Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M206395200 on July 9, 2002

J. Biol. Chem., Vol. 277, Issue 38, 35466-35474, September 20, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/38/35466    most recent
M206395200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, C. G.
Right arrow Articles by Elias, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, C. G.
Right arrow Articles by Elias, J. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Transgenic Overexpression of Interleukin (IL)-10 in the Lung Causes Mucus Metaplasia, Tissue Inflammation, and Airway Remodeling via IL-13-dependent and -independent Pathways*

Chun Geun LeeDagger , Robert J. Homer§, Lauren CohnDagger , Holger Link, Sungsoo Jung||, Joseph E. Craft**, Barney S. GrahamDagger Dagger , Teresa R. JohnsonDagger Dagger , and Jack A. EliasDagger §§

From the Dagger  Section of Pulmonary and Critical Care Medicine, Department. of Internal Medicine, Yale University School of Medicine, New Haven, Connecticut 06520-8057, the § Department of Pathology, Yale University School of Medicine, New Haven, Connecticut 06520 and the Pathology and Laboratory Medicine Service, Veterans Administration Connecticut Health Care System, West Haven, Connecticut 06516, the  Section of Respiratory Medicine, Department of Pediatrics, Yale University School of Medicine, New Haven, Connecticut 06520-8057, the || Division of Rheumatology, Hanyang University Medical College and Hospital for Rheumatic Disease, 17 Hangdang-dong, Sungdong-gu, Seoul 133-792, South Korea, the ** Section of Rheumatology, Department of Internal Medicine, Yale University School of Medicine, New Haven, Connecticut 06520-08057, and the Dagger Dagger  Division of Infectious Diseases, Vanderbilt University School of Medicine, Nashville, Tennessee 37232-2582

Received for publication, June 27, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

To address the complex chronic effector properties of interleukin (IL)-10, we generated transgenic mice in which IL-10 was overexpressed in the lung. In these mice, IL-10 inhibited endotoxin-induced tumor necrosis factor production and neutrophil accumulation. IL-10 also caused mucus metaplasia, B and T cell-rich inflammation, and subepithelial fibrosis and augmented the levels of mRNA encoding Gob-5, mucins, and IL-13. In mice bred to have null mutations of IL-13, IL-4Ralpha , or STAT-6, transgenic IL-10 did not induce mucus metaplasia but did induce inflammation and fibrosis. IL-10 was also a critical mucin regulator of virus-induced mucus metaplasia. Thus, IL-10, although inhibiting lipopolysaccharide-induced inflammation, also causes mucus metaplasia, tissue inflammation, and airway fibrosis. These responses are mediated by multiple mechanisms with mucus metaplasia being dependent on and the inflammation and fibrosis being independent of an IL-13/IL-4Ralpha /STAT-6 activation pathway.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

IL-101 was originally described as a product of type 2 T cells that inhibited interferon-gamma (IFN-gamma ) production by type I murine T cell clones. Subsequent studies demonstrated that IL-10 is produced by a wide variety of cells including monocytes, macrophages, eosinophils, and bronchial epithelial cells (1, 2). They also highlighted the impressive immunosuppressive, anti-inflammatory, and tissue-protective effects of this cytokine (3-6). This included studies that demonstrated that IL-10 decreases tissue inflammation and injury in animal models of a variety of pulmonary and extrapulmonary human disorders (5, 7-9) and that IL-10-deficient mice have Th1 polarized immune responses and develop severe inflammatory colitis resulting from chronic stimulation by enteric antigens (10). In an attempt to capitalize on these anti-inflammatory and protective properties, IL-10 is being used in clinical trials to treat patients with inflammatory bowel disease, rheumatoid arthritis, and psoriasis and chronic IL-10 administration has been proposed as a treatment for pulmonary disorders such as cystic fibrosis and asthma (2, 11-13).

In contrast to its anti-inflammatory properties, IL-10 also has well defined pro-inflammatory and immunostimulatory effector functions. They include the ability to stimulate thymocyte, T cell, B cell, and mast cell proliferation, differentiation, and cytokine elaboration and to activate endothelial cells (14-18). These and other properties of IL-10 likely contribute to its ability to augment transplant graft rejection (19), contribute to the pathogenesis of autoimmunity and anti-tumor immunity (20-22), and decrease survival and microbe clearance in models of specific bacterial pneumonias (23, 24). Although IL-10 has been proposed to be a useful therapeutic agent that can be chronically administered to patients with inflammatory disorders, the chronic effects of IL-10 in the lung and other organs have not been adequately defined.

The complexities of IL-10 are nicely illustrated in its role in the pathogenesis and treatment of asthma. A number of lines of evidence suggest that IL-10 has a predominantly anti-inflammatory effect in this setting. This includes in vitro studies that demonstrate that IL-10 inhibits Th2 cell cytokine elaboration (9, 13, 25), IgE production (26), eosinophil survival (27), and antigen-induced eosinophilic inflammation and tumor necrosis factor (TNF) production (9, 25, 28). Similarly, some in vivo studies have demonstrated a relative deficiency in the production and/or accumulation of IL-10 in asthmatics (12, 29, 30). This led to the belief that decreased IL-10 production contributes to the chronic inflammation that is characteristic of asthma and that rIL-10 could be a useful therapeutic in this disorder (6, 13, 25). In contrast, an equally cogent body of data suggests that IL-10 can contribute to the pathogenesis of this disorder. This is based on studies that demonstrate that IL-10 augments antigen-induced eosinophilic inflammation, airway hyperresponsiveness, airway mucus metaplasia, and IL-5 elaboration in acute asthma models (9, 31, 32) and studies demonstrating that IL-10 mRNA can be detected in elevated quantities in asthmatics at base line and after segmental antigen challenge (9, 33-35). The degree to which chronic IL-10 can, by itself, induce or exacerbate inflammatory, mucus, and fibrotic responses comparable to those in asthmatic airways has, however, not been investigated.

To further understand the chronic effects of IL-10 in the lung, we generated and characterized mice in which IL-10 was chronically overexpressed in the airway. These studies demonstrate that IL-10, although inhibiting lipopolysaccharide-induced tissue inflammation and TNF production, simultaneously induces a B and T cell-rich inflammatory response, mucus metaplasia, and airway remodeling. They also demonstrate that IL-10-induces these responses via multiple mechanisms, with the mucus response and the inflammatory and fibrotic responses being mediated by IL-13-dependent and -independent pathways, respectively.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Production and Identification of Transgenic Mice-- Construct pKS-CC10-rtTA-hGH, which contains the 2.3-kb rat CC10 promoter (a gift from Dr. J. Whitsett, University of Cincinnati, Cincinnati, OH), reverse tetracycline transactivator (rtTA), and human growth hormone (hGH) intronic and polyadenylation sequences was prepared as described previously by our laboratory (36). Plasmid pcD(Salpha)-F115, which contains the murine IL-10 cDNA, was obtained from the American Type Culture Collection (ATCC no. 68027) The IL-10 cDNA in this plasmid was then amplified using the following PCR primers: 5'-CACTAAGCTTGCCACAAAGC-3' and 5'-TCCACAGGATCCGTGTTTTAGC-3'. The PCR amplification product was then subcloned into pKS-CC10-rtTA-hGH replacing the rtTA with IL-10. This yielded the construct pKS-CC10-IL-10-hGH. After the fidelity of the junction areas and the IL-10 cDNA was confirmed by sequencing, the construct (Fig. 1A) was digested, isolated, purified, dialyzed, and microinjected as previously described (36, 37).

The presence or absence of the transgene in the resulting animals and their progeny was determined using tail DNA and Southern blot analysis with 32P-labeled murine IL-10 cDNA as a probe or PCR. The primers 5'-TGCTATGCTGCCTGCTCTTA-3' and 5'-TCATTTCCGATAAGGCTTGG-3' were used for PCR genotyping. The following PCR protocol was employed: 95 °C for 3 min, 30 cycles of 95 °C for 1 min, 58 °C for 1 min and 72 °C for 1 min, and a final extension at 72 °C for 10 min.

Bronchoalveolar Lavage (BAL) and Quantification of IL-10-- Mice were euthanized, the trachea was isolated by blunt dissection, and small caliber tubing was inserted and secured in the airway. Three sequential 0.75-ml volumes of PBS with 0.1% bovine serum albumin were then instilled and gently aspirated and pooled. BAL fluid samples were centrifuged, and supernatants were stored at -70 °C until used. The levels of IL-10 were determined with a commercial ELISA as per instructions from the manufacturer (R&D Systems, Inc., Minneapolis, MN).

mRNA Analysis-- mRNA levels were assessed using RT-PCR and ribonuclease protection assays (RPA) as previously described by our laboratory (38, 39). In the RT-PCR assays, gene-specific primers were used to amplify selected regions of each target moiety. The primers and reactions for the Muc-1, Muc-2, Muc-5ac, and beta -actin have been previously described (40). The other primer sequences (5' to 3') are as follows: Muc-4, TCACTGGTAACCGCTTGCTTC and CATCCTGGGGGCTGTAGAC; surfactant D, CTCTCGCAGAGATCAGTACC and GGAAAGCAGCCTTGTTGTGG; IL-4, TCAACCCCCAGCTAGTTGTC and TTCAAGCATGGAGTTTTCCC; IL-5, ATGGAGATTCCCATGAGCAC and GTCTCTCCTCGCCACACTTC; IL-9, GAAGGATGATCCACCGTCAAAATGC and CGTCCCCAGGAGACTCTTCAGAAATG; IL-10, CACTAAGCTTGCCACAAAGC and TCCACAGGATCCGTGTTTTAGC; IL-13, AGACCAGACTCCCCTGTGCA and TGGGTCCTGTAGATGGCATTG; Gob-5, CACAACCACTAAGGTGGCCT and AGGTGTTGAAGTGGTCCCTG; transforming growth factor-beta (TGF-beta 1), CTGTCCAAACTAAGGCTCGC and CGTCAAAAGACAGCCACTCA; interferon-gamma (IFN-gamma ), ACTGGCAAAAGGATGGTCAC and TGAGCTCATTGAATGCTTGG; and L32, TCCAGAGACCATCCATCCTC and ATCCTCTTGCCCTGAATCCTT. To verify that equal amounts of undegraded RNA were added in each RT-PCR reaction, beta -actin was used as an internal standard. Amplified PCR products were detected using 1.2% agarose ethidium bromide gel electrophoresis, quantitated electronically, and confirmed by nucleotide sequencing.

RPA assays were performed using the RiboQuant kit purchased from BD PharMingen (San Diego, CA). These assays were performed according to instructions provided by the manufacturer.

Histologic Evaluation-- Histologic evaluations of 10% formalin, pressure-fixed (25 cm) lungs, and formalin-fixed extrathoracic tissues were obtained as previously described (37-39). Hematoxylin and eosin, Mallory's trichrome, periodic acid-Schiff with diastase (PAS), and Alcian blue stains were performed in the Research Pathology Laboratory at Yale University.

Immunofluorescence Staining and Confocal Microscopy-- To analyze the inflammatory cells in IL-10 transgenic mice, we stained frozen tissue sections with FITC- or PE-labeled antibodies against cell surface markers. In these experiments lungs were perfused, inflated, and fixed overnight at 4 °C with paraformaldehyde lysine periodate solution (0.001 M periodate, 0.075 M lysine, 1% paraformaldehyde, pH 7.4). Cryoprotection was accomplished by consecutive 20-min incubations in graded cold sucrose solutions (10, 20, and 30% in 0.1 M phosphate buffer, pH 7.4). The lungs were then inflated with a 40% optimal cutting temperature solution diluted in PBS; cryomolds were prepared with optimal cutting temperature; and 7-µm tissue sections were prepared on microscopic glass slides, air-dried at room temperature, and stored at -80 °C for further use. For immunofluorescence staining, the slides were washed and rehydrated with TN buffer (20 mM Tris-HCl, 0.5 M NaCl, pH 7.4) for 5 min, and blocked with 100 µl of 3% bovine serum albumin in PBS for 1 h. PE- and FITC-labeled antibodies were directly added onto the samples and incubated overnight at 4 °C. PE-labeled anti-mouse CD3 (145-2C11), CD4 (GK 1.5), CD45/B220 (RA3-6B2), and I-Ab (Aalpha b) (25-9-3) antibodies and FITC-labeled anti-mouse CD3, CD4, CD45/220, and CD8a (Ly-2) antibodies were purchased from BD PharMingen and used for single or double staining with a combination of PE- and FITC-conjugated antibodies. The slides were then washed three times with TN buffer, mounted, evaluated, and photographed using the fluorescent settings on a Zeiss LSM 510 confocal laser scanning inverted microscope (Axiovert 100M, Zeiss). The laser was set at 488 nm for green (FITC) fluorescence and 568 nm for red (PE) fluorescence.

Characterization of the Effects of IL-10 on Lipopolysaccharide (LPS)-induced Inflammation-- BAL was performed, as described above, on transgene (-) and transgene (+) mice before and 6 h after the intratracheal administration of 50 µl of LPS (Escherichia coli serotype 0.55:B5, 100 ng/ml) (Sigma) or appropriate vehicle control. Total cell and neutrophil recovery were then assessed. BAL TNF levels were evaluated using a commercial ELISA (R&D, Inc.) as per instructions from the manufacturer.

PCR Cloning of Mouse Muc-4 cDNA-- To be able to characterize the expression of the Muc-4 gene in transgenic and control mice, the nucleotide sequence of murine Muc-4 needed to be defined. To accomplish this we designed the PCR primers based on the regions that were conserved in both the human Muc-4 and rat ascites sialoglycoprotein-2 sequences (41, 42). The sense 5'-TCACTGGTAACCGCTGCTTC-3' and antisense 5'-CATCCTGGGGGCTGGTAGAC-3' primers encompassed the 3'-flanking region of human Muc-4 and the 5'-coding region of rat ascites sialoglycoprotein-2. After reverse transcription and 30 cycles of PCR amplification with a 60 °C annealing temperature, the 513-bp amplified product was purified and cloned into a TA cloning vector (pCR-II, Invitrogen). The inserted cDNA was sequenced, and the nucleotide and corresponding protein sequences were submitted to GenBankTM (accession no. AF218819).

Calculation of Histologic Mucus Index-- The histologic mucus index (HMI) provides a measurement of the percentage of epithelial cells that are PAS (+) per unit airway basement membrane. It is calculated from PAS-stained sections as described previously by our laboratories (38, 39).

Slot Blotting and Immunodetection of Mucins in the BAL Fluid-- To quantitate the levels of mucins in BAL fluids from transgene (+) and transgene (-) mice, 0.1 ml of BAL fluid was slot blotted onto nitrocellulose membranes using a Minifold II slot blot apparatus (Schleicher & Schuell) according to the protocol provided by the manufacturer. After air-drying, the membrane was blocked with 5% skim milk in TTBS (0.1% Tween 20, 20 mM Tris-Cl, 500 mM NaCl) for 2 h and washed three times with TTBS. The membrane was then incubated overnight at 4 °C with a polyclonal antiserum against Mucin-1 (C-20; Santa Cruz Inc., Santa Cruz, CA), a monoclonal antibody against Mucin-2 (Ccp58, Santa Cruz Inc.), or a monoclonal antibody against Mucin-5AC (45M1; NeoMarkers, Union City, CA). After washing with TTBS, the membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated anti-mouse or anti-goat immunoglobulin (Ig)-G (Pierce). Immunoreactive mucins were detected using a chemiluminescent procedure (ECL Plus Western blotting detection system, Amersham Biosciences) according to instructions from the manufacturer.

In Situ Hybridization-- In situ hybridization was undertaken as previously described (43). The mouse Gob-5 gene probe contained the segment from the mouse Gob-5 sequence between base pairs 1027 and 1465 (GenBankTM accession no. NM_011577).

Genetically Modified Mice-- IL-10 transgene (+) mice were bred with mice with null mutations of IL-4Ralpha , IL-13, STAT-6, and IL-4. The IL-4Ralpha (-/-) mice were obtained from Dr. F. Brombacher (44), the IL-13 (-/-) mice were obtained from Dr. A. N. J. McKenzie (45), and the STAT-6 (-/-), IL-4 (-/-), and IL-10 (-/-) mice were obtained from Jackson Laboratories (Bar Harbor, ME).

Assessments of TGF-beta 1-- The levels of total and bioactive TGF-beta 1 were evaluated using an ELISA that was specific for bioactive TGF-beta 1 (R&D, Inc., Minneapolis, MN). Evaluations were undertaken with acid-treated and untreated BAL fluids from 1-3-month-old transgene (+) and littermate control animals as previously described (43).

Respiratory Syncytial Virus (RSV) Sensitization and Challenge-- Mice were sensitized intradermally, at the base of the tail, with 5 × 105 plaque-forming units of vaccinia virus (VV) expressing secreted RSV G glycoprotein (a gift from Dr. G. W. Wertz, University of Alabama at Birmingham, Birmingham, AL) or with control vaccinia virus expressing beta -galactosidase (vac-lac; a gift from Dr. B. Moss, National Institutes of Health, Bethesda, MD). Six weeks later the mice were challenged with 1 × 107 plaque-forming units (in 0.1 ml) of live RSV virus A2 strain, which was administered intranasally and aspirated into the lung. Four days after challenge the mice were sacrificed, their lungs were removed, and mucin gene expression was assessed with RT-PCR analysis as described. Comparisons were made of the levels of mucin gene expression in (a) wild-type (WT) mice and IL-10 (-/-) mice (Jackson Laboratories), (b) WT mice treated with 0.2 mg of either a neutralizing monoclonal antibody against IL-10 (clone JES5.2A5, Genetics Institute, Cambridge MA) or an IgG1 isotype control (American Type Culture Collection), and (c) WT mice treated with the IL-13 antagonist IL-13 Ralpha 2-Fc (a gift from Dr. Sandy Goldman, Wyeth Inc., Cambridge, MA) or an appropriate Ig control. These antibody interventions were administered on days -1, 0, and + 1 with respect to the live virus challenge.

Statistics-- Values are expressed as means ± S.E. As appropriate, groups were compared by analysis of variance with Scheffe's procedure post hoc analysis, Student's t test, or nonparametric assessments (Wilcoxon's rank sum, Mann-Whitney U test) using StatView software for the Macintosh (Abacus Concepts Inc., Berkeley, CA).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Generation of Transgenic Mice-- To generate transgenic mice in which IL-10 is selectively expressed in the lung, constructs containing the CC10 promoter and murine IL-10 were prepared (Fig. 1A), standard microinjection was undertaken, tail DNA was isolated, and the presence or absence of IL-10 transgenic sequences was determined via Southern blot analysis and PCR. Four animals contained the appropriate transgenic construct. Independent lines were subsequently generated by breeding these founders with C57BL/6 mice, and the appropriateness of gene expression in each line was evaluated. Qualitatively, similar phenotypes were seen on all four lines. The details of these phenotypes are described below.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1.   Generation of transgenic mice. Panel A is a schematic illustration of the construct that was used to generate the mice. The levels of IL-10 in BAL from the different lines are illustrated in panel B. Each value represents the mean ± S.E. of evaluations of a minimum of 5 animals. The organ specificity of IL-10 gene expression is illustrated in panel C. In this experiment RPA was used to compare the levels of mRNA encoding IL-10 and the housekeeping genes for L32 and beta -actin in organs from a 1-month-old transgene (+) animal.

Characterization of Gene Expression in Transgenic Mice-- To determine whether IL-10 was appropriately targeted to the lung, we quantitated the levels of BAL IL-10 and compared the levels of IL-10 mRNA in the lungs and extrapulmonary organs from transgene (+) and transgene (-) mice. The BAL fluid from transgene (+) line 2 animals contained modest amounts of IL-10 (100-200 pg/ml). Higher levels of IL-10 were noted in BAL fluids from transgene (+) line 5 (400-600 pg/ml), line 6 (1.7-1.9 ng/ml), and line 7 (1.9-2.3 ng/ml) animals (Fig. 1B). IL-10 was not detected in the BAL fluid from transgene (-) littermate control animals (data not shown). In accord with these findings, mRNA encoding IL-10 was readily detected in RNA from lungs from line 6 and 7 mice, was detected at lower levels in the RNA from line 5 and 2 mice, and was undetectable in pulmonary tissues from transgene (-) animals (data not shown). In addition, transgene-induced IL-10 mRNA was not noted and histologic abnormalities were not appreciated on hematoxylin and eosin analysis of a variety of extrapulmonary tissues from transgene (+) animals (Fig. 1C and data not shown). This demonstrates that the CC10 promoter selectively targeted IL-10 to the lungs of transgene (+) animals.

Effect of IL-10 on LPS-induced Inflammation and TNF Production-- Comparisons were subsequently undertaken of the responses elicited by LPS in transgene (-) and transgene (+) mice. BAL neutrophils were only intermittently detected, and TNF was not detected in BAL from transgene (-) and (+) animals in the absence of LPS administration (data not shown). A profound BAL neutrophilia and impressive levels of BAL TNF were noted 6 h after LPS administration to transgene (-) mice (Fig. 2). IL-10 inhibited these responses in an impressive fashion. Transgene (+) line 6 and 7 mice had levels of BAL TNF and neutrophil recovery ~5-15% of those in transgene (-) littermate controls (Fig. 2) (p < 0.01 for each comparison). Thus, transgenic IL-10 has potent anti-inflammatory effects in the LPS-challenged murine airway.


View larger version (43K):
[in this window]
[in a new window]
 
Fig. 2.   Effect of IL-10 on LPS-induced responses. IL-10 transgene (+) (IL-10 TG) and transgene (-) WT littermate control mice received intratracheal LPS (solid bars) or vehicle control (open bars) and underwent BAL 6 h later. Total cell (top left panel) and neutrophil recovery (top right panel) and TNF levels (lower panel) in BAL fluids from transgene (+) and transgene (-) mice are compared. The noted values represent the means ± S.E. of a minimum of 5 animals. (*, p < 0.05; **, p < 0.01). Neutrophils were only intermittently noted, and TNF was not detected in the BAL fluids from the vehicle control-treated animals.

Histologic Effects of IL-10-- The lungs from transgene (+) and transgene (-) animals were indistinguishable on gross examination, and differences in alveolar size or gross airway morphology were not noted on light microscopic exam (Fig. 3 and data not shown). In contrast to the transgene (-) littermates, however, lungs from transgene (+) mice manifest a mononuclear inflammatory response around small and large airways and nearby vascular structures (Fig. 3B). This response was most pronounced in the mice producing high levels of IL-10 for long periods of time (3-4 months) (data not shown). It was, however, readily apparent in line 2 mice at all time points (data not shown). Immunohistochemistry and confocal analysis demonstrated that these infiltrates contained increased numbers of CD4+ T cells and B220(+) and MHC II (+) B cells (Fig. 3, C-E). Enhanced staining with antibodies against CD8 was not appreciated (data not shown). Congo red and Alcian blue stains also did not reveal increased numbers of eosinophils or mast cells, respectively (data not shown).


View larger version (70K):
[in this window]
[in a new window]
 
Fig. 3.   Histologic effects of chronic IL-10 production. In panels A and B, hematoxylin and eosin stains were used to compare lungs from 3-month-old transgene (-) (panel A) and transgene (+) (panel B) animals (original magnification, ×10). Panels C-E illustrate the confocal immunohistochemical evaluations of the lungs from IL-10 transgenic mice demonstrating the staining (red/orange) with antibodies against CD4 (panel C), B220 (panel D), and HLA class II (panel E) (original magnification, ×20). Trichrome evaluations were used to compare the collagen in lungs from littermate control (panel F) and IL-10 transgenic mice (panel G) (original magnification, ×10). The trichrome stains of the transgene (-) and transgene (+) mice are illustrated at a higher magnification in panels H and I, respectively (original magnification, ×20).

Trichrome stains were also used to compare the fibrotic responses in the lungs from transgene (-) and (+) animals. A small amount of collagen could be appreciated in and near the airway wall, and loosely packed collagen could be appreciated in the bronchovascular bundles of transgene (-) mice. In contrast, enhanced collagen deposition was readily appreciated in the subepithelial region and, to a lesser extent, the adventitia of the small and medium-sized airways of the transgenic animals (Fig. 3, panels F-I). This accumulation was readily apparent in all four transgenic lines. It was, however, both dose- and time-dependent because it was most prominent in animals that expressed high levels of IL-10 (lines 6 and 7) for prolonged periods of time (3-4 months) (data not shown). When viewed in combination, these studies demonstrate that IL-10 is a potent in vivo stimulator of inflammation and subepithelial airway fibrosis.

Effects of IL-10 on Airway Mucus and Mucin and Gob-5 Gene Expression-- To define the effects of IL-10 on airway mucus, we compared the PAS and Alcian blue staining and levels of mucin and Gob-5 gene expression in transgene (-) and transgene (+) mice. At all time points, PAS- and/or Alcian blue-staining cells could not be appreciated in the airways of the transgene (-) animals (HMI values, 0-1). In contrast, PAS- and Alcian blue-staining cells were prominent in the airways of the transgene (+) animals (Fig. 4A). HMI calculations demonstrated that this response was present in all four transgenic lines. The most prominent alterations were noted in line 6 and 7 transgene (+) animals (HMI between 65 ± 3 and 75 ± 5, p < 0.01). As can be seen in Fig. 4B, IL-10 simultaneously increased the levels of mRNA encoding Muc-5ac, Muc-4, and Muc-2 but not Muc-1. Mucus hypersecretion was also readily apparent in the BAL immunoblot evaluations (Fig. 4C). In accord with the important role of the calcium-regulated chloride channel Gob-5 in mucus metaplasia (46, 47), Gob-5 mRNA was also prominently induced in IL-10 transgenic animals. This induction was seen in RT-PCR studies (Fig. 4B) and in in situ hybridization evaluations, which demonstrated that Gob-5 mRNA accumulated selectively in airway epithelial cells (Fig. 4D).


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 4.   Mucus-regulating effects of IL-10. In panel A, PAS and Alcian blue staining was used to compare airways from transgene (-) and transgene (+) mice (original magnification, ×10 for insets A and B; ×20 for insets C-F). In panel B, RT-PCR was used to evaluate the levels of mRNA encoding the noted mucin and Gob-5 genes in lungs from transgene (-) and transgene (+) mice. Each lane is a representative animal. In panel C slot-immunoblot analysis was utilized to evaluate the levels of the noted mucins in BAL fluids (BALF) from transgene (+) and transgene (-) mice. In panel D, in situ hybridization with sense (S) and antisense (AS) probes was used to localize Gob-5 mRNA transcripts (arrows) in tissues from IL-10 transgene (+) animals and transgene (-) littermate controls.

IL-10 Regulation of Th2 Cytokines-- Previous studies from our laboratories demonstrated that Th2 cytokines are potent inducers of mucus metaplasia in the airway (48). Thus, studies were undertaken to determine whether IL-4, IL-5, IL-13, or IL-9 were induced by IL-10 in our transgenic mice. Transcripts encoding Th2 cytokines were not detected in total lung RNA from transgene (-) animals. They were, however, readily apparent in lungs from antigen-sensitized and -challenged WT animals (Fig. 5). As shown in Fig. 5, increased levels of mRNA encoding IL-13 were detected in RNA from IL-10 transgenic mice. This stimulation was at least partially IL-13-specific because IL-10 did not stimulate the accumulation of mRNA encoding IL-4, IL-5, or IL-9 in a similar fashion (Fig. 5).


View larger version (27K):
[in this window]
[in a new window]
 
Fig. 5.   IL-10 regulation of Th2 cytokine gene expression. RT-PCR was used to evaluate the levels of mRNA encoding the noted cytokines in lungs from transgene (+) and transgene (-) control animals. RNA from lungs from WT animals sensitized and challenged with ovalbumin (OVA-RNA) serve as positive controls and are evaluated in lane 1.

Role of IL-4 Receptor alpha , STAT-6, and IL-13 in the IL-10-induced Phenotype-- To define the roles of IL-4Ralpha , STAT-6, and IL-13 in the genesis of the histologic alterations in IL-10 transgenic mice, we bred transgene (+) mice with mice with null mutations of IL-4Ralpha (IL-4Ralpha (-/-)), STAT-6 (STAT-6 (-/-)), IL-13 (IL-13 (-/-)), or IL-4 (IL-4 (-/-)). Lungs from IL-4Ralpha (-/-), STAT-6 (-/-), IL-13 (-/-), and IL-4 (-/-) mice could not be differentiated from lungs from WT transgene (-) littermate control mice on gross and light microscopic examination (data not shown). In contrast to the IL-10 transgenic mice, transgene (+)/IL-4Ralpha (-/-) mice, transgene (+)/STAT-6 (-/-) mice, and transgene (+)/IL-13 (-/-) mice did not manifest mucus metaplasia (Fig. 6). These mice had HMI values between 0 and 1 and markedly decreased Gob-5 gene expression (Fig. 6 and data not shown). They did, however, manifest levels of tissue infiltration and airway fibrosis that were comparable with those seen in IL-10 transgene (+) animals (Fig. 6 and data not shown). In accord with these findings, IL-10 caused a significant increase in TGF-beta 1 mRNA and latent TGF-beta 1 protein accumulation in lungs from transgene (+) mice (Fig. 6). These inductive responses were not altered in transgene (+)/IL-13 (-/-) or transgene (+)/STAT-6 (-/-) animals. A markedly different result was seen in transgene (+)/IL-4 (-/-) mice, which had levels of mucus metaplasia, inflammation and fibrosis comparable with WT transgene (+) animals (Fig. 6). These studies demonstrate that IL-10 induces mucus metaplasia and regulates mucin and Gob-5 gene expression via an IL-13-, STAT-6-, and IL-4Ralpha -dependent and IL-4-independent pathway. They also demonstrate that IL-13, STAT-6, and IL-4Ralpha do not play critical roles in the generation of the inflammatory and fibrotic effects of this transgenic cytokine and highlight the ability of IL-10 to stimulate the production of the fibrogenic cytokine TGF-beta 1 via an IL-13- and STAT-6-independent pathway.


View larger version (69K):
[in this window]
[in a new window]
 
Fig. 6.   Effect of null mutations of selected genes on IL-10-induced mucus metaplasia and tissue fibrosis. In panels A and B, PAS staining and trichrome staining were used to compare the mucus and fibrotic responses, respectively in IL-10 transgene (+) mice with WT and null loci. Inset a is the transgene (-) control; b, IL-10 transgene (+); c, IL-10 (+)/IL-4Ralpha (-/-); d, IL-10 (+)/STAT-6 (-/-); e, IL-10 (+)/IL-13 (-/-); f, IL-10 (+)/IL-4 (-/-). Panels A and B, original magnification, ×20 and ×10, respectively. In panels C and D, RT-PCR was used to compare the levels of IL-10, Gob-5, Muc-5ac, and TGF-beta 1 mRNA in transgene (+) and (-) mice with WT and null IL-13 and STAT-6 loci.

Mucus-regulating Effects of IL-10 in a Viral Modeling System-- To confirm that endogenous IL-10 is an important regulator of in vivo mucus responses, we compared the mucin gene expression in WT and IL-10 null (IL-10 (-/-)) mice that had been sensitized with RSV G glycoprotein and challenged with live RSV. This model was chosen because previous studies from our laboratories demonstrated increased mucus and IL-13 production in this system (49, 50). In these experiments, significant increases in Muc-5ac gene expression were seen in virus-challenged wild-type animals that had been sensitized with G glycoprotein (Fig. 7). This mucus response was IL-13-dependent because treatment with the IL-13 antagonist IL-13Ralpha 2-Fc abrogated RSV-induced increases in mucin gene expression in this system (Fig. 7A). It also appeared to depend on IL-10 production because comparable levels of induction of mucin gene expression were not seen after virus challenge of G glycoprotein-sensitized IL-10 (-/-) animals and the administration of neutralizing antibodies against IL-10 during the viral challenge phase of this protocol abrogated Muc-5ac mRNA induction (Fig. 7, B and C). Interestingly, these effects were not a result of the ability of IL-10 to inhibit IFN-gamma production because similar levels of IFN-gamma gene expression were noted in comparisons of G glycoprotein-sensitized and virus-challenged IL-10 (+/+) and (-/-) mice (data not shown). Thus, these studies demonstrate that IL-10 is an important inducer of mucin gene expression in this viral system.


View larger version (21K):
[in this window]
[in a new window]
 
Fig. 7.   Effect of IL-10 deficiency on RSV-induced mucin expression. WT (IL-10 (+/+)) or IL-10 (-/-) mice were sensitized by treatment with VV containing the soluble RSV G glycoprotein (vvGs) or VV containing a beta  galactosidase (vac-lac) control and then challenged with live RSV. In panel A the challenges were undertaken in mice treated with the IL-13 antagonist IL-13Ralpha 2-Fc (IL-13Ralpha ) or an immunoglobulin control. Muc-5ac gene expression was evaluated by RT-PCR. In panel B challenges were undertaken in mice that received neutralizing antibodies against IL-10 (anti-IL-10 (+)) or isotype controls (anti-IL-10 (-)). The levels of Muc-5ac gene expression were evaluated via RT-PCR and are expressed as a relative ratio compared with the levels of beta -actin mRNA (*, p < 0.05 compared with WT IL-10 (+/+) mice treated with VV containing the soluble RSV G glycoprotein). A representative experiment using the neutralizing antibodies against IL-10 is illustrated in panel C.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Inflammation in the lung (and other visceral structures) eliminates microbial pathogens and initiates healing responses after tissue injury. However, inflammation can also contribute to organ dysfunction and, if severe, organ failure. As a result, homeostatic systems have evolved that ensure that inflammation is not initiated after trivial exposures or injuries and that inflammatory responses are appropriately down-regulated when they are no longer required. IL-10 has been assumed to play a major role in the latter regulatory responses. This is based on studies that demonstrate that IL-10 is constitutively elaborated and prevents inflammation in normal healthy pulmonary airways and that endogenous IL-10 is induced and controls inflammatory responses initiated by infectious, particulate and antigenic stimuli (2, 8, 9, 25, 29, 51). Similarly, exogenously administered recombinant IL-10 is protective and/or controls the inflammation in Pseudomonas pneumonia, silicosis, immune complex lung injury, and ischemia-reperfusion lung injury and a deficiency of IL-10 production may contribute to the pathogenesis of the chronic inflammation seen in diseases such as cystic fibrosis (2, 7, 8, 11, 51, 52). As a consequence of these findings, it has been assumed that IL-10 can be used to control chronic inflammatory pulmonary disorders. However, IL-10 also has pro-inflammatory tissue effects and detrimental effects in models of transplant rejection and infectious pneumonias (19, 23, 24), and it can contribute to the pathogenesis of autoimmune and inflammatory disorders (53-55). These studies suggest that IL-10 may contribute to disease pathogenesis and may not always ameliorate tissue inflammation. To address the mechanisms responsible for these complex effector functions and define the mechanisms by which IL-10 can contribute to or ameliorate inflammatory responses in the lung, we generated overexpression transgenic mice in which IL-10 was expressed in the murine airway at levels comparable with or below those seen in relevant animal models, human biologic fluids, and rIL-10-treated patients (9, 33, 56-61). Studies of these mice demonstrated that IL-10 has anti-inflammatory effects in the setting of endotoxin challenge. They also demonstrated, for the first time, that IL-10 simultaneously induces mucus metaplasia, enhances mucin gene expression and mucin elaboration, and causes a T and B cell-rich inflammatory response and airway fibrosis. Finally, they demonstrate that IL-10 induces IL-13 in the lung and that the effects of IL-10 are mediated via IL-13-dependent and -independent pathways.

To address the complex effector properties of IL-10, we evaluated the effects of our transgene in naive and inflamed lungs. In accord with reports in the literature (3, 5, 25), these studies revealed potent anti-inflammatory effects of IL-10. IL-10 simultaneously induced a peribronchiolar and perivascular tissue inflammatory response, which, by confocal microscopy, was made up largely of T cells and B cells. This finding is also in accord with studies demonstrating that transgenic IL-10 causes lymphocytic inflammation in the pancreas (62) and salivary gland (53) and that IL-10 stimulates T and B cell proliferation, stimulates T cell chemotaxis, and inhibits T cell apoptosis (17, 63, 64). One could interpret these studies to demonstrate that IL-10 simultaneously exerts pro- and anti-inflammatory effects when chronically expressed in the lung. Although this may be true, we feel it is likely an overly simplistic interpretation. Instead, we believe that our studies and the literature suggest that IL-10 has complex effector properties that can vary depending on the properties of the ongoing inflammation, injury, and repair response and the timing, dose, and localization of the cytokine. In addition, the inflammation and anti-inflammatory effects of IL-10 can be tied together in a cause and effect fashion if some or all of the cells that are found in these pulmonary infiltrates are inhibitory T regulatory 1 (Tr1) cell populations that can be induced in the presence of chronic IL-10 elaboration (4). Preliminary experiments from our laboratory have, however, failed to reveal evidence for Tr1 cells in these infiltrates.2 Additional experimentation will be required to define the mechanisms of these responses, the effector capacities of the infiltrating lymphocytes in the IL-10 transgenic mice and the relationships between the different effector properties of this cytokine.

Mucus is a viscoelastic gel that coats and lubricates the epithelium of mucosal surfaces and protects against infectious and other environmental insults. Low levels of mucus are produced in the normal lung, and mucus metaplasia with mucus hypersecretion are characteristic features of airways disorders such as asthma, chronic bronchitis, and cystic fibrosis. A variety of inflammatory mediators, including the Th2 cytokines IL-4, IL-5, IL-13, and IL-9, are believed to contribute to the pathogenesis of the mucus abnormalities in these disorders (37, 65-67). The role that IL-10 plays in these responses has not been thoroughly evaluated. In addition, the literature that exists is controversial, with investigators reporting that a deficiency of IL-10 does not alter or decreases mucus responses in animal models of airway inflammation (31, 32). Our studies demonstrate, for the first time, that chronic IL-10 production induces mucus metaplasia with goblet cell hyperplasia, enhanced neutral and acidic mucus accumulation, enhanced mucin and Gob-5 gene expression, and mucus hypersecretion. They are also the first to demonstrate that endogenous IL-10 in necessary for the maximal induction of mucin gene expression in an IL-13-dependent in vivo virus challenge system. These findings suggest that IL-10 can contribute to the pathogenesis of the mucus responses that are seen at sites of chronic inflammation. They also suggest that Gob-5 may be a critical intermediary of this response because Gob-5 expression induces mucus metaplasia in the murine airway (46). This may be particularly important in inflammatory bowel disease, lung cancer, Sjogren's syndrome, and asthma (see below), where increased levels of mucus production and/or mucin gene expression are known to co-exist with the exaggerated production of IL-10 (33, 34, 55, 68).

Tissue fibrosis can represent a healing and repair response and/or a manifestation of disease pathogenesis. From our perspective, these pathways are not mutually exclusive and can be differentiated, in part, by characterizing the effects of the mediators of fibrosis on local tissue inflammation. Mediators involved in healing and repair (such as TGF-beta and IL-11 (Ref. 38)) have been shown to stimulate fibrosis while decreasing inflammation. In contrast, mediators that are not involved in healing might not alter or could increase local inflammatory responses. IL-10 has well documented anti-inflammatory properties. Our studies demonstrate that IL-10, while inhibiting LPS-induced inflammation, simultaneously generates tissue fibrosis. In contrast to previous studies (51), they also demonstrate that the fibrotic effects of IL-10 are seen in the absence of known exogenous fibrogenic stimuli. These findings have allowed us to hypothesize that, under appropriate circumstances, IL-10 production is a manifestation of local healing and repair. Our demonstration that IL-10 stimulates TGF-beta 1 would further support this contention. Our findings also suggest that the overproduction of IL-10 can contribute to the pathogenesis of human fibrotic disorders. This may be particularly relevant to the airway remodeling in asthma, the fibrosis in interstitial lung diseases such as silicosis, and the salivary gland scarring seen in Sjogren's syndrome. These studies do not, however, support the concept that IL-10 is anti-fibrotic, as has been proposed by other investigators (69). In circumstances where anti-fibrotic effects of IL-10 are seen, our data would suggest that the decrease in fibrosis is a result of the ability of IL-10 to diminish tissue inflammation and inflammation-induced injury and not direct effects of IL-10 on matrix deposition or structural cell proliferation.

Asthma is characterized by Th2 cytokine excess, chronic inflammation, and varying degrees of mucus metaplasia and subepithelial fibrosis. The role of IL-10 in the asthmatic diathesis, however, is controversial. Early studies suggested that IL-10 had important anti-inflammatory effects in models of asthma (9, 25, 28) and that a deficiency in IL-10 production contributed to the chronic inflammation in the airways of patients with this disorder (12, 29, 30). This led to the belief that IL-10 administration would be an appropriate therapeutic intervention in these patients (12, 29, 30). In contrast, other investigators demonstrated that IL-10 can augment asthma-like pathologic responses in acute animal modeling systems (9, 31, 32) and that IL-10 production is increased in patients with asthma at base line and after segmental antigen challenge (33, 34). In addition, RSV infection is the most common cause of lower respiratory infection in children and correlates with the development of asthma in later life (70). In RSV-infected children, the capacity of stimulated mononuclear cells to produce IL-10 has been shown to correlate with recurrent wheezing on follow-up (71). These studies suggest that IL-10 can contribute to disease pathogenesis in asthma. When viewed in combination with our findings, they also call into question the appropriateness of IL-10 as a therapy for these individuals because the IL-10 could worsen the inflammatory, mucus, fibrotic, and physiologic alterations seen in these individuals. A relative IL-10 deficiency has also been reported in cystic fibrosis, and exogenous rIL-10 has been proposed as a treatment for patients with this disorder (2, 11). Similar concerns about this therapeutic approach, however, need to be raised because mucus abnormalities, inflammation, and tissue fibrosis are all characteristic features of cystic fibrosis tissue pathology.

IL-13 is a pleiotropic 12-kDa cytokine that is produced in large quantities by appropriately stimulated CD4+ Th2 cells and lesser quantities by Th1 cells. It has a variety of pro-inflammatory effects that are relevant to asthma and other Th2-dominated inflammatory disorders, including the ability to induce IgE production and endothelial cell VCAM-1 expression. Studies from our laboratory and others have also demonstrated that IL-13 is a potent inducer of eosinophilic tissue inflammation, mucus metaplasia, subepithelial fibrosis, and Gob-5 gene expression (37, 47, 72). In keeping with the similarities between these IL-13 effector functions and the phenotype of our IL-10 transgenic mice, studies were undertaken to determine whether IL-13 played a role in mediating the IL-10 phenotype. These studies demonstrated, for the first time, that IL-10 stimulates IL-13 production in vivo. Our studies of the progeny of crosses of transgenic mice and IL-13 null mice also demonstrated that the IL-13 that is produced plays a critical role in the induction of the mucus metaplasia and the enhanced mucin and Gob-5 gene expression, but is not critical for the inflammatory or fibrotic responses in these animals. Our demonstration that the IL-10-induced mucus response was completely abrogated whereas the inflammatory and fibrotic responses were not altered in crosses of IL-10 transgenic mice and mice with null mutations of IL-4Ralpha or STAT-6 provides additional support for the importance of IL-13 in mediating the IL-10 phenotype and insights into the signaling pathway that it uses in this setting. Interestingly, IL-10 did not stimulate other Th2 cytokines and IL-10-induced mucus metaplasia was not abolished in the absence of IL-4. When viewed in combination, these genetic manipulations demonstrate that IL-10 production selectively induces IL-13 elaboration, which causes mucus transformation of the airway via an IL-4Ralpha - and STAT-6-dependent mechanism. Because IL-13 is a key mediator in asthma pathogenesis and IL-13 antagonism is a therapeutic goal in this disorder (73), the finding that IL-10 induces IL-13 in vivo further supports the need to be cautious with approaches that utilize IL-10 to control this and other chronic Th2-dominated inflammatory disorders.

Our studies demonstrate that IL-10 induces tissue fibrosis in the murine airway. We previously demonstrated that IL-13 is a potent stimulator of tissue fibrosis and that this effect is mediated, at least in part, via the ability of IL-13 to stimulate the production and activate TGF-beta 1 (43). As a result, we hypothesized that the fibrogenic effects of IL-10 might be mediated via an IL-13/STAT-6/IL-4Ralpha -dependent pathway. To our surprise, this did not prove to be the case because IL-10-induced tissue fibrosis was not abrogated in the absence of IL-13, STAT-6, or IL-4Ralpha . To gain insights into the mechanisms that might contribute to this fibrotic response, studies were undertaken to determine whether IL-10 stimulated the production of TGF-beta 1 in the murine lung. These studies demonstrated that IL-10 stimulated the accumulation of TGF-beta 1 mRNA and latent TGF-beta 1 protein in transgene (+) animals. In keeping with our histologic findings and genetic manipulations, this inductive response was mediated via an IL-13/STAT-6-independent pathway. These observations allow for the speculation that IL-10 induces tissue fibrosis, at least in part, via the induction of TGF-beta 1. Additional investigations in which IL-10-dependent fibrotic responses are treated with TGF-beta 1 antagonists, however, will be required to thoroughly evaluate this possibility.

In summary, these studies demonstrate that IL-10 causes a complex phenotype when chronically overexpressed in the lung. While inhibiting LPS-induced inflammation and TNF production, IL-10 simultaneously caused a T and B cell-rich inflammatory response, subepithelial fibrosis, and mucus metaplasia with goblet cell hyperplasia, mucin hypersecretion, and enhanced mucin and Gob-5 gene expression. They also demonstrate that IL-10 induces IL-13 production in vivo and that this induction is responsible for the mucus, but not the inflammatory and fibrotic effects of IL-10 in this setting. Endogenous IL-10 was also shown to be necessary for maximal Muc-5ac gene expression in a virus sensitization and challenge modeling system. Thus, IL-10 may contribute to the pathogenesis of inflammatory, fibrotic, and mucus responses at sites of pathology. The inflammatory, fibrotic, mucus, and IL-13-stimulating effects of IL-10 must be taken into account when balancing the risks and benefits of chronic IL-10 therapy for inflammatory disorders in the lung and other organs.

    ACKNOWLEDGEMENTS

We thank Kathleen Bertier for excellent secretarial and administrative assistance, and we thank the scientists who provided the genetically modified mice.

    FOOTNOTES

* This work was supported by National Institutes of Health Grants HL-56389, HL-61904, HL-64242 (to J. A. E.), and HL-6404 (to L. C.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF218819.

§§ To whom correspondence should be addressed: Dept. of Internal Medicine, Section of Pulmonary and Critical Care Medicine, Yale University School of Medicine, 333 Cedar St., 105 LCI, P. O. Box 208057, New Haven, CT 06520-8057. Tel.: 203-785-4163; Fax: 203-785-3826; E-mail: jack.elias@yale.edu.

Published, JBC Papers in Press, July 9, 2002, DOI 10.1074/jbc.M206395200

2 C. G. Lee and J. A. Elias, unpublished observation.

    ABBREVIATIONS

The abbreviations used are: IL, interleukin; STAT, signal transducers and activators of transcription; RSV, respiratory syncytial virus; IL-4R, interleukin-4 receptor; IL-13R, interleukin-13 receptor; VV, vaccinia virus; RPA, ribonuclease protection assay; IFN, interferon; BAL, bronchoalveolar lavage; TGF, transforming growth factor; ELISA, enzyme-linked immunosorbent assay; TNF, tumor necrosis factor; LPS, lipopolysaccharide; HMI, histologic mucus index; TTBS, Tris-buffered saline with Tween 20; PAS, periodic acid-Schiff with diastase; WT, wild-type; rtTA, reverse tetracycline transactivator; hGH, human growth hormone; PBS, phosphate-buffered saline; RT, reverse transcription; FITC, fluorescein isothiocyanate; PE, phycoerythrin.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Moore, K. W., O'Garra, A., de Waal Malefyt, R., Vieira, P., and Mosmann, T. R. (1993) Annu. Rev. Immunol. 11, 165-190[CrossRef][Medline] [Order article via Infotrieve]
2. Bonfield, T. L., Konstan, M. W., Burfeind, P., Panuska, J. R., Hilliard, J. B., and Berger, M. (1995) Am. J. Respir. Cell Mol. Biol. 13, 257-261[Abstract]
3. Bogdan, C., Vodovotz, Y., and Nathan, C. (1991) J. Exp. Med. 174, 1549-1555[Abstract/Free Full Text]
4. Groux, H., O'Garra, A., Bigler, M., Rouleau, M., Antonenko, S., deVries, J. E., and Roncarolo, M.-G. (1997) Nature 389, 737-742[CrossRef][Medline] [Order article via Infotrieve]
5. Gerard, C., Bruyns, C., Merchant, A. D. A., Vandenabeele, P., Delvaux, A., Fiers, W., Goldman, M., and Velu, T. (1993) J. Exp. Med. 177, 547-550[Abstract/Free Full Text]
6. Koulis, A., and Robinson, D. S. (2000) Clin. Exp. Allergy 30, 747-750[CrossRef][Medline] [Order article via Infotrieve]
7. Shanley, T. P., Schmal, H., Friedl, H. P., Jones, M. L., and Ward, P. A. (1995) J. Immunol. 154, 3454-3460[Abstract]
8. Sawa, T., Corry, D. B., Gropper, M. A., Ohara, M., Kurahashi, K., and Wiener-Kronish, J. P. (1997) J. Immunol. 159, 2858-2866[Abstract]
9. Van Scott, M. R., Justice, P., Bradfield, J. F., Enright, E., Sigounas, A., and Sur, S. (2000) Am. J. Physiol. 278, L667-L674
10. Rennick, D. M., Fort, M. M., and Davidson, N. J. (1997) J. Leukocyte Biol. 61, 389-396[Abstract]
11. Chmiel, J. F., Konstan, M. W., Knesebeck, J. E., Hilliard, J. B., Bonfield, T. L., Dawson, D. V., and Berger, M. (1999) Am. J. Respir. Crit. Care Med. 160, 2040-2047[Abstract/Free Full Text]
12. Chung, K. F. (1998) Eur. Respir. Rev. 8, 999-1006
13. Stordeur, P., de Lavareille, A., and Goldman, M. (2000) Eur. Respir. Rev. 70, 142-145
14. De Beaux, A. C., Maingay, J. P., Ross, J. A., Fearon, K. C., and Carter, D. C. (1995) J. Interferon Cytokine Res. 15, 441-445[Medline] [Order article via Infotrieve]
15. Groux, H., Bigler, M., de Vries, J. E., and Roncarolo, M. G. (1998) J. Immunol. 160, 3188-3193[Abstract/Free Full Text]
16. Lin, T.-J., and Befus, A. D. (1997) J. Immunol. 159, 4015-4023[Abstract]
17. Itoh, K., and Hirohata, S. (1995) J. Immunol. 154, 4341-4350[Abstract]
18. Vora, M., Romero, L. I., and Karasek, M. A. (1996) J. Exp. Med. 184, 821-829[Abstract/Free Full Text]
19. Qian, S. G., Li, W., Li, Y. P., Fu, F. M., Lu, L. N., Fung, J. J., and Thomson, A. W. (1996) Transplantation 62, 1709-1714[CrossRef][Medline] [Order article via Infotrieve]
20. Wogensen, L., Lee, M. S., and Sarvetnick, N. (1994) J. Exp. Med. 179, 1379-1384[Abstract/Free Full Text]
21. Moritani, M., Yoshimoto, K., Tashiro, F., Hashimoto, C., Miyazaki, J., Li, S., Kudo, E., Iwahana, H., Hayashi, Y., Sano, T., and Itakura, M. (1994) Int. Immunol. 6, 1927-1936[Abstract/Free Full Text]
22. Berman, R. M., Suzuki, T., Tahara, H., Robbins, P. D., Narula, S. K., and Lotze, M. T. (1996) J. Immunol. 157, 231-238[Abstract]
23. Vanderpoll, T., Marchant, A., Keogh, C. B., Goldman, M., and Lowry, S. F. (1996) J. Infect. Dis. 1974, 994-1000
24. Greenberger, M. J., Strieter, R. M., Kunkel, S. L., Danforth, J. M., Goodman, R. E., and Standiford, T. J. (1995) J. Immunol. 155, 722-729[Abstract]
25. Stamfli, M. R., Cwiartka, M., Gajewska, B. U., Alvarez, D., Ritz, S. A., Inman, M. D., Xing, Z., and Jordana, M. (1999) Am. J. Respir. Cell Mol. Biol. 21, 586-596[Abstract/Free Full Text]
26. Jeannin, P., Lecoanet, S., Delneste, Y., Gauchat, J. F., and Bonnefoy, J. Y. (1998) J. Immunol. 160, 3555-3561[Abstract/Free Full Text]
27. Takanaski, S., Nonaka, R., Xing, Z., Obyrne, P., Dolovich, J., and Jordana, M. (1994) J. Exp. Med. 180, 711-715[Abstract/Free Full Text]
28. Zuany-Amorim, C., Haile, S., Leduc, D., Dumarey, C., Huerre, M., Vargaftig, B. B., and Pretolani, M. (1995) J. Clin. Invest. 95, 2644-2651[Medline] [Order article via Infotrieve]
29. Borish, L., Aarons, A., Rumbyrt, J., Cvietusa, P., Negri, J., and Wenzel, S. (1996) J. Allergy Clin. Immunol. 97, 1288-1296[CrossRef][Medline] [Order article via Infotrieve]
30. Takanashi, S., Hasegawa, Y., Kanehira, Y., Yamamoto, K., Fujimoto, K., Satoh, K., and Okamura, K. (1999) Eur. Respir. J. 14, 309-314[Abstract]
31. Makela, M. J., Kanehiro, A., Borish, L., Dakhama, A., Loader, J., Joetham, A., Xing, Z., Jordana, M., Larsen, G. L., and Gelfand, E. W. (2000) Proc. Natl. Acad. Sci. U. S. A. 97, 6007-6012[Abstract/Free Full Text]
32. Yang, X., Wang, S., Fan, Y., and Han, X. (2000) Eur. J. Immunol. 30, 382-391[CrossRef][Medline] [Order article via Infotrieve]
33. Colavita, A. M., Hastie, A. T., Musani, A. I., Pascual, R. M., Reinach, A. J., Lustine, H. T., Galati, S. A., Zangrilli, J. G., Fish, J. E., and Peters, S. P. (2000) J. Allergy Clin. Immunol. 106, 880-886[CrossRef][Medline] [Order article via Infotrieve]
34. Robinson, D. S., Tsicopoulos, A., Meng, Q., Durham, S., Kay, A. B., and Hamid, Q. (1996) Am. J. Respir. Cell Mol. Biol. 14, 113-117[Abstract]
35. Magnan, A., van Pee, D., Bongrand, P., and Vervloet, D. (1998) Allergy 53, 1092-1095[Medline] [Order article via Infotrieve]
36. Ray, P., Tang, W., Wang, P., Homer, R., Kuhn, C. I., Flavell, R. A., and Elias, J. A. (1997) J. Clin. Invest. 100, 2501-2511[Medline] [Order article via Infotrieve]
37. Zhu, Z., Homer, R. J., Wang, Z., Chen, Q., Geba, G. P., Wang, J., Zhang, Y., and Elias, J. A. (1999) J. Clin. Invest. 103, 779-788[Medline] [Order article via Infotrieve]
38. Wang, J. M., Homer, R. J., Hong, L., Cohn, L., Lee, C. G., and Elias, J. A. (2000) J. Immunol. 165, 2222-2231[Abstract/Free Full Text]
39. Zheng, T., Zhu, Z., Wang, Z., Homer, R. J., Ma, B., Riese, R., Chapman, H., Shapiro, S. D., and Elias, J. A. (2000) J. Clin. Invest. 106, 1081-1093[Medline] [Order article via Infotrieve]
40. Parmley, R. R., and Gendler, S. J. (1998) J. Clin. Invest. 102, 1798-1806[Medline] [Order article via Infotrieve]
41. Wu, K., Fregien, N., and Carraway, K. L. (1994) J. Biol. Chem. 269, 11950-11955[Abstract/Free Full Text]
42. Moniaux, N., Nollet, S., Porchet, N., Degand, P., Laine, A., and Aubert, J. (1999) Biochem. J. 338, 325-333
43. Lee, C. G., Homer, R. J., Zhu, Z., Lanone, S., Wang, X., Koteliansky, V., Shipley, J. M., Gotwals, P., Noble, P., Chen, Q., Senior, R. M., and Elias, J. A. (2001) J. Exp. Med. 194, 809-821[Abstract/Free Full Text]
44. Noben-Trauth, N., Shultz, L. D., Brombacher, F., Urban, J. F., Jr., Gu, H., and Paul, W. E. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 10838-10843[Abstract/Free Full Text]
45. McKenzie, G. J., Bancroft, A., Grencis, R. K., and McKenzie, A. N. (1998) Curr. Biol. 8, 339-342[CrossRef][Medline] [Order article via Infotrieve]
46. Nakanishi, A., Morita, S., Iwashita, H., Sagiya, Y., Ashida, Y., Shirafuji, H., Fujisawa, Y., Nishimura, O., and Fujino, M. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 5175-5180[Abstract/Free Full Text]
47. Zhou, Y., Dong, Q., Louahed, J., Dragwa, C., Savio, D., Huang, M., Weiss, C., Tomer, Y., McLane, M. P., Nicolaides, N. C., and Levitt, R. C. (2001) Am. J. Respir. Cell Mol. Biol. 25, 486-491[Abstract/Free Full Text]
48. Cohn, L., Homer, R. J., MacLeod, H., Mohrs, M., Brombacher, F., and Bottomly, K. (1999) J. Immunol. 162, 6178-6183[Abstract/Free Full Text]
49. Johnson, T. R., Johnson, J. E., Roberts, S. R., Wertz, G. W., Parker, R. A., and Graham, B. S. (1998) J. Virol. 72, 2871-2880[Abstract/Free Full Text]
50. Johnson, T. R., and Graham, B. S. (1999) J. Virol. 73, 8485-8495[Abstract/Free Full Text]
51. Huaux, F., Louahed, J., Hudspith, B., Meredth, C., Delos, M., Renauld, J.-C., and Lison, D. (1998) Am. J. Respir. Cell. Mol. Biol. 18, 51-59[Abstract/Free Full Text]
52. Eppinger, M. J., Ward, P. A., Bolling, S. F., and Deeb, G. M. (1996) J. Thorac. Cardiovasc. Surg. 112, 1301-1305[Abstract/Free Full Text]
53. Saito, I., Haruta, K., Shimuta, M., Inoue, H., Sakurai, H., Yamada, K., Ishimaru, N., Higashiyama, H., Sumida, T., Ishida, H., Suda, T., Noda, T., Hayashi, Y., and Tsubota, K. (1999) J. Immunol. 162, 2488-2494[Abstract/Free Full Text]
54. Lee, M. S., Mueller, R., Wicker, L. S., Peterson, L. B., and Sarvetnick, N. (1996) J. Exp. Med. 183, 2663-2668[Abstract/Free Full Text]
55. Halse, A., Tengner, P., Wahren-Herlenius, M., Haga, H., and Jonsson, R. (1999) Scand. J. Immunol. 49, 533-538[CrossRef][Medline] [Order article via Infotrieve]
56. Russo, M., Nahori, M. A., Lefort, J., Gomes, E., de Castro Keller, A., Rodriguez, D., Ribeiro, O. G., Adriouch, S., Gallois, V., de Faria, A. M., and Vargaftig, B. B. (2001) Am. J. Respir. Cell Mol. Biol. 24, 518-526[Abstract/Free Full Text]
57. Steinhauser, M. L., Hogaboam, C. M., Kunkel, S. L., Lukacs, N. W., Strieter, R. M., and Standiford, T. J. (1999) J. Immunol. 162, 392-399[Abstract/Free Full Text]
58. Corne, J. M., Lau, L., Scott, S. J., Davies, R., Johnston, S. L., and Howarth, P. H. (2001) Am. J. Respir. Crit. Care. Med. 163, 1101-1107[Abstract/Free Full Text]
59. Dosanjh, A. K., Elashoff, D., and Robbins, R. C. (1998) J. Interferon Cytokine Res. 18, 851-854[Medline] [Order article via Infotrieve]
60. Brandtzaeg, P., Osnes, L., Ovstebo, R., Joo, G. B., Westvik, A. B., and Kierulf, P. (1996) J. Exp. Med. 184, 51-60[Abstract/Free Full Text]
61. Fedorak, R. N., Gangl, A., Elson, C. O., Rutgeerts, P., Schreiber, S., Wild, G., Hanauer, S. B., Kilian, A., Cohard, M., LeBeaut, A., and Feagan, B. (2000) Gastroenterology 119, 1473-1482[CrossRef][Medline] [Order article via Infotrieve]
62. Wogensen, L., Huang, X., and Sarvetnick, N. (1993) J. Exp. Med. 178, 175-185[Abstract/Free Full Text]
63. Cohen, S. B. A., Crawley, J. B., Kahan, M. C., Feldmann, M., and Foxwell, B. M. J. (1997) Immunology 92, 1-5[CrossRef][Medline] [Order article via Infotrieve]
64. Sozzani, S., Ghezzi, S., Iannolo, G., Luini, W., Borsatti, A., Polentarutti, N., Sica, A., Locati, M., Mackay, C., Wells, T. N. C., Biswas, P., Vicenzi, E., Poli, G., and Mantovani, A. (1998) J. Exp. Med. 187, 439-444[Abstract/Free Full Text]
65. Rankin, J. A., Picarella, D. E., Geba, G. P., Temann, U.-A., Prasad, B., DiCosmo, B., Tarallo, A., Stripp, B., Whitsett, J., and Flavell, R. A. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 7821-7825[Abstract/Free Full Text]
66. Longphre, M., Li, D., Gallup, M., Drori, E., Ordonez, C. L., Redman, T., Wenzel, S., Bice, D. E., Fahy, J. V., and Basbaum, C. (1999) J. Clin. Invest. 104, 1375-1382[Medline] [Order article via Infotrieve]
67. Lee, J. J., McGarry, M. P., Farmer, S. C., Denzler, K. L., Larson, K. A., Carrigan, P. E., Brenneise, I. E., Horton, M. A., Haczku, A., Gelfand, E. W., Leikauf, G. D., and Lee, N. A. (1997) J. Exp. Med. 185, 2143-2156[Abstract/Free Full Text]
68. Yu, C. J., Shew, J. Y., Shun, C. T., Lin, H. T., Kuo, S. H., Luh, K. T., and Yang, P. C. (1998) Am. J. Respir. Cell Mol. Biol. 18, 643-652[Abstract/Free Full Text]
69. Arai, T., Abe, K., Matsuoka, H., Yoshida, M., Mori, M., Goya, S., Kida, H., Nishino, K., Osaki, T., Tachibana, I., Kaneda, Y., and Hayash, S. (2000) Am. J. Physiol. 278, L914-L922
70. Stein, R. T., Sherrill, D., Morgan, W. J., Holberg, C. J., Halonen, M., Taussig, L. M., Wright, A. L., and Martinez, F. D. (1999) Lancet 354, 541-545[CrossRef][Medline] [Order article via Infotrieve]
71. Bont, L., Heijnen, C. J., Kavelaars, A., van Aalderen, W. M. C., Brus, F., Draaisma, T. M., Geelen, S. E., and Kimpen, J. L. L. (2000) Am. J. Resp. Crit. Care Med. 161, 1518-1523[Abstract/Free Full Text]
72. Wills-Karp, M., Luyimbazi, J., Xu, X., Schofield, B., Neben, T. Y., Karp, C. L., and Donaldson, D. D. (1998) Science 282, 2258-2260[Abstract/Free Full Text]
73. Donaldson, D. D., Elias, J. A., and Wills-Karp, M. (2001) in Progress in Respiratory Research: New Drugs in Asthma, Allergy and COPD (Hansel, T. , and Barnes, P., eds) , pp. 260-263, Karger Press, Basel, Switzerland


Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Eur Respir JHome page
Z. Wang, C. Chen, S. N. Finger, S. d/o Kwajah M.M, M. Jung, H. Schwarz, N. Swanson, R. R. Lareu, and M. Raghunath
Suberoylanilide hydroxamic acid: a potential epigenetic therapeutic agent for lung fibrosis?
Eur. Respir. J., July 1, 2009; 34(1): 145 - 155.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. G. Lee, D. Hartl, G. R. Lee, B. Koller, H. Matsuura, C. A. Da Silva, M. H. Sohn, L. Cohn, R. J. Homer, A. A. Kozhich, et al.
Role of breast regression protein 39 (BRP-39)/chitinase 3-like-1 in Th2 and IL-13-induced tissue responses and apoptosis
J. Exp. Med., May 11, 2009; 206(5): 1149 - 1166.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
C. G. Lee, D. Hartl, H. Matsuura, F. M. Dunlop, P. D. Scotney, L. J. Fabri, A. D. Nash, N.-Y. Chen, C.-Y. Tang, Q. Chen, et al.
Endogenous IL-11 Signaling Is Essential in Th2- and IL-13-Induced Inflammation and Mucus Production
Am. J. Respir. Cell Mol. Biol., December 1, 2008; 39(6): 739 - 746.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
A. Natividad, M. J. Holland, K. A. Rockett, J. Forton, N. Faal, H. M. Joof, D. C.W. Mabey, R. L. Bailey, and D. P. Kwiatkowski
Susceptibility to sequelae of human ocular chlamydial infection associated with allelic variation in IL10 cis-regulation
Hum. Mol. Genet., January 15, 2008; 17(2): 323 - 329.
[Abstract] [Full Text] [PDF]


Home page
Physiol. Rev.Home page
T. Yoshida and R. M. Tuder
Pathobiology of Cigarette Smoke-Induced Chronic Obstructive Pulmonary Disease
Physiol Rev, July 1, 2007; 87(3): 1047 - 1082.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. J. Long, J. P. Sypek, R. Askew, S. C. Fish, L. E. Mason, C. M. M. Williams, and S. J. Goldman
Gob-5 Contributes to Goblet Cell Hyperplasia and Modulates Pulmonary Tissue Inflammation
Am. J. Respir. Cell Mol. Biol., September 1, 2006; 35(3): 357 - 365.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
R. J. Homer, Z. Zhu, L. Cohn, C. G. Lee, W. I. White, S. Chen, and J. A. Elias
Differential expression of chitinases identify subsets of murine airway epithelial cells in allergic inflammation
Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L502 - L511.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
W. R. Henderson Jr., G. K. S. Chiang, Y.-t. Tien, and E. Y. Chi
Reversal of Allergen-induced Airway Remodeling by CysLT1 Receptor Blockade
Am. J. Respir. Crit. Care Med., April 1, 2006; 173(7): 718 - 728.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
K. Ask, G. E. M. Martin, M. Kolb, and J. Gauldie
Targeting genes for treatment in idiopathic pulmonary fibrosis: challenges and opportunities, promises and pitfalls.
Proceedings of the ATS, January 1, 2006; 3(4): 389 - 393.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
T. Sabo-Attwood, M. Ramos-Nino, J. Bond, K. J. Butnor, N. Heintz, A. D. Gruber, C. Steele, D. J. Taatjes, P. Vacek, and B. T. Mossman
Gene Expression Profiles Reveal Increased mClca3 (Gob5) Expression and Mucin Production in a Murine Model of Asbestos-Induced Fibrogenesis
Am. J. Pathol., November 1, 2005; 167(5): 1243 - 1256.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. A. Kuperman, X. Huang, L. Nguyenvu, C. Holscher, F. Brombacher, and D. J. Erle
IL-4 Receptor Signaling in Clara Cells Is Required for Allergen-Induced Mucus Production
J. Immunol., September 15, 2005; 175(6): 3746 - 3752.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
A. Robichaud, S. A. Tuck, S. Kargman, J. Tam, E. Wong, M. Abramovitz, J. Mortimer, H. E. Burston, P. Masson, J. Hirota, et al.
Gob-5 Is Not Essential for Mucus Overproduction in Preclinical Murine Models of Allergic Asthma
Am. J. Respir. Cell Mol. Biol., September 1, 2005; 33(3): 303 - 314.
[Abstract] [Full Text] [PDF]


Home page
Proc Am Thorac SocHome page
R. S. Peebles Jr. and B. S. Graham
Pathogenesis of Respiratory Syncytial Virus Infection in the Murine Model
Proceedings of the ATS, August 1, 2005; 2(2): 110 - 115.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
V. Barbarin, Z. Xing, M. Delos, D. Lison, and F. Huaux
Pulmonary overexpression of IL-10 augments lung fibrosis and Th2 responses induced by silica particles
Am J Physiol Lung Cell Mol Physiol, May 1, 2005; 288(5): L841 - L848.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
D. P. Ennis, J. P. Cassidy, and B. P. Mahon
Acellular Pertussis Vaccine Protects against Exacerbation of Allergic Asthma Due to Bordetella pertussis in a Murine Model
Clin. Vaccine Immunol., March 1, 2005; 12(3): 409 - 417.
[Abstract] [Full Text] [PDF]


Home page
PhysiologyHome page
R. J. Homer and J. A. Elias
Airway Remodeling in Asthma: Therapeutic Implications of Mechanisms
Physiology, February 1, 2005; 20(1): 28 - 35.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
D. Spight, B. Zhao, M. Haas, S. Wert, A. Denenberg, and T. P. Shanley
Immunoregulatory effects of regulated, lung-targeted expression of IL-10 in vivo
Am J Physiol Lung Cell Mol Physiol, February 1, 2005; 288(2): L251 - L265.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Kaviratne, M. Hesse, M. Leusink, A. W. Cheever, S. J. Davies, J. H. McKerrow, L. M. Wakefield, J. J. Letterio, and T. A. Wynn
IL-13 Activates a Mechanism of Tissue Fibrosis That Is Completely TGF-{beta} Independent
J. Immunol., September 15, 2004; 173(6): 4020 - 4029.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
K. Hashimoto, B. S. Graham, S. B. Ho, K. B. Adler, R. D. Collins, S. J. Olson, W. Zhou, T. Suzutani, P. W. Jones, K. Goleniewska, et al.
Respiratory Syncytial Virus in Allergic Lung Inflammation Increases Muc5ac and Gob-5
Am. J. Respir. Crit. Care Med., August 1, 2004; 170(3): 306 - 312.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
V. Barbarin, M. Arras, P. Misson, M. Delos, B. McGarry, S. H. Phan, D. Lison, and F. Huaux
Characterization of the Effect of Interleukin-10 on Silica-Induced Lung Fibrosis in Mice
Am. J. Respir. Cell Mol. Biol., July 1, 2004; 31(1): 78 - 85.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Li, H.-C. Hsu, C. R. Stockard, P. Yang, J. Zhou, Q. Wu, W. E. Grizzle, and J. D. Mountz
IL-12 Inhibits Thymic Involution by Enhancing IL-7- and IL-2-Induced Thymocyte Proliferation
J. Immunol., March 1, 2004; 172(5): 2909 - 2916.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Santiago, M. Galindo, G. Palao, and J. L. Pablos
Intracellular Regulation of Fas-Induced Apoptosis in Human Fibroblasts by Extracellular Factors and Cycloheximide
J. Immunol., January 1, 2004; 172(1): 560 - 566.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
Z.-H. Cui, A. Joetham, M. K. Aydintug, Y.-S. Hahn, W. K. Born, and E. W. Gelfand
Reversal of Allergic Airway Hyperreactivity after Long-term Allergen Challenge Depends on {gamma}{delta} T Cells
Am. J. Respir. Crit. Care Med., December 1, 2003; 168(11): 1324 - 1332.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Huaux, T. Liu, B. McGarry, M. Ullenbruch, Z. Xing, and S. H. Phan
Eosinophils and T Lymphocytes Possess Distinct Roles in Bleomycin-Induced Lung Injury and Fibrosis
J. Immunol., November 15, 2003; 171(10): 5470 - 5481.
[Abstract] [Full Text] [PDF]


Home page
Toxicol PatholHome page
A. K. Farraj, J. R. Harkema, T.-R. Jan, and N. E. Kaminski
Immune Responses in the Lung and Local Lymph Node of A/J Mice to Intranasal Sensitization and Challenge with Adjuvant-Free Ovalbumin
Toxicol Pathol, June 1, 2003; 31(4): 432 - 447.
[Abstract] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
J. Perez-Vilar, J. K. Sheehan, and S. H. Randell
Making More MUCS
Am. J. Respir. Cell Mol. Biol., March 1, 2003; 28(3): 267 - 270.
[Full Text] [PDF]


Home page
J. Immunol.Home page
F. Huaux, T. Liu, B. McGarry, M. Ullenbruch, and S. H. Phan
Dual Roles of IL-4 in Lung Injury and Fibrosis
J. Immunol., February 15, 2003; 170(4): 2083 - 2092.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. A. Olman
Epithelial Cell Modulation of Airway Fibrosis in Asthma
Am. J. Respir. Cell Mol. Biol., February 1, 2003; 28(2): 125 - 128.
[Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/38/35466    most recent
M206395200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, C. G.
Right arrow Articles by Elias, J. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, C. G.
Right arrow Articles by Elias, J. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement