HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 37, 34198-34207, September 13, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/37/34198    most recent M204826200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kobayashi, S. Articles by Goodman, M. F. Search for Related Content PubMed PubMed Citation Articles by Kobayashi, S. Articles by Goodman, M. F. Social Bookmarking                      What's this?

Fidelity of Escherichia coli DNA Polymerase IV

PREFERENTIAL GENERATION OF SMALL DELETION MUTATIONS BY dNTP-STABILIZED MISALIGNMENT^*

Sawami Kobayashi, Michael R. Valentine, Phuong Pham, Mike O'Donnell^§, and Myron F. Goodman^¶

From the  Department of Biological Sciences and Chemistry, Hedco Molecular Biology Laboratories, University of Southern California, University Park, Los Angeles, California 90089-1340 and the ^§ Rockefeller University and Howard Hughes Medical Institute, New York, New York 10021

Received for publication, May 16, 2002, and in revised form, July 1, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Escherichia coli DNA polymerase IV (pol IV), a member of the error-prone Y family, predominantly generates 1 frameshifts when copying DNA in vitro. T  G transversions and T  C transitions are the most frequent base substitutions observed. The in vitro data agree with mutational spectra obtained when pol IV is overexpressed in vivo. Single base deletion and base substitution rates measured in the lacZ gene in vitro are, on average, 2 × 10⁴ and 5 × 10⁵, respectively. The range of misincorporation and mismatch extension efficiencies determined kinetically are 10³ to 10⁵. The presence of  sliding clamp and -complex clamp loading proteins strongly enhance pol IV processivity but have no discernible influence on fidelity. By analyzing changes in fluorescence of a 2-aminopurine template base undergoing replication in real time, we show that a "dNTP-stabilized" misalignment mechanism is responsible for making 1 frameshift mutations on undamaged DNA. In this mechanism, a dNTP substrate is paired "correctly" opposite a downstream template base, on a "looped out" template strand instead of mispairing opposite a next available template base. By using the same mechanism, pol IV "skips" past an abasic template lesion to generate a 1 frameshift. A crystal structure depicting dNTP-stabilized misalignment was reported recently for Sulfolubus solfataricus Dpo4, a Y family homolog of Escherichia coli pol IV.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

More than 40 SOS genes, including three DNA polymerases, are induced in Escherichia coli in response to DNA damage (1). pol IV¹ and pol V are "error-prone" Y family polymerases (2, 3), and pol II is a high fidelity B family member (4, 5). Included within the Y family is a subgroup sharing sequence homology with E. coli dinB, the gene encoding pol IV. The dinB-like pols have been identified in essentially all prokaryotic and eukaryotic organisms (2).

pol V is responsible for generating SOS-induced chromosomal mutations targeted at DNA damage sites (6, 7). pol II, the only SOS pol having a 3'-exonuclease proofreading activity, plays an instrumental role during "error-free" replication-restart (8, 9). pol II is induced almost immediately (~30 s) after SOS induction (8), whereas the delayed appearance of pol V, ~30-45 min post-SOS induction (10), allows mutation-free repair processes to occur prior to error-prone translesion synthesis (8, 9).

In contrast to pol V, less is known about the cellular functions of pol IV (3). Although pol IV is not required for SOS lesion-targeted UV mutagenesis, it does cause untargeted mutations on bacteriophage , and its overexpression results in an increase of untargeted frameshift and transversion mutations on F' and chromosomal DNA (11, 12). pol IV copies DNA lesions of non-UV origin, for example, benzo(a)pyrene-guanine adducts (13, 14) and 4-nitroquinoline N-oxide (15). pols II and V are present in the cell at ~50 (16) and 15 (17) molecules/cell, respectively, in the absence of SOS induction. In contrast, constitutive levels of pol IV are ~250 molecules/cell (15).

The elevated level of expression in the absence of DNA damage implies a role for pol IV during normal DNA synthesis. For example, pol IV might help in rescuing stalled replication forks. Replication forks are thought to collapse in the absence of DNA damage perhaps as often as once per round of replication (18) and might result from mismatched or misaligned primer ends refractory to proofreading by pol III (19). By interacting with the -processivity clamp (7, 20), pol IV might displace pol III core to extend aberrant primer ends (21). Another role for pol IV was revealed by genetic assays showing that it is primarily responsible for increased mutability in starving non-dividing cells (22, 23), a phenomenon referred to as "adaptive mutation." It has recently been shown that stationary phase E. coli lacking in one or more of the SOS polymerases are less fit when grown in the presence of wild type cells (24).

Given the paucity of information regarding the roles of pol IV in vivo, it is important to investigate the biochemical properties of this atypical polymerase. In this paper, we have investigated the following: (i) the mutational spectrum for pol IV in the absence or presence of / processivity complex; (ii) nucleotide incorporation fidelity and mismatch extension efficiency of pol IV on undamaged DNA; (iii) the biochemical mechanism responsible for the favored generation of 1 frameshift mutations. To examine the mechanism governing pol IV-generated 1 frameshifts, we have measured the change in fluorescence intensity of a template 2-aminopurine while undergoing replication. Based on a crystal structure of Sulfolubus solfataricus Dpo4, a Y family homolog of E. coli pol IV, it has been suggested that 1 frameshifts occur when an incoming dNTP bound at the polymerase-active site is incorporated opposite a complementary downstream template base on a misaligned p/t DNA (25, 26), by a model which we have referred to as "dNTP-stabilized misalignment" (19, 27).

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- Oligonucleotides were synthesized on an Applied Biosystems 392 DNA/RNA synthesizer and purified on a denaturing 16% polyacrylamide gel. Tetrahydrofuran phosphoramidite was purchased from Glenn Research. Primers were labeled with ³²P using T4 polynucleotide kinase (U. S. Biochemical Corp.). Ultrapure deoxynucleoside triphosphates and ATP were purchased from Amersham Biosciences, and [-³²P]ATP was purchased from ICN. Single-stranded M13 DNA was purified as described by Sambrook et al. (28).

Buffers-- Reaction buffer (1×) consists of 20 mM Tris, pH 7.5, 8 mM MgCl₂, 5 mM DTT, 0.1 mM EDTA, 25 mM sodium glutamate, 40 µg/ml bovine serum albumin, and 4% glycerol. Stop solution is 95% formamide, 30 mM EDTA, and 0.25% bromphenol blue.

Enzymes-- Maltose-binding protein tagged pol IV (MBP-pol IV), SSB, - and -complex were purified as described previously (7). The pET16b (Novagen) was used to express histidine-tagged (His tag) pol IV and native pol IV. The entire dinB-coding sequence was amplified by PCR from E. coli genomic DNA by Pfu DNA polymerase. The resulting PCR products were cloned into NdeI and BamHI or NcoI and BamHI sites of pET16b to generate expression constructs for His tag and native pol IV, respectively. His tag pol IV was overexpressed in BL21(DE3)/pLysS at 30 °C and purified by nickel affinity column followed by gel filtration on Superdex-75 column similar to a protocol described by Wagner et al. (21).

Native pol IV protein was overproduced in E. coli strain Turner/pLysS (Novagen) and grown in LB medium in the presence of 20 µg/ml chloramphenicol and 100 µg/ml ampicillin. Expression of pol IV was induced by adding isopropyl--D-1-thiogalactopyranoside to 1 mM and growing for 3-4 h at 30 °C. Cells (~20 g) were collected by centrifugation and were resuspended in 50 ml of lysis buffer (50 mM Tris-HCl, pH 7.5, 1 M NaCl, 10% sucrose, 2 mM DTT, 1 mM EDTA, and protease inhibitor mixtures). Cells were lysed using freshly prepared lysozyme (2 mg/ml), and the clarified extract was collected. pol IV was then precipitated by ammonium sulfate added to 30% saturation (w/v) and stirring for 10 min. The precipitate was subjected to gel filtration in GF buffer (20 mM Tris-HCl, pH 7.5, 1 M NaCl, 0.1 mM EDTA, 1 mM DTT) using an Amersham Biosciences Superdex-75 XK-26/60 gel filtration column. pol IV fractions were pooled, dialyzed overnight in PC buffer (20 mM Tris-HCl, pH 7.5, 0.1 mM EDTA 1 mM DTT, 10% glycerol), containing 200 mM NaCl, and then subjected to phosphocellulose chromatography (P-11, Whatman). After washing extensively with PC buffer + 200 mM NaCl, pol IV was eluted with a linear gradient of 200-500 mM NaCl. Fractions containing native pol IV (>99% pure) were pooled and stored at 70 °C.

Gap-filling Fidelity Assays-- Fidelity of DNA synthesis by pol IV was measured using an M13mp2 DNA substrate with a single-stranded gap containing a portion of the lacZ -complementation gene target constructed as described previously (29). Gap-filling synthesis reactions (25-µl volume) were carried out in 1× reaction buffer containing 50 fmol of gapped DNA, 5 pmol of His tag pol IV or native pol IV, and 1 mM each of the four dNTP substrates. The reactions were supplemented with 500 µM ATP when - (200 fmol) and -complex (50 fmol) were present. Reaction mixtures were incubated at 37 °C for 30 min, quenched by adding 2 µl of 200 mM EDTA, and analyzed as described (29).

Gel Fidelity Assays-- Mispair formation and mispair extension fidelity were determined using a gel fidelity assay (30). Four templates and five primers were used. The four 80-mer templates had the following sequence: 5'-TGAGCGTTTTTCCTGTTGCAATGGCNGGCGGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCT-3', where N is A, C, G, or T for each template, respectively. The primer used for the mispair formation assay is 29-mer complementary to the template such that on annealing its 3'-end is adjacent to base N of the template. The primers used for the mispair extension assay are 30-mers identical in sequence to the mispair formation primer with the addition of a different base to the 3'-end of each primer. Annealing a primer to each of the four templates results in one complementary primer template complex and three with a 3'-terminal mismatch.

Primer extension reactions were in reaction buffer using 4 nM ³²P-labeled primer-template, 600 nM SSB, 80 nM -complex, 20 nM complex, 400 µM ATP, 2 nM of either His-tagged or native pol IV, and dNTP of varying concentrations in a total volume of 10 µl. Reactions were quenched by the addition of 20 µl of stop solution. Apparent V_max and K_m values were determined as described (31). The nucleotide misincorporation efficiency (f_inc) and intrinsic mismatch extension (f) are expressed as ratios of apparent second-order rate constants (31-34) (V_max/K_m)_w/(V_max/K_m)_r, where w and r refer to mispairs (wrong) and correct pairs (right) for either incorporation or extension.

Processivity Measurement-- A ³²P-labeled 30-mer primer was annealed to ssM13mp2 DNA and extended by each of three versions of pol IV, MBP-tagged, His-tagged, and native. Each reaction was performed in the presence or absence of the processivity proteins - and complex. Reactions were run at 37 °C in 1× reaction buffer containing 10 nM p/t DNA, 200 µM each of dNTPs, and varying concentrations of pol IV (0.62, 1.25, 2.5, 5, and 10 nM). SSB (1 µM), - (40 nM), and complex (10 nM), when present, were preincubated with p/t DNA and 500 µM ATP for 3 min before adding dNTP and polymerase. Reactions were quenched after 10 min at 37 °C with stop solution and resolved by 12% PAGE. Average processivity is defined as the number of nucleotides added divided by the number of primers extended.

Fluorescence Assay Measuring Extrahelical Template 2-Aminopurine-- Fluorescence measurements were carried out on a QuantaMaster (QM-1) Fluorometer (Photon Technology International) in which monochromators were used to select the wavelengths for excitation (310 nm) and emission (370 nm) with a bandpass of 6 nm. Two 80-nucleotide templates with 2-aminopurine (2AP) were designed as follows: 5'-TGAGCGTTTTTCCTGTTGCAATGX(2AP)AAAAAGTAATATTGTTCTGGATATTACCAGCAAGGCCGATAGTTTGAGTTCTTCT-3' where X is C or G. A 30-nt primer was annealed in the center of each template to form p/t DNA. A cuvette containing reaction buffer (20 mM Tris-Cl, pH 7.5, 50 mM NaCl, 4 mM MgCl₂) was placed in a fluorometer and scanned as a function of time. An aliquot of p/t DNA (2 µl) was added to the cuvette followed by pol IV (4 µl). A dNTP (10 µl) was then added as either dTTP, dGTP, or dCTP. Emission was monitored for ~1 min prior to the addition of each component. Final concentrations were 200 nM p/t DNA, 1 µM pol IV, and 1 mM dNTP in a final volume of 200 µl.

Translesion Synthesis-- 120-nt templates were synthesized either with or without an abasic site (tetrahydrofuran) located at a position 63 or 51 from the 5'-end of the template. p/t DNA substrates for lesion bypass were constructed by annealing a ³²P-labeled 30-mer primer (complementary to positions 62-91) to the template. Translesion synthesis reactions (10 µl) were carried out at 37 °C in 1× buffer containing 10 nM p/t DNA, 100 nM native pol IV, and 200 µM each of the four dNTP substrates. SSB (250 nM), - (200 nM), and -complex (50 nM) were added as indicated. When - and -complex were present, the reactions were supplemented with 500 µM ATP. The reactions were quenched after 5 min, and products were separated on 12% PAGE and visualized by PhosphorImaging.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

pol IV Mutational Spectrum-- The types of errors catalyzed by pol IV were measured using an in vitro LacZ complementation assay that scores base substitution, addition, and deletion errors within a 407-nucleotide gapped region of M13mp2 DNA (29). Because it has become common practice to purify proteins containing N- or C-terminal affinity tags, it is important to determine the extent to which specific protein interactions and functions might be impaired. A side-by-side comparison of MBP- and His-tagged pol IV with native pol IV ± / show that His-tagged and native pol IV have similar average processivities, ~50 nt in the presence of the accessory proteins. In contrast, MBP-tagged pol IV has an average processivity of only about 6-8 nt (Fig. 1). The various forms of pol IV catalyze distributive synthesis in the absence of / (Fig. 1) (7, 20, 21). The average processivity of native pol IV with / is about 6-fold lower than reported previously (20), possibly because of differences in template sequences. Despite its modest average processivity, native pol IV adds as many as 500 nt in a single binding event (Fig. 1). Although the interaction between pol IV and / appears to be unaffected by the presence of an N-terminal His tag, the processivity is severely impacted when the enzyme is encumbered with a 42-kDa N-terminal MBP tag (Fig. 1).

View larger version (95K): [in this window] [in a new window]   Fig. 1.   A comparison of the processivity of native pol IV with MBP- and His-tagged polymerases in the presence and absence of / processivity subunits. The processivity of native pol IV and pol IV containing N-terminal MBP or His tag was measured in either the presence or absence of  sliding clamp and  clamp loading complex, using a 32P-labeled 30-mer primer annealed to a circular ssM13mp2 DNA. Reactions contained 10 nM p/t DNA substrate, 200 µM of each of the four dNTP and, where indicated, 80 nM -, 20 nM complex and 500 µM ATP. The concentrations of pol IV used in individual reactions were 0.63, 1.25, 2.5, 5, and 10 nM.

Analyses of the mutational spectra were carried out using native pol IV ± / and His-tagged pol IV (Fig. 2). The lacZ average mutant frequencies and mutation distributions were essentially indistinguishable for each form of the enzyme (Fig. 2 and Table I). The average mutation frequencies are 3.0 × 10² and 3.6 × 10² for native pol IV in the presence and absence of /, respectively, and 3.7 × 10² for His-tagged pol IV without / (Table I). Both the native and His-tagged proteins were able to fill the 407-nt gap completely with or without / (data not shown).

View larger version (25K): [in this window] [in a new window]   Fig. 2.   pol IV base substitution and frameshift mutation spectra. A, spectrum of base substitution and single base deletion and addition mutations. B, spectrum of 2-, 3-, 4- and 5-base deletion mutations. A gapped DNA template containing a lacZ mutational target gene was copied with either native or His-tagged pol IV. A, the sequence of the mutational target is shown with base substitutions indicated as the appropriate base above the target sequence, single base deletions indicated as  below the sequence, and additions as + followed by the added base above the sequence. The mutations are color-coded where black refers to mutations generated by His tag pol IV, blue refers to native pol IV, and red to native pol IV + / processivity protein subunits. 375 independently isolated lacZ mutants were sequenced.

View this table: [in this window] [in a new window]   Table I Mutation frequency of pol IV when copying the LacZ target sequence in vitro

Mutational spectra were obtained by purifying and sequencing DNA obtained from randomly selected independent lacZa mutants (light blue or colorless plaques), see under "Experimental Procedures." A comparison of the mutation spectra of His tag pol IV and native pol IV ± /, reveals a similar pattern and distribution of mutations (Table I and Fig. 2). We have therefore combined the data from all of the experiments to arrive at a single pol IV mutational spectrum (Table II and Fig. 2, A and B).

View this table: [in this window] [in a new window]   Table II Base substitutions and frameshifts generated by pol IV when copying the LacZ target sequence

The average frameshift and base substitution error rates are 2.1 × 10⁴ and 5.1 × 10⁵, respectively (Table I). Frameshifts dominate the spectrum (~80%) including a sizable number of 2 deletions (Table II and Fig. 2B). A small but not insignificant number of 3, 4, and 5 deletions are also present (Fig. 2B). Base substitutions compose ~17% of the spectrum, and all are represented, except for A  T transversions. T  G transversions (1.1 × 10⁴) occur most frequently with the other transitions and transversions having frequencies between about 7 × 10⁵ and 2.5 × 10⁶ (Table II). A majority of base substitutions (~69%) occur at template T sites. The overall mutational specificities are consistent with mutational data when pol IV is overexpressed in vivo (12).

An analysis of the frameshift pattern reveals that although single base deletions are most prevalent (81%), there is an unusually large fraction of 2-base deletions (15%) (Table II and Fig. 2B). Two single base insertions were also detected. The distribution of 1 frameshifts favors some homopolymeric runs depending on the number of identical bases in the run (Fig. 2A). The rate of 1 frameshifts in a non-homopolymeric run is 6.2 × 10⁵. Homopolymeric runs of four or five bases are the strongest hotspots for 1 deletions by more than an order of magnitude. The number of 4- and 5-base runs in the lacZ target sequence are 3 and 1, respectively. The rates in runs of 2, 3, and 4 or more bases are 2.9 × 10⁴, 7.5 × 10⁵,and 1.1 × 10³, respectively. Nine of the 29 2-base runs have elevated 1 frameshift rates, whereas none of the nine 3-base runs are hotspots for 1 frameshifts (Fig. 2A). If classical Streisinger slippage, in which primer and template strands slip relative to each in homopolymeric runs (35), were the principal mechanism for generating 1 deletions, then one would expect to observe more and not less mutations in homopolymeric runs of 3 compared with 2.

One common characteristic of sequences in which 1 frameshifts are observed is the presence of an adjacent template 5'-G whether or not there is a homopolymeric run. Although G is not over-represented in the lacZ target sequence, 60% of all 1 frameshifts have an adjacent 5'-G. Two of the three 4-base runs have adjacent 5'-Gs, and these are the strongest hotspots.

There were a significant number of 2 frameshift mutations, along with 3-, 4-, and 5-consecutive base deletions. As with the single base deletions, pyrimidines were preferentially deleted. Of a total of 46 observed 2 frameshifts, 34 (74%) are deletions of two consecutive pyrimidine bases. In contrast, only three 2 frameshifts involve deletions of two consecutive purines.

pol IV-generated 1 Frameshifts by dNTP-stabilized Misalignment-- In addition to the Streisinger slippage mechanism (Fig. 3A, bottom panel), there are two other mechanisms that can lead to 1 deletions, dNTP-stabilized misalignment (19, 27) (Fig. 3A, top panel) and "misinsertion misalignment" (36, 37) (Fig. 3A, middle panel). A misinsertion misalignment occurs when a nucleotide misincorporation is followed by p/t DNA slippage, i.e. repositioning of the misincorporated nucleotide opposite a complementary downstream template base (37) (Fig. 3A, middle panel). However, a situation leading to the same structural and mutational end point takes place when an incoming dNTP bound at the polymerase active site is incorporated opposite a complementary downstream template base on a misaligned p/t DNA (19) (Fig. 3A, top panel).

View larger version (18K): [in this window] [in a new window]   Fig. 3.   The change in fluorescence intensity of 2-aminopurine undergoing replication by pol IV. A, three models for generation of 1 frameshift mutations. B, traces showing changes in 2AP fluorescence intensity accompanying the incorporation of dGMP (upper trace), inability to incorporate dCMP (middle trace), and the incorporation of dTMP (lower trace). Inset panel, the absence of a change in 2AP fluorescence intensity showing that dGMP can no longer be incorporated when G replaces C downstream of 2AP.

We have obtained direct spectroscopic evidence supporting the dNTP-stabilized misalignment model. Incorporation of dTMP opposite the fluorescent base analog 2AP is accompanied by a quenching of the fluorescence signal (Fig. 3B, lower trace). A reduction in 2AP fluorescence intensity occurs when 2AP stacks within the helical plane while forming a W-C base pair with T (38, 39). In contrast, an increase in fluorescence occurs when 2AP is extrahelical (40, 41), i.e. when 2AP is "flipped" out of the helical plane. The incorporation of dGMP opposite template C, located immediately downstream from 2AP, results in an increase in fluorescence that is caused by a reduction in base stacking when 2AP is extrahelical (Fig. 3B, upper trace).

There is no change in fluorescence intensity when the downstream template base is changed from C to G, because the incoming dGTP cannot pair opposite G and can therefore no longer stabilize the misaligned structure (Fig. 3B, inset panel). The inability to incorporate C opposite 2AP also results in no change in the fluorescence intensity (Fig. 3B, middle trace). The incorporation of G opposite C cannot be attributed to a slippage of a template A upstream of 2AP (i.e. Streisinger slippage, Fig. 3A, bottom panel), because realignment of 2AP opposite T at the 3'-primer end would result in a quench rather than increase in fluorescence. The same experiment performed with E. coli pol I Klenow fragment lacking 3'-exonuclease activity shows no evidence for 2AP flipping (data not shown).

A hallmark of the dNTP-stabilized misalignment mechanism is that apparent K_m,dNTP values are closer in magnitude to K_m,dNTP for correct nucleotide incorporation on properly aligned p/t DNA, in contrast to much larger K_m,dNTP values associated with nucleotide misincorporations (19, 27). The apparent K_m for incorporation of dTMP opposite 2AP is 264 ± 183 µM (corresponding to Fig. 3B, lower trace) whereas the K_m for incorporation of dGMP opposite C on misaligned p/t DNA, with 2AP out of the helical plane, is 740 ± 474 µM (corresponding to Fig. 3B, upper trace). In contrast, the K_m values for incorporation of dCMP or dGMP directly opposite 2AP (corresponding to Fig. 3B, middle trace and 3B, inset, respectively) are >3 mM. In the latter experiments, nucleotide misincorporation rates measured as a function of dCTP or dGTP concentration remained linear at the highest substrate concentrations (~3 mM) that did not inhibit pol IV synthesis.

pol IV-catalyzed Misincorporation Efficiencies-- The gap-filling analysis (Fig. 2) shows that small frameshifts account for roughly 80% of pol IV errors but that the remaining ~20% are divided among all possible base substitutions, except for A to T transversions that were not observed (Table II). T  C transitions and either T  G or T  A transversions are the most prevalent base substitution (Table II). By using a steady-state gel fidelity assay (see "Experimental Procedures"), we measured nucleotide misincorporation efficiencies, f_inc, for each transition and transversion mutagenic pathway catalyzed by either native or His-tagged pol IV in the presence of /-complex and SSB (Table III).

View this table: [in this window] [in a new window]   Table III pol IV nucleotide misincorporation efficiency, finc Kinetics of nucleotide incorporation by pol IV in the presence of / and SSB were measured using a standing start primer extension assay. The velocity of nucleotide addition opposite a template base is measured at varying concentrations of dNTP substrates (see "Experimental Procedures"). Reactions are run for each of the 16 canonical base pairs, and the nucleotide incorporation rate is plotted as a function of dNTP concentration. A nonlinear least squares fit of the plots to a rectangular hyperbola is used to determine the kinetic parameters, apparent Km and Vmax. The apparent Vmax/Km is a measure of reaction efficiency, and dividing the efficiency of formation of a mispair by that of a correct pair yields the misincorporation efficiency (finc). The standard errors for finc are approximately ±30%.

For native pol IV, nucleotide misincorporation efficiencies are typically larger at pyrimidine template sites (Table III and Fig. 4). In contrast, the misincorporation efficiencies at purine template sites are ~5-10-fold lower (Table III and Fig. 4). A clustering of f_inc values are observed for pyrimidine and for purine template bases, with the only outlier being the T·dCMP mispair (Fig. 4). The only mutation absent from the gap-filling spectrum (Table II) is an A  T transversion which has A·A as a base mispaired intermediate. In agreement, the incorporation of dAMP opposite A, f_inc (A·A) = 2.7 × 10⁵, is the least efficient mismatch catalyzed by pol IV (Fig. 4 and Table III). These results are consistent with the mutational spectrum derived from the gap-filling mutational assay (Table II).

View larger version (11K): [in this window] [in a new window]   Fig. 4.   A plot of pol IV misincorporation efficiency, finc, versus intrinsic mismatch extension efficiency, f. Nucleotide misincorporation and mismatch extension data were obtained for pol IV + / using a gel kinetic fidelity assay, see "Experimental Procedures." The misincorporation data are from Table III, and the mismatch extension data are from Table IV. The data points shown above the line indicate lower values for the efficiency misincorporation compared with mismatch extension; data falling below the line indicate higher values for misincorporation compared with mismatch extension. The misincorporation efficiency finc is the reciprocal of the polymerase fidelity.

Misincorporations taking place via dNTP-stabilized misalignments occur most readily in AT-rich DNA (Fig. 3) but tend to be inhibited in more stable surroundings (data not shown). The template target site N used to measure misincorporation kinetics is embedded in a GC-rich region, 5' ... GGCNGGCGG ... 3' (see "Experimental Procedures"). Consequently, there is no increase in dGMP·N misincorporations relative to other base substitution errors (Table III). However, the 3-fold larger dGMP·G misincorporation efficiency (f_inc = 3.2 × 10⁴) compared with dTMP·G and dAMP·T (f_inc = 1.1 × 10⁴) (Table III) is an indication that Streisinger slippage may be occurring.

The presence of an N-terminal His tag does not appear to exert an undue influence on pol IV-catalyzed incorporation efficiencies for 9 of the 12 mispairs (Table III). The exceptions are dAMP·A, dTMP·C, and dCMP·T where His-tagged pol IV exhibits 34-, 25-, and 20-fold increased error frequencies, respectively.

pol IV-catalyzed Mismatch Extension Efficiencies-- It has been speculated that pol IV might play a role in relieving stalled replication forks on undamaged DNA (18) by extending mismatches that are refractory to proofreading by replicative pol III core (19). In support of this possibility, of the 12 possible natural base mismatches, 9 are extended by native pol IV with efficiencies exceeding ~10⁴ (Table IV and Fig. 4). The most easily formed mismatch, f_inc (C·dAMP) = 1.7 × 10³ (Table III), is also extended with high efficiency, f (C·A-3'-primer end) = 8.6 × 10⁴ (Table IV). Two other easily formed mispairs are also extended with efficiencies approaching 10³, A·C-3'-primer end and T·T (Fig. 4). However, the T·C mismatch, which is also extended with an efficiency ~10³, is one of the most difficult mismatches to make, f_inc (T·dCMP) = 5.5 × 10⁵ (Table III and Fig. 4).

View this table: [in this window] [in a new window]   Table IV pol IV mismatch extension efficiency, f Intrinsic mismatch extension efficiencies (f) were calculated by dividing the efficiency of extension of a primer with a mispaired 3'-end, apparent (Vmax/Km) value, by that of a correctly paired primer (see "Experimental Procedures"). The standard errors for f are approximately ±30%.

Three of the four Puo·Puo transversion mispaired intermediates, A·G, G·A, and G·G, are extended with lowest efficiencies, f <4 × 10⁵. The A·A mismatch, although extended somewhat more efficiently (f <1.2 × 10⁴), is the least probable to be formed (f_inc = 1.8 × 10⁵) (Fig. 4). The latter observation reflects the absence of A  T transversion in the lacZ mutational spectrum (Table II). The other three improbable Puo·Puo transversions appear just once each in the spectrum out of 66 base substitutions scored (Table II). In contrast, the two most prevalent transversions in the spectrum, T  G (19/66) and T  A (11/16), involve the Pyd·Pyd mispaired intermediates, T·dCMP and T·dTMP, respectively. The T·dTMP intermediate is both formed and extended with high efficiency ~10³, whereas the T·dCMP intermediate is formed with an efficiency of ~10⁴, but once formed is readily extended ~10³ (Fig. 4).

One transition, T  C, appears multiple times in the lacZ mutational spectrum (16/66). The T·dGMP mispaired intermediate is both formed and extended efficiently, ~3 to 5 × 10⁴ (Tables II and III and Fig. 4). The presence of an N-terminal His tag appears to have a small effect on mismatch extension efficiencies, somewhat less than its effect on misincorporation efficiencies. The most notable perturbations are an ~10-fold increase in mismatch extension efficiencies for bases mispaired opposite template A, a 2-5-fold increase for mispairs opposite G, and an ~2-3-fold reduction in mispair extensions opposite template C.

The general conclusion is that pol IV appears to extend a significant fraction of mispaired intermediates with relatively high efficiency (>10⁴). The kinetic data are in overall agreement with the mutational spectrum. Thus, mismatches that are both formed and extended easily appear multiple times as independently scored mutations in the lacZ mutational spectrum. Mismatches that are both poorly formed and extended are either not observed (A  T transversions) or are only sparsely represented in the spectrum.

pol IV-catalyzed Abasic Site Translesion Synthesis-- An examination of the mutational spectrum shows that pol IV is heavily prone to make short deletion mutations on undamaged DNA templates (Fig. 2). The "flipping" of a template 2AP out of the helical plane (Fig. 3) provides a likely mechanism to explain the ease with which 1 frameshifts occur. However, since pol IV also appears to be involved in copying damaged (13, 14) as well as undamaged DNA (11, 22-24, 42), we have investigated the products formed when copying a simple form of template damage, a non-instructive abasic moiety (Fig. 5).

View larger version (99K): [in this window] [in a new window]   Fig. 5.   pol IV generates deletions during abasic site translesion synthesis. A, pol IV-catalyzed synthesis on undamaged DNA in the presence or absence of / and SSB. B, pol IV synthesis as in A on a template containing an abasic moiety 1 nt from the 3'-primer end (63 nt from the 5'-end of the template strand). C, pol IV synthesis as in A on a template containing an abasic moiety 13 nt from the 3'-primer end (51 nt from the 5'-end of the template strand). Reactions were carried out using a 32P-labeled 30-mer primer annealed to 120-mer synthetic template (10 nM p/t DNA). Each reaction contained native pol IV (100 nM), the four dNTP substrates (200 µM each). SSB (250 nM), - (200 nM) and -complex (50 nM) were added as indicated. X indicates the location of the abasic moiety.

For the lesion-free control template, pol IV in the absence of / extends 61 bases, stopping two bases short of the end of the template strand (Fig. 5A, 1st lane). The addition of SSB permits the addition of one more base (Fig. 5A, 2nd lane). A full-length product 63 bases long is synthesized in the presence of / and does not require the presence of SSB (Fig. 5A, 3rd and 4th lanes). For the templates with an abasic site, the products of the extension reaction are 1 base shorter compared with those of the normal template (Fig. 5, B and C), 60 added bases for pol IV alone and 62 added bases for pol IV + / (Fig. 5, B and C). pol IV makes shorter products in both sequence contexts 5'-GGX-3' (Fig. 5B) and 5'-TTX-3' (Fig. 5C). Therefore, when copying an abasic site, pol IV does not appear to insert a base opposite the lesion but instead skips past the abasic site to generate a single base deletion via dNTP-stabilized misalignment, as has been observed previously with eukaryotic pol  but not with pol  (27).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Three DNA polymerases are induced as part of the SOS regulon in response to DNA damage in E. coli. pol V appears to play a predominant role in SOS mutagenesis by generating mutations targeted directly to DNA template lesions (7, 43). pol IV, on the other hand, is believed responsible for generating untargeted mutations (11, 22-24, 42). pol II, a much higher fidelity polymerase (5), has been found to play a pivotal role during error-free replication restart (8, 9). This paper is focused on determining the fidelity properties of pol IV when copying undamaged DNA and comparing the biochemical properties determined in vitro with mutation spectra. We have investigated the mechanism of pol IV-generated 1 frameshifts with relation to unusual structural features of a pol IV homolog (Dpo4 from the archeon S. solfataricus), which also makes 1 frameshifts avidly (25, 26).

A dNTP-stabilized Misalignment Model to Account for 1 Frameshifts-- A characteristic property of pol IV is its ability to generate small deletion mutations on presumably undamaged DNA in vivo (42). In non-dividing cells, pol IV is responsible for causing about 80% of the adaptive frameshift mutations concentrated within homopolymeric runs (22, 23). There are numerous different types of slipped p/t DNA structures that can in principal lead to 1 frameshift mutations (36).

We have previously provided kinetic evidence supporting a particular type of misaligned DNA structure to explain single base deletions on damaged (27) and undamaged (19) DNA. This aberrant structure is characterized by having an incoming dNTP bound at the polymerase active site but which is not paired opposite the next available template position. Instead, the bound dNTP is misaligned opposite a template base immediately downstream from next template base (Fig. 3A, upper panel). We have coined the term dNTP-stabilized misalignment (27) to describe this particular molecular model, which can generate 1 frameshifts in either the presence or absence of homopolymeric template runs (19, 36).

Direct evidence supporting the dNTP-stabilized misalignment model as a molecular mechanism for pol IV-catalyzed 1 frameshifts is provided by the observation of a "flipped out" template 2AP occurring when dGMP is incorporated opposite a downstream template C (Fig. 3B). There is a substantial increase in 2AP fluorescence intensity when the analog is no longer stacked within a helix (Fig. 3B, upper trace) (40, 41). In contrast to the increase in fluorescence when C is located to the 5'-side of 2AP, there is no change in fluorescence when the G replaces C downstream from 2AP (Fig. 3B, inset). As expected, the fluorescence intensity decreases when dTMP is incorporated directly opposite 2AP on a normally aligned p/t DNA (Fig. 3B, lower trace). The fluorescence intensity remains unchanged when dCMP fails to be incorporated (Fig. 3B, middle trace).

We have shown previously that the apparent K_m,dNTP values that characterize "correct" nucleotide incorporation on misaligned p/t DNA ends (e.g. incorporation of dGMP opposite C, Fig. 3A, upper panel) tend to be much closer to those corresponding to formation of standard W-C base pairs than to the typically much higher values for direct misincorporations (e.g. misincorporation of dGMP opposite 2AP, followed by slippage to align dGMP opposite C, Fig. 3A, middle panel). In agreement with our earlier observations, an apparent K_m ~750 µM for incorporation of dGMP opposite C on a misaligned p/t DNA is closer to the value for the correct incorporation of dTMP opposite 2AP on a properly aligned p/t DNA (K_m ~250 µM), compared with the misincorporation of dGMP opposite 2AP on a properly aligned DNA molecule, which has a K_m value exceeding 3 mM.

The structure of the S. solfataricus Dpo4 (a homolog of pol IV) ternary complex reveals limited and nonspecific contacts with the replicating bases in the active site (25). Water might not be effectively excluded from the active site of these polymerases, thus excluding an important source of discrimination against mismatched base pairs (44, 45). The type II crystals (25) of the Dpo4 ternary complex show that two template bases occupy the active site simultaneously with the incoming nucleotide (ddGTP) bypassing an extrahelical template base (G), aligning instead directly opposite the second template base (C). The structural data are supported mechanistically by our spectroscopic data showing an extrahelical 2AP when pol IV incorporates dGMP opposite template C located immediately downstream of 2AP (Fig. 3B, upper trace; Fig. 3A, upper panel).

Relating pol IV Mutation Spectra to Fidelity-- Before it became known that dinB encoded a DNA polymerase (21), there was considerable evidence that the generation of small deletion mutations coincided with the overexpression of DinB protein (11). The biochemical data using a gap-filling lacZ forward mutational assay clearly illustrate the point that small deletions dominate the mutational spectrum by about a 4:1 margin over base substitutions (Fig. 2B and Table II). Single base deletions account for about 80% of the frameshifts observed, accompanied by a substantial number of 2 deletions (~15%).

According to the well documented Streisinger model (35), slippage of primer and template strands relative to each other in homopolymeric runs can result in frameshifts (Fig. 3A, bottom panel). A defining feature of the Streisinger slippage model is that the mutation frequency at homopolymeric runs increases with the length of the run, because larger runs produce increasingly more stable misaligned intermediates. The rates of pol IV-generated 1 frameshifts are as follows: 0.62 × 10⁴ in a non-run, 2.9 × 10⁴ in a 2-base run, 0.75 × 10⁴ in a 3-base run, and 11 × 10⁴ in runs of 4 or more bases (Table I and Fig. 2A). The error rate for the deletion of a base in a run of 4 or more identical bases is highest. However, the error rate for a 1 frameshift in a run of 3 bases is roughly equal to a non-run and is about 4 times lower than observed for a run of 2 bases. Thus, whereas the Streisinger template slippage mechanism might account for a subset of 1 frameshifts, it is unlikely to account for all of them. Instead, a sizable number of 1 deletions could be occurring by dNTP-stabilized misalignment or misinsertion misalignment mechanisms (Fig. 3A, top and middle panels). The dNTP-stabilized misalignment mechanism appears to explain a 1 deletion occurring when pol IV copies an abasic template lesion in vitro (Fig. 5). Similar properties have been observed with eukaryotic pol , but not with pol  (27).

A potentially significant point is that whereas several deletions of two or more bases occur in short 2-3-base homopolymeric runs, others decidedly do not (Fig. 2B). Given the surprisingly large fraction of 2-base deletions (15% of all frameshifts) that appear in the spectrum, we speculate that the active site of pol IV might also accommodate "looped out" template structures exceeding a single nucleotide, e.g. a slightly more elaborate version of the dNTP-stabilized misalignment mechanism.

The lacZ in vitro mutational spectrum (Fig. 2) is generally consistent with measurements performed in vivo for mutations in the cII gene of -phage when pol IV is overexpressed (12). Single base deletions constitute a large majority of the mutations observed in vivo (11, 12) and in vitro (21); (Fig. 2A and Table II); however, 2-base deletions (Fig. 2B and Table II) have not been observed in vivo. Perhaps the large distortion introduced by 2-base deletions favor their excision by one of the three proofreading-proficient polymerases in E. coli prior to extension by proofreading-deficient pol IV. Although decidedly in the minority, base substitutions nevertheless compose roughly 18% of the pol IV-generated mutations in vitro (Table II). T  G transversions and T  C transitions are the most frequent base substitutions found in vitro (Table II and Fig. 2A), in agreement with in vivo mutational data when pol IV is overexpressed (12). A  G and C  G mutations are also favored in vitro, as mirrored by in vivo data, suggesting that pol IV may tend to favor changes toward G:C pairs.

The obvious limitation when trying to compare in vitro fidelity data with in vivo mutational spectra stems from uncertainty surrounding the individual contributions made by the five polymerases in vivo. For example, an unknown number of untargeted mutations in vivo could result from pol IV replacing pol III core at stalled replication forks (18) and perhaps extending mismatched ends that are refractory to proofreading. The mutator effect emanating from overproduction of pol IV is dependent on its interaction with the  processivity clamp (46) which suggests that switching between the two pols can take place at the replication fork (3). Thus, pol III core-generated errors could be extended by pol IV. Our data suggest that pol IV is reasonably proficient at mismatch extension (f ~10³-10⁵, see Table IV and Fig. 4). However, pol IV appears to catalyze mismatch extension far less efficiently than its human counterpart, pol  (47), by factors of 10-1000-fold.

pol IV is regulated as part of the SOS response to DNA damage. However, it is nevertheless expressed at high constitutive levels because the LexA repressor binds poorly to the dinB/dinP operator consensus sequence (48). The uninduced level of expression of pol IV of about 250 molecules per cell (15) exceeds pol II, ~40-60 per cell (16), and pol V <15 per cell (17). Following SOS induction the levels of pols IV, II, and V are increased to about 2500, 350, and 200 molecules per cell, respectively (15-17).

Although geared to function when DNA is damaged, there is evidence supporting SOS polymerase function in the cell in the absence of overt SOS induction (22-24). It has been suggested that replication forks are likely to stall at least once per round of replication when cells are growing normally, in the absence of exogenous DNA damage (18). Perhaps pol IV is present at a high constitutive level for the express purpose of rescuing stalled replication forks on undamaged DNA, and in so doing may even be responsible for a generating a significant fraction of the spontaneous chromosomal mutations "blamed on" pol III. pol II, also present at an elevated constitutive level, may be engaged in rescuing replication forks that encounter an occasional spontaneously generated lesion, a so-called "cryptic" lesion (8, 9). The cell could, as a last resort, turn to pol V, whose constitutive level is barely detectable, to copy heavily damaged DNA requiring the induction of SOS.

Therefore, a degree of redundancy appears to be present permitting each SOS pol to play either a primary or back-up role when copying damaged or undamaged DNA in place of pol III (3). The elimination of one or any combination of the SOS pols results an inability of mutant cells to compete with wild type cells when growing in stationary cultures in the absence of exogenous DNA damage (24).

	FOOTNOTES

^* This work was supported by National Institutes of Health Grants GM42554 and GM21422.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ To whom correspondence should be addressed: Dept. of Biological Sciences, University of Southern California, SHS Rm. 172, University Park, Los Angeles, CA 90089-1340. Tel.: 213-740-5190; Fax: 213-740-8631; E-mail: mgoodman@mizar.usc.edu.

Published, JBC Papers in Press, July 3, 2002, DOI 10.1074/jbc.M204826200

	ABBREVIATIONS

The abbreviations used are: pol, DNA polymerase; MBP, maltose-binding protein; 2AP, 2-aminopurine; nt, nucleotide; DTT, dithiothreitol; SSB, single-stranded DNA-binding protein; p/t DNA, primer-template DNA.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES