|
Originally published In Press as doi:10.1074/jbc.M206395200 on July 9, 2002
J. Biol. Chem., Vol. 277, Issue 38, 35466-35474, September 20, 2002
Transgenic Overexpression of Interleukin (IL)-10 in
the Lung Causes Mucus Metaplasia, Tissue Inflammation, and Airway
Remodeling via IL-13-dependent and -independent
Pathways*
Chun Geun
Lee ,
Robert J.
Homer§,
Lauren
Cohn ,
Holger
Link¶,
Sungsoo
Jung ,
Joseph E.
Craft**,
Barney S.
Graham ,
Teresa R.
Johnson , and
Jack A.
Elias §§
From the Section of Pulmonary and Critical Care
Medicine, Department. of Internal Medicine, Yale University School
of Medicine, New Haven, Connecticut 06520-8057, the
§ Department of Pathology, Yale University School of
Medicine, New Haven, Connecticut 06520 and the Pathology and
Laboratory Medicine Service, Veterans Administration Connecticut Health
Care System, West Haven, Connecticut 06516, the ¶ Section of
Respiratory Medicine, Department of Pediatrics, Yale University School
of Medicine, New Haven, Connecticut 06520-8057, the Division of
Rheumatology, Hanyang University Medical College and Hospital for
Rheumatic Disease, 17 Hangdang-dong, Sungdong-gu, Seoul 133-792, South
Korea, the ** Section of Rheumatology, Department of Internal
Medicine, Yale University School of Medicine, New Haven, Connecticut
06520-08057, and the  Division of Infectious
Diseases, Vanderbilt University School of Medicine,
Nashville, Tennessee 37232-2582
Received for publication, June 27, 2002
 |
ABSTRACT |
To address the complex chronic effector
properties of interleukin (IL)-10, we generated transgenic mice in
which IL-10 was overexpressed in the lung. In these mice, IL-10
inhibited endotoxin-induced tumor necrosis factor production and
neutrophil accumulation. IL-10 also caused mucus metaplasia, B and T
cell-rich inflammation, and subepithelial fibrosis and augmented the
levels of mRNA encoding Gob-5, mucins, and IL-13. In mice bred to
have null mutations of IL-13, IL-4R , or STAT-6, transgenic IL-10 did
not induce mucus metaplasia but did induce inflammation and fibrosis.
IL-10 was also a critical mucin regulator of virus-induced mucus
metaplasia. Thus, IL-10, although inhibiting lipopolysaccharide-induced
inflammation, also causes mucus metaplasia, tissue inflammation, and
airway fibrosis. These responses are mediated by multiple mechanisms with mucus metaplasia being dependent on and the inflammation and fibrosis being independent of an IL-13/IL-4R /STAT-6 activation pathway.
 |
INTRODUCTION |
IL-101 was originally
described as a product of type 2 T cells that inhibited interferon-
(IFN- ) production by type I murine T cell clones. Subsequent studies
demonstrated that IL-10 is produced by a wide variety of cells
including monocytes, macrophages, eosinophils, and bronchial epithelial
cells (1, 2). They also highlighted the impressive immunosuppressive,
anti-inflammatory, and tissue-protective effects of this cytokine
(3-6). This included studies that demonstrated that IL-10 decreases
tissue inflammation and injury in animal models of a variety of
pulmonary and extrapulmonary human disorders (5, 7-9) and that
IL-10-deficient mice have Th1 polarized immune responses and develop
severe inflammatory colitis resulting from chronic stimulation by
enteric antigens (10). In an attempt to capitalize on these
anti-inflammatory and protective properties, IL-10 is being used in
clinical trials to treat patients with inflammatory bowel disease,
rheumatoid arthritis, and psoriasis and chronic IL-10 administration
has been proposed as a treatment for pulmonary disorders such as cystic
fibrosis and asthma (2, 11-13).
In contrast to its anti-inflammatory properties, IL-10 also has well
defined pro-inflammatory and immunostimulatory effector functions. They
include the ability to stimulate thymocyte, T cell, B cell, and mast
cell proliferation, differentiation, and cytokine elaboration and to
activate endothelial cells (14-18). These and other properties of
IL-10 likely contribute to its ability to augment transplant graft
rejection (19), contribute to the pathogenesis of autoimmunity and
anti-tumor immunity (20-22), and decrease survival and microbe
clearance in models of specific bacterial pneumonias (23, 24). Although
IL-10 has been proposed to be a useful therapeutic agent that can be
chronically administered to patients with inflammatory disorders, the
chronic effects of IL-10 in the lung and other organs have not been
adequately defined.
The complexities of IL-10 are nicely illustrated in its role in the
pathogenesis and treatment of asthma. A number of lines of evidence
suggest that IL-10 has a predominantly anti-inflammatory effect in this
setting. This includes in vitro studies that demonstrate that IL-10 inhibits Th2 cell cytokine elaboration (9, 13, 25), IgE
production (26), eosinophil survival (27), and antigen-induced
eosinophilic inflammation and tumor necrosis factor (TNF) production
(9, 25, 28). Similarly, some in vivo studies have
demonstrated a relative deficiency in the production and/or accumulation of IL-10 in asthmatics (12, 29, 30). This led to the
belief that decreased IL-10 production contributes to the chronic
inflammation that is characteristic of asthma and that rIL-10 could be
a useful therapeutic in this disorder (6, 13, 25). In contrast, an
equally cogent body of data suggests that IL-10 can contribute to the
pathogenesis of this disorder. This is based on studies that
demonstrate that IL-10 augments antigen-induced eosinophilic
inflammation, airway hyperresponsiveness, airway mucus metaplasia, and
IL-5 elaboration in acute asthma models (9, 31, 32) and studies
demonstrating that IL-10 mRNA can be detected in elevated
quantities in asthmatics at base line and after segmental antigen
challenge (9, 33-35). The degree to which chronic IL-10 can, by
itself, induce or exacerbate inflammatory, mucus, and fibrotic
responses comparable to those in asthmatic airways has, however, not
been investigated.
To further understand the chronic effects of IL-10 in the lung, we
generated and characterized mice in which IL-10 was chronically overexpressed in the airway. These studies demonstrate that IL-10, although inhibiting lipopolysaccharide-induced tissue inflammation and
TNF production, simultaneously induces a B and T cell-rich inflammatory
response, mucus metaplasia, and airway remodeling. They also
demonstrate that IL-10-induces these responses via multiple mechanisms,
with the mucus response and the inflammatory and fibrotic responses
being mediated by IL-13-dependent and -independent
pathways, respectively.
 |
EXPERIMENTAL PROCEDURES |
Production and Identification of Transgenic Mice--
Construct
pKS-CC10-rtTA-hGH, which contains the 2.3-kb rat CC10 promoter (a gift
from Dr. J. Whitsett, University of Cincinnati, Cincinnati, OH),
reverse tetracycline transactivator (rtTA), and human growth hormone
(hGH) intronic and polyadenylation sequences was prepared as described
previously by our laboratory (36). Plasmid pcD(Salpha)-F115, which
contains the murine IL-10 cDNA, was obtained from the American Type
Culture Collection (ATCC no. 68027) The IL-10 cDNA in this plasmid
was then amplified using the following PCR primers:
5'-CACTAAGCTTGCCACAAAGC-3' and 5'-TCCACAGGATCCGTGTTTTAGC-3'. The PCR
amplification product was then subcloned into pKS-CC10-rtTA-hGH replacing the rtTA with IL-10. This yielded the construct
pKS-CC10-IL-10-hGH. After the fidelity of the junction areas and the
IL-10 cDNA was confirmed by sequencing, the construct (Fig.
1A) was digested, isolated, purified, dialyzed, and
microinjected as previously described (36, 37).
The presence or absence of the transgene in the resulting animals and
their progeny was determined using tail DNA and Southern blot analysis
with 32P-labeled murine IL-10 cDNA as a probe or PCR.
The primers 5'-TGCTATGCTGCCTGCTCTTA-3' and 5'-TCATTTCCGATAAGGCTTGG-3'
were used for PCR genotyping. The following PCR protocol was employed:
95 °C for 3 min, 30 cycles of 95 °C for 1 min, 58 °C for 1 min
and 72 °C for 1 min, and a final extension at 72 °C for 10 min.
Bronchoalveolar Lavage (BAL) and Quantification of
IL-10--
Mice were euthanized, the trachea was isolated by blunt
dissection, and small caliber tubing was inserted and secured in the airway. Three sequential 0.75-ml volumes of PBS with 0.1% bovine serum
albumin were then instilled and gently aspirated and pooled. BAL fluid
samples were centrifuged, and supernatants were stored at 70 °C
until used. The levels of IL-10 were determined with a commercial ELISA
as per instructions from the manufacturer (R&D Systems, Inc.,
Minneapolis, MN).
mRNA Analysis--
mRNA levels were assessed using
RT-PCR and ribonuclease protection assays (RPA) as previously described
by our laboratory (38, 39). In the RT-PCR assays, gene-specific primers
were used to amplify selected regions of each target moiety. The
primers and reactions for the Muc-1, Muc-2, Muc-5ac, and -actin have been previously described (40). The other primer sequences (5' to 3')
are as follows: Muc-4, TCACTGGTAACCGCTTGCTTC and
CATCCTGGGGGCTGTAGAC; surfactant D, CTCTCGCAGAGATCAGTACC and
GGAAAGCAGCCTTGTTGTGG; IL-4, TCAACCCCCAGCTAGTTGTC and
TTCAAGCATGGAGTTTTCCC; IL-5, ATGGAGATTCCCATGAGCAC and
GTCTCTCCTCGCCACACTTC; IL-9, GAAGGATGATCCACCGTCAAAATGC and CGTCCCCAGGAGACTCTTCAGAAATG; IL-10, CACTAAGCTTGCCACAAAGC and
TCCACAGGATCCGTGTTTTAGC; IL-13, AGACCAGACTCCCCTGTGCA and
TGGGTCCTGTAGATGGCATTG; Gob-5, CACAACCACTAAGGTGGCCT and
AGGTGTTGAAGTGGTCCCTG; transforming growth factor-
(TGF- 1), CTGTCCAAACTAAGGCTCGC and CGTCAAAAGACAGCCACTCA; interferon- (IFN- ), ACTGGCAAAAGGATGGTCAC and
TGAGCTCATTGAATGCTTGG; and L32, TCCAGAGACCATCCATCCTC and
ATCCTCTTGCCCTGAATCCTT. To verify that equal amounts of undegraded
RNA were added in each RT-PCR reaction, -actin was used as an
internal standard. Amplified PCR products were detected using 1.2%
agarose ethidium bromide gel electrophoresis, quantitated
electronically, and confirmed by nucleotide sequencing.
RPA assays were performed using the RiboQuant kit purchased from BD
PharMingen (San Diego, CA). These assays were performed according to
instructions provided by the manufacturer.
Histologic Evaluation--
Histologic evaluations of 10%
formalin, pressure-fixed (25 cm) lungs, and formalin-fixed
extrathoracic tissues were obtained as previously described (37-39).
Hematoxylin and eosin, Mallory's trichrome, periodic acid-Schiff with
diastase (PAS), and Alcian blue stains were performed in the Research
Pathology Laboratory at Yale University.
Immunofluorescence Staining and Confocal Microscopy--
To
analyze the inflammatory cells in IL-10 transgenic mice, we stained
frozen tissue sections with FITC- or PE-labeled antibodies against cell
surface markers. In these experiments lungs were perfused, inflated,
and fixed overnight at 4 °C with paraformaldehyde lysine periodate
solution (0.001 M periodate, 0.075 M lysine, 1% paraformaldehyde, pH 7.4). Cryoprotection was accomplished by
consecutive 20-min incubations in graded cold sucrose solutions (10, 20, and 30% in 0.1 M phosphate buffer, pH 7.4). The lungs were then inflated with a 40% optimal cutting temperature
solution diluted in PBS; cryomolds were prepared with optimal cutting
temperature; and 7-µm tissue sections were prepared on microscopic
glass slides, air-dried at room temperature, and stored at 80 °C
for further use. For immunofluorescence staining, the slides were
washed and rehydrated with TN buffer (20 mM Tris-HCl, 0.5 M NaCl, pH 7.4) for 5 min, and blocked with 100 µl of 3%
bovine serum albumin in PBS for 1 h. PE- and FITC-labeled
antibodies were directly added onto the samples and incubated overnight
at 4 °C. PE-labeled anti-mouse CD3 (145-2C11), CD4 (GK 1.5),
CD45/B220 (RA3-6B2), and I-Ab (A b) (25-9-3)
antibodies and FITC-labeled anti-mouse CD3, CD4, CD45/220, and CD8a
(Ly-2) antibodies were purchased from BD PharMingen and used for single
or double staining with a combination of PE- and FITC-conjugated
antibodies. The slides were then washed three times with TN buffer,
mounted, evaluated, and photographed using the fluorescent settings on
a Zeiss LSM 510 confocal laser scanning inverted microscope (Axiovert
100M, Zeiss). The laser was set at 488 nm for green (FITC) fluorescence
and 568 nm for red (PE) fluorescence.
Characterization of the Effects of IL-10 on Lipopolysaccharide
(LPS)-induced Inflammation--
BAL was performed, as described above,
on transgene ( ) and transgene (+) mice before and 6 h after the
intratracheal administration of 50 µl of LPS (Escherichia
coli serotype 0.55:B5, 100 ng/ml) (Sigma) or appropriate
vehicle control. Total cell and neutrophil recovery were then assessed.
BAL TNF levels were evaluated using a commercial ELISA (R&D, Inc.) as
per instructions from the manufacturer.
PCR Cloning of Mouse Muc-4 cDNA--
To be able to
characterize the expression of the Muc-4 gene in transgenic and control
mice, the nucleotide sequence of murine Muc-4 needed to be defined. To
accomplish this we designed the PCR primers based on the regions that
were conserved in both the human Muc-4 and rat ascites
sialoglycoprotein-2 sequences (41, 42). The sense
5'-TCACTGGTAACCGCTGCTTC-3' and antisense 5'-CATCCTGGGGGCTGGTAGAC-3' primers encompassed the 3'-flanking region of human Muc-4 and the
5'-coding region of rat ascites sialoglycoprotein-2. After reverse
transcription and 30 cycles of PCR amplification with a 60 °C
annealing temperature, the 513-bp amplified product was purified and
cloned into a TA cloning vector (pCR-II, Invitrogen). The inserted
cDNA was sequenced, and the nucleotide and corresponding protein
sequences were submitted to GenBankTM (accession no.
AF218819).
Calculation of Histologic Mucus Index--
The histologic mucus
index (HMI) provides a measurement of the percentage of epithelial
cells that are PAS (+) per unit airway basement membrane. It is
calculated from PAS-stained sections as described previously by our
laboratories (38, 39).
Slot Blotting and Immunodetection of Mucins in the BAL
Fluid--
To quantitate the levels of mucins in BAL fluids from
transgene (+) and transgene ( ) mice, 0.1 ml of BAL fluid was slot
blotted onto nitrocellulose membranes using a Minifold II slot blot
apparatus (Schleicher & Schuell) according to the protocol provided by
the manufacturer. After air-drying, the membrane was blocked with 5%
skim milk in TTBS (0.1% Tween 20, 20 mM Tris-Cl, 500 mM NaCl) for 2 h and washed three times with TTBS. The
membrane was then incubated overnight at 4 °C with a polyclonal
antiserum against Mucin-1 (C-20; Santa Cruz Inc., Santa Cruz, CA), a
monoclonal antibody against Mucin-2 (Ccp58, Santa Cruz Inc.), or a
monoclonal antibody against Mucin-5AC (45M1; NeoMarkers, Union City,
CA). After washing with TTBS, the membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated anti-mouse or anti-goat immunoglobulin (Ig)-G (Pierce). Immunoreactive mucins were
detected using a chemiluminescent procedure (ECL Plus Western blotting
detection system, Amersham Biosciences) according to instructions from
the manufacturer.
In Situ Hybridization--
In situ hybridization was
undertaken as previously described (43). The mouse Gob-5 gene probe
contained the segment from the mouse Gob-5 sequence between base pairs
1027 and 1465 (GenBankTM accession no. NM_011577).
Genetically Modified Mice--
IL-10 transgene (+) mice were
bred with mice with null mutations of IL-4R , IL-13, STAT-6, and
IL-4. The IL-4R ( / ) mice were obtained from Dr. F. Brombacher
(44), the IL-13 ( / ) mice were obtained from Dr. A. N. J. McKenzie (45), and the STAT-6 ( / ), IL-4 ( / ), and IL-10 ( / )
mice were obtained from Jackson Laboratories (Bar Harbor, ME).
Assessments of TGF- 1--
The levels of total and
bioactive TGF- 1 were evaluated using an ELISA that was
specific for bioactive TGF- 1 (R&D, Inc., Minneapolis,
MN). Evaluations were undertaken with acid-treated and untreated BAL
fluids from 1-3-month-old transgene (+) and littermate control animals
as previously described (43).
Respiratory Syncytial Virus (RSV) Sensitization and
Challenge--
Mice were sensitized intradermally, at the base of the
tail, with 5 × 105 plaque-forming units of vaccinia
virus (VV) expressing secreted RSV G glycoprotein (a gift from Dr.
G. W. Wertz, University of Alabama at Birmingham, Birmingham, AL)
or with control vaccinia virus expressing -galactosidase (vac-lac; a
gift from Dr. B. Moss, National Institutes of Health, Bethesda, MD).
Six weeks later the mice were challenged with 1 × 107
plaque-forming units (in 0.1 ml) of live RSV virus A2 strain, which was
administered intranasally and aspirated into the lung. Four days after
challenge the mice were sacrificed, their lungs were removed, and mucin
gene expression was assessed with RT-PCR analysis as described.
Comparisons were made of the levels of mucin gene expression in
(a) wild-type (WT) mice and IL-10 ( / ) mice (Jackson
Laboratories), (b) WT mice treated with 0.2 mg of either a
neutralizing monoclonal antibody against IL-10 (clone JES5.2A5,
Genetics Institute, Cambridge MA) or an IgG1 isotype control (American
Type Culture Collection), and (c) WT mice treated with the
IL-13 antagonist IL-13 R 2-Fc (a gift from Dr. Sandy Goldman, Wyeth Inc., Cambridge, MA) or an appropriate Ig control. These
antibody interventions were administered on days 1, 0, and + 1 with
respect to the live virus challenge.
Statistics--
Values are expressed as means ± S.E. As
appropriate, groups were compared by analysis of variance with
Scheffe's procedure post hoc analysis,
Student's t test, or nonparametric assessments (Wilcoxon's
rank sum, Mann-Whitney U test) using StatView software for
the Macintosh (Abacus Concepts Inc., Berkeley, CA).
 |
RESULTS |
Generation of Transgenic Mice--
To generate transgenic mice in
which IL-10 is selectively expressed in the lung, constructs containing
the CC10 promoter and murine IL-10 were prepared (Fig.
1A), standard microinjection was undertaken, tail DNA was isolated, and the presence or absence of
IL-10 transgenic sequences was determined via Southern blot analysis
and PCR. Four animals contained the appropriate transgenic construct.
Independent lines were subsequently generated by breeding these
founders with C57BL/6 mice, and the appropriateness of gene expression
in each line was evaluated. Qualitatively, similar phenotypes were seen
on all four lines. The details of these phenotypes are described
below.

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 1.
Generation of transgenic mice.
Panel A is a schematic illustration of the
construct that was used to generate the mice. The levels of IL-10 in
BAL from the different lines are illustrated in panel
B. Each value represents the mean ± S.E. of
evaluations of a minimum of 5 animals. The organ specificity of IL-10
gene expression is illustrated in panel C. In
this experiment RPA was used to compare the levels of mRNA encoding
IL-10 and the housekeeping genes for L32 and -actin in organs from a
1-month-old transgene (+) animal.
|
|
Characterization of Gene Expression in Transgenic Mice--
To
determine whether IL-10 was appropriately targeted to the lung, we
quantitated the levels of BAL IL-10 and compared the levels of IL-10
mRNA in the lungs and extrapulmonary organs from transgene (+) and
transgene ( ) mice. The BAL fluid from transgene (+) line 2 animals
contained modest amounts of IL-10 (100-200 pg/ml). Higher levels of
IL-10 were noted in BAL fluids from transgene (+) line 5 (400-600
pg/ml), line 6 (1.7-1.9 ng/ml), and line 7 (1.9-2.3 ng/ml) animals
(Fig. 1B). IL-10 was not detected in the BAL fluid from
transgene ( ) littermate control animals (data not shown). In accord
with these findings, mRNA encoding IL-10 was readily detected in
RNA from lungs from line 6 and 7 mice, was detected at lower levels in
the RNA from line 5 and 2 mice, and was undetectable in pulmonary
tissues from transgene ( ) animals (data not shown). In addition,
transgene-induced IL-10 mRNA was not noted and histologic
abnormalities were not appreciated on hematoxylin and eosin analysis of
a variety of extrapulmonary tissues from transgene (+) animals (Fig.
1C and data not shown). This demonstrates that the CC10
promoter selectively targeted IL-10 to the lungs of transgene (+) animals.
Effect of IL-10 on LPS-induced Inflammation and TNF
Production--
Comparisons were subsequently undertaken of the
responses elicited by LPS in transgene ( ) and transgene (+) mice. BAL
neutrophils were only intermittently detected, and TNF was not detected
in BAL from transgene ( ) and (+) animals in the absence of LPS
administration (data not shown). A profound BAL neutrophilia and
impressive levels of BAL TNF were noted 6 h after LPS
administration to transgene ( ) mice (Fig.
2). IL-10 inhibited these responses in an
impressive fashion. Transgene (+) line 6 and 7 mice had levels of BAL
TNF and neutrophil recovery ~5-15% of those in transgene ( )
littermate controls (Fig. 2) (p < 0.01 for each
comparison). Thus, transgenic IL-10 has potent anti-inflammatory
effects in the LPS-challenged murine airway.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of IL-10 on LPS-induced
responses. IL-10 transgene (+) (IL-10 TG) and transgene
( ) WT littermate control mice received intratracheal LPS
(solid bars) or vehicle control (open
bars) and underwent BAL 6 h later. Total cell
(top left panel) and neutrophil
recovery (top right panel) and TNF
levels (lower panel) in BAL fluids from transgene
(+) and transgene ( ) mice are compared. The noted values represent
the means ± S.E. of a minimum of 5 animals. (*, p < 0.05; **, p < 0.01). Neutrophils were only
intermittently noted, and TNF was not detected in the BAL fluids from
the vehicle control-treated animals.
|
|
Histologic Effects of IL-10--
The lungs from transgene (+) and
transgene ( ) animals were indistinguishable on gross examination, and
differences in alveolar size or gross airway morphology were not noted
on light microscopic exam (Fig. 3 and
data not shown). In contrast to the transgene ( ) littermates,
however, lungs from transgene (+) mice manifest a mononuclear
inflammatory response around small and large airways and nearby
vascular structures (Fig. 3B). This response was most pronounced in the mice producing high levels of IL-10 for long periods
of time (3-4 months) (data not shown). It was, however, readily
apparent in line 2 mice at all time points (data not shown). Immunohistochemistry and confocal analysis demonstrated that these infiltrates contained increased numbers of CD4+ T cells and B220(+) and
MHC II (+) B cells (Fig. 3, C-E). Enhanced staining with
antibodies against CD8 was not appreciated (data not shown). Congo red
and Alcian blue stains also did not reveal increased numbers of
eosinophils or mast cells, respectively (data not shown).

View larger version (70K):
[in this window]
[in a new window]
|
Fig. 3.
Histologic effects of chronic IL-10
production. In panels A and
B, hematoxylin and eosin stains were used to compare lungs
from 3-month-old transgene ( ) (panel A) and
transgene (+) (panel B) animals (original
magnification, ×10). Panels C-E illustrate the
confocal immunohistochemical evaluations of the lungs from IL-10
transgenic mice demonstrating the staining (red/orange) with
antibodies against CD4 (panel C), B220
(panel D), and HLA class II (panel
E) (original magnification, ×20). Trichrome evaluations
were used to compare the collagen in lungs from littermate control
(panel F) and IL-10 transgenic mice
(panel G) (original magnification, ×10). The
trichrome stains of the transgene ( ) and transgene (+) mice are
illustrated at a higher magnification in panels H
and I, respectively (original magnification, ×20).
|
|
Trichrome stains were also used to compare the fibrotic responses in
the lungs from transgene ( ) and (+) animals. A small amount of
collagen could be appreciated in and near the airway wall, and loosely
packed collagen could be appreciated in the bronchovascular bundles of
transgene ( ) mice. In contrast, enhanced collagen deposition was
readily appreciated in the subepithelial region and, to a lesser
extent, the adventitia of the small and medium-sized airways of the
transgenic animals (Fig. 3, panels F-I). This
accumulation was readily apparent in all four transgenic lines. It was,
however, both dose- and time-dependent because it was most
prominent in animals that expressed high levels of IL-10 (lines 6 and
7) for prolonged periods of time (3-4 months) (data not shown). When
viewed in combination, these studies demonstrate that IL-10 is a potent
in vivo stimulator of inflammation and subepithelial airway fibrosis.
Effects of IL-10 on Airway Mucus and Mucin and Gob-5 Gene
Expression--
To define the effects of IL-10 on airway mucus, we
compared the PAS and Alcian blue staining and levels of mucin and Gob-5 gene expression in transgene ( ) and transgene (+) mice. At all time
points, PAS- and/or Alcian blue-staining cells could not be appreciated
in the airways of the transgene ( ) animals (HMI values, 0-1). In
contrast, PAS- and Alcian blue-staining cells were prominent in the
airways of the transgene (+) animals (Fig. 4A). HMI calculations
demonstrated that this response was present in all four transgenic
lines. The most prominent alterations were noted in line 6 and 7 transgene (+) animals (HMI between 65 ± 3 and 75 ± 5, p < 0.01). As can be seen in Fig. 4B, IL-10
simultaneously increased the levels of mRNA encoding Muc-5ac,
Muc-4, and Muc-2 but not Muc-1. Mucus hypersecretion was also readily
apparent in the BAL immunoblot evaluations (Fig. 4C). In
accord with the important role of the calcium-regulated chloride
channel Gob-5 in mucus metaplasia (46, 47), Gob-5 mRNA was also
prominently induced in IL-10 transgenic animals. This induction was
seen in RT-PCR studies (Fig. 4B) and in in situ
hybridization evaluations, which demonstrated that Gob-5 mRNA
accumulated selectively in airway epithelial cells (Fig.
4D).

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 4.
Mucus-regulating effects of IL-10. In
panel A, PAS and Alcian blue staining was used to
compare airways from transgene ( ) and transgene (+) mice (original
magnification, ×10 for insets A and
B; ×20 for insets C-F). In
panel B, RT-PCR was used to evaluate the levels
of mRNA encoding the noted mucin and Gob-5 genes in lungs from
transgene ( ) and transgene (+) mice. Each lane is a
representative animal. In panel C slot-immunoblot
analysis was utilized to evaluate the levels of the noted mucins in BAL
fluids (BALF) from transgene (+) and transgene ( ) mice. In
panel D, in situ hybridization with
sense (S) and antisense (AS) probes was used to
localize Gob-5 mRNA transcripts (arrows) in tissues from
IL-10 transgene (+) animals and transgene ( ) littermate
controls.
|
|
IL-10 Regulation of Th2 Cytokines--
Previous studies from our
laboratories demonstrated that Th2 cytokines are potent inducers of
mucus metaplasia in the airway (48). Thus, studies were undertaken to
determine whether IL-4, IL-5, IL-13, or IL-9 were induced by IL-10 in
our transgenic mice. Transcripts encoding Th2 cytokines were not
detected in total lung RNA from transgene ( ) animals. They were,
however, readily apparent in lungs from antigen-sensitized and
-challenged WT animals (Fig. 5). As shown
in Fig. 5, increased levels of mRNA encoding IL-13 were detected in
RNA from IL-10 transgenic mice. This stimulation was at least partially
IL-13-specific because IL-10 did not stimulate the accumulation of
mRNA encoding IL-4, IL-5, or IL-9 in a similar fashion (Fig.
5).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 5.
IL-10 regulation of Th2 cytokine gene
expression. RT-PCR was used to evaluate the levels of mRNA
encoding the noted cytokines in lungs from transgene (+) and transgene
( ) control animals. RNA from lungs from WT animals sensitized and
challenged with ovalbumin (OVA-RNA) serve as positive
controls and are evaluated in lane 1.
|
|
Role of IL-4 Receptor , STAT-6, and IL-13 in the IL-10-induced
Phenotype--
To define the roles of IL-4R , STAT-6, and IL-13 in
the genesis of the histologic alterations in IL-10 transgenic mice, we bred transgene (+) mice with mice with null mutations of IL-4R (IL-4R ( / )), STAT-6 (STAT-6 ( / )), IL-13 (IL-13 ( / )), or IL-4 (IL-4 ( / )). Lungs from IL-4R ( / ), STAT-6 ( / ), IL-13 ( / ), and IL-4 ( / ) mice could not be differentiated from lungs from WT transgene ( ) littermate control mice on gross and light microscopic examination (data not shown). In contrast to the IL-10 transgenic mice, transgene (+)/IL-4R ( / ) mice, transgene
(+)/STAT-6 ( / ) mice, and transgene (+)/IL-13 ( / ) mice did not
manifest mucus metaplasia (Fig. 6). These
mice had HMI values between 0 and 1 and markedly decreased Gob-5 gene
expression (Fig. 6 and data not shown). They did, however, manifest
levels of tissue infiltration and airway fibrosis that were comparable
with those seen in IL-10 transgene (+) animals (Fig. 6 and data not
shown). In accord with these findings, IL-10 caused a significant
increase in TGF- 1 mRNA and latent
TGF- 1 protein accumulation in lungs from transgene (+)
mice (Fig. 6). These inductive responses were not altered in transgene
(+)/IL-13 ( / ) or transgene (+)/STAT-6 ( / ) animals. A markedly
different result was seen in transgene (+)/IL-4 ( / ) mice, which had
levels of mucus metaplasia, inflammation and fibrosis comparable with
WT transgene (+) animals (Fig. 6). These studies demonstrate that IL-10
induces mucus metaplasia and regulates mucin and Gob-5 gene expression
via an IL-13-, STAT-6-, and IL-4R -dependent and
IL-4-independent pathway. They also demonstrate that IL-13, STAT-6, and
IL-4R do not play critical roles in the generation of the
inflammatory and fibrotic effects of this transgenic cytokine and
highlight the ability of IL-10 to stimulate the production of the
fibrogenic cytokine TGF- 1 via an IL-13- and
STAT-6-independent pathway.

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 6.
Effect of null mutations of selected genes on
IL-10-induced mucus metaplasia and tissue fibrosis. In
panels A and B, PAS staining and
trichrome staining were used to compare the mucus and fibrotic
responses, respectively in IL-10 transgene (+) mice with WT and null
loci. Inset a is the transgene ( ) control;
b, IL-10 transgene (+); c, IL-10 (+)/IL-4R
( / ); d, IL-10 (+)/STAT-6 ( / ); e, IL-10
(+)/IL-13 ( / ); f, IL-10 (+)/IL-4 ( / ).
Panels A and B, original
magnification, ×20 and ×10, respectively. In panels
C and D, RT-PCR was used to compare the levels of
IL-10, Gob-5, Muc-5ac, and TGF- 1 mRNA in transgene
(+) and ( ) mice with WT and null IL-13 and STAT-6 loci.
|
|
Mucus-regulating Effects of IL-10 in a Viral Modeling
System--
To confirm that endogenous IL-10 is an important regulator
of in vivo mucus responses, we compared the mucin gene
expression in WT and IL-10 null (IL-10 ( / )) mice that had been
sensitized with RSV G glycoprotein and challenged with live RSV. This
model was chosen because previous studies from our laboratories
demonstrated increased mucus and IL-13 production in this system (49,
50). In these experiments, significant increases in Muc-5ac gene
expression were seen in virus-challenged wild-type animals that had
been sensitized with G glycoprotein (Fig.
7). This mucus response was IL-13-dependent because treatment with the IL-13 antagonist
IL-13R 2-Fc abrogated RSV-induced increases in mucin gene
expression in this system (Fig. 7A). It also appeared to
depend on IL-10 production because comparable levels of induction of
mucin gene expression were not seen after virus challenge of G
glycoprotein-sensitized IL-10 ( / ) animals and the administration of
neutralizing antibodies against IL-10 during the viral challenge phase
of this protocol abrogated Muc-5ac mRNA induction (Fig. 7,
B and C). Interestingly, these effects were not a
result of the ability of IL-10 to inhibit IFN- production because
similar levels of IFN- gene expression were noted in comparisons of
G glycoprotein-sensitized and virus-challenged IL-10 (+/+) and ( / )
mice (data not shown). Thus, these studies demonstrate that IL-10 is an
important inducer of mucin gene expression in this viral system.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 7.
Effect of IL-10 deficiency on RSV-induced
mucin expression. WT (IL-10 (+/+)) or IL-10 ( / ) mice were
sensitized by treatment with VV containing the soluble RSV G
glycoprotein (vvGs) or VV containing a galactosidase
(vac-lac) control and then challenged with live RSV. In
panel A the challenges were undertaken in mice
treated with the IL-13 antagonist IL-13R 2-Fc (IL-13R )
or an immunoglobulin control. Muc-5ac gene expression was evaluated by
RT-PCR. In panel B challenges were undertaken in mice that
received neutralizing antibodies against IL-10 (anti-IL-10 (+)) or
isotype controls (anti-IL-10 ( )). The levels of Muc-5ac gene
expression were evaluated via RT-PCR and are expressed as a relative
ratio compared with the levels of -actin mRNA (*,
p < 0.05 compared with WT IL-10 (+/+) mice treated
with VV containing the soluble RSV G glycoprotein). A representative
experiment using the neutralizing antibodies against IL-10 is
illustrated in panel C.
|
|
 |
DISCUSSION |
Inflammation in the lung (and other visceral structures)
eliminates microbial pathogens and initiates healing responses after tissue injury. However, inflammation can also contribute to organ dysfunction and, if severe, organ failure. As a result, homeostatic systems have evolved that ensure that inflammation is not initiated after trivial exposures or injuries and that inflammatory responses are
appropriately down-regulated when they are no longer required. IL-10
has been assumed to play a major role in the latter regulatory responses. This is based on studies that demonstrate that IL-10 is
constitutively elaborated and prevents inflammation in normal healthy
pulmonary airways and that endogenous IL-10 is induced and controls
inflammatory responses initiated by infectious, particulate and
antigenic stimuli (2, 8, 9, 25, 29, 51). Similarly, exogenously
administered recombinant IL-10 is protective and/or controls the
inflammation in Pseudomonas pneumonia, silicosis, immune
complex lung injury, and ischemia-reperfusion lung injury and a
deficiency of IL-10 production may contribute to the pathogenesis of
the chronic inflammation seen in diseases such as cystic fibrosis (2,
7, 8, 11, 51, 52). As a consequence of these findings, it has been
assumed that IL-10 can be used to control chronic inflammatory
pulmonary disorders. However, IL-10 also has pro-inflammatory tissue
effects and detrimental effects in models of transplant rejection and
infectious pneumonias (19, 23, 24), and it can contribute to the
pathogenesis of autoimmune and inflammatory disorders (53-55). These
studies suggest that IL-10 may contribute to disease pathogenesis and
may not always ameliorate tissue inflammation. To address the
mechanisms responsible for these complex effector functions and define
the mechanisms by which IL-10 can contribute to or ameliorate
inflammatory responses in the lung, we generated overexpression
transgenic mice in which IL-10 was expressed in the murine airway at
levels comparable with or below those seen in relevant animal models,
human biologic fluids, and rIL-10-treated patients (9, 33, 56-61).
Studies of these mice demonstrated that IL-10 has anti-inflammatory
effects in the setting of endotoxin challenge. They also demonstrated, for the first time, that IL-10 simultaneously induces mucus metaplasia, enhances mucin gene expression and mucin elaboration, and causes a T
and B cell-rich inflammatory response and airway fibrosis. Finally,
they demonstrate that IL-10 induces IL-13 in the lung and that the
effects of IL-10 are mediated via IL-13-dependent and
-independent pathways.
To address the complex effector properties of IL-10, we evaluated the
effects of our transgene in naive and inflamed lungs. In accord with
reports in the literature (3, 5, 25), these studies revealed potent
anti-inflammatory effects of IL-10. IL-10 simultaneously induced a
peribronchiolar and perivascular tissue inflammatory response, which,
by confocal microscopy, was made up largely of T cells and B cells.
This finding is also in accord with studies demonstrating that
transgenic IL-10 causes lymphocytic inflammation in the pancreas (62)
and salivary gland (53) and that IL-10 stimulates T and B cell
proliferation, stimulates T cell chemotaxis, and inhibits T cell
apoptosis (17, 63, 64). One could interpret these studies to
demonstrate that IL-10 simultaneously exerts pro- and anti-inflammatory
effects when chronically expressed in the lung. Although this may be
true, we feel it is likely an overly simplistic interpretation.
Instead, we believe that our studies and the literature suggest that
IL-10 has complex effector properties that can vary depending on the properties of the ongoing inflammation, injury, and repair response and
the timing, dose, and localization of the cytokine. In addition, the
inflammation and anti-inflammatory effects of IL-10 can be tied
together in a cause and effect fashion if some or all of the cells that
are found in these pulmonary infiltrates are inhibitory T regulatory 1 (Tr1) cell populations that can be induced in the presence of chronic
IL-10 elaboration (4). Preliminary experiments from our laboratory
have, however, failed to reveal evidence for Tr1 cells in these
infiltrates.2 Additional
experimentation will be required to define the mechanisms of these
responses, the effector capacities of the infiltrating lymphocytes in
the IL-10 transgenic mice and the relationships between the different
effector properties of this cytokine.
Mucus is a viscoelastic gel that coats and lubricates the epithelium of
mucosal surfaces and protects against infectious and other
environmental insults. Low levels of mucus are produced in the normal
lung, and mucus metaplasia with mucus hypersecretion are characteristic
features of airways disorders such as asthma, chronic bronchitis, and
cystic fibrosis. A variety of inflammatory mediators, including the Th2
cytokines IL-4, IL-5, IL-13, and IL-9, are believed to contribute to
the pathogenesis of the mucus abnormalities in these disorders (37,
65-67). The role that IL-10 plays in these responses has not been
thoroughly evaluated. In addition, the literature that exists is
controversial, with investigators reporting that a deficiency of IL-10
does not alter or decreases mucus responses in animal models of airway
inflammation (31, 32). Our studies demonstrate, for the first time,
that chronic IL-10 production induces mucus metaplasia with goblet cell
hyperplasia, enhanced neutral and acidic mucus accumulation, enhanced
mucin and Gob-5 gene expression, and mucus hypersecretion. They are also the first to demonstrate that endogenous IL-10 in necessary for
the maximal induction of mucin gene expression in an
IL-13-dependent in vivo virus challenge system.
These findings suggest that IL-10 can contribute to the pathogenesis of
the mucus responses that are seen at sites of chronic inflammation.
They also suggest that Gob-5 may be a critical intermediary of this
response because Gob-5 expression induces mucus metaplasia in the
murine airway (46). This may be particularly important in inflammatory
bowel disease, lung cancer, Sjogren's syndrome, and asthma (see
below), where increased levels of mucus production and/or mucin gene
expression are known to co-exist with the exaggerated production of
IL-10 (33, 34, 55, 68).
Tissue fibrosis can represent a healing and repair response and/or a
manifestation of disease pathogenesis. From our perspective, these
pathways are not mutually exclusive and can be differentiated, in part,
by characterizing the effects of the mediators of fibrosis on local
tissue inflammation. Mediators involved in healing and repair (such as
TGF- and IL-11 (Ref. 38)) have been shown to stimulate fibrosis
while decreasing inflammation. In contrast, mediators that are not
involved in healing might not alter or could increase local
inflammatory responses. IL-10 has well documented anti-inflammatory
properties. Our studies demonstrate that IL-10, while inhibiting
LPS-induced inflammation, simultaneously generates tissue fibrosis. In
contrast to previous studies (51), they also demonstrate that the
fibrotic effects of IL-10 are seen in the absence of known exogenous
fibrogenic stimuli. These findings have allowed us to hypothesize that,
under appropriate circumstances, IL-10 production is a manifestation of
local healing and repair. Our demonstration that IL-10 stimulates
TGF- 1 would further support this contention. Our
findings also suggest that the overproduction of IL-10 can contribute
to the pathogenesis of human fibrotic disorders. This may be
particularly relevant to the airway remodeling in asthma, the fibrosis
in interstitial lung diseases such as silicosis, and the salivary gland
scarring seen in Sjogren's syndrome. These studies do not, however,
support the concept that IL-10 is anti-fibrotic, as has been proposed
by other investigators (69). In circumstances where anti-fibrotic
effects of IL-10 are seen, our data would suggest that the decrease in
fibrosis is a result of the ability of IL-10 to diminish tissue
inflammation and inflammation-induced injury and not direct effects of
IL-10 on matrix deposition or structural cell proliferation.
Asthma is characterized by Th2 cytokine excess, chronic inflammation,
and varying degrees of mucus metaplasia and subepithelial fibrosis. The
role of IL-10 in the asthmatic diathesis, however, is controversial.
Early studies suggested that IL-10 had important anti-inflammatory
effects in models of asthma (9, 25, 28) and that a deficiency in IL-10
production contributed to the chronic inflammation in the airways of
patients with this disorder (12, 29, 30). This led to the belief that
IL-10 administration would be an appropriate therapeutic intervention
in these patients (12, 29, 30). In contrast, other investigators
demonstrated that IL-10 can augment asthma-like pathologic responses in
acute animal modeling systems (9, 31, 32) and that IL-10 production is
increased in patients with asthma at base line and after segmental antigen challenge (33, 34). In addition, RSV infection is the most
common cause of lower respiratory infection in children and correlates
with the development of asthma in later life (70). In RSV-infected
children, the capacity of stimulated mononuclear cells to produce IL-10
has been shown to correlate with recurrent wheezing on follow-up (71).
These studies suggest that IL-10 can contribute to disease pathogenesis
in asthma. When viewed in combination with our findings, they also call
into question the appropriateness of IL-10 as a therapy for these
individuals because the IL-10 could worsen the inflammatory, mucus,
fibrotic, and physiologic alterations seen in these individuals. A
relative IL-10 deficiency has also been reported in cystic fibrosis,
and exogenous rIL-10 has been proposed as a treatment for patients with
this disorder (2, 11). Similar concerns about this therapeutic approach, however, need to be raised because mucus abnormalities, inflammation, and tissue fibrosis are all characteristic features of
cystic fibrosis tissue pathology.
IL-13 is a pleiotropic 12-kDa cytokine that is produced in large
quantities by appropriately stimulated CD4+ Th2 cells and lesser
quantities by Th1 cells. It has a variety of pro-inflammatory effects
that are relevant to asthma and other Th2-dominated inflammatory disorders, including the ability to induce IgE production and endothelial cell VCAM-1 expression. Studies from our laboratory and
others have also demonstrated that IL-13 is a potent inducer of
eosinophilic tissue inflammation, mucus metaplasia, subepithelial fibrosis, and Gob-5 gene expression (37, 47, 72). In keeping with the
similarities between these IL-13 effector functions and the phenotype
of our IL-10 transgenic mice, studies were undertaken to determine
whether IL-13 played a role in mediating the IL-10 phenotype. These
studies demonstrated, for the first time, that IL-10 stimulates IL-13
production in vivo. Our studies of the progeny of crosses of
transgenic mice and IL-13 null mice also demonstrated that the IL-13
that is produced plays a critical role in the induction of the mucus
metaplasia and the enhanced mucin and Gob-5 gene expression, but is not
critical for the inflammatory or fibrotic responses in these animals.
Our demonstration that the IL-10-induced mucus response was completely
abrogated whereas the inflammatory and fibrotic responses were not
altered in crosses of IL-10 transgenic mice and mice with null
mutations of IL-4R or STAT-6 provides additional support for the
importance of IL-13 in mediating the IL-10 phenotype and insights into
the signaling pathway that it uses in this setting. Interestingly,
IL-10 did not stimulate other Th2 cytokines and IL-10-induced mucus
metaplasia was not abolished in the absence of IL-4. When viewed in
combination, these genetic manipulations demonstrate that IL-10
production selectively induces IL-13 elaboration, which causes mucus
transformation of the airway via an IL-4R - and
STAT-6-dependent mechanism. Because IL-13 is a key mediator
in asthma pathogenesis and IL-13 antagonism is a therapeutic goal in
this disorder (73), the finding that IL-10 induces IL-13 in
vivo further supports the need to be cautious with approaches that
utilize IL-10 to control this and other chronic Th2-dominated
inflammatory disorders.
Our studies demonstrate that IL-10 induces tissue fibrosis in the
murine airway. We previously demonstrated that IL-13 is a potent
stimulator of tissue fibrosis and that this effect is mediated, at
least in part, via the ability of IL-13 to stimulate the production and
activate TGF- 1 (43). As a result, we hypothesized that
the fibrogenic effects of IL-10 might be mediated via an IL-13/STAT-6/IL-4R -dependent pathway. To our surprise,
this did not prove to be the case because IL-10-induced tissue fibrosis was not abrogated in the absence of IL-13, STAT-6, or IL-4R . To gain
insights into the mechanisms that might contribute to this fibrotic
response, studies were undertaken to determine whether IL-10 stimulated
the production of TGF- 1 in the murine lung. These
studies demonstrated that IL-10 stimulated the accumulation of
TGF- 1 mRNA and latent TGF- 1 protein
in transgene (+) animals. In keeping with our histologic findings and
genetic manipulations, this inductive response was mediated via an
IL-13/STAT-6-independent pathway. These observations allow for the
speculation that IL-10 induces tissue fibrosis, at least in part, via
the induction of TGF- 1. Additional investigations in
which IL-10-dependent fibrotic responses are treated with
TGF- 1 antagonists, however, will be required to
thoroughly evaluate this possibility.
In summary, these studies demonstrate that IL-10 causes a complex
phenotype when chronically overexpressed in the lung. While inhibiting
LPS-induced inflammation and TNF production, IL-10 simultaneously
caused a T and B cell-rich inflammatory response, subepithelial
fibrosis, and mucus metaplasia with goblet cell hyperplasia, mucin
hypersecretion, and enhanced mucin and Gob-5 gene expression. They also
demonstrate that IL-10 induces IL-13 production in vivo and
that this induction is responsible for the mucus, but not the
inflammatory and fibrotic effects of IL-10 in this setting. Endogenous
IL-10 was also shown to be necessary for maximal Muc-5ac gene
expression in a virus sensitization and challenge modeling system.
Thus, IL-10 may contribute to the pathogenesis of inflammatory,
fibrotic, and mucus responses at sites of pathology. The inflammatory,
fibrotic, mucus, and IL-13-stimulating effects of IL-10 must be taken
into account when balancing the risks and benefits of chronic IL-10
therapy for inflammatory disorders in the lung and other organs.
 |
ACKNOWLEDGEMENTS |
We thank Kathleen Bertier for excellent
secretarial and administrative assistance, and we thank the scientists
who provided the genetically modified mice.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grants HL-56389, HL-61904, HL-64242 (to J. A. E.), and
HL-6404 (to L. C.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF218819.
§§
To whom correspondence should be addressed: Dept. of Internal
Medicine, Section of Pulmonary and Critical Care Medicine, Yale University School of Medicine, 333 Cedar St., 105 LCI, P. O. Box 208057, New Haven, CT 06520-8057. Tel.: 203-785-4163; Fax:
203-785-3826; E-mail: jack.elias@yale.edu.
Published, JBC Papers in Press, July 9, 2002, DOI 10.1074/jbc.M206395200
2
C. G. Lee and J. A. Elias, unpublished observation.
 |
ABBREVIATIONS |
The abbreviations used are:
IL, interleukin;
STAT, signal transducers and activators of transcription;
RSV, respiratory syncytial virus;
IL-4R, interleukin-4 receptor;
IL-13R, interleukin-13 receptor;
VV, vaccinia virus;
RPA, ribonuclease
protection assay;
IFN, interferon;
BAL, bronchoalveolar lavage;
TGF, transforming growth factor;
ELISA, enzyme-linked immunosorbent assay;
TNF, tumor necrosis factor;
LPS, lipopolysaccharide;
HMI, histologic
mucus index;
TTBS, Tris-buffered saline with Tween 20;
PAS, periodic
acid-Schiff with diastase;
WT, wild-type;
rtTA, reverse tetracycline
transactivator;
hGH, human growth hormone;
PBS, phosphate-buffered
saline;
RT, reverse transcription;
FITC, fluorescein
isothiocyanate;
PE, phycoerythrin.
 |
REFERENCES |
| 1.
|
Moore, K. W.,
O'Garra, A.,
de Waal Malefyt, R.,
Vieira, P.,
and Mosmann, T. R.
(1993)
Annu. Rev. Immunol.
11,
165-190[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Bonfield, T. L.,
Konstan, M. W.,
Burfeind, P.,
Panuska, J. R.,
Hilliard, J. B.,
and Berger, M.
(1995)
Am. J. Respir. Cell Mol. Biol.
13,
257-261[Abstract]
|
| 3.
|
Bogdan, C.,
Vodovotz, Y.,
and Nathan, C.
(1991)
J. Exp. Med.
174,
1549-1555[Abstract/Free Full Text]
|
| 4.
|
Groux, H.,
O'Garra, A.,
Bigler, M.,
Rouleau, M.,
Antonenko, S.,
deVries, J. E.,
and Roncarolo, M.-G.
(1997)
Nature
389,
737-742[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Gerard, C.,
Bruyns, C.,
Merchant, A. D. A.,
Vandenabeele, P.,
Delvaux, A.,
Fiers, W.,
Goldman, M.,
and Velu, T.
(1993)
J. Exp. Med.
177,
547-550[Abstract/Free Full Text]
|
| 6.
|
Koulis, A.,
and Robinson, D. S.
(2000)
Clin. Exp. Allergy
30,
747-750[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Shanley, T. P.,
Schmal, H.,
Friedl, H. P.,
Jones, M. L.,
and Ward, P. A.
(1995)
J. Immunol.
154,
3454-3460[Abstract]
|
| 8.
|
Sawa, T.,
Corry, D. B.,
Gropper, M. A.,
Ohara, M.,
Kurahashi, K.,
and Wiener-Kronish, J. P.
(1997)
J. Immunol.
159,
2858-2866[Abstract]
|
| 9.
|
Van Scott, M. R.,
Justice, P.,
Bradfield, J. F.,
Enright, E.,
Sigounas, A.,
and Sur, S.
(2000)
Am. J. Physiol.
278,
L667-L674
|
| 10.
|
Rennick, D. M.,
Fort, M. M.,
and Davidson, N. J.
(1997)
J. Leukocyte Biol.
61,
389-396[Abstract]
|
| 11.
|
Chmiel, J. F.,
Konstan, M. W.,
Knesebeck, J. E.,
Hilliard, J. B.,
Bonfield, T. L.,
Dawson, D. V.,
and Berger, M.
(1999)
Am. J. Respir. Crit. Care Med.
160,
2040-2047[Abstract/Free Full Text]
|
| 12.
|
Chung, K. F.
(1998)
Eur. Respir. Rev.
8,
999-1006
|
| 13.
|
Stordeur, P.,
de Lavareille, A.,
and Goldman, M.
(2000)
Eur. Respir. Rev.
70,
142-145
|
| 14.
|
De Beaux, A. C.,
Maingay, J. P.,
Ross, J. A.,
Fearon, K. C.,
and Carter, D. C.
(1995)
J. Interferon Cytokine Res.
15,
441-445[Medline]
[Order article via Infotrieve]
|
| 15.
|
Groux, H.,
Bigler, M.,
de Vries, J. E.,
and Roncarolo, M. G.
(1998)
J. Immunol.
160,
3188-3193[Abstract/Free Full Text]
|
| 16.
|
Lin, T.-J.,
and Befus, A. D.
(1997)
J. Immunol.
159,
4015-4023[Abstract]
|
| 17.
|
Itoh, K.,
and Hirohata, S.
(1995)
J. Immunol.
154,
4341-4350[Abstract]
|
| 18.
|
Vora, M.,
Romero, L. I.,
and Karasek, M. A.
(1996)
J. Exp. Med.
184,
821-829[Abstract/Free Full Text]
|
| 19.
|
Qian, S. G., Li, W., Li, Y. P., Fu, F. M., Lu, L. N.,
Fung, J. J.,
and Thomson, A. W.
(1996)
Transplantation
62,
1709-1714[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Wogensen, L.,
Lee, M. S.,
and Sarvetnick, N.
(1994)
J. Exp. Med.
179,
1379-1384[Abstract/Free Full Text]
|
| 21.
|
Moritani, M.,
Yoshimoto, K.,
Tashiro, F.,
Hashimoto, C.,
Miyazaki, J., Li, S.,
Kudo, E.,
Iwahana, H.,
Hayashi, Y.,
Sano, T.,
and Itakura, M.
(1994)
Int. Immunol.
6,
1927-1936[Abstract/Free Full Text]
|
| 22.
|
Berman, R. M.,
Suzuki, T.,
Tahara, H.,
Robbins, P. D.,
Narula, S. K.,
and Lotze, M. T.
(1996)
J. Immunol.
157,
231-238[Abstract]
|
| 23.
|
Vanderpoll, T.,
Marchant, A.,
Keogh, C. B.,
Goldman, M.,
and Lowry, S. F.
(1996)
J. Infect. Dis.
1974,
994-1000
|
| 24.
|
Greenberger, M. J.,
Strieter, R. M.,
Kunkel, S. L.,
Danforth, J. M.,
Goodman, R. E.,
and Standiford, T. J.
(1995)
J. Immunol.
155,
722-729[Abstract]
|
| 25.
|
Stamfli, M. R.,
Cwiartka, M.,
Gajewska, B. U.,
Alvarez, D.,
Ritz, S. A.,
Inman, M. D.,
Xing, Z.,
and Jordana, M.
(1999)
Am. J. Respir. Cell Mol. Biol.
21,
586-596[Abstract/Free Full Text]
|
| 26.
|
Jeannin, P.,
Lecoanet, S.,
Delneste, Y.,
Gauchat, J. F.,
and Bonnefoy, J. Y.
(1998)
J. Immunol.
160,
3555-3561[Abstract/Free Full Text]
|
| 27.
|
Takanaski, S.,
Nonaka, R.,
Xing, Z.,
Obyrne, P.,
Dolovich, J.,
and Jordana, M.
(1994)
J. Exp. Med.
180,
711-715[Abstract/Free Full Text]
|
| 28.
|
Zuany-Amorim, C.,
Haile, S.,
Leduc, D.,
Dumarey, C.,
Huerre, M.,
Vargaftig, B. B.,
and Pretolani, M.
(1995)
J. Clin. Invest.
95,
2644-2651[Medline]
[Order article via Infotrieve]
|
| 29.
|
Borish, L.,
Aarons, A.,
Rumbyrt, J.,
Cvietusa, P.,
Negri, J.,
and Wenzel, S.
(1996)
J. Allergy Clin. Immunol.
97,
1288-1296[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Takanashi, S.,
Hasegawa, Y.,
Kanehira, Y.,
Yamamoto, K.,
Fujimoto, K.,
Satoh, K.,
and Okamura, K.
(1999)
Eur. Respir. J.
14,
309-314[Abstract]
|
| 31.
|
Makela, M. J.,
Kanehiro, A.,
Borish, L.,
Dakhama, A.,
Loader, J.,
Joetham, A.,
Xing, Z.,
Jordana, M.,
Larsen, G. L.,
and Gelfand, E. W.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
6007-6012[Abstract/Free Full Text]
|
| 32.
|
Yang, X.,
Wang, S.,
Fan, Y.,
and Han, X.
(2000)
Eur. J. Immunol.
30,
382-391[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Colavita, A. M.,
Hastie, A. T.,
Musani, A. I.,
Pascual, R. M.,
Reinach, A. J.,
Lustine, H. T.,
Galati, S. A.,
Zangrilli, J. G.,
Fish, J. E.,
and Peters, S. P.
(2000)
J. Allergy Clin. Immunol.
106,
880-886[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Robinson, D. S.,
Tsicopoulos, A.,
Meng, Q.,
Durham, S.,
Kay, A. B.,
and Hamid, Q.
(1996)
Am. J. Respir. Cell Mol. Biol.
14,
113-117[Abstract]
|
| 35.
|
Magnan, A.,
van Pee, D.,
Bongrand, P.,
and Vervloet, D.
(1998)
Allergy
53,
1092-1095[Medline]
[Order article via Infotrieve]
|
| 36.
|
Ray, P.,
Tang, W.,
Wang, P.,
Homer, R.,
Kuhn, C. I.,
Flavell, R. A.,
and Elias, J. A.
(1997)
J. Clin. Invest.
100,
2501-2511[Medline]
[Order article via Infotrieve]
|
| 37.
|
Zhu, Z.,
Homer, R. J.,
Wang, Z.,
Chen, Q.,
Geba, G. P.,
Wang, J.,
Zhang, Y.,
and Elias, J. A.
(1999)
J. Clin. Invest.
103,
779-788[Medline]
[Order article via Infotrieve]
|
| 38.
|
Wang, J. M.,
Homer, R. J.,
Hong, L.,
Cohn, L.,
Lee, C. G.,
and Elias, J. A.
(2000)
J. Immunol.
165,
2222-2231[Abstract/Free Full Text]
|
| 39.
|
Zheng, T.,
Zhu, Z.,
Wang, Z.,
Homer, R. J., Ma, B.,
Riese, R.,
Chapman, H.,
Shapiro, S. D.,
and Elias, J. A.
(2000)
J. Clin. Invest.
106,
1081-1093[Medline]
[Order article via Infotrieve]
|
| 40.
|
Parmley, R. R.,
and Gendler, S. J.
(1998)
J. Clin. Invest.
102,
1798-1806[Medline]
[Order article via Infotrieve]
|
| 41.
|
Wu, K.,
Fregien, N.,
and Carraway, K. L.
(1994)
J. Biol. Chem.
269,
11950-11955[Abstract/Free Full Text]
|
| 42.
|
Moniaux, N.,
Nollet, S.,
Porchet, N.,
Degand, P.,
Laine, A.,
and Aubert, J.
(1999)
Biochem. J.
338,
325-333
|
| 43.
|
Lee, C. G.,
Homer, R. J.,
Zhu, Z.,
Lanone, S.,
Wang, X.,
Koteliansky, V.,
Shipley, J. M.,
Gotwals, P.,
Noble, P.,
Chen, Q.,
Senior, R. M.,
and Elias, J. A.
(2001)
J. Exp. Med.
194,
809-821[Abstract/Free Full Text]
|
| 44.
|
Noben-Trauth, N.,
Shultz, L. D.,
Brombacher, F.,
Urban, J. F., Jr., Gu, H.,
and Paul, W. E.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
10838-10843[Abstract/Free Full Text]
|
| 45.
|
McKenzie, G. J.,
Bancroft, A.,
Grencis, R. K.,
and McKenzie, A. N.
(1998)
Curr. Biol.
8,
339-342[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Nakanishi, A.,
Morita, S.,
Iwashita, H.,
Sagiya, Y.,
Ashida, Y.,
Shirafuji, H.,
Fujisawa, Y.,
Nishimura, O.,
and Fujino, M.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
5175-5180[Abstract/Free Full Text]
|
| 47.
|
Zhou, Y.,
Dong, Q.,
Louahed, J.,
Dragwa, C.,
Savio, D.,
Huang, M.,
Weiss, C.,
Tomer, Y.,
McLane, M. P.,
Nicolaides, N. C.,
and Levitt, R. C.
(2001)
Am. J. Respir. Cell Mol. Biol.
25,
486-491[Abstract/Free Full Text]
|
| 48.
|
Cohn, L.,
Homer, R. J.,
MacLeod, H.,
Mohrs, M.,
Brombacher, F.,
and Bottomly, K.
(1999)
J. Immunol.
162,
6178-6183[Abstract/Free Full Text]
|
| 49.
|
Johnson, T. R.,
Johnson, J. E.,
Roberts, S. R.,
Wertz, G. W.,
Parker, R. A.,
and Graham, B. S.
(1998)
J. Virol.
72,
2871-2880[Abstract/Free Full Text]
|
| 50.
|
Johnson, T. R.,
and Graham, B. S.
(1999)
J. Virol.
73,
8485-8495[Abstract/Free Full Text]
|
| 51.
|
Huaux, F.,
Louahed, J.,
Hudspith, B.,
Meredth, C.,
Delos, M.,
Renauld, J.-C.,
and Lison, D.
(1998)
Am. J. Respir. Cell. Mol. Biol.
18,
51-59[Abstract/Free Full Text]
|
| 52.
|
Eppinger, M. J.,
Ward, P. A.,
Bolling, S. F.,
and Deeb, G. M.
(1996)
J. Thorac. Cardiovasc. Surg.
112,
1301-1305[Abstract/Free Full Text]
|
| 53.
|
Saito, I.,
Haruta, K.,
Shimuta, M.,
Inoue, H.,
Sakurai, H.,
Yamada, K.,
Ishimaru, N.,
Higashiyama, H.,
Sumida, T.,
Ishida, H.,
Suda, T.,
Noda, T.,
Hayashi, Y.,
and Tsubota, K.
(1999)
J. Immunol.
162,
2488-2494[Abstract/Free Full Text]
|
| 54.
|
Lee, M. S.,
Mueller, R.,
Wicker, L. S.,
Peterson, L. B.,
and Sarvetnick, N.
(1996)
J. Exp. Med.
183,
2663-2668[Abstract/Free Full Text]
|
| 55.
|
Halse, A.,
Tengner, P.,
Wahren-Herlenius, M.,
Haga, H.,
and Jonsson, R.
(1999)
Scand. J. Immunol.
49,
533-538[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Russo, M.,
Nahori, M. A.,
Lefort, J.,
Gomes, E.,
de Castro Keller, A.,
Rodriguez, D.,
Ribeiro, O. G.,
Adriouch, S.,
Gallois, V.,
de Faria, A. M.,
and Vargaftig, B. B.
(2001)
Am. J. Respir. Cell Mol. Biol.
24,
518-526[Abstract/Free Full Text]
|
| 57.
|
Steinhauser, M. L.,
Hogaboam, C. M.,
Kunkel, S. L.,
Lukacs, N. W.,
Strieter, R. M.,
and Standiford, T. J.
(1999)
J. Immunol.
162,
392-399[Abstract/Free Full Text]
|
| 58.
|
Corne, J. M.,
Lau, L.,
Scott, S. J.,
Davies, R.,
Johnston, S. L.,
and Howarth, P. H.
(2001)
Am. J. Respir. Crit. Care. Med.
163,
1101-1107[Abstract/Free Full Text]
|
| 59.
|
Dosanjh, A. K.,
Elashoff, D.,
and Robbins, R. C.
(1998)
J. Interferon Cytokine Res.
18,
851-854[Medline]
[Order article via Infotrieve]
|
| 60.
|
Brandtzaeg, P.,
Osnes, L.,
Ovstebo, R.,
Joo, G. B.,
Westvik, A. B.,
and Kierulf, P.
(1996)
J. Exp. Med.
184,
51-60[Abstract/Free Full Text]
|
| 61.
|
Fedorak, R. N.,
Gangl, A.,
Elson, C. O.,
Rutgeerts, P.,
Schreiber, S.,
Wild, G.,
Hanauer, S. B.,
Kilian, A.,
Cohard, M.,
LeBeaut, A.,
and Feagan, B.
(2000)
Gastroenterology
119,
1473-1482[CrossRef][Medline]
[Order article via Infotrieve]
|
| 62.
|
Wogensen, L.,
Huang, X.,
and Sarvetnick, N.
(1993)
J. Exp. Med.
178,
175-185[Abstract/Free Full Text]
|
| 63.
|
Cohen, S. B. A.,
Crawley, J. B.,
Kahan, M. C.,
Feldmann, M.,
and Foxwell, B. M. J.
(1997)
Immunology
92,
1-5[CrossRef][Medline]
[Order article via Infotrieve]
|
| 64.
|
Sozzani, S.,
Ghezzi, S.,
Iannolo, G.,
Luini, W.,
Borsatti, A.,
Polentarutti, N.,
Sica, A.,
Locati, M.,
Mackay, C.,
Wells, T. N. C.,
Biswas, P.,
Vicenzi, E.,
Poli, G.,
and Mantovani, A.
(1998)
J. Exp. Med.
187,
439-444[Abstract/Free Full Text]
|
| 65.
|
Rankin, J. A.,
Picarella, D. E.,
Geba, G. P.,
Temann, U.-A.,
Prasad, B.,
DiCosmo, B.,
Tarallo, A.,
Stripp, B.,
Whitsett, J.,
and Flavell, R. A.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
7821-7825[Abstract/Free Full Text]
|
| 66.
|
Longphre, M., Li, D.,
Gallup, M.,
Drori, E.,
Ordonez, C. L.,
Redman, T.,
Wenzel, S.,
Bice, D. E.,
Fahy, J. V.,
and Basbaum, C.
(1999)
J. Clin. Invest.
104,
1375-1382[Medline]
[Order article via Infotrieve]
|
| 67.
|
Lee, J. J.,
McGarry, M. P.,
Farmer, S. C.,
Denzler, K. L.,
Larson, K. A.,
Carrigan, P. E.,
Brenneise, I. E.,
Horton, M. A.,
Haczku, A.,
Gelfand, E. W.,
Leikauf, G. D.,
and Lee, N. A.
(1997)
J. Exp. Med.
185,
2143-2156[Abstract/Free Full Text]
|
| 68.
|
Yu, C. J.,
Shew, J. Y.,
Shun, C. T.,
Lin, H. T.,
Kuo, S. H.,
Luh, K. T.,
and Yang, P. C.
(1998)
Am. J. Respir. Cell Mol. Biol.
18,
643-652[Abstract/Free Full Text]
|
| 69.
|
Arai, T.,
Abe, K.,
Matsuoka, H.,
Yoshida, M.,
Mori, M.,
Goya, S.,
Kida, H.,
Nishino, K.,
Osaki, T.,
Tachibana, I.,
Kaneda, Y.,
and Hayash, S.
(2000)
Am. J. Physiol.
278,
L914-L922
|
| 70.
|
Stein, R. T.,
Sherrill, D.,
Morgan, W. J.,
Holberg, C. J.,
Halonen, M.,
Taussig, L. M.,
Wright, A. L.,
and Martinez, F. D.
(1999)
Lancet
354,
541-545[CrossRef][Medline]
[Order article via Infotrieve]
|
| 71.
|
Bont, L.,
Heijnen, C. J.,
Kavelaars, A.,
van Aalderen, W. M. C.,
Brus, F.,
Draaisma, T. M.,
Geelen, S. E.,
and Kimpen, J. L. L.
(2000)
Am. J. Resp. Crit. Care Med.
161,
1518-1523[Abstract/Free Full Text]
|
| 72.
|
Wills-Karp, M.,
Luyimbazi, J., Xu, X.,
Schofield, B.,
Neben, T. Y.,
Karp, C. L.,
and Donaldson, D. D.
(1998)
Science
282,
2258-2260[Abstract/Free Full Text]
|
| 73.
|
Donaldson, D. D.,
Elias, J. A.,
and Wills-Karp, M.
(2001)
in
Progress in Respiratory Research: New Drugs in Asthma, Allergy and COPD
(Hansel, T.
, and Barnes, P., eds)
, pp. 260-263, Karger Press, Basel, Switzerland
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Z. Wang, C. Chen, S. N. Finger, S. d/o Kwajah M.M, M. Jung, H. Schwarz, N. Swanson, R. R. Lareu, and M. Raghunath
Suberoylanilide hydroxamic acid: a potential epigenetic therapeutic agent for lung fibrosis?
Eur. Respir. J.,
July 1, 2009;
34(1):
145 - 155.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. G. Lee, D. Hartl, G. R. Lee, B. Koller, H. Matsuura, C. A. Da Silva, M. H. Sohn, L. Cohn, R. J. Homer, A. A. Kozhich, et al.
Role of breast regression protein 39 (BRP-39)/chitinase 3-like-1 in Th2 and IL-13-induced tissue responses and apoptosis
J. Exp. Med.,
May 11, 2009;
206(5):
1149 - 1166.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. G. Lee, D. Hartl, H. Matsuura, F. M. Dunlop, P. D. Scotney, L. J. Fabri, A. D. Nash, N.-Y. Chen, C.-Y. Tang, Q. Chen, et al.
Endogenous IL-11 Signaling Is Essential in Th2- and IL-13-Induced Inflammation and Mucus Production
Am. J. Respir. Cell Mol. Biol.,
December 1, 2008;
39(6):
739 - 746.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Natividad, M. J. Holland, K. A. Rockett, J. Forton, N. Faal, H. M. Joof, D. C.W. Mabey, R. L. Bailey, and D. P. Kwiatkowski
Susceptibility to sequelae of human ocular chlamydial infection associated with allelic variation in IL10 cis-regulation
Hum. Mol. Genet.,
January 15, 2008;
17(2):
323 - 329.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Yoshida and R. M. Tuder
Pathobiology of Cigarette Smoke-Induced Chronic Obstructive Pulmonary Disease
Physiol Rev,
July 1, 2007;
87(3):
1047 - 1082.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Long, J. P. Sypek, R. Askew, S. C. Fish, L. E. Mason, C. M. M. Williams, and S. J. Goldman
Gob-5 Contributes to Goblet Cell Hyperplasia and Modulates Pulmonary Tissue Inflammation
Am. J. Respir. Cell Mol. Biol.,
September 1, 2006;
35(3):
357 - 365.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Homer, Z. Zhu, L. Cohn, C. G. Lee, W. I. White, S. Chen, and J. A. Elias
Differential expression of chitinases identify subsets of murine airway epithelial cells in allergic inflammation
Am J Physiol Lung Cell Mol Physiol,
September 1, 2006;
291(3):
L502 - L511.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. R. Henderson Jr., G. K. S. Chiang, Y.-t. Tien, and E. Y. Chi
Reversal of Allergen-induced Airway Remodeling by CysLT1 Receptor Blockade
Am. J. Respir. Crit. Care Med.,
April 1, 2006;
173(7):
718 - 728.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ask, G. E. M. Martin, M. Kolb, and J. Gauldie
Targeting genes for treatment in idiopathic pulmonary fibrosis: challenges and opportunities, promises and pitfalls.
Proceedings of the ATS,
January 1, 2006;
3(4):
389 - 393.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Sabo-Attwood, M. Ramos-Nino, J. Bond, K. J. Butnor, N. Heintz, A. D. Gruber, C. Steele, D. J. Taatjes, P. Vacek, and B. T. Mossman
Gene Expression Profiles Reveal Increased mClca3 (Gob5) Expression and Mucin Production in a Murine Model of Asbestos-Induced Fibrogenesis
Am. J. Pathol.,
November 1, 2005;
167(5):
1243 - 1256.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. A. Kuperman, X. Huang, L. Nguyenvu, C. Holscher, F. Brombacher, and D. J. Erle
IL-4 Receptor Signaling in Clara Cells Is Required for Allergen-Induced Mucus Production
J. Immunol.,
September 15, 2005;
175(6):
3746 - 3752.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Robichaud, S. A. Tuck, S. Kargman, J. Tam, E. Wong, M. Abramovitz, J. Mortimer, H. E. Burston, P. Masson, J. Hirota, et al.
Gob-5 Is Not Essential for Mucus Overproduction in Preclinical Murine Models of Allergic Asthma
Am. J. Respir. Cell Mol. Biol.,
September 1, 2005;
33(3):
303 - 314.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Peebles Jr. and B. S. Graham
Pathogenesis of Respiratory Syncytial Virus Infection in the Murine Model
Proceedings of the ATS,
August 1, 2005;
2(2):
110 - 115.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Barbarin, Z. Xing, M. Delos, D. Lison, and F. Huaux
Pulmonary overexpression of IL-10 augments lung fibrosis and Th2 responses induced by silica particles
Am J Physiol Lung Cell Mol Physiol,
May 1, 2005;
288(5):
L841 - L848.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. P. Ennis, J. P. Cassidy, and B. P. Mahon
Acellular Pertussis Vaccine Protects against Exacerbation of Allergic Asthma Due to Bordetella pertussis in a Murine Model
Clin. Vaccine Immunol.,
March 1, 2005;
12(3):
409 - 417.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. J. Homer and J. A. Elias
Airway Remodeling in Asthma: Therapeutic Implications of Mechanisms
Physiology,
February 1, 2005;
20(1):
28 - 35.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Spight, B. Zhao, M. Haas, S. Wert, A. Denenberg, and T. P. Shanley
Immunoregulatory effects of regulated, lung-targeted expression of IL-10 in vivo
Am J Physiol Lung Cell Mol Physiol,
February 1, 2005;
288(2):
L251 - L265.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kaviratne, M. Hesse, M. Leusink, A. W. Cheever, S. J. Davies, J. H. McKerrow, L. M. Wakefield, J. J. Letterio, and T. A. Wynn
IL-13 Activates a Mechanism of Tissue Fibrosis That Is Completely TGF-{beta} Independent
J. Immunol.,
September 15, 2004;
173(6):
4020 - 4029.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Hashimoto, B. S. Graham, S. B. Ho, K. B. Adler, R. D. Collins, S. J. Olson, W. Zhou, T. Suzutani, P. W. Jones, K. Goleniewska, et al.
Respiratory Syncytial Virus in Allergic Lung Inflammation Increases Muc5ac and Gob-5
Am. J. Respir. Crit. Care Med.,
August 1, 2004;
170(3):
306 - 312.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Barbarin, M. Arras, P. Misson, M. Delos, B. McGarry, S. H. Phan, D. Lison, and F. Huaux
Characterization of the Effect of Interleukin-10 on Silica-Induced Lung Fibrosis in Mice
Am. J. Respir. Cell Mol. Biol.,
July 1, 2004;
31(1):
78 - 85.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Li, H.-C. Hsu, C. R. Stockard, P. Yang, J. Zhou, Q. Wu, W. E. Grizzle, and J. D. Mountz
IL-12 Inhibits Thymic Involution by Enhancing IL-7- and IL-2-Induced Thymocyte Proliferation
J. Immunol.,
March 1, 2004;
172(5):
2909 - 2916.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Santiago, M. Galindo, G. Palao, and J. L. Pablos
Intracellular Regulation of Fas-Induced Apoptosis in Human Fibroblasts by Extracellular Factors and Cycloheximide
J. Immunol.,
January 1, 2004;
172(1):
560 - 566.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z.-H. Cui, A. Joetham, M. K. Aydintug, Y.-S. Hahn, W. K. Born, and E. W. Gelfand
Reversal of Allergic Airway Hyperreactivity after Long-term Allergen Challenge Depends on {gamma}{delta} T Cells
Am. J. Respir. Crit. Care Med.,
December 1, 2003;
168(11):
1324 - 1332.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Huaux, T. Liu, B. McGarry, M. Ullenbruch, Z. Xing, and S. H. Phan
Eosinophils and T Lymphocytes Possess Distinct Roles in Bleomycin-Induced Lung Injury and Fibrosis
J. Immunol.,
November 15, 2003;
171(10):
5470 - 5481.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. K. Farraj, J. R. Harkema, T.-R. Jan, and N. E. Kaminski
Immune Responses in the Lung and Local Lymph Node of A/J Mice to Intranasal Sensitization and Challenge with Adjuvant-Free Ovalbumin
Toxicol Pathol,
June 1, 2003;
31(4):
432 - 447.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Perez-Vilar, J. K. Sheehan, and S. H. Randell
Making More MUCS
Am. J. Respir. Cell Mol. Biol.,
March 1, 2003;
28(3):
267 - 270.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Huaux, T. Liu, B. McGarry, M. Ullenbruch, and S. H. Phan
Dual Roles of IL-4 in Lung Injury and Fibrosis
J. Immunol.,
February 15, 2003;
170(4):
2083 - 2092.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Olman
Epithelial Cell Modulation of Airway Fibrosis in Asthma
Am. J. Respir. Cell Mol. Biol.,
February 1, 2003;
28(2):
125 - 128.
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|