JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M204732200 on July 26, 2002

J. Biol. Chem., Vol. 277, Issue 39, 36889-36896, September 27, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/39/36889    most recent
M204732200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jain, S.
Right arrow Articles by Kumar, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jain, S.
Right arrow Articles by Kumar, A.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Angiotensinogen Gene Polymorphism at -217 Affects Basal Promoter Activity and Is Associated with Hypertension in African-Americans*

Sudhir JainDagger , Xiangna TangDagger , Chittampalli S. NarayananDagger , Yogesh Agarwal§, Stephen M. Peterson§, Clinton D. Brown, Jurg Ott||, and Ashok KumarDagger **

From the Departments of Dagger  Pathology and § Internal Medicine, New York Medical College, Valhalla, New York 10595, the  Renal Division, Department of Medicine, State University of New York Health Science Center, Brooklyn, New York 11203, and the || Laboratory of Statistical Genetics, Rockefeller University, New York, New York 10021

Received for publication, May 14, 2002, and in revised form, July 22, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Hypertension is a serious health problem in Western society, in particular for the African-American population. Although previous studies have suggested that the angiotensinogen (AGT) gene locus is involved in human essential hypertension, the molecular mechanisms involved in hypertension in African-Americans remain unknown. We show that an A/G polymorphism at -217 in the promoter of the AGT gene plays a significant role in hypertension in African-Americans. The frequency of the -217A allele was increased significantly in African-American hypertensive subjects compared with normotensive controls. We also show that the nucleotide sequence of this region of the AGT gene promoter bound strongly to CAAT/enhancer-binding protein (C/EBP) family transcription factors when nucleoside A was present at -217. In addition, we show that reporter constructs containing the human AGT gene promoter with nucleoside A at -217 had increased basal transcriptional activity upon transient transfection in HepG2 cells compared with reporter constructs with nucleoside G at -217. Finally, we show that interleukin-6 treatment in the presence or absence of overexpressed C/EBPbeta increased the promoter activities of reporter constructs containing nucleoside A at -217 compared with reporter constructs containing nucleoside G at -217. Because the AGT gene is expressed primarily in liver and adipose tissue, and C/EBP family transcription factors play an important role in gene expression in these tissues, we propose that increased transcriptional activity of the -217A allele of the human AGT gene is associated with hypertension in African-Americans.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Hypertension is a serious risk factor for myocardial infarction, heart failure, vascular disease, stroke, and renal failure (1-3). It is estimated that hypertension affects 50 million Americans with a prevalence rate of 25-30% in the adult Caucasian population, and the incidence of hypertension is even greater in the African-American population. Hypertension is a polygenic disease, and it has been estimated by segregation analysis and twin studies that ~45% of the interindividual differences in blood pressure can be accounted for by genetic differences. However, molecular mechanisms involved in the pathophysiology of human hypertension remain unknown. The renin-angiotensin system plays an important role in the regulation of blood pressure, and the octapeptide angiotensin II is one of the most active vasopressor agents (4, 5). Angiotensin II is obtained from its precursor molecule, angiotensinogen (AGT),1 which is synthesized primarily in liver and adipose tissue and to a lesser extent in kidney, brain, heart, adrenal gland, and vascular walls (6, 7). AGT is first converted by renin to produce a decapeptide, angiotensin I, which is then converted to angiotensin II by the removal of a C-terminal dipeptide by angiotensin-converting enzyme. In experimental as well as clinical studies, administration of renin-angiotensin inhibitors is effective in reducing blood pressure and ending organ damage (8).

Jeunemaitre et al. (9) have used a highly polymorphic CA dinucleotide marker located in the 3'-region of the human AGT gene and shown an association of this gene with essential hypertension in the Caucasian population by linkage analysis. This association was later confirmed in Japanese hypertensive subjects (10). On the other hand, no association or linkage was found between genes of other components of the renin-angiotensin system, viz. renin (11), angiotensin-converting enzyme (12), and the angiotensin II subtype 1 receptor (13), with human hypertension. Jeunemaitre et al. (9) have also shown that the molecular variant M235T of the AGT gene is associated with increased plasma AGT levels. However, because amino acid 235 is located far away from the renin cleavage site, this polymorphism does not explain the mechanism involved in the increased plasma AGT levels. The human AGT gene also has an A/G polymorphism at -6. It has been shown recently that (a) molecular variants 235T and -6A are in complete linkage disequilibrium and (b) reporter constructs containing the human AGT gene promoter with nucleoside A at -6 have increased promoter activity upon transient transfection in human liver-derived HepG2 cells compared with reporter constructs containing nucleoside G at -6 (14). The results of these experiments suggest that the increased plasma AGT levels by the 235T allele may be due to increased transcriptional activity of the human AGT gene by nucleoside A at -6.

Although hypertension is more prevalent in the black population, and complication rates, particularly for renal failure, are many times higher in blacks than in whites, relatively little work has been done to understand the molecular mechanism involved in hypertension in this population. Plasma AGT levels are generally higher in the black population (15). It has been shown that (a) plasma AGT levels are ~19% higher in black children compared with white children, (b) blood pressure is normally higher and increases faster over time in black children compared with white children, and (c) plasma AGT levels are associated with the AGT gene in black children (16-18). Caulfield et al. (19) have found an association between the AGT gene locus and high blood pressure in 63 affected sibling pairs of African-Caribbean origin using CA dinucleotide markers. However, these workers could not find an association between variants M235T and A/G at -6 and hypertension in the African-American population. Other studies have also suggested that, although the frequency of the -6A allele is increased in the African-American population, there is no association between the -6A allele and hypertension in this population (20).

Our laboratory is interested in understanding the role of single nucleotide polymorphisms in the AGT gene in human hypertension. The nucleotide sequence of the human AGT gene promoter contains an A/G polymorphic site at -217. In this work, we show that the -217A allele of the AGT gene is associated with hypertension in the African-American population (p = 0.0017), but not in the Caucasian population (p = 0.12). The nucleotide sequence of the human AGT gene containing an A/G polymorphic site at -217 has partial homology to the consensus C/EBP-binding site. We show that an oligonucleotide containing the human AGT gene promoter with nucleoside A at -217 binds more strongly to recombinant C/EBPalpha , C/EBPbeta , and DBP. In addition, we show that reporter constructs containing the human AGT gene promoter with nucleoside A at -217 have increased basal promoter activity upon transient transfection in HepG2 cells compared with reporter constructs containing nucleoside G at -217. Furthermore, we show that IL-6 treatment in the presence or absence of overexpressed C/EBPbeta increases the promoter activities of reporter constructs containing nucleoside A at -217 compared with reporter constructs containing nucleoside G at -217.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Plasmid Construction-- The reporter construct pHAGT1.3luc was constructed by PCR amplification of the human AGT gene (21, 22) using TATGCTAGTCGAGTGAGTCCCTATCTATAGTGAACA as the forward primer and CAAGTACCAGTAAGTGAGTCTGAGTGGGGCCCCGCTTA as the reverse primer. The amplified fragment contained nucleotides -1206 to +70 and was subcloned in the pGL3-basic vector lacking eukaryotic promoter and enhancer sequences (Promega, Madison, WI). The reporter construct pHAGT303luc was constructed by PCR amplification of the human AGT gene (22) using ACACACCTAGGGAGATGCTCCCGTTTCTGG as the forward primer and CAAGTACCAGTAAGTGAGTCTGAGTGGGGCCCCGCTTA as the reverse primer. The amplified fragment contained nucleotides -303 to +70 and was subcloned in the pGL3-basic vector. These reporter constructs had nucleoside A at -6 and -217. Nucleoside A at -217 in these reporter constructs was mutated to G by site-specific mutagenesis using CCTGCACCAGTCTCACTCTGTTCAGTCAGTG and its complementary oligonucleotide using a Stratagene kit (Stratagene, La Jolla, CA). The nucleotide sequences of the mutated reporter constructs were confirmed by sequence analysis. The reporter constructs (223A)2-luc and (223G)2-luc were constructed by dimerization of oligonucleotides CCTGCACCAGTCTCACTCTGTTCAGTCAGTG and CCTGCACCGGCTCACTCTGTTCAGTCAGTG (the position of the A/G polymorphic site is underlined) and blunt-end ligation of dimers in the SmaI site of the pGL3 promoter vector. The pGL3 promoter vector contains the SV40 promoter, but not the enhancer sequence upstream of the luciferase gene. The Rous sarcoma virus-beta -galactosidase expression vector was obtained from Promega. Restriction enzymes were purchased from New England Biolabs (Beverly, MA). Plasmid DNAs for transient transfection were prepared using QIAGEN midi or maxi plasmid kits following the instructions supplied by the manufacturer. PolyFect transfection reagent was also purchased from QIAGEN Inc.

Cell Culture and Transient Transfection-- Human hepatoma cells (HepG2) were grown as monolayers in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 100 units/ml penicillin, and 100 µg/ml streptomycin in an atmosphere of 5% CO2. For transient transfections, reporter DNA (1.0 µg) and Rous sarcoma virus-beta -galactosidase DNA (0.1 µg) were mixed with pBluescript DNA to a final weight of 3 µg of DNA. Transient transfections were performed following the manufacturer's protocol. For cotransfection experiments, expression vectors containing MSV-C/EBPbeta and MSV-C/EBPdelta (0.25 µg) were added to the reporter constructs. After 24 h of transfection, cells were treated for an additional 24 h with recombinant human IL-6 (10 ng/ml of medium). Cells were harvested 48 h post-transfection, and whole cell extracts were prepared by resuspension in 100 µl of lysis buffer (Promega) followed by freeze-thawing in dry ice/ethanol. An aliquot of the cell extract was used to measure luciferase activity in a Turners Design TD 20/20 luminometer using a luciferase assay system (Promega) as described by the manufacturer. Luciferase activity was normalized to beta -galactosidase activity. beta -Galactosidase activity was determined as described previously (23).

Gel Mobility Shift Assay-- The probes for electrophoretic mobility shift assay were chemically synthesized, annealed, and radiolabeled at the 5'-ends by polynucleotide kinase using [gamma -32P]ATP. DNA fragments (20,000-50,000 cpm), poly(dI-dC) (1-2 µg), and nuclear extract (5-10 µg) or recombinant proteins (10-20 ng) were incubated in a solution containing 10 mM HEPES (pH 7.5), 50 mM KCl, 5 mM MgCl2, 0.5 mM EDTA, 1 mM dithiothreitol, and 12.5% glycerol in ice for 30 min and separated on a 5-8% polyacrylamide gel in a cold room. After 2-3 h, the gel was dried under vacuum, and protein-nucleic acid complexes were identified by autoradiography. For supershift assay, 1 µl of antibody was added to the reaction mixture, which was incubated for 30 min and analyzed by electrophoretic mobility shift assay. Radioactive oligonucleotides were purified by PAGE followed by electroelution for quantitative gel shift assay. Nuclear extracts for gel mobility shift assays were prepared by modification of a previously described method (24). Recombinant C/EBPalpha and C/EBPbeta were obtained through bacterial expression of histidine-tagged proteins as described previously (25). Recombinant DBP was obtained using an in vitro coupled transcription-translation system obtained from rabbit reticulocytes as described previously (23). Antibodies against C/EBPalpha and C/EBPbeta were purchased from Santa Cruz Biotechnologies (Santa Cruz, CA).

Oligonucleotides-- Double-stranded oligonucleotides 223A and 223G were obtained by annealing CGACCCTGCACCAGCTCACTCT and CGACCCTGCACCGGCTCACTCT with their respective complementary oligonucleotides. Double-stranded oligonucleotides containing the consensus C/EBP-, NF-1-, and HNF-3-binding sites were obtained by annealing AGTATTGTGCAATGT, CCTTTGGCATGCTGCCAATATG, and TATTATTGACTTAGTGATC with their respective complementary oligonucleotides.

Patient Selection-- We studied 186 African-American and 127 Caucasian subjects with hypertension (mean age of 59 ± 10 years) and 156 African-American and 135 Caucasian normotensive controls (mean age of 58 ± 10 years). All of these subjects were recruited from the outpatient department of the State University of New York Health Science Center (Brooklyn, NY) and the Westchester Medical Center (Valhalla, NY). All cases were diagnosed as having essential hypertension. The criteria for hypertension were defined as a systolic blood pressure >140 mm Hg and a diastolic blood pressure >90 mm Hg or under antihypertensive therapy. Blood pressure was measured twice with the subject seated with a 5-min interval between measurements. The normotensive subjects (with systolic blood pressure/diastolic blood pressure <140/90 mm Hg) without a history of hypertension were recruited from the same population and matched for sex and age. All participants completed a standard questionnaire on personal medical history and family history of hypertension.

Analysis of the Genomic DNA-- The genomic DNAs from hypertensive and control subjects were amplified using CTCAGTGCTGTCACACACCTA as the forward primer and AAGTGACACCACCTCCAGTCTTTAGT as the reverse primer. The amplification product (233 bp) contained nucleotides -314 to -82 of the human AGT gene promoter, including the A/G polymorphic site at -217. These amplified fragments were treated with either AluI or HpaII to identify the A/G polymorphic site at -217. The restriction enzyme AluI (restriction site AGCT) cuts the amplified sequence if nucleoside A is present at -217 and produces 134- and 99-bp fragments. On the other hand, the restriction enzyme HpaII (restriction site CCGG) cuts the amplified fragment if nucleoside G is present at -217 and produces 136- and 97-bp fragments. After restriction analysis, the resulting fragments were separated by 3.5% agarose gel electrophoresis. The nucleotide sequences of the amplified products were determined by sequence analysis to confirm the results of restriction analysis.

Statistical Analysis-- The GraphPAD statistical software package (GraphPAD Version 3.00 for Windows, GraphPAD Software, San Diego, CA) was used for analysis of the clinical characteristics, differences in allele frequency between case and control subjects, and comparison of promoter activities of different reporter constructs in transient transfection assays. Base-line characteristics between hypertensive and normotensive subjects were compared using unpaired t tests or Fisher's exact test for contingency table where appropriate. Genetic data were analyzed for allele frequency by a gene-counting method. Hardy-Weinberg equilibrium was tested using the computer program GDA (46).2 Genotype distribution and differences in allele frequencies between case and control subjects were compared using Fisher's exact test for contingency table because all the variants are dichotomous. Odds ratios (ORs) with 95% confidence intervals estimated the relative risk for hypertension associated with the -217A allele carrier. Unpaired t tests were performed to compare relative luciferase activities of reporter constructs containing nucleoside A or G at position -217 of the AGT gene promoter in transfection experiments. All experiments were conducted in sextuplicate in four independent transfection experiments as described recently (26).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Frequency of the -217A Allele of the AGT Gene Is Increased in African-American Hypertensive Patients-- To understand the role of the A/G polymorphism at -217 in the promoter of the AGT gene in hypertension, we have analyzed genomic DNAs from 186 hypertensive and 156 normotensive African-American subjects. All patients and control subjects were in Hardy-Weinberg equilibrium. The genomic DNA was amplified by PCR, and the product was analyzed for the A/G polymorphic site at -217 by restriction analysis (Fig. 1). The frequency of the -217A allele in hypertensive patients was 0.29 compared with 0.19 in the normotensive population, which is highly significant (p = 0.0017 and OR = 1.792) (Table I). To compare the role of this polymorphic site in hypertension in the African-American and Caucasian populations, we also analyzed genomic DNAs from 127 Caucasian hypertensive subjects and 135 normotensive controls. The frequency of the -217A allele in Caucasian hypertensive subjects was 0.15, and that in normotensive controls was 0.11, which is not significant (p = 0.12) (Table I). Statistical analysis based on the A/G genotype at -217 (using the A allele as a dominant model) also suggested a significant role of the -217A allele in hypertension in African-Americans (p = 0.0021 and OR = 2.015), but not in Caucasians (Table II). Because an A/G polymorphism at -6 has been previously associated with hypertension, we also analyzed genomic DNAs from the African-American and Caucasian populations for this polymorphism. The frequency of the -6A allele was 0.87 in African-American hypertensive subjects and 0.85 in normotensive controls, which is not significant (p = 0.58) (Table III). However, the frequency of the -6A allele was marginally significant in Caucasian subjects (p = 0.06). These experiments suggest that -217A allele of the human AGT gene plays a significant role in essential hypertension in African-Americans, but not in Caucasians.


View larger version (73K):
[in this window]
[in a new window]
  		Fig. 1.   Analysis of genomic DNA for an A/G polymorphism at -217 of the AGT gene. Genomic DNAs from hypertensive patients and normotensive controls were amplified to produce 233-bp fragments as described under "Experimental Procedures." The nucleotide sequence of the amplified fragment around the A/G polymorphic site at -217 of the AGT gene is shown in the first line. The AluI restriction site (which will cleave the amplified DNA if nucleoside A is present at -217) is shown in the second line, and the HpaII restriction site (which will cleave the amplified DNA if nucleoside G is present at -217) is shown in the third line. The amplified DNA fragments were treated with either AluI (upper panel) or HpaII (lower panel) and separated on a 3.5% agarose gel. Lane 1, positions of DNA markers; lanes 2-5, DNA samples from AA homozygotes; lanes 6-8, DNA samples from A/G heterozygotes; lanes 9-12, DNA samples from GG homozygotes.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Statistical analysis of the A/G polymorphism at -217 of human angiotensinogen based on allele frequency

                              
View this table:
[in this window]
[in a new window]
 
Table II
Statistical analysis of the A/G polymorphism at -217 of the angiotensinogen gene based on the genotype distribution using the A allele dominant model

                              
View this table:
[in this window]
[in a new window]
 
Table III
Statistical analysis of the A/G polymorphism at -6 of the human angiotensinogen gene based on allele frequency

Reporter Constructs Containing the Human AGT Gene Promoter with Nucleoside A at -217 Have Increased Basal Promoter Activity upon Transient Transfection in HepG2 cells Compared with Reporter Constructs Containing Nucleoside G at -217-- To understand the role of the A/G polymorphism at -217 in transcriptional regulation of the human AGT gene, we performed transient transfection of reporter constructs pHAGT1.3luc and pHAGT303luc containing either nucleoside A or G at -217 in HepG2 cells. Promoter activity was analyzed after 48 h of transfection and normalized to beta -galactosidase activity. The results of this experiment show that pHAGT1.3luc with nucleoside A at -217 had 28% increased basal promoter activity compared with pHAGT1.3luc with nucleoside G at -217 (p < 0.001) (Fig. 2). On the other hand, pHAGT303luc with nucleoside A at -217 had 37% increased basal promoter activity compared with pHAGT303luc with nucleoside G at -217 (p < 0.001) (data not shown). We also synthesized reporter constructs in which two copies of an oligonucleotide containing nucleotides -225 to -196 of the human AGT gene promoter with either nucleoside A or G at -217 were ligated in front of the luciferase gene in the pGL3 promoter vector. These reporter constructs were then used in transient transfection assay in HepG2 cells. The results of this experiment show that the reporter construct with nucleoside A at -217 had 84% increased basal promoter activity compared with the reporter construct containing nucleoside G at this position. Taken together, these experiments show that nucleoside A at -217 increases the basal promoter activities of reporter constructs containing the human AGT gene promoter upon transient transfection in HepG2 cells compared with nucleoside G at -217.


View larger version (23K):
[in this window]
[in a new window]
  		Fig. 2.   Basal promoter activities of reporter constructs containing nucleoside A or G at -217 of the human AGT gene promoter. A mixture of reporter construct pHAGT1.3luc, pHAGT303luc, or (223)2-luc (with either nucleoside A or G at -217; 1 µg); Rous sarcoma virus-beta -galactosidase (0.1 µg); and pBluescript (1.9 µg) was transiently transfected in HepG2 cells in six-well plates as described under "Experimental Procedures." Cell extracts were prepared after 48 h of transfection, and luciferase and beta -galactosidase activities were measured as described under "Experimental Procedures." Luciferase activity was normalized to beta -galactosidase activity. A, luciferase activity of pHAGT1.3luc; B, luciferase activity of pHAGT303luc; C, luciferase activity of (223)2-luc. White bars, promoter activities of reporter constructs containing nucleoside G at -217; striped bars, promoter activities of reporter constructs containing nucleoside A at -217. The promoter activity of each reporter construct containing nucleoside A at -217 was calculated by assuming the promoter activity of the same reporter construct containing nucleoside G at -217 to be 1.

Recombinant C/EBP Family Transcription Factors Bind Strongly to an Oligonucleotide Containing Nucleoside A at -217 Compared with the Same Oligonucleotide Containing Nucleoside G at -217-- The nucleotide sequence of the human AGT gene promoter (located between nucleotides -217 and -225) has partial homology to the C/EBP-binding site (Fig. 3A). The consensus C/EBP-binding site T(T/G)NNGCAA(T/G) (shown in reverse orientation in the first line in Fig. 3A) has one mismatch when nucleoside A is present at -217 and two mismatches when nucleoside G is present at -217. To examine whether this region of the human AGT gene binds to C/EBP family transcription factors, we performed gel shift assays using oligonucleotides 223A and 223G in the presence of recombinant C/EBPalpha that was synthesized as a His-tagged protein. The results of this experiment are presented in Fig. 3B. Lane 1 shows the results from a gel shift assay in the presence of recombinant C/EBPalpha in the absence of competitor DNA, and lane 2 shows the results from the same assay in the presence of a 100-fold excess of unlabeled oligonucleotide 223A. Lane 3 shows the results from an assay in the presence of a nonspecific unlabeled oligonucleotide containing the consensus NF-1-binding site. Lane 4 shows the results from an assay in the presence of anti-C/EBPalpha antibody, and lane 5 shows the results from an assay in the presence of preimmune serum. Lanes 6-10 show the same reactions in the presence of oligonucleotide 223G. The results of this experiment show that oligonucleotide 223A (containing nucleoside A at -217) formed a specific complex with recombinant C/EBPalpha and that the intensity of this complex was at least 10-fold greater compared with the that of the complex formed with oligonucleotide 223G (containing nucleoside G at -217).


View larger version (47K):
[in this window]
[in a new window]
  		Fig. 3.   A, sequence homology between the -217 region of the human AGT gene and the C/EBP site. The first line shows the nucleotide sequence of the consensus C/EBP-binding site (T(T/G)NNGCAA(T/G)) in reverse orientation; the second line shows the sequence located between nucleotides -217 and -225 of the human AGT gene with nucleoside A at -217; and the third line shows the same sequence with nucleoside G at -217 (mismatched nucleosides are marked by asterisks). B, electrophoretic mobility shift assay of oligonucleotides 223A and 223G in the presence of recombinant C/EBPalpha . Lane 1, gel shift assay in the presence of recombinant C/EBPalpha alone; lane 2, gel shift assay in the presence of a 100-fold excess of unlabeled oligonucleotide 223A; lane 3, gel shift assay in the presence of a nonspecific unlabeled oligonucleotide containing the consensus NF-1-binding site; lane 4, gel shift assay in the presence of anti-C/EBPalpha antibody (C/EBPab); lane 5, gel shift assay in the presence of preimmune serum (PIS); lanes 6-10, gel shift assay in the presence of radiolabeled oligonucleotide 223G.

We next performed a gel shift assay using oligonucleotides 223A and 223G and an oligonucleotide with the consensus C/EBP-binding site in the presence of recombinant C/EBPbeta (which was synthesized as a His-tagged protein). The results of this experiment show that oligonucleotide 223A formed a complex with recombinant C/EBPbeta (Fig. 4, lane 1) which was supershifted in the presence of anti-C/EBPbeta antibody (lane 2). An oligonucleotide containing the consensus C/EBP-binding site also formed a similar complex with recombinant C/EBPbeta (lane 3), which was partially supershifted in the presence of anti-C/EBPbeta antibody (lane 4). To compare the binding of recombinant C/EBPbeta to oligonucleotides 223A and 223G, we performed a gel shift assay in the presence of equal amounts of purified radioactive oligonucleotides using two concentrations of recombinant C/EBPbeta . The results of this experiment show that recombinant C/EBPbeta formed a much stronger complex with oligonucleotide 223A compared with oligonucleotide 223G (compare lanes 5 and 6 with lanes 7 and 8). As a control, we also performed a gel shift assay with oligonucleotides 223A and 223G using two concentrations of recombinant C/EBPalpha (compare lanes 9 and 10 with lanes 11 and 12). The results of this experiment confirmed our previous observation that oligonucleotide 223A formed a stronger complex with recombinant C/EBPalpha compared with oligonucleotide 223G.


View larger version (89K):
[in this window]
[in a new window]
  		Fig. 4.   Electrophoretic mobility shift assay of oligonucleotides 223A and 223G in the presence of recombinant C/EBPbeta . Lane 1, assay with oligonucleotide 223A and recombinant C/EBPbeta ; lane 2, the same assay in the presence of anti-C/EBPbeta antibody (ab); lane 3, assay with an oligonucleotide containing the consensus C/EBP-binding site and recombinant C/EBPbeta ; lane 4, the same assay in the presence of anti-C/EBPbeta antibody; lanes 5 and 6, gel shift assay using 20,000 cpm purified oligonucleotide 223A in the presence of 2 and 4 µl of recombinant C/EBPalpha , respectively; lanes 7 and 8, assay using 20,000 cpm purified oligonucleotide 223G in the presence of 2 and 4 µl of recombinant C/EBPalpha , respectively; lanes 9 and 10, assay using 20,000 cpm purified oligonucleotide 223A in the presence of 2 and 4 µl of recombinant C/EBPbeta , respectively; lanes 11 and 12, assay using 20,000 cpm purified oligonucleotide 223G in the presence of 2 and 4 µl of recombinant C/EBPbeta , respectively.

Because DBP also plays an important role in transcriptional regulation of liver-specific genes especially in the circadian rhythm and binds to C/EBP-binding sites (27), it was of interest to determine whether DBP also binds to this region of the human AGT gene promoter. To answer this question, recombinant DBP was synthesized by in vitro coupled transcription-translation using a rabbit reticulocyte system. Recombinant DBP was then used in a gel shift assay with equal amounts of purified radioactive oligonucleotides 223A and 223G. The results of this experiment are shown in Fig. 5. Lane 1 shows the reaction in the presence of oligonucleotide 223A, and lane 2 shows the reaction in the presence of oligonucleotide 223G. Lane 3 shows the reaction of oligonucleotide 223A and recombinant DBP in the presence of anti-DBP antibody, and lane 4 shows the same reaction in the presence of a nonspecific anti-NF-1 antibody. Lane 5 shows the reaction in the presence of a 100-fold excess of an oligonucleotide containing the consensus C/EBP-binding site; and lanes 6 and 7 show the reaction in the presence of 100-fold excesses of oligonucleotides containing the HNF-3- and NF-1-binding sites, respectively. The results of this experiment show that anti-DBP antibody produced a supershift (faint band shown by the dashed arrow), whereas anti-NF-1 antibody had no effect. In addition, the unlabeled C/EBP oligonucleotide reduced the intensity of this complex, but unlabeled oligonucleotides containing the consensus NF-1- and HNF-3-binding sites did not compete with the complex. Taken together, the results of this experiment show that oligonucleotide 223A formed a much stronger complex with recombinant DBP compared with oligonucleotide 223G.


View larger version (41K):
[in this window]
[in a new window]
  		Fig. 5.   Electrophoretic mobility shift assay of oligonucleotides 223A and 223G in the presence of recombinant DBP. Lanes 1 and 2, gel shift assay using 20,000 cpm purified oligonucleotides 223A and 223G in the presence of an equal amount of recombinant DBP, respectively; lane 3, gel shift assay using oligonucleotide 223A and recombinant DBP in the presence of anti-DBP antibody (ab); lane 4, the same assay in the presence of a nonspecific anti-NF-1 antibody; lane 5, the same assay in the presence of a 100-fold excess of an oligonucleotide containing the consensus C/EBP-binding site; lanes 6 and 7, gel shift assay of oligonucleotide 223A in the presence of a 100-fold excess of unlabeled oligonucleotides containing the consensus HNF-3- and NF-1-binding sites, respectively. The supershifted band in lane 3 is shown by the dashed arrow.

IL-6 Treatment in the Presence or Absence of C/EBPbeta Increases the Promoter Activities of Reporter Constructs Containing the Human AGT Gene with Nucleoside A at -217 Compared with Reporter Constructs Containing Nucleoside G at -217-- Because C/EBPbeta and IL-6 play an important role in liver-specific gene expression, we were interested in analyzing their effect on expression of the human AGT gene containing an A/G polymorphic site at -217. The promoter activities of pHAGT1.3luc reporter constructs with either nucleoside A or G at -217 were determined after IL-6 treatment alone or in the presence of overexpressed C/EBPbeta by transient transfection in HepG2 cells. We also compared the promoter activities of these constructs in the presence of overexpressed C/EBPbeta in the absence of IL-6 treatment. The results of these experiments show that all of these treatments increased the promoter activities of pHAGT1.3luc(-217A) and pHAGT1.3luc(-217G) (Fig. 6). Moreover, the promoter activity of the A variant was always greater than that of the G variant in each experiment. Thus, IL-6 treatment of transfected HepG2 cells increased the promoter activity of the A variant by 50% compared with the G variant (Fig. 6A, compare bars 1 and 3). Cotransfection of C/EBPbeta increased the promoter activity of the A variant by 26% compared with the G variant (Fig. 6B, compare bar 1 and 3). Cotransfection of C/EBPbeta followed by IL-6 treatment increased the promoter activity of the A variant by 50% compared with the G variant (Fig. 6C, compare bars 1 and 3). We next compared the -fold increase in the promoter activity of each variant with respect to its basal promoter activity. These values are shown above the bars for each pair of reporter constructs. IL-6 treatment increased the promoter activity of the A variant by 2.66-fold and that of the G variant by 2.18-fold; cotransfection of C/EBPbeta increased the promoter activity of the A and G variants by 1.6-fold; and cotransfection of C/EBPbeta followed by IL-6 treatment increased the promoter activity of the A variant by 3.54-fold and that of the G variant by 3.03-fold. The results of this experiment show that IL-6 treatment of HepG2 cells preferentially enhanced the human AGT promoter activity of the A variant, particularly in the case of overexpressed C/EBPbeta .


View larger version (26K):
[in this window]
[in a new window]
  		Fig. 6.   Effect of cotransfection of C/EBPbeta and/or IL-6 treatment on the promoter activity of reporter construct pHAGT1.3luc containing either nucleoside A or G at -217. The reporter construct was transfected either alone or with the murine sarcoma virus-C/EBPbeta expression vector in HepG2 cells as described under "Experimental Procedures." After 24 h of transfection, one group of cells were treated with recombinant human IL-6 (10 ng/ml) for 24 h, and promoter activity was analyzed. A, effect of IL-6 on promoter activity; B, effect of cotransfected C/EBPbeta on promoter activity; C, effect of IL-6 and cotransfected C/EBPbeta on promoter activity. Bars 4, basal promoter activity of the G variant; bars 2, basal promoter activity of the A variant; bars 3, promoter activity of variant G under experimental conditions; bars 1, promoter activity of variant A under experimental conditions. The promoter activity of each reporter construct was calculated by assuming the basal promoter activity of pHAGT1.3luc(-217G) to be 1. All experiments were conducted in sextuplicate in four independent transfections.

We also studied the effect of overexpressed C/EBPbeta and/or IL-6 treatment on the promoter activity of the 5'-deleted reporter construct pHAG303luc containing either nucleoside A or G at -217. The results of this experiment also show that all of these treatments increased the overall promoter activities of both variants (Fig. 7). In addition, the promoter activity of the A variant was always greater than that of the G variant in each experiment. We also calculated the -fold increase in the promoter activity of each variant with respect to its basal promoter activity. These values are shown above the bars for each pair of reporter constructs. IL-6 treatment increased the promoter activity of the A variant by 3.9-fold and that of the G variant by 3.7-fold; cotransfection of C/EBPbeta increased the promoter activity of the A variant by 3.6-fold and that of the G variant by 4.2-fold; and cotransfection of C/EBPbeta followed by IL-6 treatment increased the promoter activity of the A variant by 5.7-fold and that of the G variant by 5.5-fold. The results of this experiment also show that IL-6 treatment (especially in the presence of C/EBPbeta ) preferentially increased the promoter activity of the A variant. The change in the -fold increase in the promoter activities of the A and G variants in pHAGT303luc was smaller compared with that in pHAGT1.3luc, suggesting that the nucleotide sequence in the upstream region of the promoter also plays a role in IL-6-induced expression of this gene.


View larger version (22K):
[in this window]
[in a new window]
  		Fig. 7.   Effect of cotransfection of C/EBPbeta and/or IL-6 treatment on the promoter activity of reporter construct pHAGT303luc containing either nucleoside A or G at -217. The experimental conditions were same as described in the legend to Fig. 6. The promoter activity of each reporter construct was calculated by assuming the promoter activity of pHAGT303luc(-217G) to be 1.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

To date, the AGT gene locus is the only locus that has been associated with human essential hypertension. We have presented evidence that an A/G polymorphism at -217 may be involved in hypertension in the African-American population. The frequency of the -217A allele was significantly increased in African-American hypertensive subjects compared with normotensive controls. On the other hand, the frequency of the -217A allele was not significantly different in Caucasian hypertensive and normotensive subjects. We have also found that 65% of the African-American normotensive controls were GG homozygotes, whereas 48% of the African-American hypertensive subjects were GG homozygotes (p = 0.0021). This observation suggests that the -217G allele may be partially responsible for protection of African-American subjects from hypertension. On the other hand, 80% of the Caucasian normotensive controls were GG homozygotes, and 72% of the Caucasian hypertensive subjects were GG homozygotes, which is not significantly different (p = 0.14). In accordance with previous studies, we also found that, although the frequency of the -6A allele was increased in African-American subjects, this difference was not significant between hypertensive and normotensive subjects.

To understand the biological significance of this polymorphic site, we constructed three types of reporter constructs containing either nucleoside A or G at -217 and used these reporter constructs in transient transfection assays in human liver-derived HepG2 cells. Transient transfection of these reporter constructs indicated statistically significant increased basal promoter activities of reporter constructs containing nucleoside A at -217 compared with reporter constructs containing nucleoside G at -217.

The nucleotide sequence of the AGT gene promoter containing an A/G polymorphic site at -217 has partial homology to the C/EBP-binding site. Our gel shift assays have shown that recombinant C/EBPalpha , C/EBPbeta , and DBP bound more strongly to an oligonucleotide containing the human AGT gene promoter with nucleoside A at -217 compared with the same oligonucleotide containing nucleoside G at -217. Because the C/EBP family transcription factors play an important role in IL-6-induced expression of a number of genes, we studied the effect of IL-6 and C/EBPbeta on the promoter activities of reporter constructs containing either the -217A or -217G allele by transient transfection in HepG2 cells. The results of our experiments have shown that overexpression of C/EBPbeta in the presence or absence of IL-6 or IL-6 alone increased the overall promoter activities of reporter constructs pHAGT1.3luc(-217A) and pHAGT303luc(-217A) compared with pHAGT1.3luc(-217G) and pHAGT303luc(-217G), respectively. In addition, our data show that treatment of cells with IL-6 enhanced the promoter activity of the -217A variant, particularly in the case of overexpressed C/EBPbeta . Because IL-6 and C/EBPbeta enhanced expression of the human AGT gene together, our data suggest that modification of C/EBPbeta or another interacting factor by IL-6 is involved in selective up-regulation of the -217A variant of this gene.

The AGT gene is primarily expressed in liver and adipose tissue, and C/EBP family transcription factors play a crucial role in regulating expression of a number of genes in these tissues. C/EBPs are a family of leucine zipper transcription factors involved in the regulation of various aspects of cellular differentiation and function (28, 29). Six different members of this family have been identified, all sharing a strong homology in the carboxyl-terminal region (which carries a basic DNA-binding domain) and a leucine zipper motif (30-32). The leucine zipper is a heptad of leucine repeats that intercalate with repeats of the dimerization partner, forming a coil of alpha -helices in parallel orientation (33, 34). This dimerization is essential for binding of C/EBP family transcription factors to cis-acting DNA elements.

AGT is an acute-phase protein, and its expression is increased by lipopolysaccharide, IL-6, and glucocorticoid treatment (35-38). An acute-phase response unit located between nucleotides -470 and -554 has been identified in the rat AGT gene (39). This region of the promoter contains a composite NF-kappa B- and C/EBP-binding site located between nucleotides -531 and -557, a full GRE located between nucleotides -570 and -584, and a half-GRE located between nucleotides -470 and -477. All of these sites are required for a maximum acute-phase response of this gene. Although expression of both rat and human AGT genes is increased in response to the acute-phase reaction, the acute-phase response unit observed in the rat gene promoter is absent in the human gene promoter. Similarly, the nucleotide sequence around the A/G polymorphic site at -217 of the human AGT gene is not conserved in the rat gene. We have previously shown that the sequence located between nucleotides -99 and -91 of the human AGT gene binds to C/EBP family transcription factors and that this region of the promoter plays an important role in DBP- and C/EBPbeta -induced expression of this gene (23). We have also shown that the CREB binds to the sequence located between nucleotides -840 and -830 of the human AGT gene and that this sequence is involved in cAMP-induced expression of the human AGT gene (40). It has been shown previously that the human AGT gene has a C/A polymorphic site at -20 (located between the TATA box and the transcriptional initiation site) (9). We have shown that the upstream stimulatory factor binds to this sequence when nucleoside C is present at -20 and that the estrogen receptor binds to this sequence when nucleoside A is present at -20 (41). The orphan receptor Arp-1 also binds to this sequence and reduces estrogen receptor-induced promoter activity (42). Yanai et al. (43) have shown that the nucleotide sequence located between the TATA box and the transcriptional initiation site of the human AGT gene binds to the upstream stimulatory factor and plays a critical role in its expression. They have also shown that the liver-enriched transcription factor HNF-4 binds to the human AGT gene promoter and regulates expression of this gene in hepatocytes (44). In addition, we have shown that the liver-enriched transcription factor HNF-3 binds to the sequence located between nucleotides +10 and +20 of the human AGT gene promoter (45). All of these transcription factors, including C/EBP (which differentially binds to the A/G polymorphic site at -217), may interact with the transcriptional coactivator CBP and coordinately regulate expression of this gene.

In conclusion, our data suggest that an A/G polymorphism at -217 of the human AGT gene (which affects the binding of C/EBP family transcription factors and affects the basal promoter activity of the human AGT gene) may be involved in essential hypertension in the African-American population. So far, we have analyzed only DNA from members of the African-American population in the New York area, and it will be important to extend these studies to African-American populations living in other areas. It is important to mention that hypertension is a complex multigenic disease and that other genes may also be involved in the etiology of this disease. Future studies will help us understand the mechanism involved in increased expression of the -217A variant of this gene.

    ACKNOWLEDGEMENTS

We thank Drs. P. F. Johnson and Steven McKnight for C/EBP expression vectors and Dr. U. Schibler for the DBP expression vector. We thank hypertensive patients and normotensive controls for providing blood samples for this study.

    FOOTNOTES

* This work was supported by NHLBI Research Grants HL49884 and HL59547 (to A. K.) and HG00008 (to J. O.) from the National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

** To whom correspondence should be addressed: Dept. of Pathology, New York Medical College, Basic Science Bldg., Rm. 455, Valhalla, NY 10595. Tel.: 914-594-4398; Fax: 914-594-4163; E-mail: ashok_kumar@nymc.edu.

Published, JBC Papers in Press, July 26, 2002, DOI 10.1074/jbc.M204732200

2 Available at lewis.eeb.uconn.edu/lewishome/software.html.

    ABBREVIATIONS

The abbreviations used are: AGT, angiotensinogen; C/EBP, CAAT/enhancer-binding protein; IL-6, interleukin-6; NF, nuclear factor; HNF, hepatocyte nuclear factor; OR, odds ratio; CREB, cAMP-responsive element-binding protein; CBP, CREB-binding protein; DBP, D-element-binding protein; GRE, glucocorticoid-response element; MSV, murine sarcoma virus.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Burt, V. L., Whelton, P., Roccella, E. J., Brown, C., Cutler, J. A., Higgins, M., Horan, M. J., and Labarthe, D. (1995) Hypertension 25, 305-313[Abstract/Free Full Text]
2. Kannel, W. B. (2000) Am. J. Cardiol. 85, 251-255[CrossRef][Medline] [Order article via Infotrieve]
3. Mosterd, A., D'Agostino, R. B., Silbershatz, H., Sytkowski, P. A., Kannel, W. B., Grobbee, D. E., and Levy, D. (1999) N. Engl. J. Med. 340, 1221-1227[Abstract/Free Full Text]
4. Corvol, P., Jeunemaitre, X., Charru, A., Kotelevtsev, Y., and Soubrier, F. (1995) Recent Prog. Horm. Res. 50, 287-308[Medline] [Order article via Infotrieve]
5. Corvol, P., and Jeunemaitre, X. (1997) Endocr. Rev. 18, 662-677[Abstract/Free Full Text]
6. Campbell, D. J., and Habener, J. F. (1986) J. Clin. Invest. 78, 31-39[Medline] [Order article via Infotrieve]
7. Campbell, D. J., and Habener, J. F. (1987) Endocrinology 121, 1616-1626[Abstract]
8. Carson, P., Giles, T., Higginbotham, M., Hollenberg, N., Kannel, W., and Siragy, H. M. (2001) Clin. Cardiol. 24, 183-190[Medline] [Order article via Infotrieve]
9. Jeunemaitre, X., Soubrier, F., Kotelevtsev, Y. V., Lifton, R. P., Williams, C. S., Charru, A., Hunt, S. C., Hopkins, P. N., Williams, R. R., Lalouel, J. M., and Corvol, P. (1992) Cell 71, 169-180[CrossRef][Medline] [Order article via Infotrieve]
10. Hata, A., Namikawa, C., Sasaki, M., Sato, K., Nakamura, T., Tamura, K., and Lalouel, J. M. (1994) J. Clin. Invest. 93, 1285-1287[Medline] [Order article via Infotrieve]
11. Soubrier, F., Jeunemaitre, X., Rigat, B., Houot, A. M., Cambien, F., and Corvol, P. (1990) Hypertension 16, 712-717[Abstract/Free Full Text]
12. Jeunemaitre, X., Lifton, R. P., Hunt, S. C., Williams, R. R., and Lalouel, J. M. (1992) Nat. Genet. 1, 72-75[CrossRef][Medline] [Order article via Infotrieve]
13. Bonnardeaux, A., Davies, E., Jeunemaitre, X., Fery, I., Charru, A., Clauser, E., Tiret, L., Cambien, F., Corvol, P., and Soubrier, F. (1994) Hypertension 24, 63-69[Abstract/Free Full Text]
14. Inoue, I., Nakajima, T., Williams, C. S., Quackenbush, J., Puryear, R., Powers, M., Cheng, T., Ludwig, E. H., Sharma, A. M., Hata, A., Jeunemaitre, X., and Lalouel, J. M. (1997) J. Clin. Invest. 99, 1786-1797[Medline] [Order article via Infotrieve]
15. Cooper, R., Forrester, T., Ogunbiyi, O., and Muffinda, J. (1998) J. Hypertens. 16, 571-575[CrossRef][Medline] [Order article via Infotrieve]
16. Manatunga, A. K., Jones, J. J., and Pratt, J. H. (1993) Hypertension 22, 84-89[Abstract/Free Full Text]
17. Bloem, L. J., Manatunga, A. K., Tewksbury, D. A., and Pratt, J. H. (1995) J. Clin. Invest. 95, 948-953[Medline] [Order article via Infotrieve]
18. Bloem, L. J., Foroud, T. M., Ambrosius, W. T., Hanna, M. P., Tewksbury, D. A., and Pratt, J. H. (1997) Hypertension 29, 1078-1082[Abstract/Free Full Text]
19. Caulfield, M., Lavender, P., Newell Price, J., Farrall, M., Kamdar, S., Daniel, H., Lawson, M., De, Freitas, P., Fogarty, P., and Clark, A. J. (1995) J. Clin. Invest. 96, 687-692[Medline] [Order article via Infotrieve]
20. Rotimi, C., Morrison, L., Cooper, R., Oyejide, C., Effiong, E., Ladipo, M., Osotemihen, B., and Ward, R. (1994) Hypertension 24, 591-594[Abstract/Free Full Text]
21. Fukamizu, A., Takahashi, S., Seo, M. S., Tada, M., Tanimoto, K., Uehara, S., and Murakami, K. (1990) J. Biol. Chem. 265, 7576-7582[Abstract/Free Full Text]
22. Gaillard, I., Clauser, E., and Corvol, P. (1989) DNA (N. Y.) 8, 87-99[Medline] [Order article via Infotrieve]
23. Narayanan, C. S., Cui, Y., and Kumar, A. (1998) Biochem. Biophys. Res. Commun. 251, 388-393[CrossRef][Medline] [Order article via Infotrieve]
24. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11, 1475-1489[Abstract/Free Full Text]
25. Lee, Y. H., Williams, S. C., Baer, M., Sterneck, E., Gonzalez, F. J., and Johnson, P. F. (1997) Mol. Cell. Biol. 17, 2038-2047[Abstract]
26. Farzaneh-Far, A., Davies, J. D., Braam, L. A., Spronk, H. M., Proudfoot, D., Chan, S. W., O'Shaughnessy, K. M., Weissberg, P. L., Vermeer, C., and Shanahan, C. M. (2001) J. Biol. Chem. 276, 32466-32473[Abstract/Free Full Text]
27. Wuarin, J., and Schibler, U. (1990) Cell 63, 1257-1266[CrossRef][Medline] [Order article via Infotrieve]
28. Lekstrom-Himes, J., and Xanthopoulos, K. G. (1998) J. Biol. Chem. 273, 28545-28548[Abstract/Free Full Text]
29. Wu, Z., Puigserver, P., and Spiegelman, B. M. (1999) Curr. Opin. Cell Biol. 11, 689-694[CrossRef][Medline] [Order article via Infotrieve]
30. Umek, R. M., Friedman, A. D., and McKnight, S. L. (1991) Science 251, 288-292[Abstract/Free Full Text]
31. Williams, S. C., Cantwell, C. A., and Johnson, P. F. (1991) Genes Dev. 5, 1553-1567[Abstract/Free Full Text]
32. Vinson, C. R., Sigler, P. B., and McKnight, S. L. (1989) Science 246, 911-916[Abstract/Free Full Text]
33. Landschulz, W. H., Johnson, P. F., and McKnight, S. L. (1989) Science 243, 1681-1688[Abstract/Free Full Text]
34. Cao, Z., Umek, R. M., and McKnight, S. L. (1991) Genes Dev. 5, 1538-1552[Abstract/Free Full Text]
35. Kalinyak, J. E., and Perlman, A. J. (1987) J. Biol. Chem. 262, 460-464[Abstract/Free Full Text]
36. Ohtani, R., Yayama, K., Takano, M., Itoh, N., and Okamoto, H. (1992) Endocrinology 130, 1331-1338[Abstract]
37. Takahashi, S., Fukamizu, A., Sugiyama, F., Kajiwara, N., Yagami, K., and Murakami, K. (1992) J. Vet. Med. Sci. 54, 367-369[Medline] [Order article via Infotrieve]
38. Takano, M., Itoh, N., Yayama, K., Yamano, M., Ohtani, R., and Okamoto, H. (1993) Biochem. Pharmacol. 45, 201-206[CrossRef][Medline] [Order article via Infotrieve]
39. Brasier, A. R., Han, Y., and Sherman, C. T. (1999) Vitam. Horm. 57, 217-247[Medline] [Order article via Infotrieve]
40.