Originally published In Press as doi:10.1074/jbc.M202902200 on July 8, 2002
J. Biol. Chem., Vol. 277, Issue 38, 34846-34852, September 20, 2002
Inhibition of Release of Neurotransmitters from Rat Dorsal Root
Ganglia by a Novel Conjugate of a Clostridium botulinum
Toxin A Endopeptidase Fragment and Erythrina cristagalli
Lectin*
Michael J.
Duggan
§,
Conrad P.
Quinn
¶,
John A.
Chaddock
,
John R.
Purkiss
,
Frances C. G.
Alexander
,
Sarah
Doward
,
Sarah J.
Fooks
,
Lorna M.
Friis
,
Yper H. J.
Hall
,
Elizabeth R.
Kirby
,
Nicola
Leeds
,
Hilary J.
Moulsdale
,
Anthony
Dickenson**,
G. Mark
Green**,
Wahida
Rahman**,
Rie
Suzuki**,
Clifford C.
Shone
, and
Keith A.
Foster
From the
Centre for Applied Microbiology and
Research, Porton Down, Salisbury, Wiltshire SP4 0JG, United Kingdom and
the ** University College London, University College, Gower
Street, London WC1E 6BT, United Kingdom
Received for publication, March 26, 2002, and in revised form, June 19, 2002
 |
ABSTRACT |
Clostridial neurotoxins potently and specifically
inhibit neurotransmitter release in defined cell types. Here we report
that a catalytically active derivative (termed LHN/A)
of the type A neurotoxin from Clostridium botulinum has
been coupled to a lectin obtained from Erythrina
cristagalli to form a novel conjugate. This conjugate exhibits an
in vitro selectivity for nociceptive afferents compared
with the anatomically adjacent spinal neurons, as assessed using
in vitro primary neuronal culture systems to measure
inhibition of release of neurotransmitters. Chemical conjugates prepared between E. cristagalli lectin and either natively
sourced LHN/A or recombinant LHN/A purified
from Escherichia coli are assessed, and equivalence of the
recombinant material are demonstrated. Furthermore, the dependence of
inhibition of neurotransmitter release on the cleavage of SNAP-25 is
demonstrated through the use of an endopeptidase-deficient
LHN/A conjugate variant. The duration of action of
inhibition of neurotransmitter released by the conjugate in
vitro is assessed and is comparable with that observed with
Clostridium botulinum neurotoxin. Finally, in
vivo electrophysiology shows that these in vitro
actions have biological relevance in that sensory transmission from
nociceptive afferents through the spinal cord is significantly
attenuated. These data demonstrate that the potent endopeptidase
activity of clostridial neurotoxins can be selectively retargeted to
cells of interest and that inhibition of release of neurotransmitters
from a neuronal population of therapeutic relevance to the treatment of
pain can be achieved.
 |
INTRODUCTION |
The clostridial neurotoxin
(CNT)1 family includes
tetanus toxin (TeNT), produced by Clostridium tetani, and
the seven antigenically distinct botulinum neurotoxins produced from
strains of Clostridium botulinum (BoNTs). These proteins are
responsible for the conditions of tetanus and botulism, respectively,
that develop as a direct result of inhibition of
Ca2+-dependent neurotransmitter release, a
mechanism of action common to all the CNTs. In the case of BoNTs,
intoxication of the neuromuscular junction is thought to occur in at
least three phases: an initial binding phase, an internalization phase,
and finally a neurotransmitter blockade phase (1).
All CNTs have a similar structure and consist of a heavy chain
(~100 kDa) covalently joined to a light chain (~50 kDa) by a single
disulfide bond. Proteolytic cleavage of the heavy chain of
C. botulinum neurotoxin type A (BoNT/A) generates two
fragments of ~50 kDa each. The C-terminal domain (HC) is
required for target cell binding, with the N-terminal domain
(HN) being proposed to be involved in intracellular
membrane translocation (2). Under conditions in which the disulfide
bond between the light and heavy chains is maintained, trypsin cleavage
results in a 100-kDa species termed LHN/A (light
chain plus N-terminal heavy chain domain) representing a catalytically
active, non-cell binding, non-toxic derivative of BoNT/A. In addition
to obtaining LHN/A from BoNT/A, we have recently reported
that LHN/A can be expressed and purified from a
heterologous expression host (3).
It is proposed that CNTs bind to their target cell by a combination of
specific high affinity binding events, possibly involving more than one
ganglioside and glycoprotein component (4). The proposal that BoNT/B
binds to synaptotagmin and the gangliosides GT1b and
GD1a (5) and that BoNT/A and BoNT/E may also bind to
synaptotagmin (6) has supported this concept. Having accomplished the
first cell intoxication stage of binding, CNTs require mechanisms to
facilitate internalization into, and intracellular routing within, the
target cell. Although the definitive mechanisms remain unclear, the
role of an acidic compartment has been proposed (7) in common with a
number of other bacterial protein toxins (8). It is proposed that it is
the role of the HN domain to facilitate translocation of
the endopeptidase into the cytosol, and the successful retargeting of
functional LHN/A into model cell lines (9) has excluded the
obligatory requirement of the HC domain for intracellular trafficking mechanisms.
Once the CNT (or fragment) has gained access to the cytosol, the
proteolytic light chains specifically hydrolyze key components of the
SNARE protein complex (10) required for synaptic vesicle docking,
fusion, and neurotransmitter release. In the case of BoNT/A and BoNT/E
the substrate is synaptosome-associated protein-25 (SNAP-25), whereas
the vesicle-associated membrane protein and syntaxin families of
proteins are substrates for neurotoxin types B, D, F, G, and type C,
respectively (11, 12). It has been demonstrated that cleavage of these
components of the SNARE complex by CNTs results in inhibition of
transmitter release from a variety of neuronal cell systems. It is also
known that formation of the SNARE complex is a universal mechanism of
vesicle fusion and secretion, not limited to neuronal cell types. To
circumvent the limited availability of the requisite toxin receptor(s)
on the target cell of interest, we have previously reported the
replacement of the HC domain with a variety of ligands and
retargeting of the LHN/A fragment into a range of neuronal
and non-neuronal cells (9, 13).
In this study we have further developed the technology of retargeting
clostridial endopeptidases with a view to endowing the conjugate with
an ability to selectively target cells of potential therapeutic
interest relative to anatomically and functionally closely related
cells. Furthermore, we have investigated aspects of the duration of
action of retargeted endopeptidases because a number of reports (14,
15) highlight the significant longevity of action of BoNT/A when used
therapeutically. As a model system we have chosen to study the effects
of selectively targeting the endopeptidase domain to nociceptive
afferents. In vivo, the role of nociceptive afferents is to
sense noxious stimuli at the periphery and to transmit this information
to the central nervous system where it is perceived as pain.
Transmission of this signal is dependent on release of a number of
transmitters (including glutamate, substance P, and calcitonin
gene-related peptide) from synaptic vesicles (16). Though these
transmitters are found in the same terminals of small-diameter primary
afferents, glutamate is released from a different population of
synaptic vesicles to the neuropeptides (substance P and calcitonin
gene-related peptide) (17). We have previously reported that release of
substance P from a rat embryonic dorsal root ganglia (eDRG) neuronal
culture system (an in vitro system representative of
nociceptive afferents) is sensitive to inhibition by BoNT/A (18),
indicating that release of substance P is SNARE-mediated. We theorized
that if clostridial endopeptidases could be selectively targeted to the
nociceptive afferents in preference to anatomically adjacent neurons
inhibition of the transmission of noxious stimuli may be specifically prevented.
In the search for suitable targeting ligands we observed that lectins
(non-immunoglobulin proteins that recognize and bind to carbohydrates)
(19, 20) had the potential to selectively bind to extracellular
moieties and thus be used to differentiate between cell types. It has
been reported that galactose-containing carbohydrates are selectively
present on nociceptive neurons in the central and peripheral nervous
system relative to other neurons (21, 22). From these reports, and
experiments to identify binding of fluorescent-labeled lectins, we
identified Erythrina cristagalli lectin (ECL) as a suitable
ligand for selectively targeting LHN/A endopeptidase to
nociceptive afferents.
Here we report that LHN/A-ECL conjugate binds to,
internalizes into, and inhibits stimulated neurotransmitter release
from cultured eDRG neuronal cell types in preference to spinal cord neurons. Through the use of an endopeptidase-deficient conjugate variant, effects on neurotransmitter release are correlated to cleavage
of the natural BoNT/A substrate SNAP-25. This ability to achieve
cell-selective inhibition of secretion by retargeted LHN
points to the potential future therapeutic use of retargeted clostridial endopeptidases and, specifically in this instance, to the
treatment of pain.
 |
EXPERIMENTAL PROCEDURES |
Synthesis and Purification of
LHN/A-ECL
Conjugates--
Recombinant and "native" (i.e. prepared
by trypsin treatment of BoNT/A) LHN/A were prepared as
described elsewhere (3). Derivatization of ECL (Sigma;
reconstituted to 10 mg/ml in phosphate-buffered saline) and
LHN/A (5 mg/ml in phosphate-buffered saline) was based on
methodology described previously (9). Briefly, ~2 reactive leaving groups were introduced into LHN/A and a single
sulfhydryl group was introduced into ECL, in both cases by
reaction with N-succinimidyl-3-(2-pyridyldithio)propionate. Initial
fractionation of the conjugate mixture was performed by size exclusion
chromatography (Superose-12, or Superdex G-200 depending on the scale
of conjugation). Application of high molecular weight material to
immobilized lactose (Sigma) isolated functional conjugate, which was
eluted by the addition of 0.3 M lactose. Specifically
eluted fractions were dialyzed extensively against phosphate-buffered
saline to remove lactose.
Construction and Purification of
recLHN/A(H227Y)--
To
create an LHN/A variant defective in endopeptidase
activity, a single amino acid mutation at position 227 of the light chain sequence was performed by introduction of the codon for tyrosine
(TAC) in place of histidine (CAC). Mutagenesis was performed by overlap
polymerase chain reaction using a mutagenic primer pair of
CACACGAGCTCATCTACGCCGGTCATCG and CGATGACCGGCGTAGATGAGCTCGTGTG. A single
silent SacI site was introduced to aid screening of mutants. The integrity of the entire LHN/A(H227Y) DNA sequence was
confirmed by sequencing. Mutated DNA was transformed into
Escherichia coli TG1, and expression and purification
procedures followed essentially as described previously (3).
Characterization of LHN/A-ECL
Conjugates--
SDS-PAGE and Western blot analyses were performed by
standard protocols (Novex). Assessment of the ability of
recLHN/A,
recLHN/A(H227Y), and conjugates to cleave
SNAP-25 in vitro was performed essentially as previously
described (23).
In Vitro Primary Neuronal Culture--
Primary neuronal cultures
of eDRG and eSCN were established using modifications of existing
procedures (24-26). Briefly, dorsal root ganglia and spinal cord
neurons were harvested from 15-day-old fetal Sprague-Dawley rats. For
culture of eDRG, dissociated cells were plated onto 24-well plates
coated with Matrigel at a density of 1 × 106
cells/well. One day postplating the cells were treated with 10 µM cytosine
-D-arabinofuranoside for
48 h. Cells were maintained in Dulbecco's minimal essential
medium supplemented with 5% heat-inactivated fetal bovine serum, 5 mM L-glutamine, 0.6% D-glucose,
2% B27 supplement, and 100 ng/ml 2.5S mouse nerve growth factor.
Cultures were maintained for 2 weeks at 37 °C in 95% air/5%
CO2 before addition of test materials.
In the case of eSCN, dissociated cells were plated onto 12-well plates
coated with poly-D-lysine at a density of 2 × 106 cells/well. After 1 week, the cells were treated with
35 µg/ml uridine and 15 µg/ml 2-fluoro 5'-deoxyuridine and grown in
minimal essential medium supplemented with 5% heat-inactivated horse
serum, 2 mM L-glutamine, 0.6%
D-glucose, 40 ng/ml corticosterone, 20 ng/ml
triiodothyronine, 0.15% (w/v) sodium bicarbonate, and 2% N1
supplement. Cultures were maintained for 3 weeks at 37 °C in 90%
air/10% CO2 before addition of test materials.
In Vitro Assessment of Neurotransmitter Release and SNAP-25
Cleavage--
Release of substance P from eDRG was assessed by
enzyme-linked immunosorbent assay. Briefly, eDRG cells were washed
twice with low potassium-balanced salt solution (BSS: 5 mM
KCl, 137 mM NaCl, 1.2 mM MgCl2, 5 mM glucose, 0.44 mM
KH2PO4, 20 mM HEPES, pH 7.4, 2 mM CaCl2). Basal samples were obtained by
incubating each well for 5 min with 1 ml of low potassium BSS. After
removal of this buffer, the cells were stimulated to release by
incubation with 1 ml of high potassium buffer (BSS as above with
modification to include 100 mM KCl isotonically balanced
with NaCl) for 5 min. All samples were removed to tubes on ice prior to
assay of substance P. Total cell lysates were prepared by addition of
250 µl of 2 M acetic acid/0.1% trifluoroacetic acid to
lyse the cells, centrifugal evaporation, and resuspension in 500 µl
of assay buffer. Diluted samples were assessed for substance P content.
Substance P immunoreactivity was measured using Substance P Enzyme
Immunoassay Kits (Cayman Chemical Company or R&D Systems) according to
manufacturers' instructions. Substance P is expressed in pg/ml
relative to a standard substance P curve run in parallel.
Release of glutamate from eDRG was assessed as described previously
(27). Briefly, eDRG were exposed to 2-5 µCi/ml (1 ml/well) of
[3H]-L-glutamine for 80 min at 37 °C,
prior to extensive washing in low potassium BSS. Cells were stimulated
to release by the addition of 100 mM KCl for 3 min.
Released glutamate was identified following separation of
L-[3H]glutamate from non-metabolized
L-[3H]glutamine by ion exchange
chromatography (Dowex-1).
Release of transmitter from eSCN was determined essentially as
described previously (25). Briefly, eSCN cells were washed with BSS and
then loaded with [3H]glycine for 30 min prior to wash and
then removal of basal and stimulated (using 56 mM
K+ solution) samples. Cells were lysed by addition of 250 µl of 2 M acetic acid/1% trifluoroacetic acid, and a
sample was used to determine total counts from which % release could
be calculated. The basal, stimulated, and cell lysate readings were
determined by liquid scintillation counting of the cleared superfusate
collected from each treatment. Determination of the ratio of cleaved
SNAP-25 to uncleaved SNAP-25 in eDRG following exposure to conjugate
material was assessed as described previously (28).
In Vivo Electrophysiology Model--
Test material was applied
intrathecally using methodology previously described (29, 30).
Briefly, to assess the acute effects of test material on the responses
of spinal cord neurons to stimulation of C-, A
- and A
-fibers, 100 µl of LHN/A-ECL (4.5 µg/µl) was applied to the
exposed spinal cord of halothane/nitrous oxide anesthetized rats. Rats
were maintained at 37 °C in a state of areflexia under 1.5-1.8%
halothane. Extracellular recordings of convergent dorsal horn neurons
were made with parylene-coated tungsten electrodes descended through
the spinal cord (mean depth of recording neurons was 700 µm from the
surface of the cord). The responses of neurons following transcutaneous
electrical stimulation (2-ms wide pulses) of the center of the
receptive field were recorded. Responses elicited by a train of 16 stimuli at three times the stimulation threshold for C-fibers were
quantified and followed for up to 8 h following spinal application
of test material.
In a separate group of animals, assessment of electrophysiological
response 24 h after application of conjugate was performed by
modification of the above procedure. 10 µl of a 4.5 µg/µl
solution of LHN/A-ECL was applied by intrathecal injection
between lumbar sections L4-L5. Animals were allowed to recover, and
then analysis of neuronal activity was made at 24 h
postapplication, at which time 10 neurons from a single animal were
assessed for response to transcutaneous electrical stimulation as
described above. Recordings from 10 neurons from an untreated animal
were used to establish control response.
Mouse Toxicity--
The ability of botulinum toxin and conjugate
material to induce paralysis in mice (20-25 g, MF1) was evaluated
following intraperitoneal injection of 0.5 ml of test sample in
gelatin-phosphate buffer (1% (w/v) Na2HPO4,
0.2% (w/v) gelatin, pH 6.5-6.6, using methodology reported previously
(31).
 |
RESULTS |
Purification and Characterization of
LHN/A-ECL Conjugate--
To prepare
a conjugate capable of selective targeting of eDRG neurons, data were
obtained for the binding of a range of fluorescein isothiocyanate-labeled lectins to eDRG and eSCN. Data obtained for the
lectin obtained from the seeds of ECL demonstrated the most appropriate
pattern of eDRG localization (data not shown).
Conjugation of ECL to the nLHN/A (native LHN/A)
and recLHN/A (recombinant LHN/A)
fragment was performed essentially as previously described for a wheat
germ agglutinin-LHN/A conjugate (9), resulting in a
conjugation efficiency of 15.9 ± 4.3% (mean yield of ~5 mg of
conjugate from 8 mg of LHN/A and 25 mg of ECL). There were
no significant differences between the derivatization rates or final
conjugate yield when nLHN/A,
recLHN/A, or
recLHN/A(H227Y) was used for conjugate
synthesis. Purification of the conjugate was achieved by a two-step
process, involving size-exclusion chromatography to remove unconjugated
ECL followed by affinity chromatography (immobilized lactose) to remove
unconjugated LHN/A. When analyzed by SDS-PAGE (Fig.
1), conjugated species of ~160 kDa are
the major component of the final material, representative of a single
LHN/A endopeptidase covalently coupled to two ECL monomers.
The species of ~30 kDa apparent in lane 6 of Fig. 1
represents ECL monomers that have been liberated from the conjugate in
the presence of SDS, thus the final molecular mass of the predominant
conjugate species is ~200 kDa. However, it is clear from SDS-PAGE and
size exclusion data that there is a range of conjugate species of
varying ECL:LHN/A ratios present in the final purified
mixture. Analysis of the conjugate material by native PAGE is
suggestive of predominant conjugate species of 200 and 400 kDa (data
not shown).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 1.
SDS-PAGE analysis of
nLHN/A-ECL
conjugate. Protein fractions were subjected to SDS-PAGE (4-20%)
prior to staining with Coomassie Blue stain. Lanes 2 and
3 represent derivatized ECL and derivatized
nLHN/A, respectively. Lane 4 is representative
of the initial conjugation mixture prior to purification. Lanes
5 and 6 represent the conjugation mixture after
Superose-12 chromatography and after lactose-affinity chromatography,
respectively. Lane 6 represents the final material used for
in vitro and in vivo assessment. Approximate
molecular masses are indicated in lanes 1 and 7.
The profile of nLHN/A-ECL conjugate is representative of
the SDS-PAGE profile of recLHN/A-ECL and
recLHN/A(H227Y)-ECL as no significant
differences were observed.
|
|
In addition to the functionality of the ECL domain, as assessed by
lactose binding, it was necessary to confirm that the endopeptidase activity of the conjugate was not adversely affected by the
derivatization/conjugation process. By utilizing an in vitro
SNAP-25 cleavage assay (23), it was possible to demonstrate that the
catalytic activity of LHN/A was maintained in the context
of the conjugate. The concentration of material to result in 50%
cleavage of SNAP-25 (EC50) was estimated to be 8.3 ± 1.7 pM, 5.4 ± 1.6 pM, 12.8 ± 7.8 pM, and 7.5 ± 2.2 pM for
recLHN/A, nLHN/A,
recLHN/A-ECL, and nLHN/A-ECL,
respectively. It was not possible to estimate an EC50 for
recLHN/A(H227Y) and recLHN/A(H227Y)-ECL due to insufficient cleavage
of SNAP-25; however, data indicated that the endopeptidase activity of
the recLHN/A(H227Y) species was reduced
~300-fold compared with recLHN/A. This is in
reasonable agreement with the data previously reported for this H227Y
mutation in the light chain of BoNT/A (32).
The toxicity of the conjugate compared with BoNT/A was assessed in the
standard measure of toxicity for botulinum toxins, the mouse lethality
assay. The mouse lethality assay is highly sensitive for BoNT, with a
detection limit of only 5 pg (33). Injection of 50 µg of
recLHN/A-ECL or
nLHN/A-ECL conjugate did not result in any mouse deaths.
Therefore the conjugate material has an improved toxicity profile of
the order of 1 × 107, even though full endopeptidase
activity is retained. This presumably reflects the differing neuronal
selectivity of the two agents.
Inhibition of Neurotransmitter Release in Vitro--
In
vitro DRG cultures obtained from embryonic rat tissue include
neuronal populations representative of primary nociceptive afferents,
and by measuring the release of appropriate neurotransmitters effects
of agents on this neuronal population can be assessed. The close
proximity of SCN to the DRG in vivo and the fact that SCN
are exquisitely sensitive to BoNT holotoxin make the SCN system an
appropriate control for the effects of inappropriately targeted endopeptidase. In addition, the outcome of treating both these cell
types with BoNT has been reported previously (18, 34).
BoNT/A, nLHN/A-ECL, recLHN/A-ECL,
recLHN/A(H227Y)-ECL, and unconjugated control
materials were applied to eDRG and eSCN 3 days prior to assay of
neurotransmitter release (substance P, and for some assays glutamate,
from eDRG; glycine from eSCN). Fig. 2
indicates the comparative effectiveness of nLHN/A-ECL, recLHN/A-ECL, and BoNT in their ability to
inhibit release of substance P from eDRG (Fig. 2A) and
glycine from eSCN (Fig. 2B). The IC50 values for
inhibition of substance P were 17.5 ± 5.5 nM
(n = 8), 17.5 ± 2.5 nM
(n = 12), and 5.6 ± 0.93 pM
(n = 4) for eDRG treated with nLHN/A-ECL,
recLHN/A-ECL, and BoNT/A, respectively. These
data, therefore, confirm the equivalence of the two conjugated ECL
products. By comparison, it was not possible to calculate the
IC50 for nLHN/A-,
recLHN/A(H227Y)-, or
recLHN/A(H227Y)-ECL-treated cells due to the
lack of effect even at high concentration. In all cases, the dose
response observed for neurotransmitter release was in good agreement
with the cleavage of SNAP-25. For example, cleavage of SNAP-25 (and
inhibition of substance P release) from 30 µg/ml
nLHN/A-ECL or recLHN/A-ECL-treated
eDRG was determined to be 90.2 ± 6.0% (80.9 ± 4.3%) and
74.8 ± 6.5% (76.9 ± 2.2%), respectively.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
Inhibition of neurotransmitter release from
cultured neuronal cells in vitro. Embryonic DRG
(A) and SCN (B) were exposed for 3 days to a
range of concentrations of nLHN/A-ECL ( ),
recLHN/A-ECL ( ), and BoNT ( ). After this
time, the ability of the cells to release substance P (eDRG) or glycine
(eSCN) was assessed. Results are expressed as percent inhibition
compared with untreated controls. Each concentration was assessed in
triplicate, and for each treatment the dose-response curve is
representative of at least three experiments. Each point shown is the
mean of at least three determinations ± the standard error of the
mean.
|
|
In addition to an assessment of the inhibition of release of substance
P, the effect of ECL-targeted conjugates on the release of the fast
neurotransmitter glutamate from eDRG was also determined. Following
application of 10 µg/ml nLHN/A-ECL to eDRG for 3 days, 83.3 ± 9.1% (n = 3) inhibition of glutamate
release was observed, compared with 11.4 ± 1.7% inhibition by
LHN/A alone.
In the eSCN model, the IC50 for inhibition of glycine by
BoNT/A is 0.03 ± 0.01 pM (n = 3),
whereas the IC50 for inhibition of glycine release by
LHN/A-ECL conjugates could not be calculated due to the low
effect (mean inhibition of release of 17.04 ± 2.1% (recLHN/A-ECL) and 40.94 ± 2.36%
(nLHN/A-CL) at the maximum concentration used (30 µg/ml)). The ratio of IC50 data for inhibition of release for eSCN compared with eDRG neuron for BoNT/A-treated cells is 0.005:1.
Due to the low effect of LHN/A-ECL conjugates in the eSCN
model, it was not possible to accurately calculate such a ratio for
LHN/A-ECL; however, it is estimated to be in the order of
at least 6.9:1.
Duration of action of ECL-targeted endopeptidase conjugates in
vitro was assessed in the eDRG model. 40 µg/ml
nLHN/A-ECL or 40 µg/ml
recLHN/A-ECL was applied to eDRG for 16 h
prior to removal and assay of substance P release at specific intervals
up to 24 days postapplication (Fig. 3).
Maximal inhibition of substance P release was achieved after ~10 days
(71 and 68.2% for nLHN/A-ECL and
recLHN/A-ECL, respectively) with significant
effects still observed to the end point of each assay. In a parallel
series of experiments, effects of BoNT/A were also maintained to the end point of the assay (data not shown). The data therefore indicate that retargeted LHN/A does retain extended duration of
effect in in vitro cell models akin to that of the
holotoxin. The data also demonstrate the equivalence of the recombinant
LHN/A and native LHN/A in this respect.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 3.
Inhibition of substance P release from eDRG
over extended periods. Embryonic DRG were exposed for 16 h to
40 µg/ml each of nLHN/A-ECL ( ) and
recLHN/A-ECL ( ). After this time, the
solution was removed, the cells washed, and the media replaced. The
ability of the cells to release substance P over the subsequent 24 days
was assessed. Results are expressed as percent inhibition compared with
untreated controls. Each point shown is the mean of at least three
determinations ± the standard error of the mean. The data are
representative of three experiments.
|
|
In addition to establishing the selectivity and duration of action of
LHN/A-ECL, the in vitro cell culture systems
have provided data regarding the mechanism of action of the conjugates.
In the first instance, use of the endopeptidase-deficient ECL
conjugate, recLHN/A(H227Y)-ECL, has confirmed
that inhibition of neurotransmitter release is dependent on cleavage of
SNAP-25. Second, delivery of the conjugate has been shown to be ECL
ligand-mediated because both release and SNAP-25 cleavage were
decreased in the presence of increasing ECL ligand. At the maximum
concentration of competing ligand assessed, 100-fold molar excess,
inhibition of substance P release by LHN/A-ECL was reduced
from 62.7 to 11%. Third, none of the conjugates demonstrated a
cytotoxic effect toward the cells, even after prolonged exposure.
Inhibition of Neuronal Activity in Vivo--
The recording of
single dorsal horn neuronal activity provides a powerful means of
testing the effects of agents on sensory transmission from peripheral
sensory afferents through the spinal cord. Following transcutaneous
electrical stimulation above C-fiber thresholds, activity due to A
-
(non-noxious), A
-, and C-fibers (noxious) can be separated on the
basis of latency. The responses of the recorded neurons to afferent
stimuli involve the release of glutamate from A
-, A
-, and
C-fibers and an additional contribution of peptides such as substance P
and calcitonin gene-related peptide from C-fibers (possibly also
A
-fibers). Activation of the
N-methyl-D-aspartate receptor for
glutamate then causes an increase in excitability of the neurons, which
is manifested as the postdischarge (firing over the normal
C-fiber-induced level) (30). Analysis of these responses allows the
input (a measure of transmission from the presynaptic afferent terminal
onto the spinal postsynaptic neuron) and postdischarge (measure of
postsynaptic hyperexcitability) to be extracted.
Following application of the conjugate directly onto the exposed spinal
cord, nLHN/A-ECL exerted no effect over the first 5 h.
Over the next few hours, however, there was a progressive decrease in
both the C-fiber-evoked activity and the postdischarge of the recorded
neurons suggesting that the conjugate selectively inhibits
noxious-evoked activity with a slow onset of action. recLHN/A-ECL had similar effects. This suggests
a mode of action at presynaptic sites that is selective for
noxious-evoked activity, which was confirmed by the finding that the
conjugate reduced the total input into the recorded neuron. Contrary to
the relatively clear response to addition of conjugate material, ECL
alone had a predominantly facilitatory effect on the C-fiber-evoked
response and postdischarge, and again no effect on A
-fiber-evoked responses.
A final in vivo study was devised to investigate the
potential actions of LHN/A-ECL over a longer time course
than was possible in the acute studies. LHN/A-ECL was
injected into the intrathecal space of an anesthetized rat at the L4-L5
segment, and the animal was allowed to recover and was then prepared
for electrophysiological recordings from this segment 24 h later.
A total of 10 randomly selected neurons were recorded in the treated
animal, and 10 cells in a normal uninjected animal were used as
controls. The responses measured are presented in Fig.
4. After 24 h, data from the 10 neurons recorded indicated reduction in C-fiber-evoked responses; the
C-fiber-evoked response was reduced by 31.8%, whereas A
-fiber was
reduced by only 12.1% and A
-fiber remained unchanged. Postdischarge and input were unchanged. Of these 10 neurons when the recordings made
from those (5) closest to the zone of the spinal cord corresponding to
the site of injection were analyzed, the cells here showed strongly
inhibited responses. In this zone, C-fiber activity was reduced by
75.8% and postdischarge by 78.2% as was input (77.8%). The
A
-fiber-evoked activity was reduced by 42.3%, whereas the
A
-fiber-evoked responses were unchanged.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 4.
Inhibition of C-fiber function as assessed by
in vivo electrophysiology. LHN/A-ECL
(10 µl of a 4.5 µg/µl) was injected into the intrathecal space of
an anesthetized rat between lumbar sections L4-L5. Animals were allowed
to recover, and analysis of neuronal activity was made at 24 h
postapplication, at which time 10 neurons from a single animal were
assessed for response to transcutaneous electrical stimulation as
described under "Experimental Procedures." Recordings
from 10 neurons from an untreated animal were used to establish control
response. Data for all 10 neurons (Test (n = 10)) in
the experimentally treated animal and selected data for 5 neurons (Test
(n = 5)) that were within a strongly inhibited zone,
are presented. Data were obtained for C-fiber, A -fiber, A -fiber
responses, along with an assessment of postdischarge and input. See
"Results" for explanation of terms.
|
|
 |
DISCUSSION |
This report represents the first attempt to selectively target the
endopeptidase activity of clostridial neurotoxins to specific cell
types. Previous reports (9, 13) have outlined the feasibility of
endopeptidase retargeting, described some of the properties of such
novel conjugates, and proposed that such an approach may be used to
generate novel tools. The focus of the data presented in this report,
however, has been to engineer a retargeted clostridial endopeptidase
conjugate to have selectivity for nociceptive afferent neurons, with
little effect on neighboring neuronal populations. This has obvious
potential in applying the technology therapeutically.
An initial aspect of this work was to identify ligands that had greater
selectivity for the target primary nociceptive sensory afferents than
surrounding cells. From this analysis it was established that lectins
that recognized terminal galactosyl residues were one such category of
ligand and the lectin ECL was chosen for this model study. When
assessed in the eDRG and eSCN in vitro models, the
IC50 for BoNT/A-dependent inhibition of
transmitter release from eDRG is 187-fold greater than that for
inhibition of release from eSCN, whereas the equivalent
IC50 ratio for the LHN/A-ECL conjugate has been
estimated to be at least 0.15. Thus the conjugate has a projected
improvement of over 103 compared with BoNT/A in terms of
selectively targeting nociceptive neurons relative to adjacent spinal
cord neurons. Utilizing an endopeptidase conjugate containing wheat
germ agglutinin, a glucosyl-binding lectin, that has been reported
previously (9), the IC50 for inhibition of transmitter
release from eDRG and eSCN were determined to be 0.32 ± .0.05 µg/ml and 0.06 ± 0.01 µg/ml, a DRG:SCN ratio of 5.3. Again,
this is significantly different from the data described for ECL-based
conjugates and confirms that galactosyl lectins are preferred lectin
ligands for this application.
As anticipated, the use of an endopeptidase-deficient LHN/A
mutant (recLHN/A(H227Y)) confirmed that
conjugate-dependent inhibition of neurotransmitter release
is a result of SNAP-25 cleavage rather than nonspecific ligand-mediated
effects. The equivalence of cleavage and inhibition data further
support this.
The majority of the data presented in this report regarding inhibition
of neurosecretion from eDRG neuronal cultures is for release of
substance P. This is an important neurotransmitter of nociception and
is representative of the neuropeptide transmitters that are released by
primary nociceptive afferent neurons. However, the observation that
LHN/A-ECL is able to inhibit the release of glutamate (also
important in nociceptive transmission) from eDRG neuronal cultures as
effectively as it does substance P is therefore important as it
demonstrates that the conjugate is inhibiting secretion from all the
vesicle populations in the target neuron. This ability to block
secretion from multiple vesicle populations in a given target neuron is
particularly important in situations like nociception, where it is
known that multiple neurotransmitters are involved in the sensation of pain.
One of the most striking aspects of intoxication with the botulinum
neurotoxins is their extended duration of action. In clinical use this
results in prolonged relief of symptoms for the patient, with
therapeutic benefit often lasting many months. The data obtained from the in vitro eDRG assay clearly demonstrate that the
duration of action of conjugates was equivalent, within the limits of
the assay, to that seen with the holotoxin. These in vitro
results demonstrate that clostridial endopeptidase delivered into a
cell by a novel binding ligand retains the property of prolonged
inhibition of secretion. This would indicate that the extended duration
of action is a property of the endopeptidase activity of the neurotoxin and that it is independent of the cellular delivery mechanism. The
results are also supportive of the potential for longevity of effect
in vivo. The observation that reduction of C-fiber activity by LHN/A-ECL was observed 24 h after intrathecal
application is indicative that the extended duration of action observed
in vitro is indeed being realized in vivo.
Though the in vitro data are critical to understanding the
mechanism of action of the conjugate, a key observation from this report is that the in vivo electrophysiological data
confirmed the in vitro conclusions. Both the recombinant and
the native versions of the conjugate showed activity at the level of
the dorsal horn of the spinal cord. The marked effects on input and the
C-fiber-evoked responses suggest a main site of action for LHN/A-ECL on transmission from the presynaptic peripheral
nociceptive sensory neuron. The observations are therefore consistent
with LHN/A-ECL inhibiting release of neurotransmitters from
the terminals of primary nociceptive afferents. The effects of the
conjugate on postdischarge is likely to be indirect due to the
reduction in transmitter release secondarily reducing the neuronal
excitability. The in vivo results thus show that the
conjugate acts to selectively inhibit noxious-evoked activity, sparing
A
-fiber firing which, under normal conditions, conveys non-noxious
activity. This is supportive of the view that the selective targeting
of the endopeptidase activity of BoNT/A results in selective blocking
of primary nociceptive transmission in the spinal cord. The ligand
alone had no inhibitory effects on the primary nociceptive afferents,
but did modify the electrophysiological response recorded following
peripheral afferent stimulation. This is perhaps not surprising given
that ECL was selected for its ability to selectively bind to these
neurons and is further evidence for its selective interaction with
primary nociceptive afferents at the spinal level in vivo.
The effects were not consistent with inhibition of neurotransmission,
unlike those of the LHN/A-ECL conjugates.
The in vitro and in vivo data described in this
report demonstrate that LHN/A-ECL is a novel agent designed
to selectively deliver the endopeptidase activity of BoNT/A to primary
nociceptive afferent neurons. The retargeted conjugate displays
properties in terms of selectivity, duration of action, and lack of
cytotoxicity, which are supportive of the ability to produce agents
based upon retargeted clostridial neurotoxin endopeptidase with
therapeutic potential. Specifically, LHN/A-ECL display
properties, both in vitro and in vivo, which are
consistent with the application of this approach to the development of
novel analgesic agents with extended duration of action.
 |
ACKNOWLEDGEMENTS |
We acknowledge the contributions of Roger
Ling, Rob Fretwell, Karen Jameson, and Ian McEntee for supply of
materials and data.
 |
FOOTNOTES |
*
This work was supported by Allergan Inc.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Present address: Dept. of Trade and Industry, 151 Buckingham Palace
Road, London, SW1W 9SS, UK.
¶
Present address: Meningitis and Special Pathogens Branch, Div.
of Bacterial and Mycotic Diseases, MailStop D11, National Center for Infectious Diseases, 1600 Clifton Rd. N.E., Atlanta, GA 30333.
To whom correspondence should be addressed. Tel.:
44-0-1980-612733; Fax: 44-0-1980-611310; E-mail:
john.chaddock@camr.org.uk.
Published, JBC Papers in Press, July 8, 2002, DOI 10.1074/jbc.M202902200
 |
ABBREVIATIONS |
The abbreviations used are:
CNT, clostridial
neurotoxin;
HC, heavy chain C terminus;
HN, heavy chain N terminus;
SNARE, soluble NSF attachment protein
receptors;
SNAP, synaptosome-associated protein-25;
eDRG, embryonic
dorsal root ganglia;
ECL, Erythrina cristagalli lectin;
eSCN, embryonic spinal cord neuron;
BSS, balanced salt solution.
 |
REFERENCES |
| 1.
|
Simpson, L. L.
(1981)
Pharmacol. Rev.
33,
155-188[Medline]
[Order article via Infotrieve]
|
| 2.
|
Shone, C. C.,
Hambleton, P.,
and Melling, J.
(1987)
Eur. J. Biochem.
167,
175-180[Medline]
[Order article via Infotrieve]
|
| 3.
|
Chaddock, J.
(2002)
Prot. Exp. Purif.
25,
219-228[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Halpern, J. L.,
and Neale, E. A.
(1995)
Curr. Top. Microbiol. Immunol.
195,
221-241[Medline]
[Order article via Infotrieve]
|
| 5.
|
Nishiki, T.,
Kamata, Y.,
Nemoto, Y.,
Omori, A.,
Ito, T.,
Takahashi, M.,
and Kozaki, S.
(1994)
J. Biol. Chem.
269,
10498-10503[Abstract/Free Full Text]
|
| 6.
|
Li, L.,
and Singh, B. R.
(1998)
J. Nat. Toxins
7,
215-226[Medline]
[Order article via Infotrieve]
|
| 7.
|
Hoch, D. H.,
Romero-Mira, M.,
Ehrlich, B. E.,
Finkelstein, A.,
DasGupta, B. R.,
and Simpson, L. L.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
1692-1696[Abstract/Free Full Text]
|
| 8.
|
Sandvig, K.,
and Olsnes, S.
(1980)
J. Cell Biol.
87,
828-832[Abstract/Free Full Text]
|
| 9.
|
Chaddock, J. A.,
Purkiss, J. R.,
Friis, L. M.,
Broadbridge, J. D.,
Duggan, M. J.,
Fooks, S. J.,
Shone, C. C.,
Quinn, C. P.,
and Foster, K. A.
(2000)
Infect. Immun.
68,
2587-2593[Abstract/Free Full Text]
|
| 10.
|
Sollner, T.,
Whiteheart, S. W.,
Brunner, M.,
Erdjument-Bromage, H.,
Geromanos, S.,
Tempst, P.,
and Rothman, J. E.
(1993)
Nature
362,
318-324[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Blasi, J.,
Chapman, E. R.,
Link, E.,
Binz, T.,
Yamasaki, S., De,
Camilli, P.,
Sudhof, T. C.,
Niemann, H.,
and Jahn, R.
(1993)
Nature
365,
160-163[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Montecucco, C.,
and Schiavo, G.
(1994)
Mol. Microbiol.
13,
1-8[Medline]
[Order article via Infotrieve]
|
| 13.
|
Chaddock, J. A.,
Purkiss, J. R.,
Duggan, M. J.,
Quinn, C. P.,
Shone, C. C.,
and Foster, K. A.
(2000)
Growth Factors
18,
147-155[Medline]
[Order article via Infotrieve]
|
| 14.
|
Brashear, A.,
Watts, M. W.,
Marchetti, A.,
Magar, R.,
Lau, H.,
and Wang, L.
(2000)
Clin. Ther.
22,
1516-1524[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Johnson, E. A.
(1999)
Annu. Rev. Microbiol.
53,
551-575[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Dray, A.,
Urban, L.,
and Dickenson, A.
(1994)
Trends Pharmacol. Sci.
15,
190-197[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
De Biasi, S.,
and Rustioni, A.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
7820-7824[Abstract/Free Full Text]
|
| 18.
|
Welch, M. J.,
Purkiss, J. R.,
and Foster, K. A.
(2000)
Toxicon.
38,
245-258[Medline]
[Order article via Infotrieve]
|
| 19.
|
Lis, H.,
and Sharon, N.
(1986)
Annu. Rev. Biochem.
55,
35-67[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Sharon, N.
(1993)
Trends Biochem. Sci.
18,
221-226[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Streit, W. J.,
Schulte, B. A.,
Balentine, D. J.,
and Spicer, S. S.
(1985)
J. Histochem. Cytochem.
33,
1042-1052[Abstract]
|
| 22.
|
Streit, W. J.,
Schulte, B. A.,
Balentine, J. D.,
and Spicer, S. S.
(1986)
Brain Res.
377,
1-17[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Hallis, B.,
James, B. A. F.,
and Shone, C. C.
(1996)
J. Clin. Microbiol.
34,
1934-1938[Abstract]
|
| 24.
|
Ransom, B. R.,
Neale, E.,
Henkart, M.,
Bullock, P. N.,
and Nelson, P. G.
(1977)
J. Neurophysiol.
40,
1132-1150[Abstract/Free Full Text]
|
| 25.
|
Williamson, L. C.,
Halpern, J. L.,
Montecucco, C.,
Brown, J. E.,
and Neale, E. A.
(1996)
J. Biol. Chem.
271,
7694-7699[Abstract/Free Full Text]
|
| 26.
|
Welch, M. J.,
and Foster, K. A.
(1999)
in
The Neuron in Tissue Culture
(Haynes, L. W., ed), Vol. 18
, pp. 389-393, John Wiley & Sons Ltd., Chichester, UK
|
| 27.
|
Purkiss, J. R.,
Welch, M. J.,
Doward, S.,
Foster, K. A.,
and Quinn, C. P.
(1998)
Biochem. Soc. Trans.
26,
S108[Medline]
[Order article via Infotrieve]
|
| 28.
|
Boyd, R. S.,
Duggan, M. J.,
Shone, C. C.,
and Foster, K. A.
(1995)
J. Biol. Chem.
270,
18216-18218[Abstract/Free Full Text]
|
| 29.
|
Dickenson, A. H.,
and Sullivan, A. F.
(1986)
Pain
24,
211-222[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Matthews, E. A.,
and Dickenson, A. H.
(2001)
Pain
92,
235-246[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Tse, C. K.,
Dolly, J. O.,
Hambleton, P.,
Wray, D.,
and Melling, J.
(1982)
Eur. J. Biochem.
122,
493-500[Medline]
[Order article via Infotrieve]
|
| 32.
|
Zhou, L.,
de Paiva, A.,
Liu, D.,
Aoki, R.,
and Dolly, J. O.
(1995)
Biochemistry
34,
15175-15181[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Notermans, S.,
and Nagel, J.
(1989)
in
Botulinum Neurotoxin and Tetanus Toxin
(Simpson, L. L., ed)
, pp. 319-331, Academic Press, New York
|
| 34.
|
Neale, E. A.,
Bowers, L. M.,
Jia, M.,
Bateman, K. E.,
and Williamson, L. C.
(1999)
J. Cell Biol.
147,
1249-1260[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Turton, R. Natesh, N. Thiyagarajan, J. A. Chaddock, and K. R. Acharya
Crystal structures of Erythrina cristagalli lectin with bound N-linked oligosaccharide and lactose
Glycobiology,
October 1, 2004;
14(10):
923 - 929.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V P. Misra
The changed image of botulinum toxin
BMJ,
November 23, 2002;
325(7374):
1188 - 1188.
[Full Text]
[PDF]
|
 |
|