HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 37, 34254-34263, September 13, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/37/34254    most recent M201659200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Sonoda, H. Articles by Arai, H. Search for Related Content PubMed PubMed Citation Articles by Sonoda, H. Articles by Arai, H. Social Bookmarking                      What's this?

A Novel Phosphatidic Acid-selective Phospholipase A₁ That Produces Lysophosphatidic Acid^*

Hirofumi Sonoda^§, Junken Aoki^¶, Tatsufumi Hiramatsu, Mayuko Ishida, Koji Bandoh, Yuki Nagai, Ryo Taguchi, Keizo Inoue^**, and Hiroyuki Arai

From the  Graduate School of Pharmaceutical Sciences, the University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033 and  Faculty of Pharmaceutical Sciences, Nagoya City University, 3-1 Tanabe-dori, Mizuho-ku, Nagoya, Aichi 467-0027, Japan

Received for publication, February 19, 2002, and in revised form, June 12, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Lysophosphatidic acid (LPA) is a lipid mediator with diverse biological properties, although its synthetic pathways have not been completely solved. We report the cloning and characterization of a novel phosphatidic acid (PA)-selective phospholipase A₁ (PLA₁) that produces 2-acyl-LPA. The PLA₁ was identified in the GenBank^TM data base as a close homologue of phosphatidylserine (PS)-specific PLA₁ (PS-PLA₁). When expressed in insect Sf9 cells, this enzyme was recovered from the Triton X-100-insoluble fraction and did not show any catalytic activity toward exogenously added phospholipid substrates. However, culture medium obtained from Sf9 cells expressing the enzyme was found to activate EDG7/LPA₃, a cellular receptor for 2-acyl-LPA. The activation of EDG7 was further enhanced when the cells were treated with phorbol ester or a bacterial phospholipase D, suggesting involvement of phospholipase D in the process. In the latter condition, an increased level of LPA, but not other lysophospholipids, was confirmed by mass spectrometry analyses. Expression of the enzyme is observed in several human tissues such as prostate, testis, ovary, pancreas, and especially platelets. These data show that the enzyme is a membrane-associated PA-selective PLA₁ and suggest that it has a role in LPA production.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Lysophosphatidic acid (1- or 2-acyl-lysophosphatidic acid; LPA)¹ is a lipid mediator with multiple biological functions (1-3). These include induction of platelet aggregation, smooth muscle contraction, and stimulation of cell proliferation. LPA also promotes specific responses of the cytoskeleton such as generation of actin stress fibers in fibroblasts or inhibition of neurite outgrowth in neuronal cells. LPA evokes its multiple effects through G-protein-coupled receptors that are specific to LPA (see below), with consequent activation of phospholipase C (PLC) and phospholipase D (PLD), Ca²⁺ mobilization, inhibition of adenylyl cyclase, activation of mitogen-activated protein kinase, and transcription of serum-response-element transcriptional reporter genes, such as c-fos. Recent studies (4, 5) have identified a new family of receptor genes for LPA. Members of this family include three G-protein-coupled receptors belonging to the endothelial differentiation gene (EDG) family, EDG2/LP_A1 (6), EDG4/LP_A2 (7), and EDG7/LP_A3 (8). These proteins may explain various cellular responses to LPA (6-8).

In contrast to the signal transduction mediated by LPA receptors, the molecular mechanisms for LPA production are poorly understood. LPA is produced both in biological fluids such as serum (9) and in various cells such as platelets (10, 11) and ovarian cancer cells (12, 13). In these latter studies, it was speculated that LPA is produced by phospholipase A₂ (PLA₂) from phosphatidic acid (PA) that is generated as a result of PLD activation (12, 13). Tokumura et al. (14) demonstrated that LPA is also produced in plasma from lysophosphatidylcholine (LPC) by the action of lysophospholipase D, which may account for the accumulation of LPA in aged plasma.

LPA, with various fatty acid species, has been detected in several biological systems. For example, human serum contains LPA with both saturated (16:0 and 18:0) and unsaturated (16:1, 18:1, 18:2, and 20:4) fatty acids (15). A similar LPA species was detected in human platelets (10). The activity of LPA has been shown to be modulated by the length, degree of unsaturation, and linkage to the glycerol backbone of the fatty acyl chain (16-21). Of particular interest is the detection of 2-linoleoyl-LPA in ascites from ovarian cancer patients, which may account for the increased ability of the ascites to activate the growth of ovarian cancer cell lines (22). We recently identified a novel LPA receptor, EDG7/LP_A3, which shows a relatively high affinity for 2-acyl-LPA with unsaturated fatty acid (8, 23). It is generally accepted that the sn-1 position of glycerophospholipids is occupied by saturated fatty acids, whereas the sn-2 position is occupied by unsaturated fatty acids. This suggests that phospholipase A₁ (PLA₁) as well as PLA₂ are involved in LPA production.

PLA₁ enzymes hydrolyze the sn-1 fatty acids from phospholipids. Although PLA₁ activities are detected in many tissues and cell lines, a limited number of PLA₁s have been purified and cloned. We have purified and cloned a cDNA for phosphatidylserine-specific PLA₁ (PS-PLA₁), a member of the lipase family, from the culture medium of activated rat platelets. PS-PLA₁ specifically hydrolyzes PS (24) and produces 2-acyl-lysophosphatidylserine (LPS), which is a lipid mediator for mast cells (25), T cells (26), and neural cells (27). We recently showed that PS-PLA₁ stimulates histamine release from rat peritoneal mast cells by hydrolyzing PS exposed on the surface of some cell types such as apoptotic cells and activated platelets (25). Accordingly we searched GenBank^TM for sequences similar to PS-PLA₁ and found one PS-PLA₁ homologue. Here we demonstrate that the PS-PLA₁ homologue is a membrane-associated PA-selective PLA₁ (mPA-PLA₁) that can produce a bioactive lysophospholipid, 2-acyl-LPA, by hydrolyzing PA generated by PLD.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- Phospholipase D from Actinomadura (28) was kindly donated by Meito Sangyo (Tokyo, Japan). 1-Oleoyl-LPA (18:1) and 1-[³H] oleoyl-LPA (18:1) were purchased from Avanti Polar Lipids Inc. (Alabaster, AL) and Amersham Biosciences, respectively. 2-Oleoyl-LPA (18:1) was prepared as described previously (23). Other chemicals were purchased from Wako Pure Chemical Industries (Osaka, Japan).

Clone Identification-- The EST clone 789124 (GenBank^TM accession number AA149791) was identified by searching the GenBank^TM EST data base using the amino acid sequence of rat PS-PLA₁. The cDNA clone was purchased from American Type Culture Collection (ATCC). The nucleotide sequence of the clone was determined by DNA sequencing using an ABI PRISM 377 DNA sequencer. We also amplified the cDNA of mPA-PLA₁ (nPLA₁) by reverse transcription (RT)-PCR using human colon-derived total RNA (see below). The nucleotide sequence data reported in this paper have been submitted to the GenBank^TM data base under the accession number AY036912 for human mPA-PLA₁.

Expression of mPA-PLA₁ in Sf9 Cells-- The DNA fragment covering the coding region of mPA-PLA₁ (EcoRI-HindIII fragment) was subcloned into the EcoRI and HindIII sites of pFASTBAC1 expression vector (Invitrogen) to generate a donor plasmid. Recombinant viruses were prepared using the Bac-to-Bac Baculovirus Expression System (Invitrogen) according to the manufacturer's protocol. The resulting recombinant baculovirus was used to infect Sf9 cells. Sf9 insect cells were grown in serum-free EX-CELL 420 insect cell medium (Nichirei, Tokyo, Japan) at 27 °C. For infection, Sf9 cells were mixed with recombinant or wild-type Autographa californica nuclear polyhedrosis virus to produce a multiplicity of infection of 10, and the infected cells were further cultured for 48 or 72 h at 27 °C.

PLA₁ Assay-- Sf9 cells were harvested 72 h after baculovirus infection. The cells (1 × 10⁷ cells/ml) were suspended in phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 8.1 mM Na₂HPO₄12H₂O, 1.5 mM KH₂PO₄) and homogenized using a Potter-Elvehjem homogenizer. The supernatant obtained by centrifugation of the homogenate at 190 × g for 10 min was centrifuged at 100,000 × g for 60 min, and the resulting pellet was used as the "membrane fraction." Dioleoyl-PA, dioleoyl-PS, dioleoyl-phosphatidylethanolamine (dioleoyl-PE), and dioleoyl-phosphatidylcholine (dioleoyl-PC), containing a ¹⁴C-labeled fatty acid at sn-1 position, were prepared as described previously (24). The PA, PS, PE, or PC (40 µM each) were incubated at 37 °C for 30 min with membrane fraction prepared from mPA-PLA₁-expressing cells (100 µg of protein) in 100 mM Tris-HCl (pH 7.5) with 4 mM CaCl₂. The fatty acid liberated was extracted by the modified Dole's method, and radioactivity was measured with a scintillation counter as described previously (24).

Evaluation of EDG7 Activation-- Evaluation of EDG7 activation was done by Ca²⁺ assays using EDG7-expressing Sf9 cells (Sf9-EDG7 cells) as described (23). 48 h after EDG7-baculovirus infection, the cells were loaded with 2 mM Fura-2 acetoxymethyl ester (Fura-2 AM; Molecular Probes Inc., Eugene, OR) for 45 min. Free Fura-2 AM was washed out, and the cells were resuspended in MBS (10 mM NaCl, 60 mM KCl, 17 mM MgCl₂, 10 mM CaCl₂, 110 mM sucrose, 4 mM glucose, 0.1% fatty acid-free BSA (Sigma), and 10 mM MES (pH 6.2)) to produce a concentration of 10⁶ cells/ml. To examine the activity of LPA, the measurement of the ratio of emission wavelength of 500 nm by excitation wavelengths at 340 and 380 nm was performed in quartz cuvettes (total volume 1000 µl) using a CAF-110 spectrofluorometer (Japan Spectroscopy, Inc., Tokyo, Japan) or in 96 wells (total volume 200 µl) using an ARGUS-50/CA image analysis system (Hamamatsu Photonics K.K., Hamamatsu, Japan).

Exogenous PLD Treatment-- Sf9 cells were harvested 72 h after baculovirus infection and suspended in MBS. Then PLD from Actinomadura was added exogenously to the suspension to a final concentration of 0.25 units/ml, and the mixture was incubated for 30 min at 27 °C. After removing the cells by centrifugation, the supernatant was used as "conditioned medium."

Lipid Preparation-- Phospholipids were extracted by the method of Bligh and Dyer in acidic condition (lower the pH to 3.0 with 1 N HCl). Lipids in the aqueous phase were re-extracted and pooled with the previous organic phase. The extracted lipids were dried, dissolved in chloroform/methanol (1:1), and used for functional bioassays and mass spectrometry (MS) analysis. The recovery of lipids was monitored by the addition of trace amounts of 1-[³H]oleoyl-LPA to the samples. Under the above conditions, recovery of 1-[³H]oleoyl-LPA was always >95%. For MS analysis the lipids were concentrated 20-fold.

MS Analysis-- MS analysis was performed essentially as described previously (29). Lipid extracts from cells and conditioned media were analyzed by a Quattro II tandem quadrupole mass spectrometer (Micromass, Manchester, UK) equipped with an electrospray ion source (ESI-MS). Two-microliter aliquots of samples (0.1-50 pmol/µl) dissolved in chloroform/methanol (2:1) were introduced by means of a flow injector into the ESI chamber, at a flow rate of 2 µl/min. The eluting solvent was acetonitrile/methanol/water (2:3:1) containing 0.1% ammonium formate (pH 6.4). The mass spectrometer was operated in the positive and negative ion scan modes. The nitrogen drying gas flow rate was 12 liters/min, and its temperature was 80 °C. Essentially, the capillary voltage was set at 3.7 kV and the cone voltage was set at 30 V, both in the positive and negative ion scan modes. For MS/MS experiments, 3-4 × 10⁴ torr of argon was used as the collision gas, and a collision energy of 30-40 V was used for obtaining fragment ions for precursor ions. In this system, we obtained linearity up to 500 µM LPA, and 10 µM was the lower limit of detectable LPA concentration.

Antibodies-- A peptide consisting of the C-terminal 18 amino acids of mPA-PLA₁ (⁴³⁴CMENVETVFQPILCPELQL⁴⁵¹) was conjugated with keyhole limpet hemocyanin. The conjugate was injected into the hind foot pads of WKY/Izm rats using Freund's complete adjuvant. The enlarged medial iliac lymph nodes from the rats were used for cell fusion with mouse myeloma cells, PAI. The antibody-secreting hybridoma cells were selected by screening with enzyme-linked immunosorbent assay, immunofluorescence, and Western blotting.

Western Blotting-- Protein samples were separated by SDS-PAGE and transferred to nitrocellulose membranes using the Bio-Rad protein transfer system. The membranes were blocked with Tris-buffered saline containing 5% (w/v) skimmed milk and 0.05% (v/v) Tween 20, incubated with anti-mPA-PLA₁ monoclonal antibody (culture supernatant prepared from clone 11H3), and then treated with anti-rat IgG-horseradish peroxidase. Proteins bound to the antibodies were visualized with an enhanced chemiluminescence kit (ECL, Amersham Biosciences).

Immunofluorescent Staining-- Sf9 cells infected with baculoviruses grown on cover glasses were fixed with ice-cold methanol and blocked with 10% goat serum. After incubation with anti-mPA-PLA₁ monoclonal antibody (clone 11H3), followed by incubation with goat anti-rat IgG conjugated with Alexa Fluor 488 (Molecular Probes Inc.), the bound antibody was detected with a fluorescence microscope (Axiophot 2, Zeiss, Germany) and a confocal laser scanning microscope (Fluoview, Olympus, Tokyo, Japan).

Northern Blotting-- Human Multiple Tissue Northern Blots were purchased from CLONTECH (Palo Alto, CA). The membrane was hybridized with a random-primed ³²P-labeled EcoRI-XhoI 2.5-kb DNA probe at 65 °C for 4 h in Rapid Hybridization Buffer (Amersham Biosciences). The blot was rinsed in 2× SSC at room temperature for 5 min, washed twice in 0.5× SSC, 0.1% SDS at 65 °C for 20 min, and used to expose Kodak X-Omat AR film (Eastman Kodak Co.). The blots were re-hybridized with glyceraldehyde-3-phosphate dehydrogenase (G3PDH) cDNA probe (CLONTECH) as an internal standard.

RT-PCR-- Human platelets were collected from healthy volunteers using standard protocol as described previously (24). Total RNA was prepared using Isogen (Wako, Osaka, Japan). RT-PCR was performed using Superscript reverse transcriptase (Invitrogen), Ex-Taq polymerase (Takara, Kyoto, Japan). The sequences of the two oligonucleotides used in RT-PCR were TGCGAAGTAAATCATTCTTGTGAA (nucleotide position 39-62 and TGTGACATCCATAGGACGCTACTG nucleotide position 1589 to 1566). Nucleotide sequences of the PCR products were determined by direct sequencing.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Identification of a Novel PLA₁ (nPLA₁)-- Our initial efforts to identify new phospholipases homologous to PS-PLA₁ failed using low stringency cross-hybridization techniques with PS-PLA₁ sequences. A precise search of the human EST data base was successful, and one PS-PLA₁-related gene fragment was identified (GenBank^TM accession number AA149791). DNA sequence analysis of the clone revealed that the sequence was highly homologous with the entire open reading frames (ORFs) of rat and human PS-PLA₁. This cDNA clone contained a 1353-bp ORF, starting with the initiation codon (ATG) at nucleotide 91, numbered as 1, and ending with a stop codon (TAA) at position 1444-1446 (Fig. 1A). This ORF was flanked by 5'- and 3'-untranslated sequences of 90 and 1,001 bp, respectively, and encoded 451 amino acids with a predicted molecular mass of 50,859 Da. Four possible N-linked glycosylation sites and a hydrophobic sequence composed of 18 amino acid residues at the N terminus were detected in the deduced amino acid sequence. This hydrophobic sequence was probably a short signal sequence. By RT-PCR we detected a cDNA that was identical to the DNA sequences in several human tissues (data not shown), indicating the EST clone is not an artificial clone. The deduced amino acid sequence had 34.0% identity with that of human PS-PLA₁ (Fig. 1B), and the first half of the molecule, which corresponded to the N-terminal catalytic domain of PS-PLA₁, had an identity of about 40%. Three of the amino acid residues in the ORF, Ser-154, Asp-178, and His-248, were completely conserved in the lipase family and are thought to make up a catalytic triad.

View larger version (174K): [in this window] [in a new window]   Fig. 1.   Nucleotide and amino acid sequences of a newly identified human PLA1 (nPLA1). A, cDNA and amino acid sequence of human nPLA1. The 1st and 2nd lines indicate the nucleotide and the deduced amino acid sequences, respectively. Nucleotide and amino acid positions are shown at the both sides. The consensus sequences for N-linked glycosylation sites are boxed. Active serine, aspartic acid, and histidine which make up the catalytic triad of lipase are in bold and underlined. The putative signal sequence is underlined. A short lid domain is doubly underlined. B, comparison of amino acid sequences of nPLA1, human PS-PLA1, human pancreatic lipase (PL), human lipoprotein lipase (LPL), and human hepatic lipase (HL). Amino acid residues conserved among all five (phospho)lipases are indicated in bold. Ser, Asp, and His residues that are in italics and underlined are the amino acid residues that form catalytic triads in the lipases. The lid domains and 9 loops are indicated by shaded boxes. C, phylogenetic relationship of the lipase family and nPLA1. A phylogenetic tree was generated from ClustalW alignment data using the GENETYX-MAC version 10.1.6 (Software Development Co. Ltd., Tokyo, Japan). This analysis found that nPLA1 and PS-PLA1 form a subfamily in the lipase family. PLRP1, pancreatic lipase-related protein 1; PLRP2, pancreatic lipase-related protein 2.

Like PS-PLA₁, the molecule has a short lid composed of 12 amino acid residues, and a part of the 9 loop that is found in other lipases is deleted (Fig. 1B). Interestingly, the same molecular features were also observed in all the hornet PLA₁s that have been reported so far (30-32). The lids and the 9 loops in lipases were implicated in the substrate recognition. The phylogenetic tree in Fig. 1C and a BLAST search (data not shown) showed that the protein is the closest homologue of PS-PLA₁ not only in the lipase family but also in the data base. Thus we tentatively designated this as a novel PLA₁ (nPLA₁).

nPLA₁ Is a Membrane-associated Protein-- In order to detect enzyme activity of the recombinant protein, we first tried to express the protein in Sf9 insect cells by a baculovirus system, and we detected it as a protein band with an apparent molecular mass of 55 kDa on a Western blotting using a monoclonal antibody raised against the C-terminal 18 amino acids (see "Experimental Procedures") (Fig. 2A). Unlike PS-PLA₁, which was mostly secreted into the culture medium when expressed in Sf9 cells (24), the recombinant protein was detected only in the cell fraction (Fig. 2A). After high speed centrifugation of the cell homogenate, the recombinant protein was detected exclusively in the pellet (data not shown). In addition, it was found that the protein was resistant to solubilization by Triton X-100 (Fig. 2A). Immunofluorescence images using the anti-nPLA₁ antibody and a confocal laser microscope are shown in Fig. 2B. This analysis confirmed that the protein is localized exclusively to the plasma membrane.

View larger version (46K): [in this window] [in a new window]   Fig. 2.   Expression and cellular distribution of nPLA1 protein in Sf9 cells. A, Sf9 cells were infected with nPLA1 (lanes a-d), wild-type (lanes e-h), or mutant nPLA1 (lanes i-l) baculoviruses. 72 h after infection, the cells and culture supernatants were recovered. For each cell, culture supernatants (lanes a, e, and i), cells (lanes b, f, and j), Triton X-100-soluble fraction of cells (lanes c, g, and k), and Triton X-100-insoluble fraction of cells (lanes d, h, and l) (each derived from 5 × 105 cells) were prepared and were subjected to Western blotting using anti-nPLA1 monoclonal antibody. B, Sf9 cells infected with nPLA1 baculovirus were fixed with ice-cold methanol and incubated with anti-nPLA1 monoclonal antibody. The bound antibody was detected by incubating the cells with goat anti-rat IgG conjugated with Alexa Fluor 488. The phase contrast (a) and the fluorescence images (b) were detected with a fluorescence microscope, and the confocal fluorescence image (c) was detected with a confocal laser scanning microscope. nPLA1 protein is localized to the plasma membrane. Scale bar, 20 (a and b) and 4 µm (c).

Conditioned Medium from nPLA₁-expressing Sf9 Cells Activates EDG7-- We hypothesized that the newly identified protein would exhibit PLA₁ and/or lipase activity based on the similarity of its sequence to sequences of proteins in the lipase family. We first determined whether the enzyme has PLA₁ activity by an in vitro conventional assay using various phospholipids as substrate and the membrane fraction from Sf9 cells expressing nPLA₁ (Sf9-nPLA₁ cells) as an enzyme source. However, the protein in the membrane fraction did not show any PLA activity toward exogenously added phospholipids (data not shown).

Previously, we used Sf9 cells to characterize a novel LPA receptor that we isolated, EDG7, which is a member of LPA receptor family. Cells expressing EDG7 (Sf9-EDG7 cells) were found to be strongly stimulated by exogenously added LPA (8). When we accidentally mixed the cultures of Sf9-nPLA₁ and Sf9-EDG7 cells, we detected a small but significant [Ca²⁺]_i increase in Sf9-EDG7 cells (data not shown). These preliminary data suggested that Sf9 cells expressing the newly identified protein may produce LPA, which then stimulates EDG7. Therefore, we decided to analyze this phenomenon in more detail. When we incubated Sf9-nPLA₁ cells with medium containing 0.1% BSA, we found that the conditioned medium did induce a transient Ca²⁺ response in Sf9-EDG7 cells (Fig. 3A). The response was not induced at all by a conditioned medium prepared from Sf9 cells infected with wild-type baculovirus (Sf9-WT cells) (Fig. 3A). It was also shown that the conditioned medium from the Sf9-nPLA₁ cells desensitized the Ca²⁺ response induced by 100 nM LPA (Fig. 3A) and that it did not induce any Ca²⁺ response in Fura-2-loaded Sf9-WT cells (data not shown), confirming that the Ca²⁺ response is mediated by EDG7.

View larger version (11K): [in this window] [in a new window]   Fig. 3.   Conditioned medium prepared from nPLA1-expressing cells activates EDG7. A, Sf9 cells infected with nPLA1 (Sf9-nPLA1 cells) or wild-type baculovirus (Sf9-WT cells) were incubated with medium containing 0. 1% BSA (fatty acid-free) for 30 min at 27 °C. Then the production of LPA was examined by subjecting the conditioned media (40-fold dilution) to Fura-2-loaded EDG7-expressing Sf9 cells (Sf9-EDG7 cells). The changes in [Ca2+]i were analyzed in CAF-110 as described under "Experimental Procedures" and were expressed as the ratio of absorbance at 340:380 nm. B, conditioned medium from Sf9 cells infected with mutant nPLA1 (Sf9-mutPLA1 cells) was prepared as in A, and it was subjected to Fura-2-loaded Sf9-EDG7 cells (40-fold dilution). The conditioned medium from Sf9-mutPLA1 did not induce any Ca2+ response in Sf9-EDG7 cells. C, the activities to induce increases in [Ca2+]i in Sf9-EDG7 cells were determined for each concentration of 1-oleoyl-LPA (open circles) or 2-oleoyl-LPA (closed circles).

We next determined whether catalytic activity of nPLA₁ is required for the induction of a Ca²⁺ response. To do this we prepared a baculovirus to express mutant PLA₁ in which the putative active serine residue (Ser-154), which is conserved among members of the lipase/PLA₁ family (Fig. 1B), was replaced with an alanine residue. Sf9 cells infected with the mutant baculovirus (Sf9-mutPLA₁ cells) expressed mutPLA₁ protein at almost the same level as Sf9-nPLA₁ cells (Fig. 2A). However, the conditioned medium from Sf9-mutPLA₁ cells did not induce any Ca²⁺ response in Sf9-EDG7 cells (Fig. 3B). This result indicated that Ser-154 was actually the active serine residue and that catalytic activity of nPLA₁ was required for the activation of EDG7. These results, taken together, indicated that LPA was continuously produced and released from Sf9-nPLA₁ cells.

Synthetic Pathway(s) for LPA in Sf9-nPLA₁ Cells-- From the data shown above, two pathways for LPA production were postulated in which nPLA₁ is involved. In the first pathway, nPLA₁ hydrolyzes phospholipids which results in an accumulation of lysophospholipids and a consequent degradation of the lysophospholipids to LPA by the action of phospholipase D (PLD). In the second pathway, nPLA₁ hydrolyzes PA and produces LPA. To test the first pathway, we determined whether lysophospholipids accumulated in Sf9-nPLA₁ cells. For this we extracted phospholipids from both Sf9-nPLA₁ and Sf9-WT cells and performed lipid analysis by electrospray ionization mass spectrometry (ESI-MS). As shown in Fig. 4, several compounds were detected in the lipid fractions from both cell types. These included LPC (m/z 538 (16:1-LPC ion paired with HCOOH) and 566 (18:1-LPC ion paired with HCOOH) in negative ion scan mode), lysophosphatidylethanolamine (LPE) (m/z 450 (16:1-LPE) and 478 (18:1-LPE) in negative ion scan mode), lysophosphatidylinositol (LPI) (m/z 569 (16:1-LPI), 597 (18:1-LPI), 599 (18:0-LPI) in negative ion scan mode), and LPS (m/z 494 (16:1-LPS) and 522 (18:1-LPS), not shown). However, we did not observe any significant differences in the expression profiles of lysophospholipids between Sf9-nPLA₁ and Sf9-WT cells. We also examined the lysophospholipid profiles in the conditioned media and did not observe any difference in the expression of LPC, LPE, LPS, and LPI (data not shown). Although a significant difference in the activation of EDG7 was observed in the conditioned media prepared from Sf9-nPLA₁ and Sf9-WT cells (Fig. 3), signals corresponding to LPA were not detected either in the conditioned medium or in the cells under the present conditions, possibly due to a low sensitivity of the ESI-MS compared with the bioassay. Indeed, the lower limit of LPA detection was only 10 µM for ESI-MS, whereas the bioassay could detect 1-oleoyl-LPA concentrations as low as 100 nM and 2-oleoyl-LPA concentrations as low as 10 nM.

View larger version (15K): [in this window] [in a new window]   Fig. 4.   Detection of lysophospholipids in Sf9-nPLA1 and Sf9-WT cells by MS analysis. Phospholipids were recovered from both Sf9-nPLA1 and Sf9-WT cells and were subjected to lipid analysis using ESI-MS. The ESI-MS spectra of each lysophospholipid (LPC, LPE, and LPI) from both cells in the negative ion scan mode are shown. The identities of each ion are 538 (16:1-LPC ion paired with HCOOH), 566 (18:1-LPC ion paired with HCOOH), 450 (16:1-LPE), 478 (18:1-LPE), 569 (16:1-LPI), 597 (18:1-LPI), and 599 (18:0-LPI). The values representing 100% of the y axis for LPC, LPE, and LPI are 1.7, 1.9, and 1.28 × 105 eV, respectively.

To confirm the second pathway, we next examined whether activation of endogenous PLD (Fig. 5) or exogenously added PLD (Fig. 6) affected the ability of the conditioned medium from the Sf9-nPLA₁ cells to activate EDG7. First we used the ability of phorbol 12-myristate 13-acetate (PMA) to activate PLD via protein kinase C and that of short chain alcohol to inhibit PLD activity. As shown in Fig. 5, treatment of the cells with 100 nM PMA for 30 min significantly enhanced the Ca²⁺ response in Sf9-EDG7 cells initiated by the addition of conditioned medium from Sf9-nPLA₁ cells. The enhancement was not induced by addition of conditioned medium from Sf9-WT cells treated with PMA (Fig. 5). We further examined the effect of 1-butanol or 2-butanol on PMA-enhanced Ca²⁺ response. Incubation of Sf9-nPLA₁ cells with 100 nM PMA in the presence of 1-butanol at 0.5%, a concentration that completely inhibits PLD activity, completely blocked the Ca²⁺ response enhanced by PMA treatment (Fig. 5), whereas 2-butanol, a positional isomer of 1-butanol that does not have the ability to block PLD, at 0.5% did not show such an effect (Fig. 5). PMA, 1-butanol, or 2-butanol alone did not affect the Ca²⁺ responses (data not shown).

View larger version (16K): [in this window] [in a new window]   Fig. 5.   Possible involvement of intrinsic PLD in nPLA1-mediated EDG7 activation. Sf9-nPLA1 cells were treated with media containing PMA (100 nM), PMA + 1-butanol (0.5%), or PMA + 2-butanol (0.5%) in the presence of 0.1% BSA for 30 min at 27 °C. Then the production of LPA was examined by subjecting the conditioned media to Fura-2-loaded Sf9-EDG7 cells. The changes in [Ca2+]i were analyzed in CAF-110 as described under "Experimental Procedures" and were expressed as the ratio of absorbance at 340:380 nm. Values are the means ± S.E. of three independent experiments.

View larger version (15K): [in this window] [in a new window]   Fig. 6.   Exogenously added PLD enhanced the EDG7-activating potency of conditioned medium from nPLA1-expressing cells. Sf9-nPLA1, Sf9-WT, and Sf9-mutPLA1 cells were incubated with medium containing 0.1% BSA (fatty acid-free) for 30 min at 27 °C in the presence or absence of 0.25 unit/ml of PLD from Actinomadura. Various concentrations of the conditioned media were then subjected to Fura-2-loaded Sf9-EDG7 cells to evaluate LPA production. Changes in [Ca2+]i were analyzed by an ARGUS-50 system as described under "Experimental Procedures" and were expressed as the ratio of absorbance at 340:380 nm. Values are the means ± S.E. of three independent experiments.

As shown in Fig. 6, the treatment of Sf9-nPLA₁ cells with exogenously added PLD significantly enhanced the ability of the conditioned medium to activate EDG7. The ability of the conditioned medium from Sf9-nPLA₁ cells to activate EDG7 was increased at least 100 times by the PLD treatment (Fig. 6). The conditioned media from Sf9-WT and Sf9-mutPLA₁ cells induced a small Ca²⁺ response in Sf9-EDG7 cells after the PLD treatment, but they were at least 10 times less potent than the conditioned medium from Sf9-nPLA₁ cells (Fig. 6), showing that a small amount of LPA is produced after the PLD treatment in the absence of nPLA₁. Addition of PLD alone to Sf9-EDG7 cells did not induce any detectable Ca²⁺ response (data not shown). These two lines of evidence indicate that nPLA₁ produced 2-acyl-LPA by hydrolyzing PA generated on membranes by either endogenously expressed or exogenously added PLD.

nPLA₁ Is PA-selective PLA₁-- To elucidate further the substrate specificity of nPLA₁, we next performed lipid analysis of the conditioned medium prepared from Sf9-nPLA₁ cells after the PLD treatment using ESI-MS. As shown in Fig. 7, two major ion peaks (m/z 407 and 435) were detected by ESI-MS (negative ion scan mode) in the lipid fraction extracted from the conditioned medium from Sf9-nPLA₁ cells after PLD treatment. These peaks were estimated from their molecular weights to be 16:1-LPA and 18:1-LPA, respectively (29). They were only weakly detected in the lipid fractions from Sf9-WT and Sf9-mutPLA₁ cells even after the PLD treatment (Fig. 7). In the positive ion scan mode, four minor peaks, m/z 409, 426, 437, and 454, were detected that were not detected in the lipid fractions from Sf9-WT and Sf9-mutPLA₁ cells (Fig. 7). 16:1-LPA and 18:1-LPA had m/z values of 407 and 435, respectively, in the negative ion scan mode, 409 and 437, respectively, in the positive ion scan mode, and 426 and 454, respectively, complexed with ammonium ion observed only in the positive ion scan mode. The identities of the peaks were further confirmed by MS/MS analysis of the daughter ions. The detected major fragment peaks from the precursor ion, m/z 435, were m/z 78.7, 152.7, and 280.9. They correspond to PO₃, cyclic glycerophosphate, and oleic acid (18:1), respectively (data not shown). A similar result was obtained from peak m/z 407 (data not shown). Thus we concluded that LPA with 16:1 and 18:1 was produced in Sf9-nPLA₁ cells after the PLD treatment. Other than LPA, we detected four ion peaks in the negative ion scan mode with m/z values 389 (16:1-cyclic PA (cPA)), 417 (18:1-cPA), 450 (16:1-LPE), and 478 (18:1-LPE), and four ion peaks in the positive ion scan mode with m/z values 452 (16:1-LPE), 480 (18:1-LPE), 494 (16:1-LPC) and 522 (18:1-LPC), which were equally expressed among Sf9-nPLA₁, Sf9-WT, and Sf9-mutPLA₁ cells. Other MS data (not shown) indicated that the major molecular species of acyl chains at the sn-2 position of PC were specifically 16:1 and 18:1 fatty acids, and those at the sn-1 position were 16:0, 16:1, 18:0, and 18:1 in Sf9 cells. This indicated that 16:1- and 18:1-LPA were generated as a result of the PLA₁ reaction. All these results support the hypothesis that the enzyme specifically acts on PA, and not on other phospholipids, and hydrolyzes fatty acids at the sn-1 position, producing 2-acyl-LPA. Thus we refer to the enzyme as membrane-associated PA-PLA₁ (mPA-PLA₁).

View larger version (18K): [in this window] [in a new window]   Fig. 7.   Detection of LPA in the conditioned medium from Sf9-nPLA1 cells after PLD treatment by MS analysis. The ESI-MS spectra of phospholipids from the conditioned media from Sf9-nPLA1, Sf9-WT, and Sf9-mutPLA1 cells after they were treated with PLD from Actinomadura. Results from both negative and positive ion scan mode are shown. The values representing 100% of the y axis of negative and positive ion scan modes are 7.7 and 8.0 × 104 eV, respectively. The major ions and their identities are 389 (16:1-cPA), 407 (16:1-LPA), 417 (18:1-cPA), 435 (18:1-LPA), 450 (16:1-LPE), and 478 (18:1-LPE) in negative ion scan mode, and 409 (16:1-LPA), 426 (16:1-LPA ion paired with NH3), 437 (18:1-LPA), 454 (18:1-LPA ion paired with NH3), 494 (16:1-LPC), and 522 (18:1-LPC) in positive ion scan mode.

Expression of mPA-PLA₁-- We finally examined the tissue distribution of mPA-PLA₁ by Northern blotting using the full-length cDNA as a probe. The Northern blotting indicated that most of the human tissues examined had a transcript of 3.3 kb and that some had transcripts of 4.4, 2.2, and 1.5 kb. mPA-PLA₁ is most abundantly expressed in prostate, testis, ovary, colon, pancreas, kidney, and lung and is expressed at lower levels in spleen, brain, and heart (Fig. 8A). Interestingly, the expression pattern is similar, but not completely identical, to that of EDG7, which is highly expressed in prostate, pancreas, ovary, testis, lung, and heart (8). We also examined mPA-PLA₁ expression in human platelets because the cells have been well characterized as LPA-producing cells (10, 11). As shown in Fig. 8B, expression of mPA-PLA₁ in human platelets was confirmed by both mRNA and protein levels. A high level of protein expression was observed in the cells and was almost the same level observed in Sf9 overexpressing mPA-PLA₁ (Fig. 8B).

View larger version (50K): [in this window] [in a new window]   Fig. 8.   Expression of mPA-PLA1 (nPLA1) in human tissues (A) and platelets (B). A, 2 µg of poly(A)+ RNA from various human tissues (Human Multiple Tissue Northern blot, CLONTECH) were hybridized with probes specific for human mPA-PLA1 (upper panel) and G3PDH (lower panel). The origin of each RNA is shown at the top. The molecular weight standard is shown at the left. B, expression of mPA-PLA1 in human platelets was examined by both RT-PCR and Western blotting. The cDNA obtained from ATCC (see "Experimental Procedures") was used for positive control of PCR. Western blot analysis was performed as in Fig. 2 using the membrane fraction from human platelets and anti-mPA-PLA1 monoclonal antibody.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The metabolic pathways for LPA synthesis are currently poorly understood, and at least three pathways have been postulated. In the first pathway, LPA is converted from PA by PLA₁ or PLA₂, which has been observed to occur in erythrocytes and ovarian cancer cells (12, 13, 33). In the second pathway, which may occur in platelets, diacylglycerol produced by PLC, could be deacylated by diacylglycerol lipase, with the resulting monoacylglycerol being further phosphorylated into LPA (34, 35). The third pathway involves lysophospholipase D acting on LPC in plasma and may explain the large accumulation of LPA in aged plasma (14). A similar reaction may occur on the cell surface, in which LPC was converted to LPA by bacterial PLD (36). Enzymes involved in these processes of LPA synthesis have not been characterized fully. However, several PLA₂ isoforms identified and characterized biochemically have been implicated in LPA production. For example, studies using inhibitors of PLA₂ isoforms have suggested that sPLA₂-IB, Ca²⁺-independent PLA₂, and cytosolic PLA₂ were partially involved in the LPA production of ovarian cancer cells (12, 13). It was also proposed that sPLA₂-IIA was able to produce LPA by hydrolyzing PA exposed on the cell surface after phospholipid scrambling (37) or by hydrolyzing PA on membrane microvesicles shed from erythrocytes (33).

The present investigation led to several interesting observations, allowing us to propose a role of a novel PLA₁ molecule, mPA-PLA₁, in LPA production. Our results from this study are as follows. (i) A low level of LPA that could activate EDG7 was continuously produced and released into the medium in Sf9-mPA-PLA₁ cells. (ii) The production of LPA in Sf9-mPA-PLA₁ cells was significantly increased after PLD administration (Figs. 6 and 7). (iii) The expression of mPA-PLA₁ did not promote accumulation of any lysophospholipids including LPC, LPE, LPI, and LPS in the cells (Fig. 4). (iv) We also observed that cPA was equally detected in the media from Sf9-mPA-PLA₁, Sf9-WT, and Sf9-mutPLA₁ cells only after the PLD treatment (Fig. 7). The bacterial PLD (from Actinomadura) used in this study converts lysophospholipids (LPC, LPE, LPS, and LPI) to cPA but not to LPA.² All these results clearly indicate that mPA-PLA₁ produces LPA by hydrolyzing PA. We could not detect PLA₁ activity of mPA-PLA₁ toward exogenously added PA liposome using a conventional assay for PLA₁ or A₂. It can be speculated that the availability of exogenous substrate to the enzyme is limited, as mPA-PLA₁ is tightly associated with membrane phospholipids. mPA-PLA₁ may hydrolyze such phospholipids, which surround the enzyme on the plasma membrane, after the phospholipids are converted to PA.

PA is a very minor component of phospholipids in mammalian cells and also in Sf9 cells (38). This is consistent with the result that the LPA level was very low under normal conditions (Figs. 5 and 6). It is thus reasonable to assume that the rate-limiting step for LPA production in this pathway is generation of PA. PA could be generated by PLD or sequentially by PLC and diacylglycerol kinase. We observed that exogenously added PLD strongly promoted the production of LPA (Figs. 6 and 7) and that PMA-stimulated production of LPA was suppressed by a PLD inhibitor, 1-butanol (Fig. 5). Thus, it is likely that PLD is involved in the production of LPA mediated by mPA-PLA₁. In mammalian cells, the molecular identities of the two isozymes of PLD, PLD₁ and PLD₂, have been elucidated. Among these two isozymes, PLD₁ is activated by PMA both in vivo and in vitro through an activation of protein kinase C (39). Although information about PLD isozyme(s) in Sf9 insect cells is limited (40), the observation that PMA stimulated LPA formation in Sf9-mPA-PLA₁ cells (Fig. 5) suggests an involvement of a PLD₁-like molecule in the insect cells. Consistent with this, it is reported by Shen et al. (12) that LPA is produced and secreted from ovarian cancer cells after they were treated with PMA.

LPA produced by mPA-PLA₁ in Sf9 cells was rich in oleic acid (18:1) and palmitoleic acid (16:1) (Fig. 7). Marheineke et al. (38) reported that the major fatty acids in the phospholipids from Sf9 cells were oleic acid, palmitoleic acid, and stearic acid (18:0), with a small amount of palmitic acid (16:0). This explains why LPA with linoleic acid (18:2) and arachidonic acid (20:4), which are the major fatty acids at the sn-2 position of phospholipids of mammalian cells, was not detected. We observed that mPA-PLA₁ is abundantly expressed in human platelets that have been characterized well as LPA-producing cells (10, 11). In activated platelet, LPA with both saturated (16:0, 18:0) and unsaturated 16:1, 18:1, 18:2, and 20:4 has been detected. This suggests that both PLA₁ and PLA₂ isozymes are involved in the LPA production in the cells.

Although it is possible that EDG7 is activated by an entity other than LPA, this seems unlikely for two reasons. First, the amount of LPA in the conditioned medium of Sf9-mPA-PLA₁ cells treated with PLD is ~5 µM based on the MS analysis (Fig. 7) and 4 µM based on the dose response of EDG7 activation (Fig. 3C). Second, the amount of LPA in the conditioned medium of untreated Sf9-mPA-PLA₁ cells based on the bioassay is ~400 nM, a concentration that cannot be detected by MS analysis under the present conditions. These observations support the idea that LPA is the component that activated EDG7.

What molecular structures determine the enzymatic activity of PLA₁? Guinea pig pancreatic lipase-related protein 2 (GPLRP2), which is 63% identical to that of human pancreatic lipase, differs from classical pancreatic lipases in that it displays both lipase and PLA₁ activity (41, 42). Based on the three-dimensional structures of GPLRP2 and human pancreatic lipase, as well as a modeling of hornet PLA₁, two domain structures, the lid domain and the 9 loop, have been suggested to play an essential role in substrate selectivity toward triacylglycerides and phospholipids (43). The lid domain in lipases, which overlies the active site (44), has been suggested to be involved in substrate recognition (45). One striking feature of molecules belonging to the lipase family which show PLA₁ activity is existence of "short" or "mini" lids. In most of the lipases the lids are composed of 22 or 23 amino acids. By contrast, GPLRP2, hornet PLA₁, PS-PLA₁, and mPA-PLA₁ have short lids composed of 5, 7, 12, and 12 amino acids, respectively (Fig. 1B). The other domain structure that is capable of determining the substrate specificity of PLA₁/lipase is the 9 loop, which is also located in the vicinity of the active site of lipases. The loop is present in human pancreatic lipase and GPLRP2 (showing lipase activity), whereas it is absent in hornet PLA₁, PS-PLA₁, and mPA-PLA₁. Thus, simultaneous deletions of the 9 loop and the lid domain may determine the molecular characteristics of PLA₁ in the lipase family. These molecular features may allow us to identify other PLA₁ isozymes in the future.

mPA-PLA₁ and PS-PLA₁ form a subfamily within the lipase family (Fig. 1C). PS-PLA₁ produces LPS from PS (24, 46), a potential lysophospholipid mediator with an activity to stimulate mast cell degranulation (47, 48) and neurite outgrowth (27). Recently we showed (25) that PS-PLA₁ also functions as a synthetic enzyme of LPS. It is thus reasonable to assume, from both structural and functional points of view, that these two PLA₁s have specialized common function(s) to produce lysophospholipid mediators.

	ACKNOWLEDGEMENTS

We thank Drs. Takashi Izumi (Gunma University) and Takao Shimizu (University of Tokyo) for help in measurement of [Ca²⁺]_i.

	FOOTNOTES

^* This work was supported in part by research grants from the Ministry of Education, Culture, Sports, Science and Technology, and by the Human Frontier Special Program.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EBI Data Bank with accession number(s) AY036912.

^§ Research Fellow of the Japan Society for the Promotion of Science.

^¶ To whom correspondence should be addressed. Tel.: 81-3-5841-4723; Fax: 81-3-3818-3173; E-mail: jaoki@mol.f.u-tokyo.ac.jp.

^** Present address: Faculty of Pharmaceutical Sciences, Teikyo University, Sagamiko, Tsukui, Kanagawa 199-0195, Japan.

Published, JBC Papers in Press, June 12, 2002, DOI 10.1074/jbc.M201659200

² T. Kobayashi, Ochanomizu University, personal communication.

	ABBREVIATIONS

The abbreviations used are: LPA, lysophosphatidic acid; PA, phosphatidic acid; PLA₁, phospholipase A₁; mPA-PLA₁, membrane-associated PA-selective PLA₁; PS, phosphatidylserine; PS-PLA₁, PS-specific PLA₁; PLA₂, phospholipase A₂; sPLA₂-IIA, type IIA secretory PLA₂; PLD, phospholipase D; PC, phosphatidylcholine; PE, phosphatidylethanolamine; LPS, lysophosphatidylserine; LPC, lysophosphatidylcholine; LPE, lysophosphatidylethanolamine; LPI, lysophosphatidylinositol; EDG, endothelial differentiation gene; EST, expressed sequence tags; BSA, bovine serum albumin; ORF, open reading frame; G3PDH, glyceraldehyde-3-phosphate dehydrogenase; SSC, standard saline citrate; [Ca²⁺]_i, concentration of intracellular calcium ion; ESI-MS, electrospray ionization mass spectrometry; WT, wild type; RT, reverse transcription; MES, 4-morpholineethanesulfonic acid; MS, mass spectrometry; PMA, phorbol 12-myristate 13-acetate; cPA, cyclic PA; nPLA₁, novel PLA₁.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg