| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 39, 35833-35839, September 27, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Cell Biology, Johns Hopkins University
School of Medicine, Baltimore, Maryland 21205
Received for publication, June 24, 2002, and in revised form, July 16, 2002
Golgin-160 is a member of the golgin family of
Golgi-localized membrane proteins. The COOH-terminal two-thirds of
golgin-160 is predicted to form a coiled-coil, with an
NH2-terminal "head" domain. To identify the Golgi
targeting information in golgin-160, full-length and deletion
constructs tagged with green fluorescent protein were generated. The
head domain alone was targeted to the Golgi complex in the absence of
assembly with endogenous golgin-160. Further truncations from both ends
of the head domain narrowed the Golgi targeting information to 85 amino
acids between residues 172 and 257. Surprisingly, certain truncations
of the head domain also specifically accumulated in the nucleus. Both a
nuclear localization signal (masked in the full-length protein) and
information for nuclear retention contributed to the nuclear
localization of these truncations. Because the golgin-160 head is
cleaved by caspases during apoptosis, we examined the localization of
epitope-tagged proteins corresponding to all potential caspase cleavage
fragments. Our data suggest that three of six fragments could be
targeted to the nucleus, provided that they are released from Golgi
membranes after cleavage. The finding that both Golgi and nuclear
targeting information is present in the same region of golgin-160
suggests that this protein may have more than one function.
The Golgi complex of higher eukaryotic cells is composed of stacks
of cisternal membranes that function in processing and sorting of
lipids and proteins en route from the endoplasmic reticulum to the
plasma membrane and other destinations (1, 2). The enzymes responsible
for the modification of many cellular and secretory proteins reside
within the Golgi complex. These enzymes, including
glycosyltransferases, glycosidases, and sugar transporters, have unique
but overlapping distributions (3). The elaborate structure of the Golgi
complex is thought to be important for localization and efficient
function of these enzymes. The conservation of Golgi structure
throughout the eukaryotic kingdom implies an essential role in Golgi
function (4). Understanding the formation and maintenance of Golgi
structure as it relates to function is an active area of research.
Identification of Golgi-localized spectrin and ankyrin isoforms (5, 6),
and a "detergent-insoluble Golgi matrix," (7) suggests that the
structure of the Golgi complex may be organized by an "exoskeleton"
(8). This exoskeleton is proposed to be an extensive meshwork of
cytoskeletal and Golgi matrix proteins that sequester and align
enzyme-containing membranes, limit diffusion, and provide shape to
Golgi cisternae. A family of Golgi proteins, known as golgins, has been
implicated as components of this Golgi exoskeleton. Whereas this family
was first identified by antibodies from patients with
autoimmune diseases, the most characteristic feature of golgins is a
large coiled-coil domain similar to that of the myosin family. The
golgin family of proteins includes the peripheral membrane proteins
GM130 (7), golgin-97 (9), golgin-160 (10, 11), golgin-230/245 (12, 13),
and GMAP-210 (14), as well as the integral membrane proteins golgin-67
(15), golgin-84 (16), and giantin (17).
The best studied of the golgin proteins are GM130 and giantin.
Initially identified as a component of the detergent-insoluble Golgi
matrix, GM130 was later found to bind to GRASP65, a cis-Golgi membrane
protein required for stacking of Golgi cisternae in vitro (18). During mitosis, phosphorylation of GM130 is crucial for proper
disassembly of the Golgi (19). GM130 also binds to the vesicle docking
protein, p115, and to Rab1, a GTPase required for endoplasmic
reticulum-to-Golgi transport (20, 21). In addition, giantin
binds p115 suggesting the presence of a complex that tethers Golgi
cisternae containing GM130 to giantin on vesicles via p115 (22).
Disruption of GM130-giantin tethering complexes inhibits transport
through the Golgi, and causes the accumulation of transport vesicles
(23, 24). Taken together, these observations suggest that golgins
couple Golgi structure to Golgi function.
Recently, golgin-160 was shown to be a caspase substrate during
programmed cell death (25). Golgin-160 is predicted to form a
characteristic coiled-coil structure in the COOH-terminal two-thirds of
the protein, with an NH2-terminal non-coiled-coil (head)
domain. Although the normal function of golgin-160 is unknown, the
cleavage of the head domain during apoptosis is required for efficient apoptotic disassembly of the Golgi (25), suggesting that cleavage of
golgin-160 may disrupt protein-protein interactions important for Golgi function.
We have characterized the Golgi targeting of golgin-160 as a first step
toward understanding its function. We report that Golgi targeting
information resides in an 85-amino acid sequence present in the
NH2-terminal head of golgin-160. Surprisingly, we also
identified cryptic nuclear targeting information in the same region of
the head domain. Our data suggest that specific caspase cleavage
fragments of golgin-160 could be translocated from the Golgi complex to
the nucleus.
Cells and Transfection--
HeLa cells were maintained in
Dulbecco's modified Eagle's medium (Invitrogen, Carlsbad, CA)
containing 10% fetal calf serum and 0.1 mg/ml normocin-O (InvivoGen)
at 37 °C in 5% CO2. Thirty-five-mm dishes of HeLa cells
(70-80% confluent) were transfected with 8 µl of Lipofectin
(Invitrogen) and 2 µg of pEGFP-C1 (CLONTECH) or
pcDNA3.1/Myc-His(+), (Invitrogen) encoding the appropriate cDNA. Steady state expression was analyzed 16 h after
transfection. For the experiments described in the legend to Fig. 6,
HeLa cells were first infected with recombinant vaccinia virus encoding
phage T7 RNA polymerase (vTF7-3) (26). vTF7-3 was absorbed at a
multiplicity of infection of 5 in 0.5 ml of serum-free Dulbecco's
modified Eagle's medium for 1 h at 37 °C. Cells were then
transfected as described above, and expression was analyzed 2 and
4 h post-transfection.
Antibodies--
The anti-NH2-terminal golgin-160
antibody has been previously described (25). A synthetic peptide
corresponding to the 14 carboxyl-terminal amino acids of golgin-160
(with an added cysteine residue at the NH2 terminus) was
synthesized, purified, and coupled to keyhole limpet hemocyanin by
Boston Biomolecules, Inc. (Boston, MA). A polyclonal antibody
recognizing this segment of golgin-160 was made in rabbits by
immunizing with the conjugated peptide. Specificity of the antisera for
golgin-160 was confirmed by immunofluorescence and immunoprecipitation
of endogenous and overexpressed golgin-160. Monoclonal mouse antibodies
to GM130 were from Transduction Laboratories (Lexington, KY).
Polyclonal rabbit antibodies to
GFP1 were from Molecular
Probes (Eugene, OR). Monoclonal anti-Myc antibody (clone 9E10) was from
Roche Molecular Biochemicals (Indianapolis, IN). Texas Red-conjugated
goat anti-rabbit and anti-mouse IgG, and fluorescein-conjugated goat
anti-rabbit and anti-mouse IgG were from Jackson ImmunoResearch
Laboratories, Inc. (West Grove, PA).
Expression Constructs--
The cDNA clone corresponding to
the open reading frame of golgin-160 generated from human liver has
been previously described (accession number AF485338) (25). The
golgin-160 mutant proteins that required introduction of a restriction
site, termination codon, or base pair changes were generated using a
PCR-based QuikChange site-directed mutagenesis kit (Stratagene, La
Jolla, CA), and mutations were confirmed by dideoxy sequencing. Mutant
golgin-160 proteins were named with both the tag type and the amino
acids represented. The head mutant, GFP/g160-(1-393), was
generated by introducing a termination codon in place of the codon for
amino acid 394. The coiled-coil mutant, GFP/g160-(393-1498), was
prepared by introduction of a XhoI site at amino acid 392 in
the wild-type plasmid followed by ligation into the pEGFP-C1 vector. To
eliminate the potential nuclear localization signal (NLS), the sequence PREKKTSK beginning at amino acid 232 was changed to PRERRTSR by PCR
mutagenesis. For rapid expression using a vaccinia virus-T7 polymerase
system, the T7 promoter was inserted into the GFP vector. Sense and
antisense oligonucleotides corresponding to the phage T7 RNA promoter
sequence (TAATACGACTCACTATAGGGAGACC), were generated with a 5'
AgeI overhang and a 3' NheI overhang. After
hybridization, the T7 promoter sequence was ligated into pEGFP-C1 at
the AgeI and NheI sites just upstream of the GFP
sequence in GFP/g160-(140-257). Full-length golgin-160 tagged with the
c-Myc epitope was generated by introduction of a XhoI site
and start codon preceding the initial methionine, followed by ligation
into the pcDNA3.1-myc/his vector at the XhoI and
XbaI sites. Additional constructs were generated in a
similar fashion.
Indirect Immunofluorescence Microscopy--
For localization
studies of endogenous and tagged constructs of golgin-160, HeLa cells
were plated on coverslips in 35-mm dishes 1 day before staining or
transfection. Cells were transiently transfected using Lipofectin
transfection reagent according to the manufacturer's instructions as
described above. Cells grown on coverslips were fixed in 3%
paraformaldehyde for 10 min. Free aldehyde groups were quenched in 10 mM glycine in phosphate-buffered saline
(Gly/phosphate-buffered saline). Cells were permeabilized with 0.5%
Triton X-100 in Gly/phosphate-buffered saline for 3 min. Coverslips
were incubated in primary antibody diluted in Gly/phosphate-buffered
saline plus 1% bovine serum albumin for 20 min. Coverslips were washed
3 times with Gly/phosphate-buffered saline, incubated with fluorescein-
or Texas Red-labeled secondary antibodies, and washed as above.
Coverslips were then mounted in glycerol containing 0.1 M
N-propyl gallate. Images were collected on an Axioskop
microscope (Zeiss, Thornwood, NY) equipped with epifluorescence and a
Sensys CCD camera (Photometrics, Tucson, AZ) using IP Lab software
(Signal Analytics, Vienna, VA).
Metabolic Labeling and Immunoprecipitation--
Untransfected
cells were radiolabeled for 2 h, and cells transfected with tagged
constructs of golgin-160 were radiolabeled for 30 min with 150 µCi/ml
35S-Promix (Amersham Biosciences) in serum-,
methionine-, and cysteine-free medium at 37 °C. Cells were lysed at
0 °C for 30 min in detergent solution (62.5 mM EDTA, 50 mM Tris, pH 8, 0.4% deoxycholate, 1.0% Nonidet P-40) with
20 µg/ml aprotinin, 20 µg/ml leupeptin, and 2 µg/ml pepstatin A,
and lysates were cleared of debris by centrifugation at 14,000 × g for 20 min. SDS was added to 0.2%, and lysates were immunoprecipitated with 2 µl of the appropriate polyclonal antiserum to golgin-160, 0.5 µl of anti-GFP, or 2 µg of anti-Myc. Immune complexes were collected with 25 µl of fixed Staphylcoccus
aureus (Calbiochem-Novabiochem, La Jolla, CA) and washed. The
immunoprecipitates were analyzed by PAGE in the presence of SDS and
visualized by fluorography.
For the assembly experiment shown in Fig. 4B, HeLa cells
were transfected with the appropriate plasmid DNA, labeled for 30 min,
chased for 2 h, and lysates were immunoprecipitated with anti-golgin-160 antibody as above. Immunoprecipitated proteins were
then eluted with 2% SDS in detergent solution by boiling for 3 min.
The eluate was diluted 10-fold with detergent solution, and a second
round of immunoprecipitation was performed with anti-GFP antibody and
subjected to SDS-PAGE and fluorography.
Characterization of a cDNA Encoding Golgin-160 with a Novel
COOH Terminus--
Golgin-160 is a peripheral Golgi membrane protein
that was originally identified with human autoantibodies (10).
Initially, a full-length cDNA clone of golgin-160 encoding a
1530-amino acid protein called GCP170 was published (11). More
recently, we independently isolated a cDNA clone of golgin-160 from
human liver that was nearly identical to the published sequence (25).
However, our cDNA clone contains an additional 5 base pairs after
nucleotide 4129 (amino acid 1,377), producing a frameshift that
generates a novel COOH terminus that is 32 amino acids shorter than
GCP170 (Fig. 1A). A data base
search of human expressed sequence tags suggests that the version of
golgin-160 represented by our cDNA clone is widely expressed. At
least four expressed sequence tags of significant E value
containing the additional 5 base pairs exist, whereas no expressed
sequence tags representing cDNAs lacking these 5 base pairs were
found. Furthermore, the mouse homolog of golgin-160, Mea-2, contains
these 5 base pairs (27). Searching the nucleotide and protein data
bases showed that golgin-160 has no overall homology to any known
protein with the exception of the mouse Mea-2 protein. Secondary
structure analysis predicts that the protein encoded by our cDNA
consists of an NH2-terminal non-coiled-coil domain of 393 amino acids followed by a long
To confirm that the version of golgin-160 represented by our cDNA
is expressed, polyclonal anti-peptide antisera were raised against the
predicted NH2- and COOH-terminal sequences. HeLa cells were
labeled with [35S]methionine and -cysteine, and subjected
to immunoprecipitation with the NH2- and COOH-terminal
antibodies. Both antibodies specifically immunoprecipitated an
~170-kDa protein, indicating that a golgin-160 protein with the COOH
terminus predicted by our cDNA is expressed endogenously in HeLa
cells (Fig. 1C). The observed doublet of golgin-160 is
because of phosphorylation (Ref. 11 and data not shown).
The substantial predicted coiled-coil region of golgin-160 suggested it
might form a homodimer. To test this hypothesis, we transfected HeLa
cells with plasmids encoding GFP-tagged golgin-160 and
Myc-tagged golgin-160 separately or together (Fig. 1D). In cells transfected with both plasmids, the presence of Myc-tagged golgin-160 in the anti-GFP immunoprecipitation and vice versa (lanes 7 and 8) indicated that golgin-160 can
indeed dimerize.
Localization of Golgin-160 Is Distinct from That of GM130 in
Brefeldin A-treated Cells--
Brefeldin A (BFA), a fungal metabolite,
induces redistribution of Golgi membrane proteins. In BFA-treated
cells, Golgi enzymes are redistributed back to the ER, most coat
proteins to the cytoplasm, and a growing number of Golgi matrix
proteins (such as golgins) to Golgi "remnants" and/or ER exit sites
(7, 28-30). We used BFA to address the possibility that golgin-160
co-localized with components of the Golgi matrix. In BFA-treated cells,
GM130 was completely redistributed to distinct puncta spread throughout the cell (Fig. 2). In contrast,
golgin-160 appeared mostly cytoplasmic, with a bright spot at or near
the centrosome. The centrosomal staining pattern is reminiscent of the
trans-Golgi network protein, TGN38, in BFA-treated cells (31). Thus,
golgin-160 is clearly not associated with Golgi matrix components as
detected by this assay.
The NH2-terminal Domain of Golgin-160 Contains Golgi
Targeting Information--
The bulk of golgin-160 is predicted to form
an
Because golgin-160 forms a homodimer when exogenously expressed (Fig.
1D), we tested the ability of both the
NH2-terminal head domain and the COOH-terminal coiled-coil
domain to assemble with endogenous full-length golgin-160. Assembly
with endogenous golgin-160 would limit any conclusion about the ability
of the truncation mutants to specify Golgi targeting on their own. HeLa cells were transfected with GFP vector, GFP-tagged full-length golgin-160, or one of the GFP-tagged deletion mutants. Transfected cells were labeled with [35S]methionine and -cysteine for
30 min, chased for 2 h, and lysed. Expression of each protein was
confirmed by immunoprecipitation with anti-GFP antibody (Fig.
4A). Immunoprecipitates of the
endogenous protein were analyzed for the presence of the GFP-tagged
truncation mutant by sequential immunoprecipitation. To accomplish
this, endogenous golgin-160 was immunoprecipitated in the first round with anti-golgin-160 antibodies whose epitope was not present in the
GFP-tagged truncation mutant expressed in the sample (see Fig.
4A). The immunoprecipitates were eluted with SDS, diluted, and re-immunoprecipitated with anti-GFP to assess whether the expressed
truncations were present in the original immunoprecipitate via
interaction with endogenous golgin-160 (Fig. 4B). The
COOH-terminal coiled-coil domain assembled with endogenous golgin-160
(lane 4), while neither GFP alone (lane 1) nor
the NH2-terminal head domain (lane 3) was able
to form complexes with endogenous golgin-160. Endogenous golgin-160 was
observed in these immunoprecipitates only after a long exposure,
because the short label used here results in inefficient labeling
because of the long half-life of golgin-160. The Golgi targeting of the
coiled-coil domain observed in Fig. 3B could thus be because
of assembly with endogenous golgin-160. However, the
NH2-terminal domain of golgin-160 clearly contains Golgi
targeting information, demonstrated by its ability to localize GFP to
the Golgi in the absence of assembly with endogenous golgin-160. Although we could not rule out the possibility that the coiled-coil domain of golgin-160 contains a Golgi targeting signal, we focused on
dissecting the targeting signal in the head domain.
Identification of an 85-Amino Acid Sequence within the
NH2-terminal Head Domain Containing Both Golgi and Nuclear
Targeting Information--
To identify the minimal sequence within the
NH2 terminus of golgin-160 responsible for localization of
golgin-160 to the Golgi complex, progressively smaller truncations from
both ends of the 393-amino acid head domain were engineered as GFP
fusion proteins (Fig. 5A).
Expression of these GFP-tagged mutants in transfected HeLa cells
resulted in production of appropriately sized proteins, detected by
[35S]methionine and -cysteine labeling followed by
immunoprecipitation with anti-GFP antibody (Fig. 5B). The
intracellular localization of these truncation proteins was examined by
indirect immunofluorescence microscopy (Fig. 5C). Mutant
proteins containing either the first 139 amino acids or the last 136 amino acids of the NH2-terminal head domain
(GFP/g160-(1-139) and -(257-393)) were distributed diffusely
throughout the cell, indicating that these regions lack any specific
Golgi targeting information. In contrast, GFP/g160-(140-257) demonstrated specific Golgi targeting. Interestingly, this protein also
showed prominent nuclear localization. All three of the truncation proteins were small enough to diffuse into the nucleus, but only GFP/g160-(140-257) accumulated there, suggesting that this
localization is specific.
A closer look at the sequence of the head domain of golgin-160 revealed
a putative NLS, PREKKTSK, located between amino acids 232 and 239. To
test the contribution of the potential NLS to the steady state
localization of golgin-160 truncation proteins, we mutated the three
lysine residues within this sequence to arginines. The lysine residues
in other monopartite NLS-containing proteins have been shown to be
essential for nuclear import (32). Mutation of the NLS in
GFP/g160-(140-257) resulted in an increase in cytoplasmic staining and
a reduction in nuclear, but not Golgi targeting (
To more directly assess the contribution of the NLS to nuclear
localization of golgin-160 truncation proteins, we used a vaccinia virus-mediated T7 expression system to allow detection of the proteins
early after transfection. HeLa cells were first infected with a
recombinant vaccinia virus encoding T7 RNA polymerase, and subsequently
transfected with plasmids encoding GFP/g160-(140-257) or
GFP/g160-(140-257)-NLS behind a T7 promoter. The localization of these
proteins was analyzed by indirect immunofluorescence at 2 and 4 h
post-transfection (Fig. 6). At 2 h
post-transfection, there was significantly more nuclear staining when
the NLS was intact, and this was even more dramatic at 4 h
post-transfection. Thus, the NLS seems to increase the rate of nuclear
translocation.
Some nuclear accumulation was observed for GFP/g160-(140-257) even
when the NLS was mutated (Figs. 5 and 6). We hypothesize that the small
size of this protein allows diffusion into the nucleus where
interaction with a nuclear component results in nuclear retention.
Nuclear retention of GFP/g160-(140-257) seems likely because neither
GFP/g160-(1-139) nor GFP/g160-(257-393) accumulate in the nucleus
(Fig. 5), even though all three of these proteins are small enough to
diffuse into the nucleus. We conclude that a small portion
of the golgin-160 head (residues 140-257) contains three distinct
targeting signals: information for Golgi localization, for active
nuclear import, and for nuclear retention (see summary in Fig. 8).
To further narrow the minimal Golgi targeting signal, we created
smaller truncations in the minus NLS background.
GFP/g160-(172-257)-NLS was targeted to the Golgi as efficiently as the
larger truncations, narrowing the Golgi targeting signal to 85 amino
acids (Fig. 5C). This sequence contains no significant
homology to other proteins.
Specific Caspase Cleavage Fragments of the Head Domain of
Golgin-160 Have the Potential to be Targeted to the
Nucleus--
Full-length golgin-160 was never observed in the nucleus,
raising the possibility that the NLS and putative nuclear retention signal are not physiologically relevant. However, the
NH2-terminal head domain of golgin-160 is cleaved into
smaller pieces by caspases during programmed cell death (25). The
caspase cleavage sites are shown in Fig.
7A. Depending on the order of
caspase activation, a number of different fragments of golgin-160 could
potentially be released from Golgi membranes. To assess the
localization of potential caspase cleavage fragments, we constructed
Myc-tagged mutants corresponding to all possible fragments resulting
from various combinations of caspase cleavage of golgin-160 (Fig.
7A). In these experiments, we used a small epitope tag to
more closely mimic the actual fragments produced by caspase cleavage.
HeLa cells were transfected with the indicated plasmids and
localization was determined by indirect immunofluorescence microscopy
(Fig. 7B). Only those constructs that contained amino acids
140-311 were specifically localized to the nucleus, whereas the
remaining constructs were distributed throughout the entire cell. The
Myc-tagged constructs containing the 85-amino acid stretch demonstrated
to be important for Golgi targeting also showed Golgi localization. The
apparent increase in nuclear localization of these fragments compared
with those shown in Fig. 5C may indicate that the NLS is
more accessible, or that nuclear retention is more efficient. The
specific nuclear targeting of g160-(1-311)/Myc, g160-(60-311)/Myc, and g160-(139-311)/Myc suggests that if these fragments are released from the Golgi during apoptosis, they are translocated to the nucleus.
A direct demonstration of this will require antibodies that recognize
the central portion of the golgin-160 head, which are currently in
production.
Golgins were originally identified as autoantigens in certain
autoimmune diseases, but the definition of the golgin family has been
extended to include any Golgi-localized membrane protein that contains
an extensive coiled-coil domain. Although some golgins have been
implicated in vesicle tethering and/or cisternal stacking, it is likely
that different functions for other members of this broadly defined
family exist. We previously showed that the NH2-terminal head domain of golgin-160 is cleaved by caspases during programmed cell
death (25). Cleavage of golgin-160 during apoptosis may disrupt
protein-protein interactions that are critical for Golgi structure and
function, contributing to the apoptotic disassembly of the Golgi.
We have studied the targeting of golgin-160 as a first step toward
addressing the contribution of this protein to Golgi structure and
function. Our golgin-160 cDNA clone encodes a protein of 1498 amino
acids, which differs from the previously reported GCP170 sequence
because of a frameshift resulting in a novel COOH terminus (Fig.
1A). Based on the new sequence, golgin-160 is predicted to
have a non-coiled-coil NH2-terminal head domain followed by an extensive COOH-terminal coiled-coil tail (Fig. 1B). A
number of expressed sequence tags present in the data base
suggest that the protein represented by our golgin-160 cDNA is
widely expressed. Anti-peptide antisera raised against the COOH
terminus of our predicted golgin-160 protein confirmed that it is
indeed endogenously expressed in HeLa cells (Fig. 1C). It is
likely that golgin-160 exists as a dimer that is mediated by its the
coiled-coil domain (Figs. 1D and 4B).
Several golgins are present in a detergent-resistant Golgi
matrix, and redistribute to distinct cytoplasmic puncta
when cells are treated with BFA (7, 33). Golgin-160 does not appear to
be a component of the Golgi matrix, because it was not redistributed to
GM130-containing puncta in BFA-treated cells (Fig. 2).
Several golgins, including GM130, giantin, golgin-97, and golgin-84,
contain Golgi targeting signals in their COOH- terminal regions (16,
34-38). Here, we report multiple distinct targeting signals in
the NH2-terminal domain of golgin-160 (Fig.
8). We identified an 85-amino acid
stretch in the NH2-terminal domain of golgin-160 capable of
targeting GFP to the Golgi complex (Fig. 6). This 85-amino acid
sequence contains several predicted motifs, such as a
"helix-loop-helix" dimerization pattern (amino acids 199-214) that
could mediate protein-protein interactions, but no significant homology
to other proteins. The efficiency of Golgi localization was increased
by the presence of an additional flanking sequence, suggesting that the
conformation of the 85-residue domain may be critical for correct
targeting. Together, these results indicate that Golgi localization of
golgin-160 reflects an intrinsic property of the
NH2-terminal head domain in the context of the full-length
protein. A further understanding of the Golgi targeting signal will
require determining the proteins with which the signal interacts.
Interestingly, some truncations of the golgin-160 head domain showed
prominent nuclear localization, suggesting the presence of cryptic
nuclear targeting information (Fig. 5C). A putative NLS was
identified between residues 232 and 239. When this sequence was
mutated, steady state nuclear localization was reduced but not
eliminated ( We have previously shown that the NH2-terminal domain of
golgin-160 is cleaved by caspases during apoptosis (25). To determine whether caspase cleavage fragments could be targeted to the nucleus, Myc-tagged constructs corresponding to all possible cleavage fragments were generated and localized by indirect immunofluorescence microscopy (Fig. 7B). Three of the six possible cleavage fragments
showed specific nuclear localization. Although all six of the fragments are small enough to diffuse into the nucleus, only those containing the
region between residues 140 and 311 accumulated there. The three
fragments containing residues 172-257 localized predominantly to the
nucleus, even though they contain the Golgi targeting region described
above. It is possible that the NLS and/or nuclear retention domain is
completely unmasked in these fragments, which mimic the proteolytic
fragments that would be generated in vivo. Thus, if these
caspase-derived fragments are released from Golgi membranes during
programmed cell death, they are likely to be translocated to the
nucleus. It is tempting to speculate that apoptotic fragments of
golgin-160 have a specific function in the nucleus. Studies to address
this issue are presently underway.
We thank Angela McFillin for technical
assistance, Antony Rosen for helpful discussions, Ann Hubbard for
comments on the manuscript, and the members of the Machamer laboratory,
especially Emily Corse, for discussion and comments on the manuscript.
*
This work was supported by National Institutes of Health
Grant GM42522 (to C. M.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, July 18, 2002, DOI 10.1074/jbc.M206280200
The abbreviations used are:
GFP, green
fluorescent protein;
BFA, brefeldin A;
NLS, nuclear localization
signal.
The NH2-terminal Domain of Golgin-160 Contains Both
Golgi and Nuclear Targeting Information*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-helical domain of 1105 amino acids
with a strong coiled-coil prediction (Fig. 1B).
View larger version (28K):
[in a new window]
Fig. 1.
Characterization of a cDNA encoding
golgin-160 with a novel COOH terminus. A, the
nucleotide sequence and translation of previously identified GCP170
cDNA (accession number D63997), and golgin-160 cDNA (accession
number AF48558) are compared in the region where the different 3' ends
are generated. The dotted line marks the predicted border
between exons 22 and 23. The asterisks mark the position of
five additional nucleotides present in the golgin-160 cDNA, which
produce a frameshift and create a new termination codon. The GCP170
cDNA encodes a protein of 1530 amino acids, and golgin-160
encodes a protein of 1498 amino acids. B, the
coiled-coil structure of golgin-160, predicted using the COILS program
and a window of 28 amino acids. C, anti-peptide antisera
raised to the NH2- and COOH-terminal sequences predicted by
the golgin-160 cDNA specifically immunoprecipitated an ~170-kDa
protein from [35S]methionine and -cysteine-labeled HeLa
cells, indicating that a golgin-160 protein with the COOH terminus
predicted by our cDNA is expressed endogenously in HeLa cells.
D, HeLa cells were transfected with plasmids as follows:
vector alone (lanes 1 and 2), GFP-tagged
golgin-160 (lanes 3 and 4), Myc-tagged golgin-160
(lanes 5 and 6), or both GFP- and Myc-tagged
golgin-160 (lanes 7 and 8). Transfected cells
were labeled for 30 min with [35S]methionine and cysteine
and chased for 1 h. Lysates were divided in half and
immunoprecipitated (IP) with anti-GFP (lanes 1,
3, 5, and 7) or anti-Myc (lanes
2, 4, 6, and 8). The different
expression levels of GFP-tagged and Myc-tagged golgin-160 proteins make
it difficult to assess the stoichiometry of interaction.
View larger version (64K):
[in a new window]
Fig. 2.
Localization of golgin-160 is distinct from
that of GM130 in brefeldin A-treated cells. HeLa cells were
incubated in the presence or absence of 1 µg/ml BFA for 30 min at
37 °C. Cells were fixed, permeabilized, and double-labeled with
rabbit anti-golgin-160 and mouse anti-GM130 antibody. Secondary
antibodies were Texas Red-conjugated donkey anti-rabbit IgG and
fluorescein-conjugated goat anti-mouse. The pattern of redistributed
golgin-160 is distinct from that of GM130. Bar, 10 µm.
-helical coiled-coil structure with the exception of the first
393 amino acids, which make up the NH2-terminal head domain
(Fig. 1B). To examine the role of the head and coiled-coil
domains in Golgi targeting, a full-length fusion protein of golgin-160
was first created by fusing the GFP to the 5' end of the coding
sequence (Fig. 3A). Double
label immunofluorescence microscopy verified that the full-length fusion protein was targeted to the Golgi complex in transfected HeLa
cells. The localization of GM130 is shown in the right
panels to mark the Golgi complex. NH2- and
COOH-terminal deletion mutants were constructed as illustrated in Fig.
3A, and localization was examined in transfected HeLa cells.
Both the NH2-terminal head domain and the COOH-terminal
coiled-coil domains were efficiently localized to the Golgi complex
(Fig. 3B). Both truncations were expressed at higher levels
than the full-length fusion protein. Saturable binding to the Golgi
complex may explain the increased cytoplasmic staining present in cells
expressing the truncations compared with the full-length fusion
protein.
View larger version (32K):
[in a new window]
Fig. 3.
Localization of GFP-tagged golgin-160
proteins. A, schematic representation of full-length
GFP-tagged golgin-160 and mutants. Full-length golgin-160 contains an
extensive coiled-coil domain (shaded boxes) and
non-coiled-coil NH2-terminal head domain. B,
HeLa cells were transfected with the indicated cDNA,
fixed, and the GFP signal was enhanced by staining with rabbit anti-GFP
and fluorescein isothiocyanate-conjugated goat anti-rabbit IgG
(left panels). The cells were co-stained for endogenous
GM130 with mouse anti-GM130 in combination with Texas Red-conjugated
anti-mouse IgG antibody (right panels). Both the
NH2-terminal head domain and the COOH-terminal coiled-coil
domain were efficiently targeted to the Golgi complex. Bar,
10 µm.
View larger version (59K):
[in a new window]
Fig. 4.
The COOH-terminal coiled-coil domain of
golgin-160 assembles with endogenous golgin-160 in
vivo. HeLa cells were transfected with plasmids
encoding GFP alone, GFP/g160-(1-1498), GFP/g160-(1-393), or
GFP/g160-(393-1498). Transfected cells were labeled with
[35S]methionine and -cysteine for 30 min, chased for
2 h, and lysed. The lysate was divided into aliquots and
immunoprecipitated. Immunoprecipitates were analyzed by SDS-PAGE (8%
gels) and fluorography. A, the specificity of the antibodies
is shown by a single round of immunoprecipitation with either anti-GFP
or anti-golgin-160. A background band migrates slightly higher than the
GFP-tagged full-length golgin-160. Note that the endogenous golgin-160
is not well labeled after 30 min, and is difficult to detect.
B, sequential immunoprecipitations with anti-golgin-160
followed by anti-GFP were performed as described under "Experimental
Procedures." The GFP-tagged coiled-coil domain was detected in a
complex with endogenous golgin-160 (lane 4), whereas the
GFP-tagged head domain was not (lane 3).
View larger version (86K):
[in a new window]
Fig. 5.
Identification of the minimal sequence within
the head domain of golgin-160 sufficient for Golgi localization.
A, a schematic representation of GFP-tagged truncations. A
putative nuclear localization signal (gray box) was mutated
in the constructs labeled 
NLS. B, transfected
HeLa cells were labeled with [35S]methionine and
-cysteine for 30 min and lysed. Lysates were immunoprecipitated with
anti-GFP, separated by SDS-PAGE (15% gel), and the labeled proteins
were visualized by fluorography. C, transfected HeLa cells
expressing GFP-tagged truncation mutants of golgin-160 were fixed,
permeabilized, and the GFP signal was enhanced by staining with rabbit
anti-GFP and fluorescein isothiocyanate-conjugated goat anti-rabbit IgG
(left panels). Cells were co-stained for endogenous GM130
with mouse anti-GM130 in combination with Texas Red-conjugated
anti-mouse IgG (right panels). An 85-amino acid sequence
within the NH2-terminal non-coiled-coil domain of
golgin-160 (residues 172-257) is sufficient to target GFP to the
Golgi. Bar, 10 µm.
NLS, Fig.
5C). Subcellular fractionation was performed with the goal of quantifying the nuclear versus Golgi-localized
populations of these truncation proteins. However, upon homogenization
using several different methods, all of the truncation proteins were found in the cytosolic fraction (data not shown). These data suggest that the interactions responsible for nuclear retention may not be
stable enough to withstand the fractionation procedure, allowing leakage of these small proteins into the cytosol through nuclear pores.
View larger version (85K):
[in a new window]
Fig. 6.
A nuclear localization sequence in the head
of golgin-160 mediates active import of golgin-160 truncations into the
nucleus. HeLa cells were infected with vaccina virus encoding T7
RNA polymerase (VTF7-3) and transfected with plasmids encoding
GFP/g160-(139-257) or GFP/g160-(139-257)-NLS behind the T7 promoter.
At 2 or 4 h post-transfection, cells expressing GFP-tagged
truncation mutants of golgin-160 were fixed, permeabilized, and the GFP
signal was enhanced by staining with rabbit anti-GFP and fluorescein
isothiocyanate-conjugated goat anti-rabbit IgG. The golgin-160
truncation containing the NLS localizes to the nucleus more rapidly and
efficiently than the same truncation with a mutated NLS.
View larger version (78K):
[in a new window]
Fig. 7.
Specific caspase cleavage fragments of the
NH2-terminal head of golgin-160 have the potential to be
targeted to the nucleus. A, schematic representation of
Myc-tagged constructs of all possible caspase cleavage fragments of the
head domain of golgin-160. Aspartic acid residues at the caspase
cleavage sites within the NH2 terminus of golgin-160 are
marked with a star. B, potential Myc-tagged
caspase cleavage fragments of golgin-160 were expressed in HeLa cells
by transient transfection. Transfected cells were fixed, permeabilized,
and stained with mouse anti-Myc antibody and Texas Red-conjugated
secondary antibody. Bar, 10 µm.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (7K):
[in a new window]
Fig. 8.
Summary of the targeting information in
golgin-160. The gray bars represent the location of
Golgi targeting and putative nuclear retention information, and the
gray box, the NLS. Caspase cleavage sites are marked by
gray circles. Note the overlap in the Golgi and nuclear
targeting information.
NLS, Fig. 5C). Analysis at early times
post-transfection demonstrated that the NLS accelerated the rate of
nuclear accumulation of GFP/g160-(140-257) (Fig. 6). The nuclear
accumulation of truncation proteins lacking the NLS may be because of
passive diffusion into the nucleus and interaction with a nuclear
component, resulting in nuclear retention. However, it is important to
note that full-length golgin-160 (endogenous or exogenously expressed)
was never observed in the nucleus. Thus, the nuclear localization
information present in the NH2-terminal head domain does
not appear to function in the context of full-length golgin-160. There
are a number NLS examples that are masked in the cytoplasm by
protein-protein interactions, phosphorylation, or other
post-translational modifications. We speculate that the NLS in the
golgin-160 head is masked in a regulated manner.
ACKNOWLEDGEMENTS
FOOTNOTES
To whom correspondence should be addressed: Dept. of Cell Biology,
Johns Hopkins University School of Medicine, 725 Wolfe St., Baltimore,
MD 21205. Tel.: 410-955-1809; Fax: 410-955-4129; E-mail:
machamer@jhmi.edu.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Farquhar, M. G.,
and Palade, G. E.
(1998)
Trends Cell Biol.
8,
2-10[CrossRef][Medline]
[Order article via Infotrieve]
2.
Rothman, J. E.,
and Orci, L.
(1992)
Nature
355,
409-415[CrossRef][Medline]
[Order article via Infotrieve]
3.
Nilsson, T.,
Pypaert, M.,
Hoe, M. H.,
Slusarewicz, P.,
Berger, E. G.,
and Warren, G.
(1993)
J. Cell Biol.
120,
5-13 4.
Mollenhauer, H. H.,
and Morre, D. J.
(1966)
J. Cell Biol.
29,
373-376 5.
Beck, K. A.,
Buchanan, J. A.,
Malhotra, V.,
and Nelson, W. J.
(1994)
J. Cell Biol.
127,
707-723 6.
Beck, K. A.,
Buchanan, J. A.,
and Nelson, W. J.
(1997)
J. Cell Sci.
110,
1239-1249[Abstract]
7.
Nakamura, N.,
Rabouille, C.,
Watson, R.,
Nilsson, T.,
Hui, N.,
Slusarewicz, P.,
Kreis, T. E.,
and Warren, G.
(1995)
J. Cell Biol.
131,
1715-1726 8.
De Matteis, M. A.,
and Morrow, J. S.
(2000)
J. Cell Sci.
113,
2331-2343[Abstract]
9.
Griffith, K. J.,
Chan, E. K.,
Lung, C. C.,
Hamel, J. C.,
Guo, X.,
Miyachi, K.,
and Fritzler, M. J.
(1997)
Arthritis Rheum.
40,
1693-1702[Medline]
[Order article via Infotrieve]
10.
Fritzler, M. J.,
Hamel, J. C.,
Ochs, R. L.,
and Chan, E. K.
(1993)
J. Exp. Med.
178,
49-62 11.
Misumi, Y.,
Sohda, M.,
Yano, A.,
Fujiwara, T.,
and Ikehara, Y.
(1997)
J. Biol. Chem.
272,
23851-23858 12.
Erlich, R.,
Gleeson, P. A.,
Campbell, P.,
Dietzsch, E.,
and Toh, B. H.
(1996)
J. Biol. Chem.
271,
8328-8337 13.
Fritzler, M. J.,
Lung, C. C.,
Hamel, J. C.,
Griffith, K. J.,
and Chan, E. K.
(1995)
J. Biol. Chem.
270,
31262-31268 14.
Infante, C.,
Ramos-Morales, F.,
Fedriani, C.,
Bornens, M.,
and Rios, R. M.
(1999)
J. Cell Biol.
145,
83-98 15.
Jakymiw, A.,
Raharjo, E.,
Rattner, J. B.,
Eystathioy, T.,
Chan, E. K.,
and Fujita, D. J.
(2000)
J. Biol. Chem.
275,
4137-4144 16.
Bascom, R. A.,
Srinivasan, S.,
and Nussbaum, R. L.
(1999)
J. Biol. Chem.
274,
2953-2962 17.
Linstedt, A. D.,
and Hauri, H. P.
(1993)
Mol. Biol. Cell
4,
679-693[Abstract]
18.
Barr, F. A.,
Puype, M.,
Vandekerckhove, J.,
and Warren, G.
(1997)
Cell
91,
253-262[CrossRef][Medline]
[Order article via Infotrieve]
19.
Lowe, M.,
Gonatas, N. K.,
and Warren, G.
(2000)
J. Cell Biol.
149,
341-356 20.
Nakamura, N.,
Lowe, M.,
Levine, T. P.,
Rabouille, C.,
and Warren, G.
(1997)
Cell
89,
445-455[CrossRef][Medline]
[Order article via Infotrieve]
21.
Moyer, B. D.,
Allan, B. B.,
and Balch, W. E.
(2001)
Traffic
2,
268-276[CrossRef][Medline]
[Order article via Infotrieve]
22.
Linstedt, A. D.,
Jesch, S. A.,
Mehta, A.,
Lee, T. H.,
Garcia-Mata, R.,
Nelson, D. S.,
and Sztul, E.
(2000)
J. Biol. Chem.
275,
10196-10201 23.
Seemann, J.,
Jokitalo, E. J.,
and Warren, G.
(2000)
Mol. Biol. Cell
11,
635-645 24.
Alvarez, C.,
Garcia-Mata, R.,
Hauri, H. P.,
and Sztul, E.
(2001)
J. Biol. Chem.
276,
2693-2700 25.
Mancini, M.,
Machamer, C. E.,
Roy, S.,
Nicholson, D. W.,
Thornberry, N. A.,
Casciola-Rosen, L. A.,
and Rosen, A.
(2000)
J. Cell Biol.
149,
603-612 26.
Fuerst, T. R.,
Niles, E. G.,
Studier, F. W.,
and Moss, B.
(1986)
Proc. Natl. Acad. Sci. U. S. A.
83,
8122-8126 27.
Matsukuma, S.,
Kondo, M.,
Yoshihara, M.,
Matsuda, M.,
Utakoji, T.,
and Sutou, S.
(1999)
Mamm. Genome
10,
1-5[CrossRef][Medline]
[Order article via Infotrieve]
28.
Klausner, R. D.,
Donaldson, J. G.,
and Lippincott-Schwartz, J.
(1992)
J. Cell Biol.
116,
1071-1080 29.
Hendricks, L. C.,
McClanahan, S. L.,
McCaffery, M.,
Palade, G. E.,
and Farquhar, M. G.
(1992)
Eur. J. Cell Biol.
58,
202-213[Medline]
[Order article via Infotrieve]
30.
Ward, T. H.,
Polishchuk, R. S.,
Caplan, S.,
Hirschberg, K.,
and Lippincott-Schwartz, J.
(2001)
J. Cell Biol.
155,
557-570 31.
Reaves, B.,
Horn, M.,
and Banting, G.
(1993)
Mol. Biol. Cell
4,
93-105[Abstract]
32.
Colledge, W. H.,
Richardson, W. D.,
Edge, M. D.,
and Smith, A. E.
(1986)
Mol. Cell. Biol.
6,
4136-4139 33.
Seemann, J.,
Jokitalo, E.,
Pypaert, M.,
and Warren, G.
(2000)
Nature
407,
1022-1026[CrossRef][Medline]
[Order article via Infotrieve]
34.
Kjer-Nielsen, L.,
Teasdale, R. D.,
van Vliet, C.,
and Gleeson, P. A.
(1999)
Curr. Biol.
9,
385-388[CrossRef][Medline]
[Order article via Infotrieve]
35.
Kjer-Nielsen, L.,
van Vliet, C.,
Erlich, R.,
Toh, B. H.,
and Gleeson, P. A.
(1999)
J. Cell Sci.
112,
1645-1654[Abstract]
36.
Misumi, Y.,
Sohda, M.,
Tashiro, A.,
Sato, H.,
and Ikehara, Y.
(2001)
J. Biol. Chem.
276,
6867-6873 37.
Munro, S.,
and Nichols, B. J.
(1999)
Curr. Biol.
9,
377-380[CrossRef][Medline]
[Order article via Infotrieve]
38.
Barr, F. A.
(1999)
Curr. Biol.
9,
381-384[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  F. Yu, J. Megyesi, and P. M. Price Cytoplasmic initiation of cisplatin cytotoxicity Am J Physiol Renal Physiol, July 1, 2008; 295(1): F44 - F52. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. I. Sbodio and C. E. Machamer Identification of a Redox-sensitive Cysteine in GCP60 That Regulates Its Interaction with Golgin-160 J. Biol. Chem., October 12, 2007; 282(41): 29874 - 29881. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. E. McBride, J. Li, and C. E. Machamer The Cytoplasmic Tail of the Severe Acute Respiratory Syndrome Coronavirus Spike Protein Contains a Novel Endoplasmic Reticulum Retrieval Signal That Binds COPI and Promotes Interaction with Membrane Protein J. Virol., March 1, 2007; 81(5): 2418 - 2428. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Williams, S. W. Hicks, C. E. Machamer, and J. E. Pessin Golgin-160 Is Required for the Golgi Membrane Sorting of the Insulin-responsive Glucose Transporter GLUT4 in Adipocytes Mol. Biol. Cell, December 1, 2006; 17(12): 5346 - 5355. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. I. Sbodio, S. W. Hicks, D. Simon, and C. E. Machamer GCP60 Preferentially Interacts with a Caspase-generated Golgin-160 Fragment J. Biol. Chem., September 22, 2006; 281(38): 27924 - 27931. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Dumin, I. Bendikov, V. N. Foltyn, Y. Misumi, Y. Ikehara, E. Kartvelishvily, and H. Wolosker Modulation of D-Serine Levels via Ubiquitin-dependent Proteasomal Degradation of Serine Racemase J. Biol. Chem., July 21, 2006; 281(29): 20291 - 20302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. G. Nacak, K. Leptien, D. Fellner, H. G. Augustin, and J. Kroll The BTB-kelch Protein LZTR-1 Is a Novel Golgi Protein That Is Degraded upon Induction of Apoptosis J. Biol. Chem., February 24, 2006; 281(8): 5065 - 5071. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Kopecky-Bromberg, L. Martinez-Sobrido, and P. Palese 7a Protein of Severe Acute Respiratory Syndrome Coronavirus Inhibits Cellular Protein Synthesis and Activates p38 Mitogen-Activated Protein Kinase J. Virol., January 15, 2006; 80(2): 785 - 793. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Sztul and V. Lupashin Role of tethering factors in secretory membrane traffic Am J Physiol Cell Physiol, January 1, 2006; 290(1): C11 - C26. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Fu, Y.-s. Gao, A. Tousson, A. Shah, T.-L. L. Chen, B. M. Vertel, and E. Sztul Nuclear Aggresomes Form by Fusion of PML-associated Aggregates Mol. Biol. Cell, October 1, 2005; 16(10): 4905 - 4917. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Hicks and C. E. Machamer Isoform-specific Interaction of Golgin-160 with the Golgi-associated Protein PIST J. Biol. Chem., August 12, 2005; 280(32): 28944 - 28951. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
