|
Originally published In Press as doi:10.1074/jbc.M206700200 on August 13, 2002
J. Biol. Chem., Vol. 277, Issue 43, 40505-40512, October 25, 2002
mRNA Decay Is Rapidly Induced after Spore Germination of
Saccharomyces cerevisiae*
Muriel
Brengues ,
Lionel
Pintard§, and
Bruno
Lapeyre¶
From the Centre de Recherche de Biochimie Macromoléculaire du
CNRS, 34293 Montpellier, Cedex 5, France
Received for publication, July 6, 2002
 |
ABSTRACT |
Spores from the yeast Saccharomyces
cerevisiae can germinate and resume their vegetative growth when
placed in favorable conditions. Biochemical studies on germination have
been limited by the difficulty of obtaining a pure population of spores
germinating synchronously. Here, we report that spores can be purified
and sorted according to their size by centrifugal elutriation and that
these spores are able to germinate synchronously. Synchronizing their
development has allowed reevaluating certain parameters of germination,
and we demonstrate that both transcription and translation are induced very rapidly after germination induction. Spores contain mRNAs that
are stable for several months in spores kept at 4 °C. Germination induction leads to very rapid degradation of these mRNAs, thus providing a simple model to study induction of mRNA decay in
eukaryotes. mRNAs from the spore are polyadenylated, capped,
and cosediment on sucrose gradients with ribosomes and polysomes and
with components of the mRNA degradation machinery. The presence of
polysomes in the spores led us to evaluate the activity of the
translation apparatus in these cells. We present evidence that there is
ongoing transcription and translation in nongerminating yeast spores
incubated in water at 30 °C, suggesting that these activities could
play a role in spore long term survival.
 |
INTRODUCTION |
Saccharomyces cerevisiae a/ diploid cells, when
deprived of nitrogen in the presence of a nonmetabolizable carbon source, can enter a developmental program known as sporulation (1).
Yeast sporulation consists of two overlapping processes, meiosis and
spore formation. Meiosis leads to the synthesis of four haploid
daughter cells that are the yeast gametes. Meanwhile, these gametes are
embedded into a specialized structure, the spore, that can resist a
variety of harsh treatments and allow the cell to survive drought,
frost, heat, and chemical exposure (2). When favorable conditions
return, the spore germinates and resumes its vegetative growth. This
germination program includes the activation of cellular metabolism,
extensive morphological changes, and reentry into the cell cycle
followed by mating. One haploid cell of the a-mating type
will encounter one haploid cell of the -mating type, and their
fusion will lead to the formation of a diploid cell, thus completing
the sexual cycle (3). The development of germinating spores has been
examined by electron microscopy (4-7), and various physiological
parameters have been characterized (8-12). For instance, protein
synthesis was reported to start 20 min and RNA transcription 70 min
after the addition of glucose (13), therefore suggesting that spores
must contain mRNA available for immediate translation. More
recently, it has been confirmed that spore germination requires active
protein synthesis during the 1st h and that it depends on the Ras
signaling pathway (14). However, biochemical analysis was limited by
the poor synchrony of germination of spores obtained by classical methods.
In contrast to spore germination, about which little was known, meiosis
had been the subject of numerous studies in yeast, and a large body of
information was available, which had been completed by transcriptome
analyses (15, 16). Meiosis requires the coordinate expression of a
large number of genes that are expressed in a timely fashion (15-17).
In addition to strict transcriptional control, this sharp pattern of
expression for early meiotic transcripts is caused by their high
instability (18, 19). Regulation of mRNA decay represents a
significant part of the post-transcriptional control of gene expression
(20). The major mRNA degradation pathway in yeast initiates with
3'-poly(A) tail shortening that is catalyzed by the
Ccr4p-Pop2p-Not complex (21, 22). It is followed by the removal
of the 5'-cap structure by the Dcp1p decapping enzyme, which exposes
the body of the transcript to Xrn1p, a 5' 3'-exonuclease (20, 23).
A complex of seven Lsm proteins (including Spb8p/Lsm1p) and
Pat1p has been shown to interact with mRNA and to be required for
mRNA decapping (20, 23-26).
We present here a method of preparing pure spores that germinate with
high synchrony, thus enabling a biochemical analysis of germination.
The addition of glucose results in rapid induction of transcription and
translation. Spores contain mRNAs that are stable for months when
the spores are kept at 4 °C; however, they are rapidly degraded when
germination is induced. These mRNAs are capped and polyadenylated
in spores, and they cosediment on sucrose gradients with ribosomes and
polysomes. We present evidence that in nongerminating spores there is
ongoing transcription and translation whose involvement in spore
survival will be discussed.
 |
EXPERIMENTAL PROCEDURES |
Strains, Media, Spore Elutriation, and Germination
Induction--
The diploid Y55 strain used for this study was provided
by J. Haber (Y55-523: MATa/ ura3).
The two HA1-tagged cyclin
genes (27) were introduced into the Y55 strain by genetic crossing,
followed by five backcrosses, then a double-tagged strain was
constructed to yield strain YBL4325 (MATa/ ade2-1 leu2- ura3-1 CLN2-3HA CLB5-3HA).
Yeast cells were handled essentially as described (28). To induce
sporulation, 4 liters of diploid cells were grown at 30 °C in YEPA
(YEPA: 1% yeast extract, 2% peptone, 2% potassium acetate) until
A600 nm ~2, then washed in H2O and
transferred into 4 liters of sporulation medium (0.3% potassium
acetate, 0.02% raffinose) for 72 h. To facilitate the enzymatic
digestion, asci were first resuspended in 10 ml/g pelleted cells in 100 mM EDTA (pH 8.0), 10 mM dithiothreitol, and
incubated for 30 min at 30 °C with gentle shaking. Then, cells were
transferred into the same volume of 50 mM sodium phosphate
buffer (pH 7.0), 1.1 M sorbitol and digested with 0.4 mg/ml
Zymolyase 20T (Seikagaku Corp.) for 3 h at 30 °C with gentle
shaking. Freed spores were then resuspended in 0.5% Triton X-100 (ICN)
and sonicated.
Separation of the yeast spores according to their size was performed
with a Beckman elutriation rotor (JE-5.0), using 0.5% Triton X-100 as
a counterbalancing fluid. A600 nm ~6,000 cells were loaded into the 30-ml elutriation chamber and centrifuged at 3,200 rpm at 4 °C. Once the gradient was established, the flow of the pump
was increased progressively, and cellular debris were expulsed from the
chamber first, as checked by microscopic observation. Then, once all
cellular debris had been eliminated, the flow was increased regularly
until cells began to exit the chamber. Fractions of 250 ml were
collected, and cell size was monitored using a cell analyzer system
(CASY-TTC, Schärfe System, Germany). Fractions containing spores
(average cell diameter ~3 µm) were pooled and resuspended in 0.5%
Triton X-100 at a concentration of A600 nm ~10.
To induce germination, spores were equilibrated at 30 °C in YEP
minus glucose, at a concentration of A600 nm
~1, and a sample was taken immediately before the addition of glucose
(time 0). Then, germination was induced by adding 2% glucose, and
samples were taken at time intervals, rapidly cooled down, and washed once in TE before freezing the cell pellets in liquid nitrogen.
For scanning electron microscopy examination, cells were fixed
overnight in phosphate buffer containing 3.6% formaldehyde, then
washed three times in phosphate buffer, once in 50% ethanol, and once
in 100% ethanol before cells underwent critical point drying using
CO2. Samples were then covered with carbon and viewed using
a Jeol GSM6300F microscope.
RNA Procedures--
RNA extraction was performed as described
previously (29, 30). RNA samples were separated either by agarose gel
electrophoresis or by PAGE. For agarose gel electrophoresis, 10 µg of
total RNA was separated onto a 1.2% agarose slab gel before capillary
transfer to positively charged Nylon (Nytran plus) performed in 10×
SSC. For PAGE, RNA was loaded onto a 0.75-mm thick, 24-cm long 6%
polyacrylamide, 8.3 M urea, 1× Tris borate-EDTA gel and
electrophoresed for 3 h at 750 V. RNA was transferred onto
Nylon membrane (Hybond N+, Amersham Biosciences) by
electroblotting in 25 mM phosphate buffer (pH 6.8)
overnight at 8 V, in the cold room. Hybridization was done as described
previously (31), either with end-labeled oligonucleotides or with
randomly primed double-stranded DNA (Neblot kit, Amersham Biosciences).
Poly(A) tail analysis was performed as described previously (32). For
RNase H cleavage experiments, 10 µg of total RNA and 100 ng of
mRNA-specific oligonucleotide (OBL137:
TTGATCTATCGATTTCAATTCAATTCAATTT) plus or minus 300 ng of oligo(dT) were
hybridized in 10 µl of 25 mM Tris-Cl (pH 7.5), 1 mM EDTA, 50 mM NaCl for 10 min at 68 °C.
Then, the mixture was slowly cooled down until it reached 30 °C and
brought to 20 µl in 20 mM Tris-Cl (pH 7.5), 10 mM MgCl2, 0.5 mM EDTA, 50 mM NaCl, 1 mM dithiothreitol, 30 µg/ml bovine serum albumin, and cleavage was performed with 0.25 unit of RNase H
(Invitrogen) for 1 h at 30 °C. The reaction was stopped by
adding 300 µl of 10 mM Tris-Cl (pH 7.5), 5 mM
EDTA, 0.5% SDS, followed by phenol-chloroform extraction and ethanol
precipitation. Immunoprecipitation of capped mRNAs was carried out
as described (33), using antibody H20 (34) except that incubation with
RNA was performed for 3 h.
Protein Extraction from Yeast Cells, Western Blotting, and
Immunoprecipitation--
Proteins were prepared and analyzed as
described previously (26). For Western blot analysis, primary
antibodies were added at the following dilutions: anti-Xrn1p (35),
1/5,000; anti-Pab1p (36), 1/5,000; rabbit polyclonal anti-eIF4E (a gift
from J. van den Heuvel), 1/2,500; anti-Qsr1p (37), 1/1,000, anti-HA, 1/1,000 (Roche Molecular Biochemicals). Anti-mouse and anti-rabbit antibodies coupled to horseradish peroxidase were obtained from Sigma.
Polysomes were prepared as originally described (38), modified
according to Ref. 30. Immunoprecipitation was performed using native
protein extracts and an anti-Pab1p antibody, as described previously
(30).
RNA and Protein Labeling--
Incorporation of labeled
precursors into trichloroacetic acid-precipitable material was
used to monitor transcription and translation activities. Cells (2 OD/ml) were labeled with 100 µCi of [3H]uracil either
for 10 min (germinating spores) or for 0-2 h (resting spores). Total
RNA was then extracted, trichloroacetic acid precipitated, and counted.
For [35S]methionine incorporation, spores (5 OD/ml) were
equilibrated either in YNB or in H2O with or without 100 µg/ml cycloheximide. After 15 min, [35S]methionine was
added and incubated for different times as indicated in the figure
legends. For incorporation studies, protein extracts were prepared and
trichloroacetic acid precipitated. For qualitative analysis, labeled
proteins were fractionated onto 12% SDS-PAGE, transferred to
nitrocellulose, and autoradiographed.
 |
RESULTS |
Preparation of Elutriated Spores--
Biochemical analysis of
germination has been limited in the past by the difficulty in obtaining
large amounts of pure spores germinating synchronously. Indeed, spores
prepared using classical methods are contaminated by vegetative cells,
and they germinate asynchronously. To overcome these problems, it was
necessary to select a yeast strain able to sporulate and germinate
efficiently and to design a new method of preparing pure spores able to
germinate synchronously. First, we tested several yeast strains for
their ability to sporulate and germinate efficiently. For instance, the
widely used laboratory strain W303 gave efficient germination but low
sporulation rates (~35%). A strain frequently used to study meiosis,
SK1, gave a very high sporulation rate (~90%), but the spores thus
obtained had a moderate rate and a poor synchrony of germination. We
selected for this analysis strain Y55, which combined a high score of
sporulation (~75%) with the best rate of germination obtained for
the strains that we tested. However, the spores obtained with this
strain were still contaminated with vegetative cells, and they
germinated asynchronously. Centrifugal elutriation has proven to be a
powerful tool to separate cells according to their size. For instance,
it permits selection of small yeast daughter cells that are able to
undergo a full cell cycle synchronously, once returned to the
appropriate growth medium (39-41). We reasoned that asynchronous
germination of yeast spores also could be because of their size
heterogeneity, and we decided to test on the spores the effect of
physical separation previously applied to vegetative cells. The Y55
strain was sporulated, and tetrads were enzymatically digested to free
the spores from the asci. After several washes and sonication, spores
were elutriated, and several fractions were collected and further
tested. The major difficulty in handling the spores came from their
extreme stickiness, which is likely necessary in their natural
environment to attach to their resting and/or feeding substrate. We
tested several conditions for elutriation and found that the addition
of 0.5% Triton X-100 was sufficient to prevent spore aggregation and
clogging of the elutriation apparatus. Once the elutriation chamber was
filled and the gradient of cells had formed in the chamber, the flux of
the liquid through the chamber was increased progressively to push the
smallest spores outside the chamber and to collect them in several
fractions. The first fractions, which contained much cellular debris,
were tested visually under a microscope and were discarded. Then, spore
sorting was monitored by measuring the cell volume using a cell
analyzer system (CASY). Before elutriation, the cell suspension was
heterogeneous in size (between 2.5- and 7.5-µm diameter) and
contained, in addition to the spores, undigested tetrads, diads,
vegetative cells, and much cellular debris (Fig. 1A). Pooled elutriated spores
had a diameter of ~3 µm (Fig. 1B), and no cellular
debris or other cell type could be observed by light microscopy. Spores
were also examined by scanning electron microscopy, which confirmed the
excellent size homogeneity of the population and the absence of
contaminating vegetative cells (Fig. 1C). Starting with
A600 nm ~6,000 cells, we routinely obtained A600 nm ~600 elutriated spores that can still
germinate after several months of storage at 4 °C in 0.5% Triton
X-100.

View larger version (63K):
[in this window]
[in a new window]
|
Fig. 1.
Spores can be sorted efficiently by
centrifugal elutriation. A and B, a diploid Y55
strain was sporulated in liquid medium for 3 days, then spores were
freed by digesting the ascus wall with zymolyase before being
elutriated using a Beckman centrifuge. Samples were taken before and
after elutriation and analyzed using a CASY apparatus (respectively,
A and B). The cell number is represented as a
function of the cell diameter in µm. Likely because of some artifact,
the actual peak of elutriated cells (~3 µm) is always preceded by a
trace on the record (~2-2.5 µm) which does not correspond to any
cells or debris when examined under a microscope. C,
scanning electron microscopy picture of elutriated yeast spores.
|
|
Nongerminating Spores Exhibit a Significant Level of Metabolic
Activity at 30 °C--
When we initiated this work, it was commonly
assumed that spores were resting cells, all of whose metabolic
activities were shut off, awaiting a germination signal to resume their
vegetative growth (see, e.g. Refs. 10 and 42). We
decided to determine carefully whether a basal level of metabolic
activity could be detected in elutriated spores prepared from strain
Y55. Unexpectedly, when incubated at 30 °C either in minimal medium
lacking a carbon source or in water, spores were able to incorporate
slowly but steadily both uracil and methionine. Incorporation of
[3H]uracil for 2 h at 30 °C was about half of the
level obtained with vegetative cells labeled for 10 min (Fig.
2A and data not shown).
Therefore, transcription activity in spores corresponded to ~5% of
its level in vegetative cells. Then, we examined protein synthesis by
measuring [35S]methionine incorporation rates in spores
incubated in water for up to 2 h (Fig. 2B).
Incorporation of methionine in spores also corresponded to ~5% of
the incorporation in vegetative cells. Similar results were obtained
with spores prepared from an SK1 strain. To visualize the synthesized
polypeptides, [35S]methionine-labeled proteins were
fractionated onto SDS-PAGE, transferred onto membrane, and
autoradiographed (Fig. 2C, lanes 1-5). The
complex pattern thus obtained revealed that numerous proteins were
synthesized in nongerminating spores. Moreover, this pattern is
specific for the spore, and it is significantly different from the one
obtained with vegetative cells (lane 6). Addition of
cycloheximide prevents protein synthesis in vegetative cells
(lane 7) but had no effect on spores (data not shown),
likely because of the inability of the drug to penetrate the cell wall of nongerminating spores. This last result demonstrates that the translational activity detected in elutriated spores was not caused by
contamination by vegetative cells that would have been otherwise inhibited by cycloheximide.

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 2.
Analysis of metabolic activities
in spores. Spores were resuspended in water
(A600 ~5) and incubated at 30 °C with 100 µCi/ml of either [3H]uracil or
[35S]methionine for the indicated time. Total RNA or
proteins were extracted, and incorporation of radioactivity was
determined by trichloroacetic acid precipitation. A,
incorporation of [3H]uracil reflects transcriptional
activity; B, incorporation of [35S]methionine
reflects translational activity; C, proteins synthesized in
nongerminating spores were fractionated onto 12% SDS-PAGE, transferred
onto membrane, and autoradiographed. VC, vegetative cells
incubated for 15 min with or without cycloheximide and then labeled for
5 min with [35S]methionine.
|
|
We conclude from these results that yeast spores do possess a basal
metabolism when placed in water at 30 °C, which corresponds to
~5% of the metabolism of exponentially growing cells.
mRNAs from Spores Cosediment with Ribosomes, Polysomes, and
Components of the Degradation Machinery--
To characterize mRNA
metabolism in spores further, we first identified mRNAs that were
present in spores, and we selected abundant ones to facilitate their
analysis. PGK1 mRNA metabolism is well characterized because it has
been used in numerous mRNA degradation studies, and it was
predicted by a transcriptome analysis to be present in late sporulation
(15). Similarly, SPS100 was originally identified by differential
screening as a gene induced in late sporulation (43). These two
mRNAs turned out to be present in spores, in which they are
relatively abundant. Mobilization of mRNA to polysomes reflects
their active translational activity (44). Therefore, we analyzed the
distribution of PGK1 and SPS100 mRNA after separation of polysomes
from free ribosomes on sucrose gradient. Cellular extracts were
fractionated onto linear sucrose gradients, then fractions were tested
by Northern blotting to localize the mRNAs and by Western blotting
to search for some of the proteins involved in mRNA translation and
degradation. Cellular extracts prepared from exponentially growing
cells contained large amounts of polysomes, which reflect their high
level of translational activity (Fig.
3A). In contrast, cellular
extracts from spores contained essentially one type of complex which
likely corresponds to 80 S particles. However, they also contained some larger complexes that are likely polysomes (Fig. 3A). The
two mRNAs PGK1 and SPS100 sedimented along with high molecular
weight complexes, roughly the size of monosome and small polysome
complexes (Fig. 3B). Moreover, Pab1p and eIF4E, the two
proteins that bind the poly(A) tails and the cap structure on the
mRNA, were also sedimenting with fractions containing the two
mRNAs along with monosomes and polysomes, even though a subset of
these proteins was also detected in lighter fractions (Fig.
3C). In addition, the exonuclease Xrn1p cosedimented with
the two mRNAs and the polysomes. This distribution is very similar
to the one observed in exponentially growing vegetative cells, except
that the latter possess a much more prominent level of polysomes
because of their higher translation rate. In conclusion, in spores
mRNAs are engaged on large structures that are likely monosomes and
polysomes.

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 3.
SPS100 and PGK1 mRNAs cosediment with
polysomes on sucrose gradients. Total cell extracts were
fractionated onto 15-50% linear sucrose gradients. A, a
continuous A254 nm record is presented, with the
top of the gradient on the right. The
arrows indicate the peaks for 40 S, 60 S, and 80 S subunits
as well as polysomes. B, 16 different fractions were
collected, then RNA was phenol extracted and analyzed by Northern
blotting with probes for SPS100 and PGK1 mRNAs. C,
identical fractions were collected directly into tubes containing
trichloroacetic acid (20% final), and precipitated proteins were
solubilized and analyzed by Western blotting using antibodies raised
against the indicated proteins, Xrn1p, Qsr1p, eIF4E, and Pab1p.
|
|
Characterization of the Structure of mRNAs Stored in
Spores--
Spores are able to survive for very long periods of time
when kept at 4 °C, and the level of endogenous mRNAs is little
affected in spores that are several months old (data not shown). We
decided to characterize the structure of mRNAs from spores to
determine whether it differs from vegetative cells. The global average
size of the poly(A) tails was determined by the RNase A protection assay (32) and found to be similar in spores and in vegetative cells
(data not shown). In addition, more than 90% of PGK1 and SPS100
mRNAs were detected in the polyadenylated fraction after oligo(dT)
cellulose fractionation (data not shown). Then, we determined specifically the poly(A) tail length of PGK1 mRNA in spores and found that it is comparable with vegetative cells (Fig.
4A). The structure of the
mRNA 5'-end from spores was analyzed by the TAP method (45), and
the results suggested that mRNA was capped (data not shown). To
confirm this observation, we performed immunoprecipitation experiments
using an antibody raised against the trimethyl cap structure of small
nuclear RNAs which also reacts with the monomethyl cap structure of
mRNAs (34). We used the trimethyl capped U3 snoRNA as a positive
control for immunoprecipitation, and the uncapped scR1 RNA was used as
a negative control for immunoprecipitation (Fig. 4B). From
the results of these experiments we conclude that PGK1 and SPS100
mRNAs are mostly capped in spores.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 4.
SPS100 and PGK1 mRNAs are capped and
polyadenylated in spores. A, to resolve the length of the
PGK1 mRNA poly(A) tail, RNA samples were cleaved with RNase H and
specific oligonucleotides before being analyzed on a 6% polyacrylamide
8.3 M urea gel. After transfer onto nylon membrane, short
RNA fragments were detected by hybridization with oligonucleotide
OBL137 (PGK1). Lanes 2 and 4, specific
cleavage with oligonucleotide ORP70 (53); lanes 1 and 3, same as above plus oligo(dT) to remove the poly(A)
tails. B, immunoprecipitation was performed with total RNA
from vegetative cells (VC) and from spores (Sp).
Three fractions were then analyzed by Northern blotting with different
probes. T, total RNA before precipitation; P,
pellet from the immunoprecipitation; S, supernatant. Probes
were for PGK1, U3, and scR1.
|
|
Spore Metabolism Declines Slowly during Incubation at 30 °C in
Water--
Because spores incubated in water were not fed, we expected
their metabolic activities to diminish with time. To test this hypothesis, spores were incubated in water at 30 °C, and their ability to incorporate [35S]methionine into proteins was
tested at different times. Protein synthesis capacity was reduced to
~50% after 24 h and to 25% after 3 days, and some activity
could still be detected after 3 weeks of incubation at 30 °C (Fig.
5A). Interestingly, spore
viability was also reduced after incubation for several weeks at
30 °C; however, this diminishing was delayed compared with the
decrease in protein synthesis capacity.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 5.
Protein synthesis, germination capacity, and
level of endogenous mRNA decreased when spores were incubated in
water at 30 °C. A, spores were incubated for various
times in water at 30 °C, then their ability to synthesize proteins
and to germinate was determined. Protein synthesis was followed by
labeling spores for 1 h with [35S]methionine at the
indicated times. Germination capacity was determined by transferring
the spores to YPD at 30 °C and incubating them for 4 h before
by measuring the budding index with an hematimeter. B, total
RNA was extracted, and 10 µg/lane was fractionated onto a
1.2% agarose formaldehyde gel and analyzed by Northern blotting with a
probe for PGK1.
|
|
Then, we determined whether this reduction in protein synthesis was
accompanied by a similar decrease in the mRNA content of spores.
Spores were incubated in water at 30 °C, and samples were taken at
different times as above. Then, RNA was extracted and analyzed by
Northern blotting using a probe for PGK1. When spores were incubated at
30 °C, PGK1 mRNA was degraded with a half-life of ~10 h,
whereas in spores kept at 4 °C it was still detected after 6 months
of storage (Fig. 5B and data not shown).
Elutriated Spores from Strain Y55 Germinate with High
Synchrony--
Elutriated Y55 spores were equilibrated in YEP medium
at 30 °C, then glucose was added, and samples were taken at
different times. The size of the spores increased very slowly during
the 1st h and then more rapidly, until the first buds appeared after 4 h of germination (Fig.
6A). Western blot analysis
revealed that synthesis of the two cyclins Clb5 and Cln2, which are
required, respectively, for DNA replication and bud emergence, occurs
240 min after inducing germination (Fig. 6B). Moreover,
electron scanning microscopy analysis of hundreds of cells showed that
more than 95% of the germinating spores at a given stage have a
similar morphology (Fig. 6C). Taken together, these
observations demonstrate that centrifugal elutriation permits selection
of spores that are homogeneous in size and germinate with high
synchrony until the entry into the S phase.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 6.
Elutriated spores germinate with high
synchrony. Y55 spores were prepared, elutriated, and equilibrated
in YEP at 30 °C. Then, germination was induced by adding 2%
glucose, and samples were taken and analyzed at the indicated time.
A, cell size (black circles) was measured with a
CASY apparatus, and budding index (open circles) was
determined by counting 200 cells at each time point with a hematimeter
and a microscope. B, the YBL4325 strain used for this
experiment expressed two HA-tagged proteins, Clb5p-HA and
Cln2p-HA, which were detected by Western blotting with an
anti-HA antibody. C, scanning electron microscopy picture of
spores after 90 min of germination.
|
|
Glucose Addition Rapidly Boosts Cellular Metabolism--
We
examined various metabolic activities during synchronous germination of
the Y55 spores prepared using the method described above.
[3H]Uracil incorporation indicated that RNA synthesis
increased within minutes of the addition of glucose until it reached
the level of synthesis of vegetative cells after ~3 h of germination (Fig. 7A and data not shown).
To confirm this observation, we examined directly the synthesis of
newly formed molecules. Five different selected mRNAs were clearly
accumulated at a high level as early as 15 min after the addition of
glucose, as demonstrated by Northern blot analysis (Fig.
7B), a result that was in striking contrast to previous
studies (13). In addition to this class of early induced genes, several
other genes accumulated later during germination, as it is the case for
PGK1 (see below) and S phase cyclins (data not shown).

View larger version (42K):
[in this window]
[in a new window]
|
Fig. 7.
Metabolic activities are rapidly boosted
after the addition of glucose. A and B, RNA
synthesis. Germination was induced by adding YNB containing 2%
glucose, then cells were labeled with 100 µCi of
[3H]uracil for 10 min, at the indicated times. Total RNA
was extracted, and incorporation of radioactivity was determined by
trichloroacetic acid precipitation (A). Similar RNA was
prepared from unlabeled cells and analyzed by Northern blotting with
probes for eIF4G, PAB1, eIF4E, actin, and calmodulin (CMD1)
(B). C and D, protein synthesis. Same
as above except that cells were labeled with 50 µCi of
[35S]methionine for 2.5 min at the indicated times.
Proteins were extracted, and incorporation of radioactivity was
determined by trichloroacetic acid precipitation (C), or
proteins were fractionated further by 12% SDS-PAGE, transferred to
nitrocellulose, and autoradiographed (D). E,
Pab1p was translated as early as 20 min after germination induction.
Pab1p was immunoprecipitated from a native cell extract prepared from
spores incubated for 5 min with [35S]methionine added 15 min after germination induction. Upper panel, Western blot
analysis; lower panel, autoradiography of the same membrane.
Spores were incubated with 2% glucose (lane 1) or 2%
2'-O-deoxyglucose (lane 2).
|
|
Protein synthesis during germination was monitored by
[35S]methionine incorporation (Fig. 7C).
Samples were analyzed by SDS-PAGE, transferred onto membrane, and
autoradiographed (Fig. 7D). As shown on the figure, mRNA
translation started within minutes of the addition of glucose to the
spores, and the pattern of newly synthesized proteins evolved during
germination. Protein synthesis was also followed by immunoprecipitating
newly synthesized proteins that were radiolabeled by incorporation of
[35S]methionine. For instance,
35S-radiolabeled Pab1p was immunoprecipitated as early as
20 min after the addition of glucose, although it was not detected when spores were incubated with a nonmetabolizable analog of glucose (2'-O-deoxyglucose) (Fig. 7E). Taken together
these results demonstrate that protein synthesis was rapidly induced
during germination.
mRNAs from Spores Are Rapidly Degraded upon Germination
Induction--
In nongerminating spores kept at 4 °C, PGK1 or
SPS100 mRNAs were very stable, whereas incubation in
H2O at 30 °C led to the decay of PGK1 after a few days
(see above and Fig. 5). Data presented above also indicate that
mRNA transcription and translation were rapidly boosted during
germination. Therefore, we wondered whether mRNA decay was also
boosted early after germination induction. We selected PGK1 and SPS100
mRNAs for this analysis for two reasons. First, their abundance in
spores facilitates their detection. Second, SPS100 is expressed
exclusively during sporulation and not in vegetative cells (43), and
PGK1 de novo synthesis starts only after 70 min of
germination (see below). Therefore, because neither of these two
mRNAs was transcribed during the 1st h of germination, it was
possible to analyze their decay solely. scR1, the RNA component of the
SRP, is a very abundant and stable cytoplasmic small RNA (46, 47) that
is commonly used as an internal standard for normalizing RNA loading.
It is noteworthy that scR1, which was known to undergo very little
variation in various physiological situations, is also present at a
constant level throughout sporulation and spore germination. PGK1 and
SPS100 mRNAs were both rapidly degraded upon germination induction.
Although PGK1 mRNA has a half-life of about 45 min in vegetative
cells (48), it has a half-life of less than 15 min in germinating
spores (Fig. 8, cycloheximide rows). SPS100 mRNA was degraded with similar kinetics. We
conclude that spores contain mRNAs that are stable for several
months in resting spores stored at 4 °C, but whose degradation is
induced very rapidly during germination.

View larger version (81K):
[in this window]
[in a new window]
|
Fig. 8.
Degradation of PGK1 and SPS100 mRNAs
during germination. RNA was prepared from germinating spores at
the indicated times and probed for PGK1, SPS100, and scR1. Spores were
incubated at 30 °C in YEP containing 2% glucose in the absence
( cyclo) or in the presence (+cyclo) of 40 µg/ml cycloheximide.
|
|
To investigate whether this degradation process was comparable with
mRNA degradation in vegetative cells, we tested the effect of
cycloheximide on the stability of these mRNAs. Cycloheximide is a
translation inhibitor that has pleiotropic effects in the cell. It has
been reported to stabilize mRNA and to prevent decapping (49-51).
Cycloheximide had no detectable effect on the level of scR1, as is the
case in vegetative cells. In contrast, PGK1 and SPS100 mRNAs were
highly stabilized by the addition of cycloheximide to the germination
medium. For instance, SPS100 half-life was increased from 15 to 180 min
(Fig. 8, +cycloheximide rows). This result suggests that the
decay pathway for these mRNAs could be similar in germinating
spores and in vegetative cells.
 |
DISCUSSION |
Yeast spore germination provides a good model for studying the
mechanisms that govern exit from dormancy and G0 to
G1 transition in a simple eukaryotic organism. However,
biochemical studies of this cell developmental model have been limited
in the past by the difficulty in preparing pure fractions of spores
cleared of any contaminating vegetative cells and able to germinate
synchronously. Indeed, studying a particular stage of germination
implies the ability to isolate components, such as RNA or proteins,
which specifically correspond to that stage. Therefore, we first
focused our attention on preparing spores devoid of any contaminating vegetative cells and able to germinate synchronously. We demonstrate in
this report that centrifugal elutriation is a powerful tool in
achieving this goal. Examination of purified spores by electron scanning microscopy revealed that elutriated spores were homogeneous in
size and not contaminated by any detectable vegetative cells. Monitoring cell size increase, budding index, and the accumulation of
cyclins by Northern and Western blotting revealed that most cells enter
the S phase synchronously at 4 h of germination. Therefore, elutriated spores will permit detailed biochemical analyses of germination.
Originally, one of our goals was to find a physiological
situation in yeast in which mRNA decay could be induced in a
controlled manner. Because it was generally accepted that spores were
resting cells (10, 11, 13, 42), we hypothesized that mRNA
degradation, as well as other metabolic activities, could be halted,
awaiting germination induction to resume. By performing Northern
blotting using a series of probes we identified PGK1 and SPS100
mRNA as being abundant in spores and not transcribed during the
first stages of germination. These mRNAs were very stable in spores kept at 4 °C, and they were still detected after 6 months of storage at 4 °C and after several days at 30 °C. However, they were very rapidly degraded when germination was induced by the addition of
glucose. Although PGK1 has a half-life of ~45 min in vegetative cells, it was degraded with a half-life of ~15 min in germinating spores. However, the structure of mRNAs stored in spores cannot account for their increased rate of degradation during germination because we found that both PGK1 and SPS100 mRNAs apparently possess normal 5'- and 3'-ends, with a structure recognized by an anticap antibody at the 5'-end and a poly(A) tail at the 3'-end. Untranslated mRNAs are generally associated within mRNP particles, not with polysomes (52). We observed that spores contain a high level of large
complexes that are likely monosomes and some polysomes, the monosome
peak being by far the most important one on sucrose gradient. The two
mRNAs PGK1 and SPS100 cosedimented with monosomes and polysomes,
therefore suggesting that they were engaged in translation. In
addition, at least three components of the degradation machinery were
detected in spores that cosedimented with polysomes and mRNAs, as
is the case for vegetative cells (6).
In the present study, we have reevaluated the levels of metabolic
activities in nongerminating spores using a highly purified population
of spores prepared by centrifugal elutriation. To detect even faint
levels of metabolism, spores were incubated at 30 °C in water, and
incubation times with radiolabeled precursors were significantly
lengthened. Under these conditions, we detected both RNA transcription
and protein synthesis, and spore metabolism was estimated to correspond
to ~5% of exponentially growing cells. Because spores incubated in
water at 30 °C were not fed, we hypothesized that their metabolic
capacity was fading rapidly with time. Indeed, we observed that protein
synthesis activity was reduced to less than 25% after 3 days at
30 °C. We concluded from these experiments that, in striking
contrast to what was postulated previously and on which we originally
based our work, spores are not quiescent cells exhibiting no metabolic
activity. Actually, spores do possess a basal level of RNA
transcription and translation when placed in water at 30 °C.
Previous studies had reported that translation takes place within 20 min of germination, whereas transcription resumes only after 70 min,
therefore suggesting that early translation must take place on mRNA
already present in spores (13). Thus, we examined the situation with
the Y55 strain chosen for this analysis, and with synchronously
germinating spores. Results obtained with incorporation of
[3H]uracil could be misleading because of the slow
turnover of this precursor. However, our preliminary data indicated
that transcription was taking off much more rapidly than described
previously. Therefore, we examined the appearance of newly formed
molecules that were absent or in low amount in spores. Our data clearly
show that transcription of several mRNAs takes place very rapidly
after germination induction. Similarly, we demonstrate that translation takes place very early during germination, by measuring
[35S]methionine incorporation and by immunoprecipitating
newly synthesized molecules. In the light of our results, we propose
now that these activities exist in spores and are simply highly boosted
upon germination induction, thus explaining why they are detected so early in germination.
These results have greatly modified our view on spore germination and
have raised several questions. First, how is metabolism down-regulated
at the end of the sporulation program, and what are the key controlling
elements? Second, how is the transition from a waking state to an
active state controlled by the addition of glucose? Third, why do
spores maintain a certain level of protein synthesis during their
dormancy? It is conceivable that basal level of RNA and protein
synthesis is required for spore survival. Our data indicate that there
is a significant delay between the decline of protein synthesis and the
decrease of spore viability. However, this lag may simply reflect the
fact that proteins synthesized in nongerminating spores have long
half-lives. In that case, ongoing metabolic activities in spores could
play a role in spore survival, a possibility that should be explored in
future experiments. Further work will also include a transcriptome
analysis of resting and germinating spores, to broaden our view of the
different classes of mRNAs that are either degraded or accumulated
in various germination conditions. However, transcriptome analysis of
sporulation performed with three different yeast strains has yielded
significantly different data for each strain, only a fraction of the
genes being regulated similarly in the three strains throughout meiosis
and sporulation (16). It is likely that a comparison of transcriptome
analyses for different yeast strains will be necessary to provide a
clear view of the core genes required to achieve this cell
developmental program.
 |
ACKNOWLEDGEMENTS |
We thank M. Aldea for the strains expressing
the HA-tagged cyclins, J. van den Heuvel for the gift of anti-eIF4E, R. Lührmann for anti-cap, and J. Haber and E. Louis for providing
several Y55 strains. We thank E. Schwob for an introduction to the
elutriation method and for numerous fruitful discussions as well as for
generously sharing equipment and supplies. We thank R. Parker, C. Bonnerot, and G. Cathala for help and stimulating discussions, and L. Dirick for critically reading the manuscript.
 |
FOOTNOTES |
*
This work was supported in part by the CNRS and by grants
from the Association pour la Recherche contre le Cancer, the Ligue contre le Cancer, and the Fondation pour la Recherche Médicale.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by a fellowship from the Ligue Nationale contre le Cancer.
§
Recipient of a fellowship from the Ministère de
l'Éducation Nationale de l'Enseignement Supérieur et de
la Recherche and from the Association pour la Recherche contre
le Cancer. Present address: Swiss Institute for Experimental
Cancer Research, Epalinges/VD, Switzerland.
¶
To whom correspondence should be addressed: CRBM, 1919 Route
de Mende, 34293 Montpellier Cedex 5, France. Tel.:
33-467-61-3680; Fax: 33-467-04-0231; E-mail:
lapeyre@crbm.cnrs-mop.fr.
Published, JBC Papers in Press, August 13, 2002, DOI 10.1074/jbc.M206700200
 |
ABBREVIATIONS |
The abbreviation used is:
HA, hemagglutinin.
 |
REFERENCES |
| 1.
|
Esposito, R. E.,
and Klapholz, S.
(1981)
in
The Molecular Biology of the yeast Saccharomyces: Life Cycle and Inheritance
(Strathern, J. N.
, Jones, E. W.
, and Broach, J. R., eds), Vol. 2
, pp. 211-287, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 2.
|
Kupiec, M.,
Byers, B.,
Esposito, R. E.,
and Mitchell, A. P.
(1997)
in
The Molecular and Cellular Biology of the Yeast Saccharomyces: Cell Cycle and Cell Biology
(Pringle, J. R.
, Broach, J. R.
, and Jones, E. W., eds), Vol. 2
, pp. 889-1036, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 3.
|
Herskowitz, I.
(1988)
Microbiol. Rev.
52,
536-553[Free Full Text]
|
| 4.
|
Rousseau, P.,
Halvorson, H. O.,
Bulla, L. A., Jr.,
and St. Julian, G.
(1972)
J. Bacteriol.
109,
1232-1238[Abstract/Free Full Text]
|
| 5.
|
Hashimoto, T.,
Conti, S. F.,
and Naylor, H. B.
(1958)
J. Bacteriol.
76,
406-416[Free Full Text]
|
| 6.
|
Steele, S. D.,
and Miller, J. J.
(1974)
Can. J. Microbiol.
20,
929-933[Medline]
[Order article via Infotrieve]
|
| 7.
|
Kreger-Van Rij, N. J.
(1978)
Arch. Microbiol.
117,
73-77[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Nagashima, T.
(1959)
Ecolog. Rev.
15,
75-78
|
| 9.
|
Rousseau, P.,
and Halvorson, H. O.
(1973)
Can. J. Microbiol.
19,
1311-1318[Medline]
[Order article via Infotrieve]
|
| 10.
|
Rousseau, P.,
and Halvorson, H. O.
(1973)
Can. J. Microbiol.
19,
547-555[Medline]
[Order article via Infotrieve]
|
| 11.
|
Rousseau, P.,
and Halvorson, H. O.
(1973)
J. Bacteriol.
113,
1289-1295[Abstract/Free Full Text]
|
| 12.
|
Choih, S. J.,
Ferro, A. J.,
and Shapiro, S. K.
(1977)
J. Bacteriol.
131,
63-68[Abstract/Free Full Text]
|
| 13.
|
Xu, G.,
and West, T. P.
(1992)
Experientia (Basel)
48,
786-788[CrossRef]
|
| 14.
|
Herman, P. K.,
and Rine, J.
(1997)
EMBO J.
16,
6171-6181[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Chu, S.,
DeRisi, J.,
Eisen, M.,
Mulholland, J.,
Botstein, D.,
Brown, P. O.,
and Herskowitz, I.
(1998)
Science
282,
699-705[Abstract/Free Full Text]
|
| 16.
|
Primig, M.,
Williams, R. M.,
Winzeler, E. A.,
Tevzadze, G. G.,
Conway, A. R.,
Hwang, S. Y.,
Davis, R. W.,
and Esposito, R. E.
(2000)
Nat. Genet.
26,
415-423[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Baker, B. S.,
Carpenter, A. T.,
Esposito, M. S.,
Esposito, R. E.,
and Sandler, L.
(1976)
Annu. Rev. Genet.
10,
53-134[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Surdej, P.,
Riedl, A.,
and Jacobs-Lorena, M.
(1994)
Annu. Rev. Genet.
28,
263-282[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Surosky, R. T.,
and Esposito, R. E.
(1992)
Mol. Cell. Biol.
12,
3948-3958[Abstract/Free Full Text]
|
| 20.
|
Wilusz, C. J.,
Wormington, M.,
and Peltz, S. W.
(2001)
Nat. Rev. Mol. Cell. Biol.
2,
237-246[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Tucker, M.,
Staples, R. R.,
Valencia-Sanchez, M. A.,
Muhlrad, D.,
and Parker, R.
(2002)
EMBO J.
21,
1427-1436[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Chen, J.,
Chiang, Y. C.,
and Denis, C. L.
(2002)
EMBO J.
21,
1414-1426[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Tucker, M.,
and Parker, R.
(2000)
Annu. Rev. Biochem.
69,
571-595[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Bouveret, E.,
Rigaut, G.,
Shevchenko, A.,
Wilm, M.,
and Séraphin, B.
(2000)
EMBO J.
19,
1661-1671[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Boeck, R.,
Lapeyre, B.,
Brown, C. E.,
and Sachs, A. B.
(1998)
Mol. Cell. Biol.
18,
5062-5072[Abstract/Free Full Text]
|
| 26.
|
Bonnerot, C.,
Boeck, R.,
and Lapeyre, B.
(2000)
Mol. Cell. Biol.
20,
5939-5946[Abstract/Free Full Text]
|
| 27.
|
Gallego, C.,
Gari, E.,
Colomina, N.,
Herrero, E.,
and Aldea, M.
(1997)
EMBO J.
16,
7196-7206[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
| Guthrie, C., and Fink, R. G. (1991) Methods Enzymol.
194
|
| 29.
|
Cross, F. R.,
and Tinkelenberg, A. H.
(1991)
Cell
65,
875-883[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Pintard, L.,
Kressler, D.,
and Lapeyre, B.
(2000)
Mol. Cell. Biol.
20,
1370-1381[Abstract/Free Full Text]
|
| 31.
|
Church, G. M.,
and Gilbert, W.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
1991-1995[Abstract/Free Full Text]
|
| 32.
|
Sachs, A. B.,
and Davis, R. W.
(1989)
Cell
58,
857-867[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Muhlrad, D.,
Decker, C. J.,
and Parker, R.
(1994)
Genes Dev.
8,
855-866[Abstract/Free Full Text]
|
| 34.
|
Bochnig, P.,
Reuter, R.,
Bringmann, P.,
and Lührmann, R.
(1987)
Eur. J. Biochem.
168,
461-467[Medline]
[Order article via Infotrieve]
|
| 35.
|
Heyer, W. D.,
Johnson, A. W.,
Reinhart, U.,
and Kolodner, R. D.
(1995)
Mol. Cell. Biol.
15,
2728-2736[Abstract]
|
| 36.
|
Adam, S. A.,
Nakagawa, T.,
Swanson, M. S.,
Woodruff, T. K.,
and Dreyfuss, G.
(1986)
Mol. Cell. Biol.
6,
2932-2943[Abstract/Free Full Text]
|
| 37.
|
Tron, T.,
Yang, M.,
Dick, F. A.,
Schmitt, M. E.,
and Trumpower, B. L.
(1995)
J. Biol. Chem.
270,
9961-9970[Abstract/Free Full Text]
|
| 38.
|
Hutchison, H. T.,
Hartwell, L. H.,
and McLaughlin, C. S.
(1969)
J. Bacteriol.
99,
807-814[Abstract/Free Full Text]
|
| 39.
|
Elliott, S. G.,
and McLaughlin, C. S.
(1978)
Proc. Natl. Acad. Sci. U. S. A.
75,
4384-4388[Abstract/Free Full Text]
|
| 40.
|
Schwob, E.,
and Nasmyth, K.
(1993)
Genes Dev.
7,
1160-1175[Abstract/Free Full Text]
|
| 41.
|
Johnston, L. H.,
and Johnson, A. L.
(1997)
Methods Enzymol.
283,
342-350[Medline]
[Order article via Infotrieve]
|
| 42.
|
Harper, J. F.,
Clancy, M. J.,
and Magee, P. T.
(1980)
J. Bacteriol.
143,
958-965[Abstract/Free Full Text]
|
| 43.
|
Law, D. T.,
and Segall, J.
(1988)
Mol. Cell. Biol.
8,
912-922[Abstract/Free Full Text]
|
| 44.
|
Perry, R. P.,
and Meyuhas, O.
(1990)
Enzyme
44,
83-92[Medline]
[Order article via Infotrieve]
|
| 45.
|
Couttet, P.,
Fromont-Racine, M.,
Steel, D.,
Pictet, R.,
and Grange, T.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
5628-5633[Abstract/Free Full Text]
|
| 46.
|
Felici, F.,
Cesareni, G.,
and Hughes, J. M.
(1989)
Mol. Cell. Biol.
9,
3260-3268[Abstract/Free Full Text]
|
| 47.
|
Hann, B. C.,
and Walter, P.
(1991)
Cell
67,
131-144[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Muhlrad, D.,
Decker, C. J.,
and Parker, R.
(1995)
Mol. Cell. Biol.
15,
2145-2156[Abstract]
|
| 49.
|
Herrick, D.,
Parker, R.,
and Jacobson, A.
(1990)
Mol. Cell. Biol.
10,
2269-2284[Abstract/Free Full Text]
|
| 50.
|
Beelman, C. A.,
and Parker, R.
(1994)
J. Biol. Chem.
269,
9687-9692[Abstract/Free Full Text]
|
| 51.
|
Hartwell, L. H.,
Hutchison, H. T.,
Holland, T. M.,
and McLaughlin, C. S.
(1970)
Mol. Gen. Genet.
106,
347-361[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Dworkin, M. B.,
Shrutkowski, A.,
and Dworkin-Rastl, E.
(1985)
Proc. Natl. Acad. Sci. U. S. A.
82,
7636-7640[Abstract/Free Full Text]
|
| 53.
|
Decker, C. J.,
and Parker, R.
(1993)
Genes Dev.
7,
1632-1643[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Cotoras, C. Garcia, and L. Mendoza
Botrytis cinerea isolates collected from grapes present different requirements for conidia germination
Mycologia,
May 1, 2009;
101(3):
287 - 295.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|