|
Originally published In Press as doi:10.1074/jbc.M201485200 on August 2, 2002
J. Biol. Chem., Vol. 277, Issue 42, 39786-39791, October 18, 2002
Regulation of Reticuloendothelial Iron Transporter MTP1 (Slc11a3)
by Inflammation*
Funmei
Yang ,
Xiao-bing
Liu§,
Marlon
Quinones§,
Peter C.
Melby§¶,
Andrew
Ghio , and
David J.
Haile§¶**
From the ¶ Audie Murphy Veterans Affairs Medical Center, South
Texas Veterans Health System, San Antonio, Texas 78229, the
Department of Cellular and Structural Biology and the
§ Department of Medicine, University of Texas Health Science
Center, San Antonio, Texas 78229, and the National Health and
Environmental Effect Research Laboratory, Environmental Protection
Agency, Chapel Hill, North Carolina 78229
Received for publication, February 13, 2002, and in revised form, July 30, 2002
 |
ABSTRACT |
Acute and chronic inflammation cause many changes
in total body iron metabolism including the sequestration of iron in
phagocytic cells of the reticuloendothelial system. This change in iron
metabolism contributes to the development of the anemia of
inflammation. MTP1, the duodenal enterocyte basolateral iron exporter,
is also expressed in the cells of the reticuloendothelial system (RES) and is likely to be involved in iron recycling of these cells. In this
study, we use a lipopolysaccharide model of the acute inflammation in
the mouse and demonstrate that MTP1 expression in RES cells of the
spleen, liver, and bone marrow is down-regulated by inflammation. The
down-regulation of splenic expression of MTP1 by inflammation was also
observed in a Leishmania donovani model of chronic
infection. The response of MTP1 to lipopolysaccharide (LPS) requires
signaling through the LPS receptor, Toll-like receptor 4 (TLR4). In
mice lacking TLR4, MTP1 expression is not altered in response to LPS.
In addition, mice lacking tumor necrosis factor-receptor 1a
respond appropriately to LPS with down-regulation of MTP1, despite
hyporesponsiveness to tumor necrosis factor- signaling, suggesting
that this cytokine may not be required for the LPS effect. We
hypothesize that the iron sequestration in the RES system that
accompanies inflammation is because of down-regulation of MTP1.
 |
INTRODUCTION |
Iron is an essential nutrient for growth and development of
eucaryotes and most prokaryote species. A normal individual will absorb
~1 mg of elemental iron a day through the duodenum, to match an
equivalent daily physiologic loss. The plasma turnover of iron is
~10-20 mg a day and one source of this pool is iron released from
the reticuloendothelial system
(RES).1 Macrophages of the
RES release iron from phagocytosed erythrocytes and return it to the
circulation for reuse by the erythroid compartment of the body.
Difficulties in environmental iron acquisition limit the growth of
microorganisms and some of the major virulence factors associated with
bacterial infections are genes encoding more efficient means for
acquiring iron from the host. One defense against invading microorganisms involves the sequestration of iron in body compartments not readily accessible to these invaders. The acute phase
response to infection is characterized by a number of changes in
iron metabolism including acute declines in serum iron, increases in
the rate of serum iron disappearance, a decline in serum iron turnover, sequestration of the metal in the RES, and a decline in intestinal iron
absorption (reviewed in Refs. 1 and 2). Chronic inflammatory states are
also characterized by low serum iron levels, RES iron sequestration,
and anemia (3, 4, 5). A number of cytokines including interleukin 1 (IL-1) (6-11), tumor necrosis factor- (TNF- ) (11-14), and IL-6
(16-18) have been demonstrated to be potentially involved in changes
in iron metabolism in animal and human models of acute and chronic inflammation.
During inflammation serum iron levels drop secondary to an increase in
the rate of iron clearance from plasma, a decrease in iron mobilization
from the RES compartment (the so-called iron exit block) (19-25), and
a decrease in iron absorption (23, 26-28). The recent identification
and characterization of the duodenal epithelial cell basolateral iron
exporter solute carrier family 11a member 3 (SLC11a3), also known as
IREG1 (29), ferroportin 1 (30), MTP1 (31) as an iron-regulated protein
that is also expressed in the RES, has led to the hypothesis that MTP1
may be the protein responsible for iron export from this compartment. There is ample evidence that MTP1 exports iron from cells.
Overexpression of MTP1, by transient transfection, in tissue culture
cells has been demonstrated to result in depletion of intracellular
ferritin and cytosolic iron levels (31) and MTP1 expression in frog
oocytes results in measurable iron efflux (29, 30). In this paper we
report that MTP1 expression in the cells of the RES is regulated by
acute inflammation. This inflammation-mediated control of MTP1 expression in the RES may be one component responsible for iron sequestration in the RES in both acute and chronic inflammatory states.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Lipopolysaccharide (LPS), from Escherichia
coli serotype 055:B5, iron-dextran, and pyrrolidinedithiocarbamate
(PDTC) were purchased from Sigma and resuspended in saline. Recombinant
tumor necrosis factor- were obtained from PeproTech (Rocky Hill,
NJ). Rat anti-mouse F4/80 antigen antibody was obtained from Serotec (Raleigh, NC). The production of the rabbit anti-MTP1 polyclonal antibody has been previously described (31). Alexa dye-conjugated goat
anti-rat and goat anti-rabbit antibodies were purchased from Molecular
Probes (Eugene, OR). Goat anti-rat/mouse TNF- was from Calbiochem
(La Jolla, CA). For in vivo work anti-TNF- (clone MP3-XT6) was from Pharmingen (San Diego, CA).
Mice--
Unless otherwise indicated C57/BL6 mice aged 8-12
weeks of either sex were used for the experiments described. LPS, PDTC, and all cytokines were prepared in a 100-µl volume of saline
and given intraperitoneally. Iron-dextran was given in 50-100 µl of saline in one or two thigh muscles. Turpentine was administered to
anesthetized animals as a 50-100-µl subcutaneous injection into the
back between the scapulas. Unless noted otherwise, a minimum of 4 animals were used per experimental condition. Low iron mouse chow was
purchased from Harlan Sprague-Dawley (Indianapolis, IN).
Experimental Infection--
Six-week-old male BALB/c mice were
infected intravenously with 1 × 106 Leishmania
donovani (MHOM/S.D./001S-2D) amastigotes in Hanks' balanced salt
solution as previously described (32). Age-matched control mice
received the same volume of Hanks' balanced salt solution by the same
route of inoculation. At 56 days post-infection, mice were killed and
the spleen sections were prepared in paraffin. Samples were
immunostained with anti-MTP1 antibody as described below.
Immunohistochemistry--
Immunohistochemistry was performed on
paraffin-embedded mouse organ sections using an affinity purified
rabbit anti-MTP1 polyclonal antibody using the Envision+ (Dako Corp.,
Carpenteria, CA) staining kit with Vector VIP or AEC as chromogen
(Vector Laboratories, Burlingame, CA) as described previously (31).
Immunofluorescence was performed using the affinity purified rabbit
anti-MTP1 polyclonal antibody at 4 µg/ml, and a rat anti-mouse F4/80
antigen antibody (Serotec, Raleigh, NC) at 1:20. Secondary reagents
were Alexa 488-labeled goat anti-rabbit IgG antibody and Alexa 594 goat
anti-rat IgG antibody at 1:500 dilution. Sections used for
immunofluorescence were fixed with a 50:50 mixture of acetone and
methanol for 20 min at 20 °C. Pictures were obtained on color
slide film using an Olympus BX-60 fluorescence microscope.
Western Blotting--
Liver and spleen lysates were prepared by
homogenization of tissue in phosphate-buffered saline supplemented with
0.5% Triton X-100, 5 mM EDTA, 0.1 mg/ml
4-(2-aminoethyl)benzenesulfonyl fluoride, 10 µg/ml leupeptin
hydrochloride, and 2 µg/ml peptostatin A. After Dounce homogenization
of tissue pieces, the nuclei and insoluble debris was spun down in a
microcentrifuge at 13,000 rpm for 10 min in the cold and the
supernatant was removed. For the immunoprecipitation, 15 µl of
Protein A/G slurry (Calbiochem) was incubated for 1 h with 1 µg
of affinity purified rabbit anti-MTP1 polyclonal antibody or a similar
amount of control normal rabbit IgG in phosphate-buffered saline, 0.5% Triton X-100 and washed extensively. Two hundred micrograms of total protein from the organ lysates was added to the
Protein A/G slurry bound to the anti-MTP1 antibody and tumbled for
2 h in the cold. Subsequently, the slurry was washed extensively with phosphate-buffered saline, 0.5% Triton X-100 and then boiled in
SDS sample buffer prior to electrophoresis using the Laemmli gel
system. The gel was transferred to nitrocellulose and Western blotting
was done using the affinity purified rabbit anti-MTP1 polyclonal
antibody or control IgG (400 ng/ml antibody concentration). Peptide
blocking experiments were done by preincubating the diluted anti-MTP1
antibody with 2 µg of specific peptide prior to addition of the
antibody to the membrane. Horseradish peroxidase-labeled goat
anti-rabbit antibody (Pierce) was used as a secondary reagent at
1:2000-1:5000 dilution and signal detected on radiographic film using
commercially available chemluminescent substrates.
Cell Culture and RT-PCR Analysis--
Total splenocytes from
C57/Bl6 mice were prepared by manual crushing of the spleen using the
back of a 10-ml syringe in 3 ml of Dulbecco's modified Eagle's medium
containing 10% fetal bovine serum and antibiotics. The spleen cell
suspension was filtered through a nylon mesh and the cells were
resuspended at 2-5 million mononuclear cells per milliliter and plated
into 12-well plates. An aliquot of the cell suspension was treated with
ammonium sulfate to lyse the red blood cells to determine the
mononuclear cell number. The cells were incubated in plastic dishes at
37 °C for 2 h and then washed four times with complete
Dulbecco's modified Eagle's medium to remove nonadherent cells. The
plates were then returned to the incubator and 2 h later LPS was
added at 5 µg/ml concentration. PDTC was added at a concentration of
100 µM and a goat anti-rat/mouse TNF- was used at 1 µg/ml. TNF- was added to cultures at 10 ng/ml. After overnight
incubation, total RNA was isolated using a commercially available RNA
isolation kit (RNA-4-PCR, Ambion. One-fifth of the RNA was transcribed
into cDNA using a commercially available kit (Retroscript
Kit, Ambion).
Quantitative PCR was performed using TaqMan polymerase with detection
of SYBR Green fluorescence on an ABI Prism 7700 Sequence detector (PE
Biosystems, Foster City, CA). MTP1 mRNA levels were normalized
using the expression of GAPDH as a housekeeping gene. Relative
quantitation of both MTP1 and GAPDH mRNA was based on standard
curves prepared from serially diluted mouse mast cell cDNA. The
following sense and antisense sequences were employed: mouse
MTP1, sense, CTACCATTAGAAGGATTGACCAGCTA, antisense,
ACTGGAGAACCAAATGTCATAATCTG; mouse GAPDH, sense, CATGGCCTTCCGTGTTCCTA,
antisense, TGT CATCATACTTGGCAGGTTTCT.
Serum Iron Measurements--
Iron was reduced and released from
serum transferrin by addition of an equal volume of 0.2 N
HCl containing 0.05% ascorbic acid. Subsequently the sample was
deproteinated by addition of an equal volume trichloroacetic acid
(11%). The sample was then centrifuged and iron in the supernatant was
measured using a commercially available ferrozine-based Total Iron
Measurement Kit (Sigma).
 |
RESULTS |
MTP1 Is Expressed in Splenic, Liver, and Bone Marrow Macrophage
Cells--
Previous work had indicated that MTP1 is primarily
expressed in the Kupffer cells of the liver and red pulp of the spleen and had a distribution similar to that seen with the F4/80, a macrophage-specific cell surface antigen (31). The identification of
MTP1 staining cells in the spleen, liver, and bone marrow as macrophages was confirmed by two-color double immunofluorescence staining using antibodies to MTP1 and F4/80 antigen in frozen liver,
spleen, and bone marrow cell sections (Fig.
1). In the red pulp of the spleen, there
was great overlap between distribution of MTP1 and F4/80 staining
cells. Interestingly, there were F4/80 positive cells in the white pulp
of the spleen that do not stain with the MTP1 antibody, indicating that
not all macrophages express MTP1. In the liver, as reported previously,
MTP1 immunostaining was apparent on the surface of hepatocytes and in
Kupffer cells. The MTP1 immunofluorescence of the Kupffer cells
co-localized to the immunostaining with the F4/80 antigen. In bone
marrow cell cytospins, there were many MTP1 positive cells, and
immunostaining also co-localized with F4/80 in most of the cells.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 1.
MTP1 co-localizes with macrophage marker
F4/80. Sections of frozen mouse spleen (first
row), frozen liver (second row), and bone marrow cell
cytospin (third row) were stained with antibodies against
MTP1 and F4/80 as indicated. Secondary reagents were Alexa
488-conjugated goat anti-rabbit and Alexa 594 goat-conjugated anti-rat
secondary antibodies. Photographs were taken using appropriate green
and red filters. Photographs illustrating merging of red and
green fluorescence were done by double exposure.
Arrows indicate F4/80 positive but MTP1 negative cells.
Original magnification was ×200-400.
|
|
Inflammation Results in Down-regulation of MTP1 Expression in the
Reticuloendothelial Cells--
A murine LPS model of the acute
phase reaction was used to examine the connection between MTP1
expression in the RES compartment of the body and inflammation.
Experimental mice were treated with 100 µg of LPS and changes in MTP1
expression were assessed 16-18 h later (Fig.
2A). Immunohistochemical
staining using an anti-MTP1 antibody of sections of spleen from
LPS-treated mice demonstrated diminished MTP1 staining of spleen
macrophages compared with control mice. To study the response of
Kupffer cell MTP1 expression to LPS administration, mice were treated
with 1-2 mg of iron-dextran to induce Kupffer cell MTP1 expression
(31) and 7-10 days later treated with LPS. In iron-treated mice, LPS
injection resulted in down-regulation of MTP1 in the Kupffer cells.
Additionally, MTP1 was also down-regulated in bone marrow cells with
LPS treatment. Last, duodenal MTP1 expression was induced with feeding
of a low iron diet to mice and subsequent LPS administration to these
iron-deficient mice also resulted in down-regulation of duodenal MTP1
expression compared with controls.

View larger version (105K):
[in this window]
[in a new window]
|
Fig. 2.
Down-regulation of MTP1 in mouse spleen,
liver, and duodenum is induced by LPS administration and chronic
infection. A, immunohistochemistry using the anti-MTP1
antibody was performed as outlined above on paraffin-embedded tissue
sections of spleen, liver, bone marrow, and duodenum of mice treated
with 100 µg of LPS 18 h prior to sacrifice. Mice used for liver
immunohistochemistry staining were treated with an intramuscular
injection of 1-2 mg of iron-dextran 1 week prior to LPS treatment.
Mice used for duodenal sections were given an iron-free diet for the
month preceding LPS injection. B, paraffin-embedded
spleens of mice infected with L. donovani and control
animals were analyzed for MTP1 content by immunohistochemistry using an
anti-MTP1 antibody.
|
|
The regulation of MTP1 in the spleen in a mouse model of a more chronic
infectious disease was examined. The spleens of mice infected with
L. donovani for 8 weeks were examined for MTP1 expression by
immunohistochemistry using paraffin-embedded tissue and the anti-MTP1
antibody. Infected mice demonstrated diminished MTP1 staining in the
spleen in comparison to control mice (Fig. 2B). Tissues from
two infected and two control animals were examined. These data
demonstrate that MTP1 was also down-regulated in a more chronic
inflammatory state induced by an infection.
Western blotting of liver and spleen samples from LPS-treated and
control mice confirmed the decreased tissue expression of MTP1
secondary to LPS administration (Fig. 3).
The down-regulation of MTP1 expression by LPS was apparent in Western
blots of immunoprecipitated MTP1 from spleen (Fig. 3, left
panel) and liver lysates (Fig. 3, right panel). In
most, but not all experiments at least two or more distinct bands were
apparent in the immunoblots of spleen and liver lysates. The first was
a smear occurring at 60,000-65,000 and the second was of higher
molecular weight appearing at 110,000-130,000. The appearance
of the 60,000-65,000 and the higher molecular weight bands were
specific to immunoprecipitation with the anti-MTP1 antibody and
blotting with the anti-MTP1 antibody. The peptide used to purify the
anti-MTP1 antiserum blocked the appearance of the bands. The higher
molecular weight bands were present in most experiments and the ratio
of these bands to the 60,000-65,000-band varied from experiment to
experiment. The 60-65-kDa-band is most likely MTP1. Preliminary data
indicates that the larger bands do not represent either glycosylation
or ubiquitination intermediates of MTP1. Anti-ubiquitin antibodies do
not recognize the higher molecular weight bands by Western blotting and
treatment with N-linked carbohydrate endoglycosidases does
not alter the mobility of these higher molecular weight bands (data not
shown). The larger bands probably represent a fraction of MTP1 that is
modified, aggregated, or exhibits an aberrant migration.

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 3.
Immunoblot analysis of MTP1 protein
expression in LPS-treated mouse spleen and liver. Representative
immunoprecipitation followed by immunoblotting using an anti-MTP1
antibody of spleen (left panel) and liver lysates
(right panel) prepared from control and LPS-treated mice was
done as described. The band on the gel at 45-50 kDa is IgG
heavy chain. Data shown is for two mice for each condition.
|
|
In LPS-treated mice, hypoferraemia was induced more rapidly than
changes in splenic MTP1 protein expression. Serum iron was diminished
as early as 2 h after LPS administration (Fig.
4A); whereas, there was no
change in MTP1 expression at this time point (Fig. 4B).
Diminished MTP1 expression was noted at 6 h after LPS administration and this declined persisted as long as 72 h (data not shown). These data indicate that the early hypoferraemia because of
LPS administration precedes MTP1 protein down-regulation and is not
likely to be caused by changes in MTP1 expression. Other mechanisms,
such as an increased clearance of blood iron may be more important in
the development of the initial hypoferraemia.

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 4.
MTP1 down-regulation by LPS is delayed
relative to development of hypoferraemia. Mice were treated with
LPS for the times indicated and serum iron levels (A) and
Western blotting (B) of splenic MTP1 protein levels were
assayed as indicated previously. Data shown is for three mice for each
time period.
|
|
Toll-like Receptor 4 Signaling Is Required for MTP1 Down-regulation
by LPS--
Mice lacking a functional LPS receptor, the Toll-like
receptor 4 (TLR4), such as the C3H/HeJ mouse strain are resistant to the lethal effects of LPS and fail to mount an acute phase response to
LPS challenge and do not demonstrate a decline in serum iron (33, 34).
Although C3H/HeJ mice are resistant to induction of the acute phase
response with LPS, they are known to be sensitive to other inflammatory
mediators. We examined the response of splenic MTP1 to LPS in the
C3H/HeJ mouse strain (Fig. 5).
LPS-mediated down-regulation of MTP1 in the spleen was abrogated in the
C3H/HeJ compared with the LPS-sensitive C3H/HeJ-FeB strain. A
turpentine injection model of acute inflammation (23, 27, 35) was used to determine whether MTP1 down-regulation was specific for TLR4 or
could be achieved by other stimuli in the C3H/HeJ mice. Turpentine injection of C3H/HeJ mice results in sterile inflammation and the
response has been associated with a decline in serum iron and induction
of the acute phase response (33, 34). C3H/HeJ mice treated with
turpentine demonstrated marked down-regulation of MTP1 expression in
the spleen compared with untreated controls. These results indicate
that inflammatory stimuli other than LPS can induce down-regulation of
MTP1 in the spleen by a non-TLR4 dependent mechanism.

View larger version (126K):
[in this window]
[in a new window]
|
Fig. 5.
Spleen expression of MTP1 in C3H/HeJ mice is
down-regulated turpentine but not by LPS. Paraffin-embedded spleen
sections from C3H/HeJ-FeB and C3H/HeJ mice administered 100 µg of LPS
and C3H/HeJ mice administered turpentine, and untreated controls were
immunostained with anti-MTP1 antibody (4 µg/ml).
|
|
TNF- Does Not Induce MTP1 Down-regulation in the
Spleen--
Many of the acute effects of LPS are mediated by induction
of expression of proinflammatory cytokines such as TNF- ,
interferon- , IL-6, and IL-1. The response of MTP1 in spleens was
assessed in C57/Bl6 mice administered TNF- . Intraperitoneal
injection of mice with 1 µg of rTNF- had no effect on MTP1
expression assessed by IHC on spleen sections using an anti-MTP1
antibody (Fig. 6). In addition, the
response of MTP1 in the spleen to LPS was assessed in
B6.129-Tnfrsf1atm1Mak mice, which lack
expression of TNF- receptor type 1a and are hyporesponsive to
TNF- stimulation (36). The mice that were treated with LPS and a
neutralizing anti-TNF- antibody responded to LPS by down-regulation
of splenic MTP1 indicating that TNF- stimulation is not required for
this effect (Fig. 6). Furthermore, administration of PDTC, a well
characterized inhibitor of NF- B activation and TNF- production
(37), to mice prior to treatment with LPS did not alter the change in
MTP1 expression induced by LPS (data not shown).

View larger version (130K):
[in this window]
[in a new window]
|
Fig. 6.
LPS-mediated MTP1 regulation is independent
of TNF- signaling. A, C57/Bl6
mice were injected with TNF- (1 µg/mouse), LPS (100 µg/mouse),
or untreated and 18 h later spleens were collected and embedded in
paraffin. B,
B6.129-Tnfrsf1atm1Mak mice were treated with LPS
(50 µg/mouse) and control IgG (75 µg/mouse) or LPS and anti-TNF-
antibody (75 µg/mouse) or left untreated and 18 h later spleens
were collected and embedded in paraffin. Tissues were assayed for MTP1
expression using immunohistochemistry with the anti-MTP1 antibody (4 µg/ml).
|
|
MTP1 mRNA in Adherent Spleen Cell Fractions Is Down-regulated
by LPS in Vitro--
To determine the mechanism of regulation of MTP1
expression by LPS, spleen and liver MTP1 mRNA expression was
examined by real-time RT-PCR of total RNA from animals treated with LPS
and untreated controls. There was a 2-3-fold down-regulation of
MTP1-specific PCR product in spleen and liver samples from LPS-treated
animals compared with control mice (Fig.
7A). To better determine
whether there may be a change in macrophage-specific MTP1 mRNA
secondary to LPS treatment (as opposed to total spleen MTP1 mRNA),
splenic macrophages were enriched by adherence to plastic and these
cells were treated with LPS, PDTC, or rTNF- . Total RNA was isolated from these cells and MTP1 and GAPDH mRNA levels were assessed using
RT-PCR. In vitro LPS treatment resulted in down-regulation of MTP1 mRNA expression relative to GAPDH expression in the splenic adherent cells (Fig. 7B). The addition of PDTC, an inhibitor
of NF- B, did not abrogate the effect of LPS. In addition, direct addition of TNF- to the adherent cells did not result in
down-regulation of MTP1 mRNA. The data indicate that LPS results in
down-regulation of MTP1 mRNA in adherent mouse spleen cells and
that this action of LPS is probably independent of NF- B activation
and TNF- synthesis.

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 7.
Splenic and liver MTP1 mRNA levels
decline in response to LPS treatment. A, MTP1 and GAPDH
mRNA levels were assayed in total RNA from spleen and liver tissue
of control or LPS-treated mice with MTP1 and GAPDH-specific primers
using real time RT-PCR as indicated above. Data shown is compiled from
four LPS and four control animals from two independent experiments.
Ratios of MTP1 mRNA to GAPDH mRNA were calculated and the
MTP1/GAPDH mRNA ratio of one control per experiment was set
arbitrarily to 100%. Other values are the MTP1/GAPDH mRNA ratios
normalized to this one control. B, adherent mouse
splenocytes were isolated as indicated above and treated overnight with
LPS (5 µg/ml) or LPS and PDTC (100 µM) or TNF- (10 ng/ml). Total RNA from the treated and control cells was subjected to
RT-PCR analysis using MTP1-specific and GAPDH housekeeping gene
primers. Ratios of MTP1 mRNA to GAPDH mRNA are calculated and
the MTP1/GAPDH mRNA ratio of one control per experiment was set
arbitrarily to 100%. Other values are the MTP1/GAPDH mRNA ratios
normalized to this one control. The data for the control and LPS
animals is from 6 mouse spleens used in three separate experiments.
PDTC and TNF- data represent duplicates of an experiment in which
adherent cells were derived from two pooled mouse spleens. * indicates
results that have calculated p < 0.05 for
differences.
|
|
 |
DISCUSSION |
MTP1 is a metal transporter that exports iron from the cytosol to
the outside of cells and was initially identified as the duodenal
epithelial basolateral iron transporter (29-31). MTP1 has also been
demonstrated to export iron when expressed in tissue culture cells and
Xenopus oocytes. In addition, there is genetic evidence that
MTP1 is involved in iron export from the yolk sac of zebrafish embryos.
The recent identification of MTP1 mutation leading to hemochromatosis
in man adds further weight to the hypothesis that MTP1 is involved in
iron homeostasis (38, 39). RES cells are responsible for the recycling
of iron from the breakdown of heme from senescent erythrocytes and MTP1
has been hypothesized to be the key iron exporter in these cells.
Supporting this hypothesis is the observation that MTP1 is expressed in
the RES macrophages of the spleen (29-31), Kupffer cells (29-31),
bone marrow, and lymph node
histiocytes.2 Although there
has been no direct demonstration of MTP1-mediated iron export from RES
cells, the ability of MTP1 to export iron from other cell types and its
involvement in iron export from the duodenal epithelial cells and the
zebrafish yolk sac support the supposition that MTP1 may export iron
derived from senescent erythrocytes from the RES cells and back into
the blood for reutilization by the erythroid compartment.
Chronic and acute inflammation are well characterized conditions in
which iron metabolism is altered. These changes in iron metabolism are
characterized by a drop in serum iron, an increase in the rate of
plasma iron disappearance, a decline in the rate of plasma iron
turnover, RES cell iron sequestration, and hyperferritinemia (reviewed
Refs. 1-5). In vivo studies of animal models of acute inflammation secondary to LPS or turpentine administration have demonstrated several mechanisms for the decline in serum iron. LPS and
turpentine induce an accelerated clearance of iron from blood, thought
to be because of an increase in transferrin-dependent uptake of iron by hepatocytes and other cells (13, 14, 23, 24, 40-42).
Release of lactoferrin by inflammatory cells may also be a contributing
factor to this acute decline (43), but this hypothesis has been
challenged more recently (7, 9). Other changes in iron metabolism
because of inflammatory stimuli include a decline in RES and hepatocyte
cell iron turnover; and the decrease in RES cell iron turnover results
in an accumulation of iron in the RES compartment (23-25, 40-42, 44).
The mechanism for the RES iron sequestration is not known, although an
inflammation-induced increase in ferritin synthesis has been
hypothesized to play a role (35). A decrease in intestinal iron
absorption as a consequence of LPS or turpentine administration has
also been demonstrated suggesting another possible mechanism for the
more chronic effects of inflammation on iron metabolism (23,
26-28).
The data presented here demonstrate that acute LPS administration to
mice results in down-regulation of MTP1 expression in cells of the RES
in the liver, marrow, and spleen and in duodenal epithelial cells.
Western blotting of total liver and spleen lysates confirmed the
decline in MTP1 protein expression. Furthermore, in an infectious model
of chronic visceral leishmaniases, MTP1 was also down-regulated in the
infected spleen. The effects of LPS on MTP1 expression are specific for
the RES cells and a significant change in staining of blood vessels or
kidney cells in response to acute LPS administration was not observed
(data not shown). These observations support a hypothesis that the RES
cell iron exit block of acute and/or chronic inflammation result from
down-regulation of MTP1. The down-regulation of MTP1 in the spleen by
LPS was not apparent at 2 h after injection, whereas hypoferraemia
was present at this time. Other reports have also pointed to a fast onset of hypoferraemia with LPS (43, 45). These observations make it
unlikely that the LPS-mediated MTP1 down-regulation in the RES is
responsible for the initial hypoferraemia observed with LPS. The
initial hypoferraemia probably result from an increased rate of
transferrin-mediated uptake of blood iron. It is more likely that
MTP1-mediated RES cell iron exit block may serve to maintain the
hypoferraemia rather than initiate it.
Many of the effects on iron metabolism of LPS are known to be secondary
to LPS-induced synthesis of known proinflammatory mediators such as the
interleukins and TNF- . Although it is difficult to draw many
conclusions from the literature because of differences in animal models
used, doses of cytokines, and the modes of administration among others,
numerous reports indicate administration of IL-6 (17), IL-1 (6, 7, 14),
and TNF- (11, 14, 15) in humans and animals result in rapid drops in
serum iron but this decline is relatively short-lived compared with
that observed with LPS. Chronic administration of TNF- (11, 15) or
IL-1 (10, 15) results in more prolonged hypoferraemia. In these studies, the major effects of IL-6 (17), IL-1 (7, 15), and TNF- (15)
on iron metabolism appear to be an increase in the rate of plasma iron
disappearance and an increase in hepatocyte uptake of transferrin-iron
(17) but there is no consistent data on changes in RES iron
mobilization to these cytokines (7, 15).
Treatment of mice with TNF- did not result in an appreciable decline
in MTP1 expression in mouse spleen at 24 h. Furthermore, mice
lacking TNF- receptor type 1a and pretreated with neutralizing anti-TNF- antibodies responded to LPS with decreased MTP1 expression indicating that TNFR1a and possibly TNF- signaling is not required for the LPS effect. Moreover, while in vitro treatment of
mouse adherent splenocytes directly with LPS resulted in
down-regulation of MTP1 mRNA, addition of TNF- had no effect.
Furthermore, PDTC did not block the in vitro effect of LPS
on MTP1 mRNA down-regulation. The lack of antagonism between LPS
and PDTC in vitro and in vivo indicates that
NF- B activation may not be required for MTP1 down-regulation. Signaling by TLR4 through the c-Jun NH2-terminal kinase,
p38MAPK, or c-Jun NH2-terminal
kinase-dependent pathways may be more important in
regulation of MTP1 by LPS.
This lack of effect of TNF- on splenic MTP1 protein expression
in vivo and the lack of effect of in vitro
TNF- on adherent splenocyte MTP1 mRNA production is not
inconsistent with the observations that this cytokine induces
hypoferraemia when administered in vivo. First, in our
in vivo experiments, the cytokine was administered as a
single injection and it has been characterized that the decline in
serum iron induced by these cytokines is not long-lived and is usually
reversed within 24 h. In addition, RES iron sequestration is only
one of several mechanisms responsible for the hypoferraemia of
inflammation. TNF- may induce increased uptake of iron from blood
without altering the RES iron sequestration. Therefore it would not be
unexpected that serum iron may be altered but MTP1 expression in the
RES may not change in response to TNF- .
A clue to the molecular signaling mechanism for MTP1 down-regulation by
LPS comes for the study of the C3H/HeJ mouse, which lacks a functional
TLR4 receptor. The LPS receptor, TLR4, is required to mount an acute
phase response including hypoferraemia to LPS. Similarly, we do not
observe a down-regulation of MTP1 in response to LPS in the C3H/HeJ
mice. This finding indicates that the down-regulation of MTP1 by LPS
requires signaling through TLR4. Despite resistance to LPS, the C3H/HeJ
mice are responsive to other mediators of inflammation and we observed
that treatment of C3H/HeJ mice with turpentine for a period of 24 h resulted in down-regulation of MTP1 expression in the spleen.
Therefore, there are both TLR4 and non-TLR4-dependent
mechanisms for the down-regulation of MTP1 by inflammatory stimuli.
The anemia of chronic diseases is the cause of much morbidity in
patients with a variety of illnesses. In addition to direct effects on
erythropoiesis, chronic inflammation also perturbs normal body iron
metabolism and results in RES cell iron sequestration. Abnormalities in
iron kinetics have been observed in many disease states including
cancers, rheumatologic conditions, chronic renal failure, and acute and
chronic infectious diseases. This work is significant because the data
suggest that strategies aimed at abrogating the down-regulation of MTP1
by inflammation may improve the supply of iron to the erythron and led
to improvements in anemia in these patients. Furthermore, new evidence
suggests that chronic inflammation may play a role in the pathogenesis of a variety of disease states such as chronic renal failure and heart
disease. Down-regulation of MTP1 by chronic inflammation may result in
iron sequestration in tissues and predispose to iron-dependent oxidative stresses.
 |
ACKNOWLEDGEMENTS |
We thank the San Antonio Cancer Institute
Pathology Core Laboratory for help with the immunohistochemistry.
 |
FOOTNOTES |
*
This work was supported by a Veterans Affairs Merit Grant
Award (to D. J. H.), National Institutes of Health Grant
R01DK53079 (to D. J. H.), and a grant from the Morrison Trust
(to F. Y.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
**
To whom correspondence should be addressed. Tel.: 210-567-4848;
Fax: 210-567-1956; E-mail: Haile@uthscsa.edu.
Published, JBC Papers in Press, August 2, 2002, DOI 10.1074/jbc.M201485200
2
D. J. Haile, unpublished observation.
 |
ABBREVIATIONS |
The abbreviations used are:
RES, reticuloendothelial system;
IL, interleukin;
TNF, tumor necrosis
factor;
LPS, lipopolysaccharide;
PDTC, pyrrolidinedithiocarbamate;
RT, reverse transcriptase;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
TLR4, Toll-like receptor 4.
 |
REFERENCES |
| 1.
|
Patruta, S. I.,
and Horl, W. H.
(1999)
Kidney Int. Suppl.
69,
S125-S130[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Jurado, R. L.
(1997)
Clin. Infect. Dis.
25,
888-995[Medline]
[Order article via Infotrieve]
|
| 3.
|
Weiss, G.
(1999)
Kidney Int. Suppl.
69,
S12-S17[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Means, R. T., Jr.
(1999)
Int. J. Hematol.
70,
7-12[Medline]
[Order article via Infotrieve]
|
| 5.
|
Bertero, M. T.,
and Caligaris-Cappio, F.
(1997)
Haematologica
82,
375-381[Abstract/Free Full Text]
|
| 6.
|
Fischer, E.,
Marano, M. A.,
Barber, A. E.,
Hudson, A.,
Lee, K.,
Rock, C. S.,
Hawes, A. S.,
Thompson, R. C.,
Hayes, T. J.,
Anderson, T. D.,
Benjamin, W. R.,
Lowry, S. F.,
and Moldawer, L. L.
(1991)
Am. J. Physiol. Regul. Intergr. Comp. Physiol.
261,
R442-R452[Abstract/Free Full Text]
|
| 7.
|
Uchida, T.,
Yamagiwa, A.,
and Nakamura, K.
(1991)
Eur. J. Haematol.
46,
1-5[Medline]
[Order article via Infotrieve]
|
| 8.
|
Kampschmidt, R. F.,
and Mesecher, M.
(1985)
Proc. Soc. Exp. Biol. Med.
179,
197-200[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Gordeuk, V. R.,
Prithviraj, P.,
Dolina, R. T.,
and Brittenham, G. M.
(1988)
J. Clin. Invest.
82,
1934-1938[Medline]
[Order article via Infotrieve]
|
| 10.
|
Hill, A. G.,
Siegel, J.,
Rounds, J.,
and Wilmore, D. W.
(1997)
Ann. Surg.
225,
246-251[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Feelders, R. A.,
Vreugdenhil, G.,
Eggermont, A. M.,
Kuiper-Kramer, P. A.,
van Eijk, H. G.,
and Swaak, A. J.
(1998)
Eur J. Clin. Invest.
28,
520-527[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Tanaka, T.,
Araki, E.,
Nitta, K.,
and Tateno, M.
(1987)
J. Biol. Respon. Modif.
6,
484-488
|
| 13.
|
Alvarez-Hernandez, X.,
Liceaga, J.,
McKay, I. C.,
and Brock, J. H.
(1989)
Lab. Invest.
61,
319-322[Medline]
[Order article via Infotrieve]
|
| 14.
|
Moldawer, L. L.,
Marano, M. A.,
Wei, H.,
Fong, Y.,
Silen, M. L.,
Kuo, G.,
Manogue, K. R.,
Vlassara, H.,
Cohen, H.,
and Cerami, A.
(1989)
FASEB J.
3,
1637-1643[Abstract]
|
| 15.
|
Mabika, M.,
and Laburn, H.
(1999)
Pflugers Arch.
438,
218-223[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Nieken, J.,
Mulder, N. H.,
Buter, J.,
Vellenga, E.,
Limburg, P. C.,
Piers, D. A.,
and de Vries, E. G.
(1995)
Blood
86,
900-905[Abstract/Free Full Text]
|
| 17.
|
Kobune, M.,
Kohgo, Y.,
Kato, J.,
Miyazaki, E.,
and Niitsu, Y.
(1994)
Hepatology
19,
1468-1475[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
van Gameren, M. M.,
Willemse, P. H.,
Mulder, N. H.,
Limburg, P. C.,
Groen, H. J.,
Vellenga, E.,
and de Vries, E. G.
(1994)
Blood
84,
1434-1441[Abstract/Free Full Text]
|
| 19.
|
Kampschmidt, R. F.,
Upchruch, H. F.,
and Johnson, H. L.
(1965)
Am. J. Physiol.
208,
68-72[Abstract/Free Full Text]
|
| 20.
|
Kampschmidt, R. F.,
and Arrendondo, M. I.
(1963)
Proc. Soc. Exp. Biol. Med.
113,
142-145[Medline]
[Order article via Infotrieve]
|
| 21.
|
Pekarek, R. S.,
Bostian, K. A.,
Bartelloni, P. J.,
Calia, F. M.,
and Beisel, W. R.
(1969)
Am. J. Med. Sci.
258,
14-25[Medline]
[Order article via Infotrieve]
|
| 22.
|
Fillet, G.,
Cook, J. D.,
and Finch, C. A.
(1974)
J. Clin. Invest.
53,
1527-1533[Medline]
[Order article via Infotrieve]
|
| 23.
|
Hershko, C.,
Cook, J. D.,
and Finch, C. A.
(1974)
Br. J. Haematol.
28,
67-75[Medline]
[Order article via Infotrieve]
|
| 24.
|
Uchida, T.,
Igarashi, T.,
Suzuki, T.,
Kokubun, K.,
Matsuda, S.,
and Kariyone, S.
(1983)
Tohoku J. Exp. Med.
139,
293-298[Medline]
[Order article via Infotrieve]
|
| 25.
|
Fillet, G.,
and Beguin, Y. L.
(1989)
Blood
74,
844-851[Abstract/Free Full Text]
|
| 26.
|
Cortell, S.,
and Conrad, M. E.
(1967)
Am. J. Physiol.
213,
43-47[Free Full Text]
|
| 27.
|
Raja, K. B.,
Duane, P.,
and Peters, T. J.
(1990)
Int. J. Exp. Pathol.
71,
785-789[Medline]
[Order article via Infotrieve]
|
| 28.
|
El-Shobaki, F.,
and Rummel, W.
(1985)
Blut
50,
95-101[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
McKie, A. T.,
Marciani, P.,
Rolfs, A.,
Brennan, K.,
Wehr, K.,
Barrow, D.,
Miret, S.,
Bomford, A.,
Peters, T. J.,
Farzaneh, F.,
Hediger, M. A.,
Hentze, M. W.,
and Simpson, R. J.
(2000)
Mol. Cell
5,
299-309[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Donovan, A.,
Brownlie, A.,
Zhou, Y.,
Shepard, J.,
Pratt, S. J.,
Moynihan, J.,
Paw, B. H.,
Drejer, A.,
Barut, B.,
Zapata, A.,
Law, T. C.,
Brugnara, C.,
Lux, S. E.,
Pinkus, G. S.,
Pinkus, J. L.,
Kingsley, P. D.,
Palis, J.,
Fleming, M. D.,
Andrews, N. C.,
and Zon, L. I.
(2000)
Nature
403,
776-781[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Abboud, S.,
and Haile, D. J.
(2000)
J. Biol. Chem.
275,
19906-19912[Abstract/Free Full Text]
|
| 32.
|
Melby, P. C.,
Yang, Y. Z.,
Cheng, J.,
and Zhao, W.
(1998)
Infect. Immun.
6,
18-27
|
| 33.
|
Kampschmidt, R. F.,
Pulliam, L. A.,
and Upchurch, H. F.
(1980)
J. Lab. Clin. Med.
95,
616-623[Medline]
[Order article via Infotrieve]
|
| 34.
|
Poltorak, A., He, X.,
Smirnova, I.,
Liu, M. Y.,
Huffel, C. V., Du, X.,
Birdwell, D.,
Alejos, E.,
Silva, M.,
Galanos, C.,
Freudenberg, M.,
Ricciardi-Castagnoli, P.,
Layton, B.,
and Beutler, B.
(1998)
Science
282,
2085-2088[Abstract/Free Full Text]
|
| 35.
|
Konijn, A. M.,
and Hershko, C.
(1977)
Br. J. Haematol.
37,
7-16[Medline]
[Order article via Infotrieve]
|
| 36.
|
Pfeffer, K.,
Matsuyama, T.,
Kundig, T. M.,
Wakeham, A.,
Kishihara, K.,
Shahinian, A.,
Wiegmann, K.,
Ohashi, P. S.,
Kronke, M.,
and Mak, T. W.
(1993)
Cell
73,
457-467[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Lauzurica, P.,
Martinez-Martinez, S.,
Marazuela, M.,
Gomez del Arco, P.,
Martinez, C.,
Sanchez-Madrid, F.,
and Redondo, J. M.
(1999)
Eur. J. Immunol.
29,
1890-1900[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Montosi, G.,
Donovan, A.,
Totaro, A.,
Garuti, C.,
Pignatti, E.,
Cassanelli, S.,
Trenor, C. C.,
Gasparini, P.,
Andrews, N. C.,
and Pietrangelo, A. J.
(2001)
Clin. Investig.
108,
619-623
|
| 39.
|
Njajou, O. T.,
Vaessen, N.,
Joosse, M.,
Berghuis, B.,
van Dongen, J. W.,
Breuning, M. H.,
Snijders, P. J.,
Rutten, W. P.,
Sandkuijl, L. A.,
Oostra, B. A.,
van Duijn, C. M.,
and Heutink, P.
(2001)
Nat. Genet.
28,
213-214[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Beguin, Y.,
Huebers, H. A.,
Weber, G.,
Eng, M.,
and Finch, C. A.
(1989)
J. Lab. Clin. Med.
113,
346-354[Medline]
[Order article via Infotrieve]
|
| 41.
|
Feldman, B. F.,
Kaneko, J. J.,
and Farver, T. B.
(1981)
Am. J. Vet. Res.
42,
586-589[Medline]
[Order article via Infotrieve]
|
| 42.
|
Feldman, B. F.,
Kaneko, J. J.,
and Farver, T. B.
(1981)
Am. J. Vet. Res.
42,
583-585[Medline]
[Order article via Infotrieve]
|
| 43.
|
Gutteberg, T. J.,
Rokke, O.,
Andersen, O.,
and Jorgensen, T.
(1989)
Scand. J. Infect. Dis.
21,
709-715[Medline]
[Order article via Infotrieve]
|
| 44.
|
Feldman, B. F.,
Kaneko, J. J.,
and Farver, T. B.
(1981)
Am. J. Vet. Res.
42,
1109-1133[Medline]
[Order article via Infotrieve]
|
| 45.
|
Bertini, R.,
Bianchi, M.,
Erroi, A.,
Villa, P.,
and Ghezzi, P.
(1989)
J. Leukocyte Biol.
46,
254-262[Abstract]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
I. Theurl, E. Aigner, M. Theurl, M. Nairz, M. Seifert, A. Schroll, T. Sonnweber, L. Eberwein, D. R. Witcher, A. T. Murphy, et al.
Regulation of iron homeostasis in anemia of chronic disease and iron deficiency anemia: diagnostic and therapeutic implications
Blood,
May 21, 2009;
113(21):
5277 - 5286.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. I. Rathore, B. J. Kerr, A. Redensek, R. Lopez-Vales, S. Y. Jeong, P. Ponka, and S. David
Ceruloplasmin Protects Injured Spinal Cord from Iron-Mediated Oxidative Damage
J. Neurosci.,
November 26, 2008;
28(48):
12736 - 12747.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. E. Van Zandt, F. B. Sow, W. C. Florence, B. S. Zwilling, A. R. Satoskar, L. S. Schlesinger, and W. P. Lafuse
The iron export protein ferroportin 1 is differentially expressed in mouse macrophage populations and is present in the mycobacterial-containing phagosome
J. Leukoc. Biol.,
September 1, 2008;
84(3):
689 - 700.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Tacchini, E. Gammella, C. De Ponti, S. Recalcati, and G. Cairo
Role of HIF-1 and NF-{kappa}B Transcription Factors in the Modulation of Transferrin Receptor by Inflammatory and Anti-inflammatory Signals
J. Biol. Chem.,
July 25, 2008;
283(30):
20674 - 20686.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Theurl, M. Theurl, M. Seifert, S. Mair, M. Nairz, H. Rumpold, H. Zoller, R. Bellmann-Weiler, H. Niederegger, H. Talasz, et al.
Autocrine formation of hepcidin induces iron retention in human monocytes
Blood,
February 15, 2008;
111(4):
2392 - 2399.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. De Domenico, D. M. Ward, G. Musci, and J. Kaplan
Evidence for the multimeric structure of ferroportin
Blood,
March 1, 2007;
109(5):
2205 - 2209.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Theurl, V. Mattle, M. Seifert, M. Mariani, C. Marth, and G. Weiss
Dysregulated monocyte iron homeostasis and erythropoietin formation in patients with anemia of chronic disease
Blood,
May 15, 2006;
107(10):
4142 - 4148.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Peyssonnaux, A. S. Zinkernagel, V. Datta, X. Lauth, R. S. Johnson, and V. Nizet
TLR4-dependent hepcidin expression by myeloid cells in response to bacterial pathogens
Blood,
May 1, 2006;
107(9):
3727 - 3732.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Donovan, C. N. Roy, and N. C. Andrews
The Ins and Outs of Iron Homeostasis
Physiology,
April 1, 2006;
21(2):
115 - 123.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Canonne-Hergaux, A. Donovan, C. Delaby, H.-j. Wang, and P. Gros
Comparative studies of duodenal and macrophage ferroportin proteins
Am J Physiol Gastrointest Liver Physiol,
January 1, 2006;
290(1):
G156 - G163.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Delaby, N. Pilard, A. S. Goncalves, C. Beaumont, and F. Canonne-Hergaux
Presence of the iron exporter ferroportin at the plasma membrane of macrophages is enhanced by iron loading and down-regulated by hepcidin
Blood,
December 1, 2005;
106(12):
3979 - 3984.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Kasvosve, Z. A. Gomo, K. J Nathoo, P. Matibe, B. Mudenge, M. Loyevsky, and V. R Gordeuk
Effect of ferroportin Q248H polymorphism on iron status in African children
Am. J. Clinical Nutrition,
November 1, 2005;
82(5):
1102 - 1106.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Yang, D. J. Haile, X. Wang, L. A. Dailey, J. G. Stonehuerner, and A. J. Ghio
Apical location of ferroportin 1 in airway epithelia and its role in iron detoxification in the lung
Am J Physiol Lung Cell Mol Physiol,
July 1, 2005;
289(1):
L14 - L23.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Wang, M. D. Garrick, F. Yang, L. A. Dailey, C. A. Piantadosi, and A. J. Ghio
TNF, IFN-{gamma}, and endotoxin increase expression of DMT1 in bronchial epithelial cells
Am J Physiol Lung Cell Mol Physiol,
July 1, 2005;
289(1):
L24 - L33.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W.-I. Leong and B. Lonnerdal
Iron transporters in rat mammary gland: effects of different stages of lactation and maternal iron status
Am. J. Clinical Nutrition,
February 1, 2005;
81(2):
445 - 453.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Knutson, M. Oukka, L. M. Koss, F. Aydemir, and M. Wessling-Resnick
Iron release from macrophages after erythrophagocytosis is up-regulated by ferroportin 1 overexpression and down-regulated by hepcidin
PNAS,
February 1, 2005;
102(5):
1324 - 1328.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Nemeth, M. S. Tuttle, J. Powelson, M. B. Vaughn, A. Donovan, D. M. Ward, T. Ganz, and J. Kaplan
Hepcidin Regulates Cellular Iron Efflux by Binding to Ferroportin and Inducing Its Internalization
Science,
December 17, 2004;
306(5704):
2090 - 2093.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Krijt, M. Vokurka, K.-T. Chang, and E. Necas
Expression of Rgmc, the murine ortholog of hemojuvelin gene, is modulated by development and inflammation, but not by iron status or erythropoietin
Blood,
December 15, 2004;
104(13):
4308 - 4310.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K J H Robson, A T Merryweather-Clarke, E Cadet, V Viprakasit, M G Zaahl, J J Pointon, D J Weatherall, and J Rochette
Recent advances in understanding haemochromatosis: a transition state
J. Med. Genet.,
October 1, 2004;
41(10):
721 - 730.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C Gasche, M C E Lomer, I Cavill, and G Weiss
Iron, anaemia, and inflammatory bowel diseases
Gut,
August 1, 2004;
53(8):
1190 - 1197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Mok, J. Jelinek, S. Pai, B. M. Cattanach, J. T. Prchal, H. Youssoufian, and A. Schumacher
Disruption of ferroportin 1 regulation causes dynamic alterations in iron homeostasis and erythropoiesis in polycythaemia mice
Development,
April 15, 2004;
131(8):
1859 - 1868.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Deicher and W. H. Horl
Hepcidin: a molecular link between inflammation and anaemia
Nephrol. Dial. Transplant.,
March 1, 2004;
19(3):
521 - 524.
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K.-y. Yeh, M. Yeh, and J. Glass
Hepcidin regulation of ferroportin 1 expression in the liver and intestine of the rat
Am J Physiol Gastrointest Liver Physiol,
March 1, 2004;
286(3):
G385 - G394.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Knutson, M. R. Vafa, D. J. Haile, and M. Wessling-Resnick
Iron loading and erythrophagocytosis increase ferroportin 1 (FPN1) expression in J774 macrophages
Blood,
December 1, 2003;
102(12):
4191 - 4197.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Sarkar, V. Seshadri, N. A. Tripoulas, M. E. Ketterer, and P. L. Fox
Role of Ceruloplasmin in Macrophage Iron Efflux during Hypoxia
J. Biol. Chem.,
November 7, 2003;
278(45):
44018 - 44024.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|