Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M106339200 on November 26, 2001

J. Biol. Chem., Vol. 277, Issue 4, 2695-2701, January 25, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/4/2695    most recent
M106339200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gilbert, L.
Right arrow Articles by Nanes, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gilbert, L.
Right arrow Articles by Nanes, M. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Expression of the Osteoblast Differentiation Factor RUNX2 (Cbfa1/AML3/Pebp2alpha A) Is Inhibited by Tumor Necrosis Factor-alpha *

Linda GilbertDagger , Xiaofei HeDagger , Paul FarmerDagger , Janet RubinDagger , Hicham Drissi§, Andre J. van Wijnen§, Jane B. Lian§, Gary S. Stein§, and Mark S. NanesDagger

From the Dagger  Division of Endocrinology and Metabolism, Emory University School of Medicine and Atlanta Veterans Affairs Medical Center, Atlanta, Georgia 30033 and the § Department of Cell Biology, University of Massachusetts Medical School, Worcester, Massachusetts 01655

Received for publication, July 6, 2001, and in revised form, October 17, 2001


    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The transcription factor RUNX2 (Cbfa1/AML3/Pebp2alpha A) is a critical regulator of osteoblast differentiation. We investigated the effect of the inflammatory cytokine tumor necrosis factor alpha  (TNF) on the expression of RUNX2 because TNF is known to inhibit differentiation of osteoblasts from pluripotent progenitor cells. TNF treatment of fetal calvaria precursor cells or MC3T3-E1 clonal pre-osteoblastic cells caused a dose-dependent suppression of RUNX2 steady state mRNA as measured by reverse transcription-PCR. The IC50 for TNF inhibition was 0.6 ng/ml. TNF suppression of RUNX2 mRNA was confirmed using Northern analysis. The effect of TNF was studied using isoform-specific primers that flanked unique regions of two major RUNX2 isoforms. TNF suppressed expression of the mRNA coding for the shorter MRIPV isoform by >90% while inhibiting expression of the mRNA for the longer MASNS isoform by 50%. RUNX2 nuclear content was evaluated by electrophoretic mobility shift assay using a rat osteocalcin promoter binding sequence as probe and by Western analysis. TNF reduced nuclear RUNX2 protein. Inhibition of new protein synthesis with cycloheximide failed to prevent TNF inhibition of RUNX2 mRNA, suggesting that a newly translated protein did not mediate the TNF effect. RUNX2 mRNA half-life was 1.8 h and reduced to 0.9 h by TNF. The effect of TNF on RUNX2 gene transcription was evaluated using a 0.6-kb RUNX2 promoter-luciferase reporter in MC3T3-E1 cells. TNF caused a dose-dependent inhibition of transcription to 50% of control values. The inhibitory effect of TNF was preserved with deletions to nucleotide -108 upstream of the translational start site; however, localization downstream of nucleotide -108 was obscured by loss of basal activity. Our results indicate that TNF regulates RUNX2 expression at multiple levels including destabilization of mRNA and suppression of transcription. The disproportionate inhibition of RUNX2 nuclear protein suggests that additional post-transcriptional mechanisms may be occurring. Suppression of RUNX2 by TNF may decrease osteoblast differentiation and inhibit bone formation in TNF excess states.


    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

The inflammatory cytokine tumor necrosis factor-alpha (TNF)1 has been shown to contribute to bone loss through a variety of mechanisms that increase bone resorption and decrease bone formation. TNF has a major role as an inflammatory mediator in rheumatoid arthritis where increased bone resorption causes periarticular bone loss, and in postmenopausal osteoporosis in which there is generalized bone loss (1-5). In addition to the effects of TNF on bone resorption, TNF also inhibits the bone-forming function of osteoblasts. In mature osteoblasts TNF inhibits the expression of the skeletal matrix proteins type I collagen and osteocalcin, causes resistance to the genomic action of 1,25-dihydroxyvitamin D3, and increases the production of matrix metalloproteinases and pathologic paracrine factors (6-11). We have shown previously that TNF inhibits the differentiation of new osteoblasts from precursor cells (12). In the presence of low concentrations of TNF, fetal calvaria precursor cells fail to form a mineralized matrix or to express the bone-specific osteocalcin gene. Similarly, clonal MC3T3-E1 cells, which spontaneously differentiate to the osteoblast phenotype, remain undifferentiated after TNF treatment and fail to form a matrix that is competent for mineralization.

Osteoblasts differentiate from pluripotent precursor cells that have the capacity to become adipocytes, skeletal muscle cells, tendon, or fibroblasts (13-17). During differentiation, a program of gene expression occurs that is characterized by sequential steps of proliferation, phenotype selection, skeletal gene expression, and finally apoptosis (18). A number of hormonal, paracrine, and autocrine signals regulate the steps that promote differentiation along an osteoblastic trajectory, rather than the selection of other cell phenotypes. The way in which TNF inhibits the program of osteoblast differentiation is unknown but could involve suppression of a critical regulator.

RUNX2 (Cbfa1/AML3/Pebp2alpha A) is a runt related transcription factor that is essential for osteoblast differentiation (19-22). RUNX2 regulates the expression of several osteoblastic genes including alpha 1(I)collagen, osteopontin, bone sialoprotein, and the skeletal-specific osteocalcin gene (23, 24). The binding of nuclear RUNX2 to osteoblast-specific elements up-regulates skeletal genes and consequently the osteoblast phenotype. Mice engineered as nullizygous for both RUNX2 alleles are born with a completely cartilaginous skeleton (21). These experiments established the requirement for RUNX2 in osteoblast differentiation during embryogenesis. Studies in cultured cells suggest that RUNX2 expression is regulated by bone morphogenic proteins and transforming growth factor-beta . In addition, glucocorticoids may modulate RUNX2 at the levels of mRNA and protein expression (25-30). In the adult, osteoblasts are recruited from pluripotent stem cells during a continuous remodeling and repair process that recapitulates ontogenic events; thus, factors that regulate RUNX2 are important during development and in the mature skeleton. Here we hypothesize that TNF inhibits osteoblast differentiation, in part, through suppression of RUNX2 expression. The regulation of RUNX2 by TNF could diminish recruitment of osteoblast precursors into the pool of mature bone-forming cells and contribute toward inhibition of bone formation in TNF-excess states such as rheumatoid arthritis and menopause.

    MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Reagents-- Reagents were obtained from the following sources: Human TNF was purchased from PeproTech, Inc. (Rocky Hill, NJ), EffecteneTM transfection reagent from Qiagen Inc. (Valencia, CA), types I and II collagenase from Worthington Biochemical Corp. (Lakewood, NJ), and Earle's minimum essential medium (MEM) from Invitrogen. Heat-inactivated fetal bovine serum was purchased from HyClone Laboratories (Logan, UT), Dulbecco's phosphate-buffered saline (without calcium and magnesium; calcium/magnesium-free D-PBS), trypsin/Versene, sodium bicarbonate solution, HEPES, and penicillin/streptomycin were purchased from BioWhittaker, Inc. (Walkersville, MD). BGJb (Fitton-Jackson modification) was from either Invitrogen (liquid medium) or Sigma (powdered medium). Other cell culture reagents, actinomycin-D-mannitol, and cycloheximide (CHX) were purchased from Sigma. TRIzol® reagent was purchased from Invitrogen. Galacto-StarTM beta -galactosidase reporter gene assay system was purchased from Tropix (Bedford, MA), and the luciferase assay system was from Promega (Madison, WI). The protein assay dye reagent was purchased from Bio-Rad, and bovine serum albumin solution for standards was from Pierce. T4 polynucleotide kinase was purchased from Promega. Primers for RT-PCR and oligomeric probes for Northern analysis and electromobility shift assays were synthesized by the Emory University Microchemical Facility (Atlanta, GA). Zeta-Probe Membranes were purchased from Bio-Rad. Hybond-P polyvinylidene difluoride membrane, [gamma -32P]ATP, and [alpha -32P]dCTP were purchased from Amersham Biosciences Inc. GeneAmp® RNA PCR core kits were purchased from PE Biosystems (Foster City, CA). Antibodies for Western blots and electromobility shift assays were obtained from Oncogene (La Jolla, CA). Tween 20 was obtained from J.T. Baker (Phillipsburg, NJ). The plasmid carrying the rat Cbfa1/RUNX2 (-600) promoter construct with a luciferase reporter and its deletion constructs have been described previously (31). The reporter includes the native TATA, cap site, first ATG (MLHSP start site), and 5'-untranslated sequence ending at the second ATG (MASNS start site). The pSV40beta -galactosidase plasmid was purchased from Promega.

Fetal Rat Calvaria Cultures-- The Emory University and Veterans Affairs Medical Center animal use committee approved all procedures. Timed pregnant Sprague-Dawley rats were obtained from Charles River Laboratories (Wilmington, MA). Cultures of primary and secondary fetal rat calvaria cells were prepared as described previously (12).

MC3T3-E1 Cell Cultures-- The clonal osteoblastic cell line MC3T3-E1, clone 14, was kindly provided by Dr. Rene Franceschi (University of Michigan, Ann Arbor, MI). This cell line has been described extensively (32). Stock cultures were grown in MEM + 10% FBS without L-ascorbate to maintain the cells in an undifferentiated state. For experiments, cells were plated in MEM + 10% FBS and differentiation was initiated by adding 50 µg/ml L-ascorbate at the desired time and 10 mM beta -glycerophosphate on day 8 to promote mineralization.

Northern Analysis and RT-PCR-- Total cellular RNA was prepared from fetal rat calvaria or MC3T3-E1 cultures by adding TRIzol® (1 ml/well of a six-well plate or 1 ml/60-mm plate) to lyse the cells. Chloroform was added (0.2 ml/sample) to separate the aqueous and organic phases, followed by precipitation of the RNA with isopropanol (0.5 ml/sample). Northern analysis for RUNX2 was carried out by fractionating total RNA in a 2.2 M formaldehyde gel followed by capillary transfer to Zeta-Probe membrane. Cbfa1/RUNX2 mRNA species were detected using a cDNA probe spanning the mouse RUNX2 sequence nucleotides 670:1050 that included the RUNT homology domain (GenBankTM accession no. AF010284) after random primer labeling with [32P]dCTP. Membranes were stripped and re-hybridized with a human glyceraldehyde-3-phosphate dehydrogenase cDNA probe. mRNA band intensity was quantitated using a Storm PhosphorImager (Molecular Dynamics, Sunnyvale, CA) and results were calculated for each time point as RUNX2/glyceraldehyde-3-phosphate dehydrogenase and normalized to the control sample. Semiquantitative RT-PCR was carried out using 0.5 µg of total cellular RNA/reaction. Preliminary experiments determined the optimum PCR cycle number within the linear range of amplification for each gene being measured. The primers used are shown in Table I. [32P]dCTP-labeled PCR products were separated by electrophoresis on a 15% polyacrylamide gel. Results were quantitated using the PhosphorImager and corrected for 18 S RNA amplified from the same samples in the PCR reaction. The following primers were used for RT-PCR. Primers spanning the conserved RUNT homology domain used for RUNX2 semiquantitative PCR (5'>3') were Cbfa1 forward (CCAGATGGGACTGTGGTTACC) and Cbfa1 reverse (ACTTGGTGCAGAGTTCAGGG). Isoform-specific primers as labeled in Fig. 3 were P1/MASNS isoform forward primer 1 (ATGCTTCATTCGCCTCACAAAC), reverse primer 2 (AGTCCCTCCTTTTTTTTCCAG), and P2/MRIPV isoform forward primer 5 (ATGCGTATTCCTGTAGATCCGAG) and reverse primer 6 (CATCATTCCCGGCCATGACGGTAAC).

Transient Transfection and Transcription Assays-- MC3T3-E1 cells were plated at 200,000 cells/2.0 ml/well in six-well plates in MEM + 10% FBS (3 wells/group; plating = day 0). Cultures were transiently transfected on day 1 using Effectene according to the following protocol. The medium was aspirated, each well was washed once with 1.5 ml of calcium/magnesium-free D-PBS, and MEM + 10% FBS (2.0 ml/well) was added to each well. Transfection mixtures for each well contained 0.55 µg of pCbfa1(-600)LUC (the RUNX2 promoter reporter), 0.125 µg of pSV40beta -Gal, and an amount of filler plasmid to equalize total DNA/well to 0.8 µg. Plasmids were diluted into Qiagen Buffer EC to bring the total volume to 100 µl for each well, and 6.4 µl of Enhancer and 8 µl of Effectene were added to the mixtures according to the manufacturer's instructions. MEM + 10% FBS (0.5 ml/well) was added to each reaction mixture and the transfection mix was applied dropwise to each well while swirling the plate. TNF was added 3 h after transfection without removing the transfection mixture. The medium was changed on day 2, adding MEM + 10% FBS and fresh TNF. Cell lysates were prepared on day 3 by aspirating the medium, washing each well once with 1.5 ml of calcium/magnesium-free D-PBS, and adding 150 µl of 100 mM potassium phosphate, pH 7.8, 0.2% Triton X-100, 0.5 mM DTT. Lysates were frozen at -70 °C. After thawing, the lysates were centrifuged at 13,000 × g for 4 min at 4 °C. The supernatants were assayed for luciferase and beta -galactosidase according to the instructions provided with the reagent kit for each enzyme.

Electromobility Shift Assays-- Nuclear extracts of MC3T3-E1 cells were prepared by sequential hypotonic cell lysis and high salt extraction of nuclei as described previously (33). Extracts were stored at -70 °C in single use aliquots. Protein was measured using the Bio-Rad version of the Bradford dye-binding assay with bovine serum albumin as the standard. Double-stranded DNA probes were end-labeled using T4 polynucleotide kinase and [gamma -32P]ATP. Binding of nuclear proteins to the labeled DNA probes was carried out using standard gel shift methods and detected using autoradiography (33).

Western Blots-- Nuclear extracts (5 µg protein/lane) were separated by SDS-PAGE under reducing conditions using a 10% acrylamide gel and a discontinuous buffer system and proteins were electrotransferred to polyvinylidene difluoride membranes. The Western blot was developed using the standard protocol for the ECL Plus immunodetection kit. The AML-3 (RUNX2) primary antibody (no cross-reactivity to AML-1 or AML-2) was diluted to 2.5 µg/ml in the ECL Plus blocking solution, and donkey anti-rabbit IgG-horseradish peroxidase was diluted to 1:5000 in calcium/magnesium-free D-PBS + 0.1% Tween 20. The reactive protein bands were detected using the fluorescence-scanning feature of the Storm PhosphorImager.

Statistics-- Analysis of variance was used to determine statistical differences between groups. Multiple comparisons between individual groups were assessed by the method of Tukey. Comparisons of multiple groups to a single control were done according to the method of Dunnet. For comparison of mRNA half-life curves, replicate values from control or TNF-treated groups were compared at single time points by Student's t test. Data were also analyzed after transformation of the exponential decay to the natural logarithmic value. The resulting linear equations were used for statistical evaluation by comparison of the 95% confidence intervals of the slopes. In legends, p = NS indicates not significant (p >=  0.05).

    RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Fetal rat calvaria cells derived from day 21 of gestation differentiate to osteoblasts over 14 days in culture with formation of discrete nodules, mineralization, and expression of the skeletal-specific osteocalcin gene (12, 14, 34-36). These cultures express RUNX2 by day 7. Steady state mRNA levels of RUNX2 were determined by semiquantitative RT-PCR using primers flanking the highly conserved RUNT homology domain. Fig. 1A shows that treatment of fetal rat calvaria cells with TNF (10 ng/ml), a dose shown previously to completely inhibit differentiation in these cells, caused a 50% decline in RUNX2 mRNA by 24 h. The inhibitory effect of TNF on RUNX2 mRNA was confirmed by Northern analysis of the sample as shown in Fig. 1B.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 1.   A, TNF inhibition of RUNX2 mRNA in fetal calvaria cells. Cells were isolated from day 21 fetal calvaria, and secondary cultures were treated with TNF (10 ng/ml) on day 7. RNA was isolated at the indicated times, and RUNX2 mRNA was determined by semiquantitative RT-PCR. Results are mean ± S.E. of RUNX2/18 S signal for n = 3/group. *, p < 0.05 compared with 0 h by analysis of variance. B, Northern analysis of RUNX2 mRNA from cells treated identically as above confirming TNF inhibition of steady state RUNX2 mRNA by 4 h. C, control; T, TNF (10 ng/ml). Arrows indicate the major RUNX2 species and 18 S RNA.

To further define the molecular mechanism of TNF action on RUNX2 expression, we utilized the clonal preosteoblast cell line MC3T3-E1. This cell line expresses RUNX2 within 48 h of plating and becomes phenotypically osteoblastic after 14 days in culture. Fig. 2A shows the dose-dependent inhibition of RUNX2 mRNA expression by TNF, as measured by RT-PCR. The IC50 for TNF inhibition of RUNX2 was 0.6 ng/ml. TNF inhibition of RUNX2 was associated with inhibition of mineralization of the cultures, as shown in Fig. 2B and reported previously (12). TNF suppressed RUNX2 in MC3T3-E1 cells 70% (range 50-80% in four experiments).


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 2.   A, TNF inhibits RUNX2 mRNA in MC3T3-E1 pre-osteoblastic cells. Dose-response effect of TNF inhibition of steady state RUNX2/18 S mRNA. Cells were plated at day 0 and ascorbate added on day 1 to induce differentiation. TNF was added at day 2 in the doses indicated and RNA was isolated 24 h later. *, p < 0.05 versus control (0 ng/ml) by analysis of variance. B, dose-response effect of TNF inhibition of osteoblast differentiation. MC3T3-E1 cells were plated and ascorbate added to cultures on day 1 to induce differentiation. Von Kossa staining for mineral is shown on day 14 of culture for cells grown with the indicated doses of TNF from days 1-14.

Multiple protein isoforms of RUNX2 have been described because of the presence of different translation start sites and additional RNA splice donor/acceptor sites. As illustrated in Fig. 3, there are two major RNA species that are transcribed from two promoters (P1 and P2), and encode two principal isoforms with different N termini (P1/MASNS and P2/MRIPV). Primers specific for the P1 and P2 related mRNAs were constructed to measure the effect of TNF on steady state levels of these two major RUNX2 mRNA isoforms. Fig. 3A shows a map of the two isoforms and the target sequences for primer amplification. The top panel shows the mRNA isoform beginning from the second transcriptional start site (P1/MRIPV), and the lower panel shows the mRNA isoform originating from the first transcriptional start site (P2/MASNS). Fig. 3B shows RT-PCR results for four individual cultures treated with or without TNF (10 ng/ml). We observed that the P1/MASNS mRNA isoform was reduced 50% by TNF treatment. The P2/MRIPV mRNA isoform was reduced >90% (Fig. 3B). We observed two expected bands and one unexpected band using the P1/MASNS-specific primer pair 1/2. The P1/MASNS-related mRNAs indicated in Fig. 3B (labeled b and c) are predicted based on alternative splicing of a micro-exon in the 5'-untranslated region of the P1/MASNS RUNX2 mRNA as reported previously (37). The larger 380-kb band represents an unspliced mRNA species in which intron 1 is retained, preserving the coding sequence in frame. Isolation, subcloning, and direct sequencing confirmed the nucleotide sequence of the bands. The observed bands were not the result of genomic contamination because they were absent when reverse transcriptase was excluded from the reaction mixture. In addition, DNase digestion of the samples failed to eliminate the bands (data not shown). The P2/MRIPV isoform primers yielded the predicted RT-PCR product (Fig. 3B, d). The P2/MRIPV mRNA was strongly inhibited by TNF. TNF had no effect on 18 S RNA. Thus, TNF inhibited expression of both the P1/MASNS and P2/MRIPV mRNA isoforms at an early time point in differentiation. The semiquantitative RT-PCR results suggested that TNF had a more pronounced effect on the P2/MRIPV mRNA isoform.


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 3.   A, structure of the mouse RUNX2 gene showing the two major isoforms and location of primers used to amplify isoform-specific signals. Two promoters (P1, P2) control transcription from each of the two utilized start sites, which results in translation of protein isoforms with beginning amino acid sequences MASNS and MRIPV. The location of sequences complimentary to the PCR primers is shown. Primer sequences are listed under "Materials and Methods." RHD, runt homology domain. B, effect of TNF on steady state levels of RUNX2 mRNA species. MC3T3-E1 cells were treated with or without TNF (10 ng/ml) on day 2 of culture, and RNA was collected 24 h later. RT-PCR was done with primers specific for the major RUNX2 isoforms as shown in A or for 18 S ribosomal RNA as a reference. Results show the RT-PCR signal for the MASNS and MRIPV isoforms and for 18 S as indicated on the left. The first lane shows molecular size markers. MASNS bands a, b, and c represent forms of the mRNA in which the 3'-untranslated mRNA is differentially spliced, as confirmed by direct sequencing. A single expected band is generated for the MRIPV isoform.

To determine whether TNF inhibition of RUNX2 mRNA was associated with a reduction in RUNX2 protein, RUNX2 nuclear content was measured using both EMSA and Western analysis. In this way, we assessed functional RUNX2 binding to DNA and also total RUNX2 nuclear protein. MC3T3-E1 cells were treated with or without TNF (10 ng/ml) for 24 h. Nuclear extract was isolated, and EMSA was done using a 32P-labeled rat osteocalcin OSE2 probe to assess nuclear protein/DNA binding (37). Fig. 4 shows that TNF decreased RUNX2 binding to the probe. RUNX2 binding was decreased after 24 h of TNF treatment but not by 4 h (4 h not shown). The RUNX2 band was supershifted with a specific RUNX2 (AML-3) antibody in control or TNF-treated cells. A control antibody to the closely related AML1 protein did not supershift the bands (data not shown).


View larger version (61K):
[in this window]
[in a new window]
  		Fig. 4.   Effect of TNF on binding of nuclear RUNX2 to the RUNX2 binding sequence of the rat osteocalcin promoter. MC3T3-E1 cells were treated with or without TNF (10 ng/ml) for 24 h, and nuclear extract was prepared as described under "Materials and Methods." Arrows indicate binding of nuclear RUNX2 from control (C) or TNF-treated (T) cells to the probe in lanes 2 and 3, respectively. FP, free probe (no nuclear extract in lane 1). Lanes 4 and 5 show supershift of the RUNX2 bands by a specific RUNX2 antibody (alpha RUNX2), confirming identity.

RUNX2 is a phosphoprotein regulated via the mitogen-activated protein kinase pathway. Because binding of RUNX2 to DNA could be regulated by changes in RUNX2 phosphorylation state rather than quantity, Western analysis of nuclear extracts was done to directly measure RUNX2 nuclear content. Fig. 5 shows that TNF treatment (10 ng/ml) inhibited nuclear RUNX2 protein after 24 h of treatment, but not by 4 h, a finding consistent with results from the EMSA. We found that TNF caused a >90% inhibition of nuclear RUNX2 by Western analysis.


View larger version (54K):
[in this window]
[in a new window]
  		Fig. 5.   Western analysis of nuclear RUNX2. MC3T3-E1 cells were treated with TNF as in Fig. 4. Nuclear extract was obtained at 4 and 24 h and total RUNX2 nuclear content determined as described under "Materials and Methods." Left panel, Western blot using RUNX2 antibody. Right panel, Coomassie staining showing total protein in the nuclear extracts.

TNF could inhibit expression of RUNX2 by affecting mRNA stability or through transcriptional suppression. To determine which of these mechanisms were occurring, the effect of TNF on RUNX2 mRNA stability was measured after treating cells with actinomycin D to inhibit new RNA synthesis. The decay of pre-formed RUNX2 mRNA was measured using RT-PCR in cells pre-treated with TNF for 2 h. Fig. 6 shows that the RUNX2 mRNA has a short half-life calculated as 1.8-2.3 h (range of three experiments). Treatment with TNF caused a decrease in RUNX2 half-life to 0.9 h, which was apparent at 1 h after TNF treatment.


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 6.   TNF decreases RUNX2 mRNA half-life. MC3T3-E1 cells were treated with actinomycin D with or without TNF as described under "Materials and Methods," and total RNA was isolated at 1, 2, 4, and 7 h. RT-PCR of RUNX2 mRNA was done using primers flanking the conserved RUNT homology domain to assess total RUNX2 mRNA remaining at the indicated times. Control, closed circles; TNF, open circles. *, p < 0.05 TNF group versus control, n = 3-5 cultures/group. The results shown were similar in three independent experiments.

To determine whether the inhibitory effect of TNF on RUNX2 steady state mRNA requires new protein synthesis, MC3T3-E1 cells were treated with cycloheximide for 2 h prior to addition of TNF (10 ng/ml, 24 h) and RUNX2 mRNA was measured by RT-PCR. The addition of cycloheximide reduced the steady state mRNA level of RUNX2; however, the concurrent treatment of TNF + cycloheximide still caused a 50% inhibition of RUNX2 mRNA compared with cycloheximide alone (Fig. 7). These results are consistent with a direct effect of TNF (or the TNF-stimulated signal transduction pathway) on the RUNX2 gene without the need for new protein synthesis.


View larger version (10K):
[in this window]
[in a new window]
  		Fig. 7.   TNF inhibition of RUNX2 mRNA is independent of new protein synthesis. MC3T3-E1 cells were treated with or without TNF in the presence or absence of cycloheximide. Total RNA was collected and RT-PCR done for RUNX2 mRNA. TNF, TNF (10 ng/ml); CHX, CHX (5 µg/ml). p < 0.05, control versus TNF. p < 0.05, control + CHX versus TNF + CHX.

The effect of TNF on RUNX2 gene transcription was studied using a reporter that included 0.6 kb of the rat RUNX2 promoter (exon-1 start site) fused to the firefly luciferase gene (-600pCbfa-1LUC). Previous work has shown that this region of the promoter is sufficient to confer transcriptional activation (31). The effect of TNF treatment on the -600pCbfa-1LUC construct is shown in Fig. 8. TNF treatment for 24 h caused a dose dependent inhibition of transcription with an estimated IC50 between 0.1 and 1 ng/ml, similar to the IC50 for TNF inhibition of steady state mRNA and osteoblast differentiation. The effect of 5'-deletions of the promoter on basal transcription is shown in Fig. 9A and confirms the previously described repressor region between -351 to -458 in studies done with ROS 17/2.8 cells (31). The effect of TNF on transcription of -600pCbfa-1LUC deletion constructs is shown in Fig. 9B. It can be seen that the inhibitory effect of TNF (10 ng/ml, 24 h) is observed with deletions to at least nucleotide -108 of the start site. The low basal transcription rate of the constructs between -108 and the start site precluded further mapping of the TNF-responsive region; however, this region appears to be located close to the proximal promoter or in the 5'-untranslated region.


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 8.   TNF inhibition of RUNX2 promoter activity. MC3T3-E1 cells were transiently transfected with the p-600Cbfa-1-LUC reporter and treated with TNF in the indicated doses. Results show mean ± S.E. as percentage of control cultures. Values are corrected for differences in transfection efficiency using a pSV40beta -galactosidase reporter. *, p < 0.05 versus control (0 ng/ml TNF), n = 3/group.


View larger version (22K):
[in this window]
[in a new window]
  		Fig. 9.   A, basal activity of the rat RUNX2 promoter in MC3T3-E1 cells. Cells were transiently transfected with serial deletion constructs of the RUNX2 promoter reporter (pCbfa-1-LUC) compared with the longest promoter fragment (-600 graphed as 100% activity). Deletion constructs shown refer to nucleotides upstream of the MASNS start site. The results show mean ± S.E. activity corrected for transfection efficiency with a pSV40-beta -galactosidase reporter. n = 3 cultures/group. *, p < 0.05 versus -600 construct. B, effect of deletions of the RUNX2 promoter on the inhibitory effect of TNF. MC3T3-E1 cells were treated as in Fig. 8. The results show luciferase activity in TNF-treated cells for each deletion construct of the RUNX2 promoter expressed as a percentage of untreated control cultures. The dashed line indicates the basal activity of the promoter in untreated cells shown as 100%. Mean ± S.E., n = 3 cultures/group. *, p < 0.05 versus -600cbfa-1-LUC.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

Our results show that TNF suppresses the expression of RUNX2 in pre-osteoblastic cells. We considered that TNF could decrease RUNX2 by regulating gene transcription, mRNA stability, protein translation, or compartmentalization and half-life of the protein. Although not addressed here, phosphorylation of RUNX2 may also influence its potency as a transcription factor and potentially its stability (38, 39). We found that the mechanism of TNF inhibition of RUNX2 includes some destabilization of the mRNA and also suppression of transcription, because TNF inhibited activity of the RUNX2 promoter. Transcriptional control of RUNX2 may have rapid effects on RUNX2 availability, given the short half-life of the mRNA.

The RUNX2 promoter has two transcriptional start sites that are regulated by two promoters (P1 and P2). The upstream P1 promoter generates three different mRNA isoforms that differ in micro-splicing events involving a mini-intron in the 5'-untranslated region (40). Two putative translation start sites have been observed for the mRNAs originating from the P1 promoter, and these sites produce proteins starting with MLHSP or MASNS peptides. However, only one of these (MASNS) is efficiently utilized for translation (41), a conclusion corroborated by the observation that high titer antibodies against the MLHSP antibodies fail to detect a protein in osseous cell lysates.2 Thus, our PCR primers detect the two major mRNA transcripts that are translated to MASNS and MRIPV protein isoforms. Additional alternative splicing events in the 3'end of RUNX2 mRNAs may further increase protein diversity and account for other bands generated using the most 3' PCR primers in our studies (42). The MRIPV isoform is regulated by the downstream P2 promoter (44). The MRIPV isoform is more ubiquitously expressed in bone, testes, thymus, and liver but nevertheless retains transcriptional activation potency for a number of skeletal genes (43-45). The role that each isoform has in regulating osteoblast differentiation remains to be determined. The P2/MRIPV isoform appears to be expressed more constitutively and at an early time point in mesenchymal pluripotent precursor cells, whereas expression of the P1/MASNS isoform is increased at a later time as the precursor cells become committed to the osteoblast phenotype (45). Our data show that the levels of expression of both the P1 and P2 promoter products are down-regulated by TNF, but the magnitude of inhibition differs between these mRNA species. The mRNA encoding the P2 (MRIPV) isoform was almost completely inhibited by TNF, whereas the P1 (MASNS) isoform was inhibited only 50%. This differential regulation suggests that the almost complete suppression of the P2/MRIPV form of RUNX2 by TNF blocks selection of the osteoblast phenotype very early in differentiation of the pluripotent precursor cell.

TNF may preferentially inhibit selection of the P2/MRIPV transcriptional start site, a mechanism that would account for the differential mRNA isoform suppression. Alternatively, the different mRNA species could have different half-lives; however, in half-life experiments done using isoform-specific primers, the same decrease in mRNA half-life was observed for both P1 and P2 products after treatment with TNF (data not shown). Our analysis of the P1 promoter reveals that the inhibition of the P1 (MASNS) levels is at least in part mediated by a transcriptional mechanism, reflected by a 2-fold down-regulation of P1 promoter activity following TNF treatment.

Treatment of cells with cycloheximide to inhibit new protein synthesis did not block the effect of TNF on RUNX2 mRNA, suggesting that the effect of TNF on RUNX2 gene transcription does not require synthesis of a new TNF-induced intermediary protein. Rather, TNF may regulate RUNX2 transcription through a more rapid signal cascade that directly influences the RUNX2 promoter. Candidates for TNF-induced signals include activation of NFkappa B, AP-1 transcription factors, or changes in mitogen-activated protein kinases, nitric oxide, signal transducers and activators of transcription, or in the ceramide pathway (46). Determining which of these is involved in RUNX2 regulation will require additional studies.

Using both EMSA and Western analysis, we found that TNF reduced nuclear RUNX2 levels at 24 but not 4 h. Thus, a decrease in nuclear RUNX2 protein follows the decrease in mRNA, as expected. We found a discrepancy between the 50-70% reduction in steady state mRNA, as measured by primers flanking the common RUNT homology domain, and the >90% reduction in nuclear RUNX2 protein, as measured by Western analysis. Because the TNF reduction in nuclear RUNX2 protein was greater than expected compared with the decrease in total RUNX2 mRNA species, TNF may also have post-transcriptional effects. Direct measurement of specific protein isoforms of RUNX2 awaits the availability of isoform-specific antibodies.

The RUNX2 promoter is highly conserved among rat, mouse, and human. The rat distal promoter is 95% homologous to mouse and 94% to human, whereas the proximal rat promoter is 100% homologous to mouse and 97% homologous to the human sequence (31). The major difference in promoter structure between species is variability in the length of two purine-rich regions of unknown function. We studied the effect of TNF on the rat RUNX2 promoter using a reporter that included 0.6 kb of rat DNA sequence upstream of the MASNS translation start site. The 0.6 kb of DNA has been shown to support basal transcription of this promoter and to contain numerous potential regulatory sequences including a repressor region at nucleotides -351 to -458. Negative auto-regulation by RUNX2 is also a feature of this promoter. The promoter contains homologous NFkappa B and AP-1 binding sites located between -500 and -300 that could confer responsiveness to TNF. We found that the basal transcriptional activity in MC3T3-E1 cells was almost identical to that described previously in osteoblastic ROS 17/2.8 cells and similar to the activity in NIH3T3 cells (31). Our data revealed a dose-dependent inhibition of promoter activity by TNF with an IC50 similar to the inhibition of steady state RUNX2 mRNA. Interestingly, the IC50 was also similar to that observed for TNF inhibition of osteoblast differentiation (12). Progressive deletions of the RUNX2 promoter showed that the inhibitory effect of TNF was maintained at least to nucleotide -108 upstream of the start site. These results exclude the NFkappa B and AP-1-like binding sites between nucleotides -500 and -300 as regions that could confer TNF action. Because additional deletions of the more proximal promoter were associated with loss of basal transcriptional activity, we were unable to further localize the TNF-responsive region. Additional studies will be needed to precisely determine a TNF-response sequence.

The level of RUNX2 in the nucleus is a critical determinant for selection of the pathway of osteoblast differentiation. Thus, the suppression of RUNX2 nuclear protein that we observed is likely to be important for differentiating cells. This is supported by the observation that RUNX2 haploinsufficiency, which should be associated with a 50% decrement in RUNX2 protein, is sufficient to cause the disorder cleidocranial dysplasia (47, 48). In postmenopausal osteoporosis, rheumatoid arthritis, and other TNF excess states, TNF may decrease the phenotype selection of precursor cells to the osteoblast pathway. Recent data suggesting that RUNX2 may also stimulate osteoprotegerin, a soluble inhibitor of RANKL-stimulated osteoclastogenesis, suggests that TNF suppression of RUNX2 could decrease bone formation while simultaneously increasing resorption (49).

    ACKNOWLEDGEMENTS

We thank Dr. Rene Franceschi for generously providing the MC3T3-E1 clone 14 cell line and Will Sepp for technical assistance.

    FOOTNOTES

* This work was supported by National Institutes of Health Grant R01 AR46452-01 and a Department of Veterans Affairs Merit Review grant (both to M. S. N.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Div. of Endocrinology and Metabolism, Veterans Affairs Medical Center (111), 1670 Clairmont Rd., Decatur, GA 30033. E-mail: mnanes@emory.edu.

Published, JBC Papers in Press, November 26, 2001, DOI 10.1074/jbc.M106339200

2 A. J. van Wijnen, J. B. Lian, and G. S. Stein, unpublished observations.

    ABBREVIATIONS

The abbreviations used are: TNF, tumor necrosis factor; CHX, cycloheximide; RT, reverse transcription; D-PBS, Dulbecco's phosphate-buffered saline; MEM, minimal essential medium; FBS, fetal bovine serum; EMSA, electrophoretic mobility shift assay.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

1. Ralston, S. H., Russell, R. G., and Gowen, M. (1990) J. Bone Miner. Res. 5, 983-988
2. Pacifici, R., Brown, C., Puscheck, E., Friedrich, E., Slatopolsky, E., Maggio, D., McCracken, R., and Avioli, L. V. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 5134-5138
3. Ammann, P., Rizzoli, R., Bonjour, J. P., Bourrin, S., Meyer, J. M., Vassalli, P., and Garcia, I. (1997) J. Clin. Invest. 99, 1699-1703
4. Kimble, R. B., Bain, S., and Pacifici, R. (1997) J. Bone Miner. Res. 12, 935-941
5. Choy, E. H., and Panayi, G. S. (2001) N. Engl. J. Med. 344, 907-916
6. Centrella, M., McCarthy, T. L., and Canalis, E. (1988) Endocrinology 123, 1442-1448
7. Canalis, E. (1987) Endocrinology 121, 1596-1604
8. Nanes, M. S., McKoy, W. M., and Marx, S. J. (1989) Endocrinology 124, 339-345
9. Nanes, M. S., Rubin, J., Titus, L., Hendy, G. N., and Catherwood, B. (1991) Endocrinology 128, 2577-2582
10. Kuno, H., Kurian, S. M., Hendy, G. N., White, J., deLuca, H. F., Evans, C. O., and Nanes, M. S. (1994) Endocrinology 134, 2524-2531
11. Goldring, S. R., and Gravallese, E. M. (2000) Curr. Opin. Rheumatol. 12, 195-199
12. Gilbert, L., He, X., Farmer, P., Boden, S., Kozlowski, M., Rubin, J., and Nanes, M. S. (2000) Endocrinology 141, 3956-3964
13. Aubin, J. E., and Liu, F. (1996) in Principles of Bone Biology (Bilezikian, J. P. , Raisz, L. G. , and Rodan, G. A., eds) , pp. 51-68, Academic Press, San Diego
14. Aubin, J. E. (1998) Biochem. Cell Biol. 76, 899-910
15. Pittenger, M. F., Mackay, A. M., Beck, S. C., Jaiswal, R. K., Douglas, R., Mosca, J. D., Moorman, M. A., Simonetti, D. W., Craig, S., and Marshak, D. R. (1999) Science 284, 143-147
16. Karsenty, G., Ducy, P., Starbuck, M., Priemel, M., Shen, J., Geoffroy, V., and Amling, M. (1999) Bone 25, 107-108
17. Ducy, P. (2000) Dev. Dyn. 219, 461-471
18. Lian, J. B., and Stein, G. S. (2001) in Osteoporosis (Marcus, R. , Feldman, D. , and Kelsey, J., eds), 2nd Ed. , Academic Press, Stanford, CA
19. Banerjee, C., McCabe, L. R., Choi, J. Y., Hiebert, S. W., Stein, J. L., Stein, G. S., and Lian, J. B. (1997) J. Cell. Biochem. 66, 1-8
20. Ducy, P., Zhang, R., Geoffroy, V., Ridall, A. L., and Karsenty, G. (1997) Cell 89, 747-754
21. Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y., Bronson, R. T., Gao, Y. H., Inada, M., Sato, M., Okamoto, R., Kitamura, Y., Yoshiki, S., and Kishimoto, T. (1997) Cell 89, 755-764
22. Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C., Rosewell, I. R., Stamp, G. W., Beddington, R. S., Mundlos, S., Olsen, B. R., Selby, P. B., and Owen, M. J. (1997) Cell 89, 765-771
23. Ducy, P., Starbuck, M., Priemel, M., Shen, J., Pinero, G., Geoffroy, V., Amling, M., and Karsenty, G. (1999) Genes Dev. 13, 1025-1036
24. Javed, A., Barnes, G. L., Jasanya, B. O., Stein, J. L., Gerstenfeld, L., Lian, J. B., and Stein, G. S. (2001) Mol. Cell. Biol. 21, 2891-2905
25. Tsuji, K., Ito, Y., and Noda, M. (1998) Bone 22, 87-92
26. Lee, M. H., Javed, A., Kim, H. J., Shin, H. I., Gutierrez, S., Choi, J. Y., Rosen, V., Stein, J. L., van Wijnen, A. J., Stein, G. S., Lian, J. B., and Ryoo, H. M. (1999) J. Cell. Biochem. 73, 114-125
27. Gori, F., Thomas, T., Hicok, K. C., Spelsberg, T. C., and Riggs, B. L. (1999) J. Bone Miner. Res. 14, 1522-1535
28. Lee, K. S., Kim, H. J., Li, Q. L., Chi, X. Z., Ueta, C., Komori, T., Wozney, J. M., Kim, E. G., Choi, J. Y., Ryoo, H. M., and Bae, S. C. (2000) Mol. Cell. Biol. 20, 8783-8792
29. Bae, S. C., Lee, K. S., Zhang, Y. W., and Ito, Y. (2001) J. Bone Joint Surg. Am. 83-A Suppl. 1, S48-S55
30. Prince, M., Banerjee, C., Javed, A., Green, J., Lian, J. B., Stein, G. S., Bodine, P. V., and Komm, B. S. (2001) J. Cell. Biochem. 80, 424-440
31. Drissi, H., Luc, Q., Shakoori, R., Chuva De Sousa Lopes, S., Choi, J. Y., Terry, A., Hu, M., Jones, S., Neil, J. C., Lian, J. B., Stein, J. L., Van Wijnen, A. J., and Stein, G. S. (2000) J. Cell. Physiol. 184, 341-350
32. Wang, D., Christensen, K., Chawla, K., Xiao, G., Krebsbach, P. H., and Franceschi, R. T. (1999) J. Bone Miner. Res. 14, 893-903
33. Farmer, P. K., He, X., Schmitz, M. L., Rubin, J., and Nanes, M. S. (2000) Am. J. Physiol. 279, E213-E220
34. McCabe, L. R., Last, T. J., Lynch, M., Lian, J., Stein, J., and Stein, G. (1994) J. Cell. Biochem. 56, 274-282
35. Boden, S. D., Hair, G., Titus, L., Racine, M., McCuaig, K., Wozney, J. M., and Nanes, M. S. (1997) Endocrinology 138, 2820-2828
36. Boden, S. D., McCuaig, K., Hair, G., Racine, M., Titus, L., Wozney, J. M., and Nanes, M. S. (1996) Endocrinology 137, 3401-3407
37. Schinke, T., and Karsenty, G. (1999) J. Biol. Chem. 274, 30182-30189
38. Narayanan, K., Srinivas, R., Ramachandran, A., Hao, J., Quinn, B., and George, A. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 4516-4521
39. Selvamurugan, N., Pulumati, M. R., Tyson, D. R., and Partridge, N. C. (2000) J. Biol. Chem. 275, 5037-5042
40. Xiao, Z. S., Thomas, R., Hinson, T. K., and Quarles, L. D. (1998) Gene (Amst.) 214, 187-197
41. Stewart, M., Terry, A., Hu, M., O'Hara, M., Blyth, K., Baxter, E., Cameron, E., Onions, D. E., and Neil, J. C. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 8646-8651
42. Tsuji, K., and Noda, M. (2000) Biochem. Biophys. Res. Commun. 274, 171-176
43. Ogawa, S., Harada, H., Fujiwara, M., Tagashira, S., Katsumata, T., and Takada, H. (2000) DNA Res. 7, 181-185
44. Xiao, Z. S., Hinson, T. K., and Quarles, L. D. (1999) J. Cell. Biochem. 74, 596-605
45. Banerjee, C., Javed, A., Choi, J. Y., Green, J., Rosen, V., van Wijnen, A. J., Stein, J. L., Lian, J. B., and Stein, G. S. (2001) Endocrinology 142, 4026-4039
46. Aggarwal, B. B. (2000) Ann. Rheum. Dis. 59 Suppl. 1, i6-16
47. Komori, T., and Kishimoto, T. (1998) Curr. Opin. Genet. Dev. 8, 494-499
48. Zhou, G., Chen, Y., Zhou, L., Thirunavukkarasu, K., Hecht, J., Chitayat, D., Gelb, B. D., Pirinen, S., Berry, S. A., Greenberg, C. R., Karsenty, G., and Lee, B. (1999) Hum. Mol. Genet. 8, 2311-2316
49. Thirunavukkarasu, K., Halladay, D. L., Miles, R. R., Yang, X., Galvin, R. J., Chandrasekhar, S., Martin, T. J., and Onyia, J. E. (2000) J. Biol. Chem. 275, 25163-25172

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Rheumatology (Oxford)Home page
D. Morimoto, S. Kuroda, T. Kizawa, K. Nomura, C. Higuchi, H. Yoshikawa, and T. Tomita
Equivalent osteoblastic differentiation function of human mesenchymal stem cells from rheumatoid arthritis in comparison with osteoarthritis
Rheumatology, June 1, 2009; 48(6): 643 - 649.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Gastrointest. Liver Physiol.Home page
L. Harris, P. Senagore, V. B. Young, and L. R. McCabe
Inflammatory bowel disease causes reversible suppression of osteoblast and chondrocyte function in mice
Am J Physiol Gastrointest Liver Physiol, May 1, 2009; 296(5): G1020 - G1029.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. Guo, M. Yamashita, Q. Zhang, Q. Zhou, D. Chen, D. G. Reynolds, H. A. Awad, L. Yanoso, L. Zhao, E. M. Schwarz, et al.
Ubiquitin Ligase Smurf1 Mediates Tumor Necrosis Factor-induced Systemic Bone Loss by Promoting Proteasomal Degradation of Bone Morphogenetic Signaling Proteins
J. Biol. Chem., August 22, 2008; 283(34): 23084 - 23092.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
J. Hewitt, X. Lu, L. Gilbert, and M. S. Nanes
The Muscle Transcription Factor MyoD Promotes Osteoblast Differentiation by Stimulation of the Osterix Promoter
Endocrinology, July 1, 2008; 149(7): 3698 - 3707.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. Yu, Y. Jiang, D. L. Galson, M. Luo, Y. Lai, Y. Lu, H.-J. Ouyang, J. Zhang, and G. Xiao
General Transcription Factor IIA-{gamma} Increases Osteoblast-specific Osteocalcin Gene Expression via Activating Transcription Factor 4 and Runt-related Transcription Factor 2
J. Biol. Chem., February 29, 2008; 283(9): 5542 - 5553.
[Abstract] [Full Text] [PDF]

Home page
 Stem CellsHome page
K. J. Manton, D. F. M. Leong, S. M. Cool, and V. Nurcombe
Disruption of Heparan and Chondroitin Sulfate Signaling Enhances Mesenchymal Stem Cell-Derived Osteogenic Differentiation via Bone Morphogenetic Protein Signaling Pathways
Stem Cells, November 1, 2007; 25(11): 2845 - 2854.
[Abstract] [Full Text] [PDF]

Home page
 Rheumatology (Oxford)Home page
X. Baraliakos, J. Listing, J. Brandt, H. Haibel, M. Rudwaleit, J. Sieper, and J. Braun
Radiographic progression in patients with ankylosing spondylitis after 4 yrs of treatment with the anti-TNF-{alpha} antibody infliximab
Rheumatology, September 1, 2007; 46(9): 1450 - 1453.
[Abstract] [Full Text] [PDF]

Home page
 J. Clin. Endocrinol. Metab.Home page
Z.-H. Tang, P. Xiao, S.-F. Lei, F.-Y. Deng, L.-J. Zhao, H.-Y. Deng, L.-J. Tan, H. Shen, D.-H. Xiong, R. R. Recker, et al.
A Bivariate Whole-Genome Linkage Scan Suggests Several Shared Genomic Regions for Obesity and Osteoporosis
J. Clin. Endocrinol. Metab., July 1, 2007; 92(7): 2751 - 2757.
[Abstract] [Full Text] [PDF]

Home page
 PediatricsHome page
M. B. Leonard
Glucocorticoid-Induced Osteoporosis in Children: Impact of the Underlying Disease
Pediatrics, March 1, 2007; 119(Supplement_2): S166 - S174.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
X. Lu, L. Gilbert, X. He, J. Rubin, and M. S. Nanes
Transcriptional Regulation of the Osterix (Osx, Sp7) Promoter by Tumor Necrosis Factor Identifies Disparate Effects of Mitogen-activated Protein Kinase and NF{kappa}B Pathways
J. Biol. Chem., March 10, 2006; 281(10): 6297 - 6306.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
H. Kaneki, R. Guo, D. Chen, Z. Yao, E. M. Schwarz, Y. E. Zhang, B. F. Boyce, and L. Xing
Tumor Necrosis Factor Promotes Runx2 Degradation through Up-regulation of Smurf1 and Smurf2 in Osteoblasts
J. Biol. Chem., February 17, 2006; 281(7): 4326 - 4333.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Renal Physiol.Home page
K. K. Frick, K. LaPlante, and D. A. Bushinsky
RANK ligand and TNF-{alpha} mediate acid-induced bone calcium efflux in vitro
Am J Physiol Renal Physiol, November 1, 2005; 289(5): F1005 - F1011.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
G. Xiao, D. Jiang, C. Ge, Z. Zhao, Y. Lai, H. Boules, M. Phimphilai, X. Yang, G. Karsenty, and R. T. Franceschi
Cooperative Interactions between Activating Transcription Factor 4 and Runx2/Cbfa1 Stimulate Osteoblast-specific Osteocalcin Gene Expression
J. Biol. Chem., September 2, 2005; 280(35): 30689 - 30696.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Endocrinol. Metab.Home page
L. C. Gilbert, J. Rubin, and M. S. Nanes
The p55 TNF receptor mediates TNF inhibition of osteoblast differentiation independently of apoptosis
Am J Physiol Endocrinol Metab, May 1, 2005; 288(5): E1011 - E1018.
[Abstract] [Full Text] [PDF]

Home page
 EndocrinologyHome page
C. J. Jagger, J. M. Lean, J. T. Davies, and T. J. Chambers
Tumor Necrosis Factor-{alpha} Mediates Osteopenia Caused by Depletion of Antioxidants
Endocrinology, January 1, 2005; 146(1): 113 - 118.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
M. Qiao, P. Shapiro, R. Kumar, and A. Passaniti
Insulin-like Growth Factor-1 Regulates Endogenous RUNX2 Activity in Endothelial Cells through a Phosphatidylinositol 3-Kinase/ERK-dependent and Akt-independent Signaling Pathway
J. Biol. Chem., October 8, 2004; 279(41): 42709 - 42718.
[Abstract] [Full Text] [PDF]

Home page
 GENES CELLSHome page
T. Nakamoto, A. Shiratsuchi, H. Oda, K. Inoue, T. Matsumura, M. Ichikawa, T. Saito, S. Seo, K. Maki, T. Asai, et al.
Impaired spermatogenesis and male fertility defects in CIZ/Nmp4-disrupted mice
Genes Cells, June 1, 2004; 9(6): 575 - 589.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
Z.-S. Xiao, A. B. Hjelmeland, and L. D. Quarles
Selective Deficiency of the "Bone-related" Runx2-II Unexpectedly Preserves Osteoblast-mediated Skeletogenesis
J. Biol. Chem., May 7, 2004; 279(19): 20307 - 20313.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
D. Jiang, R. T. Franceschi, H. Boules, and G. Xiao
Parathyroid Hormone Induction of the Osteocalcin Gene: REQUIREMENT FOR AN OSTEOBLAST-SPECIFIC ELEMENT 1 SEQUENCE IN THE PROMOTER AND INVOLVEMENT OF MULTIPLE SIGNALING PATHWAYS
J. Biol. Chem., February 13, 2004; 279(7): 5329 - 5337.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
K. Redlich, B. Gortz, S. Hayer, J. Zwerina, N. Doerr, P. Kostenuik, H. Bergmeister, G. Kollias, G. Steiner, J. S. Smolen, et al.
Repair of Local Bone Erosions and Reversal of Systemic Bone Loss Upon Therapy with Anti-Tumor Necrosis Factor in Combination with Osteoprotegerin or Parathyroid Hormone in Tumor Necrosis Factor-Mediated Arthritis
Am. J. Pathol., February 1, 2004; 164(2): 543 - 555.
[Abstract] [Full Text] [PDF]

Home page
 Genes Dev.Home page
R. Sitcheran, P. C. Cogswell, and A. S. Baldwin Jr.
NF-{kappa}B mediates inhibition of mesenchymal cell differentiation through a posttranscriptional gene silencing mechanism
Genes & Dev., October 1, 2003; 17(19): 2368 - 2373.
[Abstract] [Full Text] [PDF]

Home page
 Ann Rheum DisHome page
H Marzo-Ortega, D McGonagle, G Haugeberg, M J Green, S P Stewart, and P Emery
Bone mineral density improvement in spondyloarthropathy after treatment with etanercept
Ann Rheum Dis, October 1, 2003; 62(10): 1020 - 1021.
[Full Text]

Home page
 Cancer Res.Home page
J. Pratap, M. Galindo, S. K. Zaidi, D. Vradii, B. M. Bhat, J. A. Robinson, J.-Y. Choi, T. Komori, J. L. Stein, J. B. Lian, et al.
Cell Growth Regulatory Role of Runx2 during Proliferative Expansion of Preosteoblasts
Cancer Res., September 1, 2003; 63(17): 5357 - 5362.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
R. A. Kahler and J. J. Westendorf
Lymphoid Enhancer Factor-1 and beta -Catenin Inhibit Runx2-dependent Transcriptional Activation of the Osteocalcin Promoter
J. Biol. Chem., March 28, 2003; 278(14): 11937 - 11944.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/4/2695    most recent
M106339200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gilbert, L.
Right arrow Articles by Nanes, M. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gilbert, L.
Right arrow Articles by Nanes, M. S.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement