stimulation (control:apical stimulation, 1:1.9 ± 0.3; control:basolateral stimulation, 1:1.5 ± 0.05 relative units from densitometric scan, mean ± S.D., n = 3, p < 0.01 and p < 0.001, respectively). As expected, caveolin was enriched in the caveolar fraction (postnuclear:plasma membrane:caveoli, 1:1.8 ± 0.2:7.2 ± 0.1 in unstimulated monolayers, relative units from densitometric scans, mean ± S.D., n = 3, p < 0.001 plasma membrane and caveolar fraction compared with the postnuclear supernatant). Apical or basolateral adenosine did not have any effect on the distribution of caveolin in these fractions (postnuclear:plasma membrane:caveoli apical adenosine, 1:1.8 ± 0.1:7.0 ± 0.3; basolateral adenosine, 1:2.0 ± 0.01:6.9 ± 0.2, relative units from densitometric scan, mean ± S.D., n = 3). These data demonstrate that apical or basolateral stimulation with adenosine results in the recruitment of A2bR to the plasma membrane and, to a lesser extent, to the caveolar fraction.

View larger version (19K): [in this window] [in a new window]   Fig. 5.   Adenosine induces recruitment of A2bR to plasma membrane fraction. T84 monolayers were washed with HBSS, equilibrated for 20 min at 37 °C, and stimulated with adenosine (100 µM, apical or basolateral) for 5 min. T84 cells were subfractionated as described under "Materials and Methods." The amount of protein in each subcellular fraction was determined and 5 µg of protein from each subcellular fraction (caveoli and plasma membrane) and 10 µg of postnuclear supernatant was resolved by SDS-PAGE and immunoblotted for A2bR and caveolin-1. Cav, caveolar membrane; P.M., plasma membrane; P.N., postnuclear supernatant. Representative data observed in three separate experiments is shown. Bar graphs for A2bR represent the fold increase in band intensity of apical (A) or basolateral (B) stimulation compared with unstimulated monolayers, mean ± S.D.; n = 3; *, p < 0.001; **, p < 0.01. Bar graphs for caveolin represent relative band intensity of postnuclear, plasma membrane, and caveolar fraction C (control), A (apical stimulation), and B (basolateral stimulation), mean ± S.D.; n = 3; *, p < 0.001, compared with caveolin in postnuclear supernatant.

The A2bR Associates with the PDZ-domain Containing Proteins, E3KARP and Ezrin-- NHERF and E3KARP are subplasma membrane PDZ domain proteins that may serve to anchor membrane proteins such as CFTR to the cytoskeleton. NHERF and E3KARP are thought to work in concert with ezrin and PKA to bring a signaling complex in close proximity to membrane proteins, such as CFTR enhancing efficiency and stabilizing proteins in the membrane. To determine whether the PDZ domain protein may regulate A2bR membrane organization, we examined whether NHERF was associated with A2bR. As shown in Fig. 6A, E3KARP co-immunoprecipitated with the A2bR. This association was apparent 5 min after apical or basolateral adenosine stimulation and was barely detectable in resting cells (unstimulated:apical adenosine, 1:1.9 ± 0.1; and unstimulated:basolateral adenosine, 1:2.1 ± 0.05, relative band intensity, mean ± S.D., n = 3, p < 0.03). The A2bR also co-immunoprecipitated with ezrin after apical or basolateral stimulation for 5 min with adenosine (Fig. 6B). The coimmunoprecipitation of the A2bR with ezrin after receptor stimulation was 4-fold higher than that of the immunoprecipitate obtained in control cells (unstimulated:apical adenosine, 1:4 ± 0.2; unstimulated:basolateral adenosine, 1:4.5 ± 0.9, relative band intensity, mean ± S.D. n = 3, p < 0.001 unstimulated compared with apical or basolateral stimulation, respectively). In addition, as shown in Fig. 6C, apical or basolateral stimulation of the A2bR enhanced the interaction between E3KARP and ezrin (unstimulated:apical adenosine, 1:3 ± 0.1; unstimulated:basolateral adenosine, 1:3 ± 0.1, relative band intensity, mean ± S.D., n = 2, p < 0.01 unstimulated compared with apical or basolateral adenosine, respectively). However, the interaction of ezrin with PKA RII was not affected by adenosine stimulation (Fig. 6D) (unstimulated:apical stimulation, 1:1.3 ± 0.4; unstimulated:basolateral adenosine stimulation, 1:1.4 ± 0.5, relative band intensity, mean ± S.D., n = 3, NS). These data demonstrate that the A2bR interacts with E3KARP and ezrin. Consistent with the data in the literature, ezrin associates with E3KARP and PKA RII-. The interaction between A2bR and ezrin and ezrin and E3KARP were significantly enhanced upon stimulation with adenosine.

View larger version (32K): [in this window] [in a new window]   Fig. 6.   Interaction between A2bR and E3KARP, ezrin, and PKA. T84 cells were washed with HBSS, equilibrated for 20 min at 37 °C, and stimulated with adenosine (100 µM, apical (ap) or basolateral (bs) for 5 min (lane 1, unstimulated; lane 2, ap adenosine; lane 3, bs adenosine). A, immunoprecipitates obtained with E3KARP antibody from T84 cell lysates were separated on SDS-PAGE, transferred to polyvinylidene difluoride membrane, and probed with a polyclonal anti-A2bR (anti-A2b). B, immunoprecipitates obtained with monoclonal ezrin antibody were immunoblotted with polyclonal anti-A2b antibody. C, immunoprecipitates obtained with monoclonal anti-ezrin antibody were immunoblotted with polyclonal anti-A2b antibody; D, immunoprecipitates obtained with monoclonal ezrin antibody were immunoblotted with polyclonal anti-PKA RII. As a negative control, immunoprecipitation was performed using irrelevant mouse IgG (lane 0). The results represent three separate experiments. E, bar graph represents fold increase in band intensity of apical (2) or basolateral (3) adenosine stimulation compared with unstimulated monolayers shown in panels A-D, respectively. Values represent mean ± S.D.; n = 3; *, p < 0.001; **, p < 0.03.

	DISCUSSION

TOP ABSTRACT INTRODUCTION Materials and Methods RESULTS DISCUSSION REFERENCES

In this study we used the human intestinal epithelial cell line T84 to examine the distribution and association of A2bR to its signaling repertoire in response to agonist stimulation. The cell line used, T84, was previously used to identify mechanisms of neutrophil-derived 5'-AMP conversion to adenosine (CD 73), identify A2bR as the only adenosine receptor, and define its signaling mechanism (cAMP). These observations were subsequently shown to accurately predict events in natural human intestinal epithelia (9-11, 14). In this study we first verified the specificity of the anti-A2bR antibody. The antibody gives an immunoreactive band at 42-44 kDa in T84 cells, CHO cells transfected with full-length A2bR, and HEK 293 membranes overexpressing A2bR. This immunoreactive band was not present in untransfected CHO cells or Caco2-BBE cells. In addition, using GFP-A2b fusion protein we show that immunoreactivity at 68-70 kDa corresponds to the GFP-A2bR fusion protein. Furthermore, using anti-hemagglutinin and anti-V5 antibodies, we demonstrate that CHO cells transfected with hemagglutinin- or V5-tagged A2bR also gives an immunoreactive band at 40-44 kDa similar to that observed in T84 cells (data not shown). These results establish that the anti-A2b antibody specifically recognizes the A2bR. Our data is in agreement with others who, using antibody to another epitope in the A2bR, observed that the A2bR had a similar molecular mass of 42 kDa (32, 33) in human lymphocytes and CHO cells transfected with the native receptor. The A2bR is known to have two promoters and in addition, a pseudogene located on chromosome 1 (34). Alternate splicing resulting in protein sequence heterogeneity similar to that observed in several other receptors such as dopamine receptor; EP3 receptor has been proposed for the A2bR (3). This may explain the discrepancy in the molecular mass observed in our study compared with a predicted molecular mass of 36 kDa (35).

We used the anti-A2b antibody to further characterize the A2bR in the model intestinal epithelia. We and others have previously shown that A2b is the only adenosine receptor present in T84 cells and in intact human intestinal epithelia (10, 14, 36). Here we show that the A2bR is present at both the apical and basolateral membranes of T84 cells. Cell surface biotinylation studies show a more prominent expression of the A2bR at the basolateral surface compared with apical surface. We and others have shown that for the same amount of Isc by adenosine, basolateral stimulation gives 10-20-fold greater cAMP compared with apical stimulation (10, 15, 16). The higher receptor density at the basolateral membrane may explain the robust cAMP response to basolateral adenosine stimulation.

Our data show that apical or basolateral stimulation of the A2bR results in increased receptor expression in the plasma membrane fraction. Such recruitment and movement of receptor in and out of the membrane microdomain is known to occur for other G protein-coupled receptors including adenosine A1 receptor (37) and transporters including CFTR (38-40).

In addition to receptor density, the disparate cAMP response of apical versus basolateral adenosine stimulation compared with the Isc response (10) may also be explained by the presence of A2bR and its signaling complex in close proximity to the cAMP-dependent Cl channels in the apical membrane. Thus, signal transduction via apical adenosine receptor may occur at low receptor occupancy (ED₅₀ > 10-fold lower) via efficient coupling to adenylate cyclase, protein kinase A, and Cl conductance pathways. Such efficiency may reflect the close spatial relationship between the components of this putative signal-transducing pathway (10). Indeed recent data using patch clamp experiments in isolated apical membrane are in agreement with this hypothesis (19). Our findings provide structural evidence that the A2bR upon apical or basolateral agonist stimulation is present in a multiprotein complex. We demonstrate protein-protein association between A2bR and E3KARP and ezrin, ezrin and E3KARP and PKA RII. Along with our data demonstrating the recruitment of the A2bR to the plasma membrane fraction, these data suggest that the A2bR may be anchored in the plasma membrane by E3KARP. The A2bR, through activation of ezrin, may thus bring PKA in close proximity to adenylate cyclase and CFTR. Ezrin on the one hand interacts with actin cytoskeleton and on the other hand functions as a PKA anchoring protein bringing it in close proximity to the receptor signaling complex (21, 25). Similar interaction between NHERF and the G protein-coupled receptor has been noted for the ₂-adrenergic receptor (22).

We are currently exploring the mechanism by which A2bR interacts with E3KARP. In the case of the ₂-adrenergic receptor, the interaction between the receptor and NHERF was shown to be mediated by the PDZ-binding (S/T)XL motif in the C terminus of the ₂-adrenergic receptor that directly interacts with NHERF (22). The authors also showed that such an interaction was not necessary for the coupling of the ₂-adrenergic receptor to G-proteins but was essential for the receptor-mediated inhibition of the Na⁺/H⁺ exchanger (22). Although the A2bR does not contain the consensus PDZ-binding motif in the classical C terminus location, the sequence is present in the third intracellular loop. Such interaction between NHERF-1/E3KARP and the PDZ-interacting motif in atypical locations has been observed for NHE3-NHERF interaction (25). Whether or not the interaction of A2b receptor with E3KARP, ezrin, and PKA is necessary for G-protein coupling or chloride secretion needs to be determined. Our preliminary data shows that the cAMP response to adenosine stimulation is attenuated in Caco2-BBE cells transfected with a GFP-tagged A2bR containing a valine  alanine mutation in the PDZ consensus motif in the third extracellular loop.²

Our data demonstrate that the A2bR interacts with ezrin and the interaction of ezrin with both E3KARP and A2bR is at least 3-fold greater upon stimulation of the A2bR suggesting activation of ezrin by adenosine. Furthermore, our data suggest that the activation of ezrin is not merely because of an increase in cAMP but rather A2bR-mediated as forskolin, which increases cAMP by activating adenylate cyclase, does not increase E3KARP-ezrin interaction (25). Ezrin is present in cells in both active and inactive states. The inactive state of ezrin precludes its binding to its partners, NHERF-1, E3KARP, and the actin cytoskeleton. The activation of ezrin is thought to be secondary to phosphorylation of a COOH-terminal threonine (24). The mechanism of ezrin activation by adenosine is intriguing and to our knowledge, this is the first evidence of receptor-mediated direct activation of ezrin.

In summary, we show that the A2bR is recruited to the plasma membrane upon agonist stimulation. The A2bR, in response to agonist stimulation, interacts with E3KARP, ezrin, and PKA (Fig. 7). We speculate that such an interaction not only anchors the receptor in the plasma membrane but functions to stabilize the receptor in a signaling complex in the membrane microdomain that defines the chloride secretory response to adenosine.

View larger version (30K): [in this window] [in a new window]   Fig. 7.   Schematic representation of A2b trafficking and its interaction with E3KARP. The figure shows that neutrophils release 5'-AMP which is then converted into adenosine by epithelial ectonucleotidase (CD 73). The adenosine then interacts with A2bR, a G protein-coupled receptor, coupled to Gs and increases cAMP. Upon stimulation, the receptor is recruited to the plasma membrane where it interacts with E3KARP, which in turn is associated with ezrin. Ezrin on one hand interacts with actin cytoskeleton and on the other hand acts as a protein kinase A anchoring protein. Protein kinase A is activated by A2bR-mediated increase in cAMP. PKA phosphorylates CFTR activating chloride secretion.

	ACKNOWLEDGEMENTS

We thank Dr. Laura Volpicelli for assisting with quantitation of confocal images and Dr. Guy Benian and Baljit Walia for critical reading of the manuscript.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grants K08 DK02802 (to S. V. S.), K01 DK 02831 (to D. M.), DK 35932 and DK 47662 (to J. L. M.), and the Deutsche Forschungsgemeinschaft (to M. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ To whom correspondence should be addressed. E-mail: ssitar2@emory.edu.

Published, JBC Papers in Press, June 21, 2002, DOI 10.1074/jbc.M202522200

² S. V. Sitaraman, unpublished data.

	ABBREVIATIONS

The abbreviations used are: PKA, protein kinase A; CFTR, cystic fibrosis transmembrane conductance regulator; A2bR, adenosine 2b receptor; GFP, green fluorescent protein; CHO, Chinese hamster ovary; CD 73, 5'-ectonucleotidase; HBSS, Hank's balanced salt solution.

	REFERENCES

TOP ABSTRACT INTRODUCTION Materials and Methods RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				M. L. Hart, M. Henn, D. Kohler, D. Kloor, M. Mittelbronn, I. C. Gorzolla, G. L. Stahl, and H. K. Eltzschig Role of extracellular nucleotide phosphohydrolysis in intestinal ischemia-reperfusion injury FASEB J, August 1, 2008; 22(8): 2784 - 2797. [Abstract] [Full Text] [PDF]

				S. Ryzhov, R. Zaynagetdinov, A. E. Goldstein, S. V. Novitskiy, M. M. Dikov, M. R. Blackburn, I. Biaggioni, and I. Feoktistov Effect of A2B Adenosine Receptor Gene Ablation on Proinflammatory Adenosine Signaling in Mast Cells J. Immunol., June 1, 2008; 180(11): 7212 - 7220. [Abstract] [Full Text] [PDF]

				D. Wang, Y. Sun, W. Zhang, and P. Huang Apical adenosine regulates basolateral Ca2+-activated potassium channels in human airway Calu-3 epithelial cells Am J Physiol Cell Physiol, June 1, 2008; 294(6): C1443 - C1453. [Abstract] [Full Text] [PDF]

				S. Ryzhov, R. Zaynagetdinov, A. E. Goldstein, S. V. Novitskiy, M. R. Blackburn, I. Biaggioni, and I. Feoktistov Effect of A2B Adenosine Receptor Gene Ablation on Adenosine-Dependent Regulation of Proinflammatory Cytokines J. Pharmacol. Exp. Ther., February 1, 2008; 324(2): 694 - 700. [Abstract] [Full Text] [PDF]

				Y. Hayashi, N. Okino, Y. Kakuta, T. Shikanai, M. Tani, H. Narimatsu, and M. Ito Klotho-related Protein Is a Novel Cytosolic Neutral beta-Glycosylceramidase J. Biol. Chem., October 19, 2007; 282(42): 30889 - 30900. [Abstract] [Full Text] [PDF]

				M. Donowitz and X. Li Regulatory Binding Partners and Complexes of NHE3 Physiol Rev, July 1, 2007; 87(3): 825 - 872. [Abstract] [Full Text] [PDF]

				A. L. Theiss, T. S. Obertone, D. Merlin, and S. V. Sitaraman Interleukin-6 Transcriptionally Regulates Prohibitin Expression in Intestinal Epithelial Cells J. Biol. Chem., April 27, 2007; 282(17): 12804 - 12812. [Abstract] [Full Text] [PDF]

				L. Wang, S. Srinivasan, A. L. Theiss, D. Merlin, and S. V. Sitaraman Interleukin-6 Induces Keratin Expression in Intestinal Epithelial Cells: POTENTIAL ROLE OF KERATIN-8 IN INTERLEUKIN-6-INDUCED BARRIER FUNCTION ALTERATIONS J. Biol. Chem., March 16, 2007; 282(11): 8219 - 8227. [Abstract] [Full Text] [PDF]

				A. L. Theiss, R. D. Idell, S. Srinivasan, J.-M. Klapproth, D. P. Jones, D. Merlin, and S. V. Sitaraman Prohibitin protects against oxidative stress in intestinal epithelial cells FASEB J, January 1, 2007; 21(1): 197 - 206. [Abstract] [Full Text] [PDF]

				N. D. Holliday, C.-W. Lam, I. R. Tough, and H. M. Cox Role of the C Terminus in Neuropeptide Y Y Receptor Desensitization and Internalization Mol. Pharmacol., March 1, 2005; 67(3): 655 - 664. [Abstract] [Full Text] [PDF]

				V. Kolachala, V. Asamoah, L. Wang, S. Srinivasan, D. Merlin, and S. V. Sitaraman Interferon-{gamma} Down-regulates Adenosine 2b Receptor-mediated Signaling and Short Circuit Current in the Intestinal Epithelia by Inhibiting the Expression of Adenylate Cyclase J. Biol. Chem., February 11, 2005; 280(6): 4048 - 4057. [Abstract] [Full Text] [PDF]

				S. Shenolikar, J. W. Voltz, R. Cunningham, and E. J. Weinman Regulation of Ion Transport by the NHERF Family of PDZ Proteins Physiology, December 1, 2004; 19(6): 362 - 369. [Abstract] [Full Text] [PDF]

				L. Wang, V. Kolachala, B. Walia, S. Balasubramanian, R. A. Hall, D. Merlin, and S. V. Sitaraman Agonist-induced polarized trafficking and surface expression of the adenosine 2b receptor in intestinal epithelial cells: role of SNARE proteins Am J Physiol Gastrointest Liver Physiol, November 1, 2004; 287(5): G1100 - G1107. [Abstract] [Full Text] [PDF]

				C. Hague, M. A. Uberti, Z. Chen, C. F. Bush, S. V. Jones, K. J. Ressler, R. A. Hall, and K. P. Minneman Olfactory receptor surface expression is driven by association with the {beta}2-adrenergic receptor PNAS, September 14, 2004; 101(37): 13672 - 13676. [Abstract] [Full Text] [PDF]

				C. Hague, M. A. Uberti, Z. Chen, R. A. Hall, and K. P. Minneman Cell Surface Expression of {alpha}1D-Adrenergic Receptors Is Controlled by Heterodimerization with {alpha}1B-Adrenergic Receptors J. Biol. Chem., April 9, 2004; 279(15): 15541 - 15549. [Abstract] [Full Text] [PDF]

				R. E. Bucheimer and J. Linden Purinergic regulation of epithelial transport J. Physiol., March 1, 2004; 555(2): 311 - 321. [Abstract] [Full Text] [PDF]

				W. B. Sneddon, C. A. Syme, A. Bisello, C. E. Magyar, M. D. Rochdi, J.-L. Parent, E. J. Weinman, A. B. Abou-Samra, and P. A. Friedman Activation-independent Parathyroid Hormone Receptor Internalization Is Regulated by NHERF1 (EBP50) J. Biol. Chem., October 31, 2003; 278(44): 43787 - 43796. [Abstract] [Full Text] [PDF]

				L. Wang, B. Walia, J. Evans, A. T. Gewirtz, D. Merlin, and S. V. Sitaraman IL-6 Induces NF-{kappa}B Activation in the Intestinal Epithelia J. Immunol., September 15, 2003; 171(6): 3194 - 3201. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/36/33188    most recent M202522200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sitaraman, S. V. Articles by Madara, J. L. Search for Related Content PubMed PubMed Citation Articles by Sitaraman, S. V. Articles by Madara, J. L. Social Bookmarking                      What's this?