|
Originally published In Press as doi:10.1074/jbc.M206043200 on August 23, 2002
J. Biol. Chem., Vol. 277, Issue 43, 40768-40774, October 25, 2002
Identification of ATF-2 as a Transcriptional Regulator for the
Tyrosine Hydroxylase Gene*
Takahiro
Suzuki ,
Tohru
Yamakuni§¶,
Masatoshi
Hagiwara , and
Hiroshi
Ichinose **
From the Division of Molecular Genetics, Institute
for Comprehensive Medical Science, Fujita Health University, Toyoake,
Aichi 470-1192, Japan, the § Department of Pharmaceutical
Molecular Biology, Graduate School of Pharmaceutical Sciences, Tohoku
University, Aoba, Aramaki, Aoba-ku, Sendai 980-8578, Japan, the
¶ Mitsubishi Kagaku Institute of Life Sciences, 11 Minamiooya,
Machida, Tokyo 194-8511, Japan, and the Department of Functional
Genomics, Medical Research Institute, Tokyo Medical and Dental
University, Tokyo 113-8510, Japan
Received for publication, June 18, 2002, and in revised form, August 7, 2002
 |
ABSTRACT |
Transcriptional regulation of
catecholamine-synthesizing genes is important for the determination of
neurotransmitters during brain development. We found that three
catecholamine-synthesizing genes were transcriptionally up-regulated in
cloned PC12D cells overexpressing V-1, a protein that is highly
expressed during postnatal brain development (1). To reveal the
molecular mechanism to regulate the expression of tyrosine hydroxylase
(TH), which is the rate-limiting enzyme for catecholamine biosynthesis,
we analyzed the transcription factors responsible for TH induction in
the V-1 clonal cells. First, by using reporter constructs, we found
that the transcription mediated by cAMP-responsive element (CRE) was
selectively enhanced in the V-1 cells, and TH promoter activity was
totally dependent on the CRE in the promoter region of the TH gene.
Next, immunoblot analyses and a transactivation assay using a GAL4
reporter system revealed that ATF-2, but not cAMP-responsive
element-binding protein (CREB), was highly phosphorylated and activated
in the V-1 cells, while both CREB and ATF-2 were bound to the TH-CRE.
Finally, the enhanced TH promoter activity was competitively attenuated
by expression of a plasmid containing the ATF-2 transactivation domain.
These data demonstrated that activation of ATF-2 resulted in the
increased transcription of the TH gene and suggest that ATF-2 may be
deeply involved in the transcriptional regulation of
catecholamine-synthesizing genes during neural development.
 |
INTRODUCTION |
Catecholamines are synthesized from L-tyrosine by the
sequential action of four enzymes: tyrosine is converted to DOPA by tyrosine hydroxylase (TH),1
DOPA to dopamine by aromatic L-amino acid decarboxylase
(AADC), dopamine to norepinephrine by dopamine -hydroxylase (DBH),
and norepinephrine to epinephrine by phenylethanolamine
N-methyltransferase. The regulation of the gene expression
of these enzymes is important for the determination of the expression
of neurotransmitters during brain development as well as for brain
function under physiological and pathological conditions.
TH is the rate-limiting enzyme for catecholamine biosynthesis. The
transcriptional regulation of the TH gene has been extensively studied,
and many transcription factors were suggested to regulate TH gene
expression. CREB, ATF-1, and CREM were shown to recognize the
cAMP-responsive element (CRE) located at position 45/ 38 in the TH
promoter (2-6). CREB was reported to mediate basal and cAMP-induced TH
transcription in various cultured cells including PC12 cells by the use
of dominant-negative CREB protein and antisense RNA against CREB
(7-10). CREB is activated by phosphorylation on Ser133
(11, 12). The activation of CREB by phosphorylation has been shown to
mediate PKA-dependent (7, 13-15) and -independent (13, 14)
induction of TH transcription. Functional and physiological roles of
ATF-1 and CREM for TH transcription remained unclear. AP-1
transcription factors bound to the TPA-responsive element located at
205/ 199 in the TH promoter, which also plays a critical role in the
transcriptional induction of the TH gene (16). Expression of AP-1
family was induced by several stimuli to enhance TH gene transcription,
and overexpression of Fra-2 and c-Fos stimulated TH transcription in
PC12 and PC18 cells, respectively (17, 18).
Nurr1 and Ptx3/Pitx3, which are expressed in midbrain dopaminergic
neuron at embryonic stage, were recently shown to regulate TH gene
expression. Nurr1-null mice lacked TH immunoreactivity in midbrain
(19), and overexpression of Nurr1 was shown to induce the TH gene
expression in neural stem cells (20, 21). However, it is unclear
whether or not Nurr1 directly acts on its responsive element in the TH
promoter region (20, 21). Overepxression of Ptx3/Pitx3 activated the TH
promoter activity in neuroblastoma cells through its responsive
elements (22, 23).
Three of the catecholamine-synthesizing enzymes, i.e. TH,
AADC, and DBH, were up-regulated in cloned PC12D cells overexpressing V-1 (1). V-1 is an adaptor-like protein, the expression of which is
transiently high during postnatal brain development (24, 25).
Therefore, V-1 potentially participate TH gene expression in postnatal
brain development. We were interested in the intracellular events in
the V-1-overexpressing PC12D cells, because none of the transcription
factors are known to induce these catecholamine-synthesizing genes simultaneously.
In the present study, we found that the transcription mediated by CRE
was specifically and highly elevated in the V-1 cells, and that
transcription of the TH gene is enhanced by activation of ATF-2, which
directly acted on the CRE in the TH promoter. Our results suggest that
ATF-2 is involved in the expression of the TH gene during neural development.
 |
MATERIALS AND METHODS |
Cell Culture--
Two PC12D clones stably and highly expressing
V-1, named V1-46 and V1-69, and two vector control clones, termed C-7
and C-9, were established as described previously (1). Parental PC12D cells were cultured in Dulbecco's modified Eagle's medium
containing 10% horse serum and 5% fetal bovine serum. The stable
clones were cultured in medium containing 280 µg/ml G418 (Invitrogen).
Reporter Plasmids--
Mouse TH genomic DNA containing 5.5 kb of
its 5'-flanking region, and exon 1 was originally isolated from a mouse
genomic library and cloned into the pBluescript II KS(+) plasmid
(mTH5.5-pBS). First, to produce mTHpro0.8-Luc, which contains the
region of 752 bp from the transcriptional start site to the
translational start site of the mouse TH gene, we amplified a fragment
containing about 1.2 kb of the mouse TH 5'-flanking region by PCR using
primers GTTCCCTTAGTGAGAGGACAC (forward) and GGAATTCCATGGTGCAAGCTGGTGGTC (reverse) and mTH5.5-pBS. The region between 752 bp from the transcriptional start position and the translational start site was
ligated to a firefly luciferase reporter plasmid, PGV-B2 (Toyoink, Tokyo). The entire sequence of the inserted TH 5'-flanking region was
confirmed by DNA sequencing using an ABI PRISM 310 genetic analyzer
(Applied Biosystems). Next, to produce mTHpro4.3-Luc, a fragment that
corresponded to the region between 4326 and 753 bp from the
transcriptional start position was isolated by the digestion of
mTH5.5-pBS with XhoI and then inserted into the
XhoI site of mTHpro0.8-Luc. To produce a CRE mutant of
mTHpro0.8-Luc that contained a 4-base deletion in a canonical CRE
sequence of the TH promoter region (TGACGTCA), we digested
the wild-type mTHpro0.8-Luc with AatII to result in a
plasmid cut in the middle of the CRE sequence, blunted the end with T4
exonuclease, and then religated it.
Firefly luciferase reporter plasmids containing a cyclic AMP-, AP-1-,
NF- B-, glucocorticoid-, heat shock protein-, or serum-responsive element upstream of a TATA-like promoter (PTAL) region
taken from herpes simplex thymidine kinase promoter were purchased from
Clontech. The following plasmids were purchased
from Stratagene as parts of PathDetect trans-reporting
systems: pFC-MEKK and pFC-PKA are MEKK (amino acids 380 to 672) and PKA
(catalytic subunit) expression vectors, respectively; pFA2-CREB and
pFA-ATF-2 are expression vectors that consist of CREB (amino acids
1-280) and ATF-2 (amino acids 1-96) transactivation domains fused to
the GAL4 DNA binding domain (GAL4DBD, amino acids 1-147),
respectively; pFC-dbd is the control vector for GAL4DBD
only; and pFR-Luc reporter is a reporter plasmid containing five copies
of the GAL4-responsive element.
DNA Transfection and Luciferase Assay--
Seapansy luciferase
vectors, pRL-CMV and pRL-TK (Toyoink), were used as an internal control
to normalize for variations in transfection efficiency. Cells were
transfected by lipofection using LipofectAMINE 2000 (Invitrogen). One
day prior to transfection, the cells were plated on 24-well plates and
transfected at ~50% confluence. In the experiments shown in Figs.
1-3, the cells were transfected with 0.75 µg of the firefly reporter
plasmids and 0.05 µg of pRL-CMV per well. In experiments using the
GAL4 system shown in Fig. 6, cells were transfected with 0.65 µg of
pFR-Luc, 0.05 µg of pFA2-CREB or pFA-ATF-2, and 0.05 µg of pRL-TK
per well. As a positive control, 0.05 µg of a PKA-expression vector
(PKA) or a MEKK-expression vector (MEKK) was used for co-transfection of the parental PC12D cells, and otherwise, pBluescript plasmid was
used as a carrier DNA. In the experiments shown in Fig. 7, the cells
were transfected with 0.25 µg of mTHpro4.3-Luc or PGV-C2 (a SV40
promoter luciferase vector, Toyoink), 0.5 µg of pFA-ATF2, pFA2-CREB,
or pFC2-dbd, and 0.05 µg of pRL-CMV per well. At 48 h after
transfection, the cells were harvested and assayed for firefly and
seapansy luciferase activities by using a PicaGene Dual
luciferase assay kit (Toyoink).
Preparation of Cell Lysates--
Cells were washed three times,
suspended in ice-cold phosphate-buffered saline, and then pelleted in a
microcentrifuge at 300 × g for 3 min. For preparation
of nuclear extracts for electrophoretic mobility shift assays and
immunoblot analysis of phosphorylated proteins, the cell pellet was
lysed, and nuclear proteins were extracted as described (26) except
that all buffers contained 0.10 volume of a Protease Inhibitors
Cocktail (Sigma) substitute for phenylmethylsulfonyl fluoride
and contained 0.01 volume of Phosphatase Inhibitor Cocktails I
and II (Sigma). Protein concentration of the nuclear extract was
determined by the method of Bradford (27), with bovine -globulin
used as a standard. For preparation of whole-cell extracts for
immunoblot analysis of phosphorylated proteins, the cell pellet was
directly lysed in SDS-sample buffer, and the supernatant was collected
as the whole-cell extract. The cell lysates were stored at 80 °C
in small aliquots until assayed.
Electrophoretic Mobility Shift Assay--
Sense and antisense
strands of rat TH-CRE oligonucleotides (sense, GAGGGGCTTTGACGTCAGCCTGG)
were annealed and end-labeled with [ -32P]ATP (6000 Ci/mmol, PerkinElmer Life Sciences) by use of T4 polynucleotide kinase.
DNA-protein binding reactions were performed as described by Nankova
et al. (18) with a slight modification. Briefly, the basic
binding buffer contained 0.5 µg/µl bovine serum albumin, 0.1 µg/µl poly(dI-dC), 1 ng of end-labeled TH-CRE oligonucleotide (~35,000 cpm), and 10 µg of nuclear extract. Double-stranded
oligonucleotides or antibodies (1 µl; Cell Signaling Technology) were
preincubated on ice for 1 h prior to the addition of the labeled
oligonucleotide, and the reaction was initiated by the addition of the
labeled oligonucleotide. The mixture was then incubated for 20 min at room temperature. Electrophoresis was performed as described by Kapatos
et al. (28), and radioactivity was visualized by exposing the x-ray film for 12 h at 80 °C.
Immunoblot Analysis--
Phosphorylated form-specific and
nonspecific antibodies against CREB, ATF-2, and c-Jun were purchased
from Cell Signaling Technology. Immunoblotting were performed following
the supplier's protocol. The cell lysate was separated by SDS-PAGE and
transferred to a polyvinylidene difluoride membrane (Bio-Rad). Proteins
were visualized with ECL plus (Amersham Biosciences).
Statistics--
Student's t test was used for
statistical evaluations. A level of p < 0.05 was
accepted as statistically significant.
 |
RESULTS |
Increased Promoter Activity of the TH Gene in Clonal PC12D Cells
Overexpressing V-1--
We previously described that TH enzymatic
activity, protein level, and mRNA level were all elevated in
V-1-overexpressing clones (V1-46 and V1-69) compared with their values
for the control (C-7 and C-9) clones (1). To examine the transcription
of the TH gene in the V-1 and control clones, we transfected the cloned cells with plasmid constructs containing 4.3 kb of mouse TH 5'-flanking region fused to a luciferase reporter gene (mTHpro4.3-Luc). Reporter activity relative to pRL-CMV was significantly increased in the V-1
clones compared with that in the control clones (Fig.
1), suggesting that the increased level
of TH mRNA in the V-1 clones was mainly due to an increased
transcriptional rate and that cis-acting DNA elements
located within the 4.3 kb of 5'-flanking region of the TH gene were
required for the overexpression of the TH gene.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 1.
Transient transfection assay using a TH
promoter construct. A, diagram of a reporter plasmid
containing 4.3 kb of the TH 5'-flanking region (mTHpro4.3-Luc).
B, relative reporter activity of mTHpro4.3-Luc in
V-1-overexpressing clones (V1-46 and V1-69; closed bars) and
control clones (C-7 and C-9; open bars) was measured. A
seapansy luciferase vector, pRL-CMV, was used as an internal control to
normalize for variations in transfection efficiency. Data are the
mean ± S.D. values from three independent experiments. Values of
p were calculated from the two control clones, and the
higher values are shown: *, p < 0.05.
|
|
CRE-mediated Transcription Was Increased in the V-1 Clones--
To
explore the transcriptional events changed in the V-1 clones, we
measured promoter activities of reporter genes containing cAMP-, AP-1-,
NF- B-, glucocorticoid-, heat shock protein-, and serum-responsive
elements. In the V-1 clones, we found that the transcriptional activity
mediated by CRE was greatly elevated compared with that in the control
clones, whereas that mediated by the other elements was unchanged (Fig.
2).

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 2.
Enhancement of CRE-mediated transcription in
the V-1 clones. A, reporter vectors have a specific
cis-acting element, cAMP-, AP-1-, NF- B-, glucocorticoid-, heat shock
protein-, or serum-responsive element (AP1, CRE,
GRE, HSE, B, and SRE,
respectively), upstream from the TATA-like promoter region taken from
the herpes simplex virus thymidine kinase (PTAL) and
connected to firefly luciferase cDNA. The control vector lacks the
responsive element and has PTAL only. B, The
relative activity of the reporter gene in one clone was evaluated as
-fold activation to the activity of the control vector in the same
clone. Transfection efficiency was normalized using pRL-CMV. Data are
the mean ± S.D. values from three to five independent
experiments. Values of p for CRE activities of V-1 clones
were calculated from the 2 control clones and the higher values are
shown: *, p < 0.05; **, p < 0.001.
|
|
Evaluation of CRE-dependent Expression of the TH Gene
in the V-1 Clones--
A CRE consensus motif (TCACGTCA) exists in the
5'-flanking region of the rat TH gene (29), and the sequence and its
location (near the TATA-box) are highly conserved among rat, mouse, and man (30). It was earlier shown that the TH-CRE was essential for both
basal and cyclic AMP-induced transcription of the TH gene in various
cell lines, including PC12 cells (3, 31) and a subclone of PC12 (29).
To evaluate the contribution of the increased activity of CRE-mediated
transcription to the increased transcription of the TH gene in the V-1
clonal cells, we made wild-type and CRE-mutagenized TH reporter vectors
containing about 0.8 kb of the mouse TH 5'-flanking region upstream
from the transcriptional start site (mTHpro0.8-Luc; Fig.
3A). The reporter activity of the wild-type mTHpro0.8-Luc was markedly increased in V1-69 cells (Fig.
3B), as had been the case for mTHpro4.3-Luc (Fig. 1). The reporter activity of the CRE mutant was almost the same as that of the
promoter-less vector, PGV-B2 in V1-69, C-7, and the parental PC12D
cells (Fig. 3B). Results for the other V-1 clone, V1-46, were similar to those for V1-69 (data not shown). These results indicated the importance of the CRE-mediated transcription for the
regulation of the TH gene expression in the V-1 cells.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 3.
Deletion of CRE abolished transcription of a
TH reporter gene in the V-1 and control cells. A,
reporter plasmids containing 0.8 kb of the TH 5'-flanking region
without or with a mutation in the CRE consensus motif
(mTHpro0.8-Luc and mTHpro0.8CREmt-Luc, respectively) were constructed.
Deleted residues in the CRE mutant are in boldface type.
B, reporter activities of the wild-type (open
bars) and the CRE-mutant (closed bars) TH promoter
constructs, and of the promoter-less vector PGV-B2 (hatched
bars), were evaluated in a V-1 clone (V1-69) and in a control
clone (C-7). Data are the mean ± S.D. values from three to six
independent experiments. Values of p were calculated
compared with the values of both the control clone and the parental
PC12D cells: *, p < 0.001.
|
|
Identification of ATF-2 as a Transcription Factor Binding to TH-CRE
in PC12D Cells--
To identify transcriptional factors that might be
involved in the CRE-mediated transcription of the TH gene, we conducted an electrophoretic mobility shift assay using nuclear extracts of PC12D
cells and analyzed binding proteins that made a complex with the TH-CRE
(Fig. 4). There were major bands
(Bands 1-3) that disappeared in a
dose-dependent manner by the addition of excess amounts of
cold TH-CRE competitor (Fig. 4, lanes 2-5). However, an
excess molar amount of TH-CRE mutant also decreased the amount of Band
3 to the same extent as did the TH-CRE wild type, whereas Bands 1 and 2 remained almost unaffected (Fig. 4, lanes 6-8), indicating
that Bands 1 and 2 represented the protein-DNA complexes specific to
the TH-CRE. An anti-CREB antibody supershifted Band 2 to Band B (Fig.
4, lane 13), and an anti-ATF-2 antibody supershifted Band 1 to Band A (Fig. 4, lane 14), indicating that Bands 1 and 2 represented complexes containing ATF-2 and CREB, respectively. Since
ATF-2 was reported to bind to CRE as a homodimer or as a heterodimer
with c-Jun (32-34), we examined whether c-Jun was contained in the
TH-CRE complex. An anti-c-Jun antibody did not supershift Band 1 containing ATF-2 (Fig. 4, lane 15).

View larger version (64K):
[in this window]
[in a new window]
|
Fig. 4.
Analysis of DNA-protein complex formation
between TH-CRE oligonucleotide and nuclear extract obtained from PC12D
cells. A, sequences of oligonucleotides used in this
assay. Consensus sequences of CRE and AP-1 oligonucleotides (TH-CREwt
and TH-AP-1) are in boldface type. Mutations in a CRE mutant
oligonucleotide (TH-CREmu) are underlined.
32P-Labeled TH-CREwt was used as a probe. Cold TH-CREwt,
TH-CREmu, and TH-AP-1 were used in excess amount as competitors.
B, binding of nuclear extract obtained from PC12D cells to
32P-labeled TH-CREwt. Descriptions of lanes: 1,
free probe; 2-11, competition assay with excess molar
excess (10-, 30-, and 100-fold) of cold oligonucleotides;
12-15, supershift assay with antibodies; 2,
buffer control for competitors; 3-5, cold TH-CREwt;
6-8, TH-CREmu; 9-11, TH-AP-1; 12,
buffer control for antibodies; and 13-15, antibodies
against CREB, ATF-2, and c-Jun, respectively. Data are representative
from three to five independent experiments.
|
|
We also conducted an electrophoretic mobility shift assay using TH-CRE
and nuclear extracts of V-1 and control clones. There was no
significant difference in band patterns between V-1 or control clones
and the parental PC12D cells (data not shown). These data suggest that
proteins binding to the TH-CRE, including CREB and ATF-2, were not
dramatically changed in the V-1 clones.
Activation of ATF-2 in the V-1 Clones--
CREB and ATF-2 are well
characterized among ATF/CRE binding proteins; phosphorylation of CREB
on Ser133 (11, 12) or phosphorylation of ATF-2 on
Thr69/71 (35, 36) activates the CRE-mediated transcription.
Since we identified CREB and ATF-2 as transcription factors binding to
the TH-CRE as was shown in Fig. 4, we next examined the phosphorylation and expression of CREB and ATF-2 in the V-1 clones by Western blot
analysis using phosphorylated form-specific and nonspecific antibodies
against CREB or ATF-2. As positive controls, PC12D cells were treated
with forskolin (FSK) or nerve growth factor (NGF) for 15 min (11, 37).
In whole-cell extracts of FSK- or NGF-stimulated PC12D cells, the
Ser133-phosphorylated form of CREB was much increased (Fig.
5A, upper panels).
Faster running bands that were immunostained with the antibody against
CREB phosphorylated on Ser133 appeared, and the intensity
of bands immunostained with anti-CREB antibody was reduced by FSK- and
NGF-stimulation (Fig. 5A, upper panels),
suggesting that CREB was rapidly degraded after its activation. In
addition, phosphorylation of ATF-2 was also increased by FSK or NGF
stimulation in PC12D cells, while the total amount of ATF-2 protein was
unchanged (Fig. 5A, lower panels). In the V-1
clones, although there were no or few changes in the expression and
phosphorylation of CREB compared with those in the control clones and
the non-stimulated parental PC12D cells (Fig. 5A,
upper panels), the level of the phosphorylated form of ATF-2
(on Thr71) was increased without any significant change in
the expression of ATF-2 (Fig. 5A, lower
panels).

View larger version (57K):
[in this window]
[in a new window]
|
Fig. 5.
Phosphorylation of ATF-2 was increased in the
V-1 clones. Western blotting was performed using phosphorylated
form-specific or nonspecific antibody against CREB or ATF-2.
A, whole-cell extracts were prepared from PC12D cells
incubated without or with 10 µM FSK or 10 ng/ml NGF and
from V-1 or control clones. Whole-cell extracts were separated by
SDS-PAGE (10% gel) and then analyzed by immunoblotting with antibodies
against CREB phosphorylated on Ser133 and CREB
(left and right of upper panels,
respectively) or ATF-2 phosphorylated on Thr71 and ATF-2
(left and right of lower panels,
respectively). B, nuclear extracts were prepared from V-1
and control clones and separated by SDS-PAGE (8% gel) and then
analyzed by immunoblotting with antibodies against ATF-2 dual
phosphorylated on Thr69/71 (left panel), ATF-2
phosphorylated Thr71 (middle panel), and ATF-2
(right panel). Data are representative from three to five
independent experiments.
|
|
Previous mutation analysis of Thr69 and Thr71
of ATF-2 strongly indicated that the dual phosphorylated form of ATF-2,
i.e. the protein phospho-Thr69 and
-Thr71, is the transcriptionally active form (35, 36). This
form of ATF-2 was greatly increased in nuclear extracts of the V-1 clones, compared with that in those of the control clones (Fig. 5B). On the other hand, the amount of ATF-2 was not
increased in the nuclear extracts of the V-1 clones (Fig.
5B).
We also used the GAL4 reporter assay to examine expression vectors
expressing the transactivation domain of CREB or ATF-2 (CREBTAD, amino acids 1-280 or ATF-2TAD, amino
acids 1-96, respectively) fused to a GAL4-DNA binding domain
(GAL4DBD). Although the
GAL4DBD-CREBTAD activity in the parental PC12D
cells transiently co-transfected with a PKA expression vector was
dramatically increased, this activity in the V-1 clones was unchanged
compared with that in the control clone and the non-stimulated parental
PC12D cells (Fig. 6A). In
contrast, the GAL4DBD-ATF-2TAD activity in the
V-1 clones was greatly increased and was comparable with that in PC12D cells transiently co-transfected with an active MEKK expression vector
as a positive control (Fig. 6B). These data demonstrate that, ATF-2, as a TH-CRE-binding protein, was highly phosphorylated and activated in the V-1 clones.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 6.
Activation of a GAL4-ATF-2 fusion protein in
the V-1 clones. A, expression vectors for fusion
proteins (pFA2-CREB and pFA-ATF-2) consist of the transactivation
domain of CREB and ATF-2 (CREBTAD and ATF-2TAD,
respectively) fused with the DNA binding domain of the yeast GAL4
(GAL4DBD). The luciferase reporter vector (pFR-Luc) confers
GAL4 responsiveness. B, the reporter activities in the
presence of GAL4DBD-CREBTAD (A) and
GAL4DBD-ATF-2TAD (B) were measured
in the V-1 and control clones and in the parental PC12D cells. pRL-TK
was used as an internal control to normalize for variations in
transfection efficiency. As a positive control, PKA-expression vector
(PKA) or a MEKK-expression vector (MEKK) was used
for co-transfection of the parental PC12D cells. Data are the mean ± S.D. values from two independent experiments done in triplicate.
Values of p were calculated based on the value of the
parental PC12D cells: *, p < 0.001.
|
|
Enhanced Activity of the TH Promoter in the V-1 Clones Was
Attenuated by the Expression of the ATF-2 Transactivation
Domain--
To examine whether the enhanced activity of the TH gene
transcription was due to activation of ATF-2, we adapted the
GAL4DBD-ATF-2TAD expression vector to the
reporter assay for the TH promoter. Overexpression of the
GAL4DBD-ATF-2TAD protein containing the
phosphorylation sites was expected to interfere competitively with the
activation of the endogenous ATF-2 protein for the CRE-mediated TH gene
transcription. The reporter activity of mTHpro0.8-Luc in the V1-69
clone was greatly decreased by co-transfection with the
GAL4DBD-ATF-2TAD expression vector compared
with that when the control vector that expressed GAL4DBD
only was used for co-transfection, whereas that in the parental PC12D
cells was slightly, but not significantly, decreased (Fig.
7A). The increased TH promoter
activity in the V-1 clone remained unchanged by co-transfection with
the GAL4DBD-CREBTAD expression vector in
contrast to the GAL4DBD-ATF-2TAD expression vector (Fig. 7A). In contrast to the TH promoter, the SV40
promoter was not activated in the V-1 clone and not affected by the
expression of either GAL4DBD-ATF-2TAD or
GAL4DBD-CREBTAD (Fig. 7B).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 7.
Enhanced activity of the TH promoter in the
V-1 clones was attenuated by expression of ATF-2 transactivation
domain. Relative activities of the TH promoter vector
(mTHpro4.3-Luc, A) and SV40 promoter vector (PGV-C2,
B) were measured. The luciferase reporter vectors were used
for co-transfection along with the expression vector for
GAL4DBD-ATF-2TAD (closed bars),
GAL4DBD-CREBTAD (hatched bars), or a
control vector for GAL4DBD only (open bars); and
pRL-CMV was used as an internal control to normalize for variations in
transfection efficiency. The V1-69 clone and the parental PC12D cells
were used. Data are the mean ± S.D. values from two independent
experiments done in triplicate. Values of p were calculated
based on the value of the control vector: *, p < 0.001.
|
|
 |
DISCUSSION |
In the present study, we found that CRE-mediated transcription was
highly elevated in V-1-overexpressing clones of the PC12D cell line. We
then identified ATF-2 as one of the TH-CRE-binding proteins in PC12D
cells, and, for the first time, found that activation of ATF-2
up-regulated the TH gene transcription via CRE.
ATF-2 (32), also called CRE-BP1 (34), is a member of the ATF/CREB
family of transcription factors that bind to CRE. The TH-CRE was shown
to be recognized by other members of the ATF/CREB family,
i.e. CREB, ATF-1, and CREM (2-6). Among these transcription factors, only CREB was shown to be an activator of the TH gene transcription (7-10). Our data confirmed that CREB is one of the TH-CRE-binding proteins in PC12D cells (Fig. 4). However, our data
showed that the enhanced transcription of the TH gene in the V-1 clones
was driven by a CREB-independent mechanism, because neither CREB
phosphorylation (Fig. 5) nor GAL4DBD-CREBTAD
activity (Fig. 6) was enhanced.
In contrast to CREB, we showed that ATF-2 was highly phosphorylated on
Thr69 and Thr71 in the V-1 clones (Fig. 5) and
that GAL4DBD-ATF-2TAD activity was greatly
enhanced (Fig. 6). There was no significant difference between the V-1
and control cells in expression level of ATF-2 determined by immunoblot
analysis (Fig. 5) and in binding of ATF-2 to the TH-CRE determined by
the gel mobility shift assay (data not shown). Because the
GAL4DBD-ATF-2TAD protein containing the phosphorylation sites had a dominant-negative effect for the enhanced activity of the TH promoter in the V-1 cells (Fig. 7), our data collectively show that phosphorylation of ATF-2 induced the TH gene
transcription in the V-1 clones.
The stress-activated kinases (SAPKs), such as Jun amino-terminal kinase
(JNK) (36) and p38/HOG (38), both of which phosphorylate ATF-2, have
been identified as stimulators of ATF-2 (35, 36, 39). However the
phosphorylation state or expression of these kinases in the V-1 clones
was little changed compared with that of the control or parental PC12D
cells, as determined by Western blotting analysis with antibodies
against phosphorylated JNK or p38/HOG (data not shown). Although we
have not yet identified the kinase that phosphorylates ATF-2 in the V-1
clones, a small up-regulation of these kinases may contribute to the
long-lasting ATF-2 activation in the V-1 clones. Alternatively, there
is a possibility that the activity of phosphatases active toward ATF-2, which have not been identified, may be decreased in the V-1 clones. It
is of importance that the mechanism of the increased phosphorylation of
ATF-2 in the V-1 clones be explored.
Our results suggest the involvement of phosphorylated ATF-2 in the
enhanced CRE-mediated transcription in the V-1 clones. Although there
are some reports showing enhancement of CRE-mediated transcription by
phosphorylation of ATF-2 on Thr69 and Thr71
(40, 41), the mechanism is largely unknown. In the case of CREB, it is
well known that phosphorylation of CREB on Ser133 directly
recruits CBP, a transcriptional co-activator (42-44), and results in
the transcriptional activation of the target gene. The transactivation
domain of ATF-2, however, was reported not to interact with CBP even
after phosphorylation (45). No protein has been identified as one that
specifically binds to phosphorylated ATF-2 to elevate CRE-mediated
transcription. The V-1 cells could be a good material to explore the mechanism.
ATF-2 was reported to bind not only to CRE, but also to AP-1 binding
motif (33). Using nuclear extracts of striatal neurons, Guo et
al. (46) found that ATF-2 bound to a TH-AP-1 oligonucleotide dissociated from the TH-AP-1 after the cells had been stimulated to
induce TH expression. Since Band 1 containing ATF-2 was reduced in the
presence of a TH-AP-1 competitor, though to a less extent than a TH-CRE
competitor (Fig. 6, lanes 9-11), our data confirmed weak
interaction of ATF-2 with the TH-AP-1. However, our data suggest that
the TH-AP-1 does not contribute to the enhanced expression of the TH
gene by the activated ATF-2 in the V-1 clones, because the activity of
the AP-1-mediated transcription was unchanged in the V-1 clones (Fig.
2). NGF, a factor that induces differentiation of the sympathetic
neurons in association with the expression of TH (47), preferentially
activates the AP-1-mediated transcription in PC12 cells. It was
reported that NGF-induced potentiation of the TH promoter activity was
completely blocked by mutation of the TH-AP-1, but not by that of the
TH-CRE (31), whereas enhanced activity of the TH promoter via the
cAMP-PKA pathway was completely blocked by mutation of the TH-CRE (3,
31). The complete loss of the promoter activity in the TH-CRE mutant in
the V-1 clones (Fig. 3) also suggests that AP-1-mediated transcription
is independent of the enhancement of the TH gene transcription in the
V-1 clones.
Mouse null mutants of ATF-2 died shortly after birth and displayed
symptoms of severe respiratory distress with lungs filled with meconium
(48). In the ATF-2-deficient mice, an increased level of TH mRNA
was shown in the embryonic brain, and the authors attributed it to
hypoxia in the mice (48). Our data, however, may suggest another
possibility that it reflects a direct influence of the disappearance of
ATF-2 for the TH gene expression.
Although ATF-2 was reported to be required for postnatal neural
development (49), activation of ATF-2 was also observed in apoptotic
cells, i.e. activation of ATF-2 reduced the survival rate of
differentiated PC12 cells (50). There may be some unknown mechanisms of
ATF-2 to regulate both apoptosis and differentiation of neural cells.
Because the TH gene expression was induced by ATF-2 activation in the
V-1 clones, these cells would be a good model for investigating the
function of ATF-2 during neural development.
GTP cyclohydrolase I (GCH) is the rate-limiting enzyme for the de
novo synthesis of tetrahydrobiopterin, which is an important regulator of TH enzymatic activity and the protein level (51). In the
V-1 clonal cells, we recently showed an increased tetrahydrobiopterin content and enhanced expression of GCH (52). In our previous study, we
showed increased promoter activity of the GCH gene in the V-1 clones
(52) as we did for that of the TH gene in this report. Recently, ~150
bp of the 5'-promoter region of the GCH gene was identified as the
region contributing to basal and cyclic AMP-induced transcriptional
activity and containing a non-canonical CRE (28, 53), and we showed
that this region was sufficient for the increased activity of the GCH
promoter in the V-1 clones (52). Hirayama et al. (53)
reported that the proximal promoter region could recruit ATF-2. These
observations suggest that ATF-2 may coordinately regulate the
expression of both TH and GCH genes.
It is interesting that the mRNA levels of AADC and DBH were also
up-regulated in the V-1 clones (1), in addition to those of TH and GCH.
Since the DBH gene has a noncanonical CRE in its 5'-flanking region to
mediate cAMP-responsiveness (54); it is quite possible that the
increased activity of the CRE-mediated transcription in the V-1 clones
is responsible for the increased expression of the DBH gene. However,
with the respect to the elevated expression of the AADC gene, the
relationship between it and the CRE-mediated transcription has not yet
been reported. Even though the expression of each enzyme might be
governed by different transcription factors, any concerted regulatory
mechanism(s) would be expected to play key roles during neural
development. The present data suggest that ATF-2 may be involved in
coordinate expression of the catecholamine-synthesizing enzymes for the
development of catecholaminergic neurons.
In contrast to our observation of the enhanced expression of the
catecholamine-synthesizing enzymes in the stable transformants of PC12D
cells overexpressing V-1, transient transfection of PC12D cells with
V-1 plasmids did not enhance the activities of the CRE- and TH
promoter-reporting genes (data not shown). Because an increased
expression of TH was observed in transgenic mice overexpressing
V-1,2 our data suggest that
the enhanced expression of the TH gene may be a consequence of long
lasting expression of V-1. Although we have not fully clarified the
action of V-1 in the cells, we showed that ATF-2 in the V-1 cells were
activated and that activation of ATF-2 enhances TH gene transcription.
We are now investigating the general role of ATF-2 in transcription of
the TH gene as well as that of other catecholamine-synthesizing genes.
 |
ACKNOWLEDGEMENTS |
We thank Dr. Shunsuke Ishii and Dr. Toshiaki
Katada for helpful discussion. We also thank Drs. Hiroshi Ishiguro and
Akira Nakashima for technical advice.
 |
FOOTNOTES |
*
This work was supported by grants from the programs
grants-in-aid for Encouragement of Young Scientists (to T. S.);
grants-in-aid for Scientific Research on Priority Areas (C), Advanced
Brain Science Project (to H. I.), from the Ministry of Education,
Culture, Sports, Science, and Technology of Japan; Health Science
Research Grants, Research on Human Genome, Tissue Engineering Food
Biotechnology, from the Ministry of Health, Labor, and Welfare of Japan
(to H. I.); and Human Frontier Science Program (to H. I.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
**
To whom correspondence should be addressed: Division of Molecular
Genetics, Inst. for Comprehensive Medical Science, Fujita Health
University, Toyoake, Aichi 470-1192, Japan. Tel.: 81-562-93-9391; Fax:
81-562-93-8831; E-mail: hichi@fujita-hu.ac.jp.
Published, JBC Papers in Press, August 23, 2002, DOI 10.1074/jbc.M206043200
2
T. Yamakuni, T. Yamamoto, H. Yamamoto,
S.-Y. Song, T. Nagatsu, K. Kobayashi, M. Yokoyama, A. Nakano, R. Suzuki, N. Suzuki, S. Iwashita, A. Omori, Y. Ichinose, C. Kato, M. Kobayashi, and Y. Ishida, unpublished observations.
 |
ABBREVIATIONS |
The abbreviations used are:
TH, tyrosine
hydroxylase;
AADC, aromatic L-amino acid decarboxylase;
DBH, dopamine -hydroxylase;
CRE, cAMP-responsive element;
CREB, cAMP-responsive element-binding protein;
CREM, cAMP-responsive
element modulator;
PKA, protein kinase A;
FSK, forskolin;
NGF, nerve growth factor;
GCH, GTP cyclohydrolase I;
MEKK, mitogen-activated
protein kinase/extracellular signal-regulated kinase kinase
kinase.
 |
REFERENCES |
| 1.
|
Yamakuni, T.,
Yamamoto, T.,
Hoshino, M.,
Song, S. Y.,
Yamamoto, H.,
Kunikata-Sumitomo, M.,
Minegishi, A.,
Kubota, M.,
Ito, M.,
and Konishi, S.
(1998)
J. Biol. Chem.
273,
27051-27054[Abstract/Free Full Text]
|
| 2.
|
Tinti, C.,
Conti, B.,
Cubells, J. F.,
Kim, K. S.,
Baker, H.,
and Joh, T. H.
(1996)
J. Biol. Chem.
271,
25375-25381[Abstract/Free Full Text]
|
| 3.
|
Kim, K. S.,
Lee, M. K.,
Carroll, J.,
and Joh, T. H.
(1993)
J. Biol. Chem.
268,
15689-15695[Abstract/Free Full Text]
|
| 4.
|
Hyman, S. E.,
Comb, M.,
Lin, Y. S.,
Pearlberg, J.,
Green, M. R.,
and Goodman, H. M.
(1988)
Mol. Cell. Biol.
8,
4225-4233[Abstract/Free Full Text]
|
| 5.
|
Shimomura, A.,
Okamoto, Y.,
Hirata, Y.,
Kobayashi, M.,
Kawakami, K.,
Kiuchi, K.,
Wakabayashi, T.,
and Hagiwara, M.
(1998)
J. Neurochem.
70,
1029-1034[Medline]
[Order article via Infotrieve]
|
| 6.
|
Usukura, J.,
Nishizawa, Y.,
Shimomura, A.,
Kobayashi, K.,
Nagatsu, T.,
and Hagiwara, M.
(2000)
Genes Cells
5,
515-522[Abstract]
|
| 7.
|
Swanson, D. J.,
Zellmer, E.,
and Lewis, E. J.
(1997)
J. Biol. Chem.
272,
27382-27392[Abstract/Free Full Text]
|
| 8.
|
Nagamoto-Combs, K.,
Piech, K. M.,
Best, J. A.,
Sun, B.,
and Tank, A. W.
(1997)
J. Biol. Chem.
272,
6051-6058[Abstract/Free Full Text]
|
| 9.
|
Piech-Dumas, K. M.,
and Tank, A. W.
(1999)
Brain Res. Mol. Brain Res.
70,
219-230[Medline]
[Order article via Infotrieve]
|
| 10.
|
Lazaroff, M.,
Patankar, S.,
Yoon, S. O.,
and Chikaraishi, D. M.
(1995)
J. Biol. Chem.
270,
21579-21589[Abstract/Free Full Text]
|
| 11.
|
Gonzalez, G. A.,
and Montminy, M. R.
(1989)
Cell
59,
675-680[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Sheng, M.,
McFadden, G.,
and Greenberg, M. E.
(1990)
Neuron
4,
571-582[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Beitner-Johnson, D.,
and Millhorn, D. E.
(1998)
J. Biol. Chem.
273,
19834-19839[Abstract/Free Full Text]
|
| 14.
|
Nankova, B.,
Hiremagalur, B.,
Menezes, A.,
Zeman, R.,
and Sabban, E.
(1996)
Brain Res. Mol. Brain Res.
35,
164-172[Medline]
[Order article via Infotrieve]
|
| 15.
|
Lane-Ladd, S. B.,
Pineda, J.,
Boundy, V. A.,
Pfeuffer, T.,
Krupinski, J.,
Aghajanian, G. K.,
and Nestler, E. J.
(1997)
J. Neurosci.
17,
7890-7901[Abstract/Free Full Text]
|
| 16.
|
Trocmé, C.,
Mallet, J.,
and Biguet, N. F.
(1997)
J. Neurosci. Res.
48,
489-498[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Sun, B.,
and Tank, A. W.
(2002)
J. Neurochem.
80,
295-306[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Nankova, B. B.,
Rivkin, M.,
Kelz, M.,
Nestler, E. J.,
and Sabban, E. L.
(2000)
J. Neurosci.
20,
5647-5653[Abstract/Free Full Text]
|
| 19.
|
Zetterström, R. H.,
Solomin, L.,
Jansson, L.,
Hoffer, B. J.,
Olson, L.,
and Perlmann, T.
(1997)
Science
276,
248-250[Abstract/Free Full Text]
|
| 20.
|
Sakurada, K.,
Ohshima-Sakurada, M.,
Palmer, T. D.,
and Gage, F. H.
(1999)
Development (Camb.)
126,
4017-4026[Abstract]
|
| 21.
|
Wagner, J.,
Åkerud, P.,
Castro, D. S.,
Holm, P. C.,
Canals, J. M.,
Snyder, E. Y.,
Perlmann, T.,
and Arenas, E.
(1999)
Nat. Biotechnol.
17,
653-659[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Cazorla, P.,
Smidt, M. P.,
O'Malley, K. L.,
and Burbach, J. P.
(2000)
J. Neurochem.
74,
1829-1837[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Lebel, M.,
Gauthier, Y.,
Moreau, A.,
and Drouin, J.
(2001)
J. Neurochem.
77,
558-567[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Taoka, M.,
Yamakuni, T.,
Song, S. Y.,
Yamakawa, Y.,
Seta, K.,
Okuyama, T.,
and Isobe, T.
(1992)
Eur. J. Biochem.
207,
615-620[Medline]
[Order article via Infotrieve]
|
| 25.
|
Taoka, M.,
Isobe, T.,
Okuyama, T.,
Watanabe, M.,
Kondo, H.,
Yamakawa, Y.,
Ozawa, F.,
Hishinuma, F.,
Kubota, M.,
Minegishi, A.,
Song, S.-Y.,
and Yamakuni, T.
(1994)
J. Biol. Chem.
269,
9946-9951[Abstract/Free Full Text]
|
| 26.
|
Dignam, J. D.,
Lebovitz, R. M.,
and Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1489[Abstract/Free Full Text]
|
| 27.
|
Bradford, M. M.
(1976)
Anal. Biochem.
72,
248-254[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Kapatos, G.,
Stegenga, S. L.,
and Hirayama, K.
(2000)
J. Biol. Chem.
275,
5947-5957[Abstract/Free Full Text]
|
| 29.
|
Lewis, E. J.,
Harrington, C. A.,
and Chikaraishi, D. M.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
3550-3554[Abstract/Free Full Text]
|
| 30.
|
Tinti, C.,
Yang, C.,
Seo, H.,
Conti, B.,
Kim, C.,
Joh, T. H.,
and Kim, K. S.
(1997)
J. Biol. Chem.
272,
19158-19164[Abstract/Free Full Text]
|
| 31.
|
Ghee, M.,
Baker, H.,
Miller, J. C.,
and Ziff, E. B.
(1998)
Brain Res. Mol. Brain Res.
55,
101-114[Medline]
[Order article via Infotrieve]
|
| 32.
|
Hai, T. W.,
Liu, F.,
Coukos, W. J.,
and Green, M. R.
(1989)
Genes Dev.
3,
2083-2090[Abstract/Free Full Text]
|
| 33.
|
Hai, T.,
and Curran, T.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
3720-3724[Abstract/Free Full Text]
|
| 34.
|
Maekawa, T.,
Sakura, H.,
Kanei-Ishii, C.,
Sudo, T.,
Yoshimura, T.,
Fujisawa, J.,
Yoshida, M.,
and Ishii, S.
(1989)
EMBO J.
8,
2023-2028[Medline]
[Order article via Infotrieve]
|
| 35.
|
Livingstone, C.,
Patel, G.,
and Jones, N.
(1995)
EMBO J.
14,
1785-1797[Medline]
[Order article via Infotrieve]
|
| 36.
|
Gupta, S.,
Campbell, D.,
Dérijard, B.,
and Davis, R. J.
(1995)
Science
267,
389-393[Abstract/Free Full Text]
|
| 37.
|
Ginty, D. D.,
Bonni, A.,
and Greenberg, M. E.
(1994)
Cell
77,
713-725[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Raingeaud, J.,
Gupta, S.,
Rogers, J. S.,
Dickens, M.,
Han, J.,
Ulevitch, R. J.,
and Davis, R. J.
(1995)
J. Biol. Chem.
270,
7420-7426[Abstract/Free Full Text]
|
| 39.
|
van Dam, H.,
Wilhelm, D.,
Herr, I.,
Steffen, A.,
Herrlich, P.,
and Angel, P.
(1995)
EMBO J.
14,
1798-1811[Medline]
[Order article via Infotrieve]
|
| 40.
|
Sano, Y.,
Harada, J.,
Tashiro, S.,
Gotoh-Mandeville, R.,
Maekawa, T.,
and Ishii, S.
(1999)
J. Biol. Chem.
274,
8949-8957[Abstract/Free Full Text]
|
| 41.
|
Kawasaki, H.,
Schiltz, L.,
Chiu, R.,
Itakura, K.,
Taira, K.,
Nakatani, Y.,
and Yokoyama, K. K.
(2000)
Nature
405,
195-200[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Yamamoto, K. K.,
Gonzalez, G. A.,
Menzel, P.,
Rivier, J.,
and Montminy, M. R.
(1990)
Cell
60,
611-617[CrossRef][Medline]
[Order article via Infotrieve]
|
| 43.
|
Chrivia, J. C.,
Kwok, R. P.,
Lamb, N.,
Hagiwara, M.,
Montminy, M. R.,
and Goodman, R. H.
(1993)
Nature
365,
855-859[CrossRef][Medline]
[Order article via Infotrieve]
|
| 44.
|
Parker, D.,
Rivera, M.,
Zor, T.,
Henrion-Caude, A.,
Radhakrishnan, I.,
Kumar, A.,
Shapiro, L. H.,
Wright, P. E.,
Montminy, M.,
and Brindle, P. K.
(1999)
Mol. Cell. Biol.
19,
5601-5607[Abstract/Free Full Text]
|
| 45.
|
Sano, Y.,
Tokitou, F.,
Dai, P.,
Maekawa, T.,
Yamamoto, T.,
and Ishii, S.
(1998)
J. Biol. Chem.
273,
29098-29105[Abstract/Free Full Text]
|
| 46.
|
Guo, Z., Du, X.,
and Iacovitti, L.
(1998)
J. Neurosci.
18,
8163-8174[Abstract/Free Full Text]
|
| 47.
|
Gizang-Ginsberg, E.,
and Ziff, E. B.
(1990)
Genes Dev.
4,
477-491[Abstract/Free Full Text]
|
| 48.
|
Maekawa, T.,
Bernier, F.,
Sato, M.,
Nomura, S.,
Singh, M.,
Inoue, Y.,
Tokunaga, T.,
Imai, H.,
Yokoyama, M.,
Reimold, A.,
Glimcher, L. H.,
and Ishii, S.
(1999)
J. Biol. Chem.
274,
17813-17819[Abstract/Free Full Text]
|
| 49.
|
Reimold, A. M.,
Grusby, M. J.,
Kosaras, B.,
Fries, J. W.,
Mori, R.,
Maniwa, S.,
Clauss, I. M.,
Collins, T.,
Sidman, R. L.,
Glimcher, M. J.,
and Glimcher, L. H.
(1996)
Nature
379,
262-265[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Leppä, S.,
Eriksson, M.,
Saffrich, R.,
Ansorge, W.,
and Bohmann, D.
(2001)
Mol. Cell. Biol.
21,
4369-4378[Abstract/Free Full Text]
|
| 51.
|
Sumi-Ichinose, C.,
Urano, F.,
Kuroda, R.,
Ohye, T.,
Kojima, M.,
Tazawa, M.,
Shiraishi, H.,
Hagino, Y.,
Nagatsu, T.,
Nomura, T.,
and Ichinose, H.
(2001)
J. Biol. Chem.
276,
41150-41160[Abstract/Free Full Text]
|
| 52.
|
Suzuki, T.,
Inagaki, H.,
Yamakuni, T.,
Nagatsu, T.,
and Ichinose, H.
(2002)
Biochem. Biophys. Res. Commun.
293,
962-968[CrossRef][Medline]
[Order article via Infotrieve]
|
| 53.
|
Hirayama, K.,
Shimoji, M.,
Swick, L.,
Meyer, A.,
and Kapatos, G.
(2001)
J. Neurochem.
79,
576-587[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Ishiguro, H.,
Kim, K. T.,
Joh, T. H.,
and Kim, K. S.
(1993)
J. Biol. Chem.
268,
17987-17994[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. Kvetnansky, E. L. Sabban, and M. Palkovits
Catecholaminergic Systems in Stress: Structural and Molecular Genetic Approaches
Physiol Rev,
April 1, 2009;
89(2):
535 - 606.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. D. Gueorguiev, S.-Y. Cheng, and E. L. Sabban
Prolonged Activation of cAMP-response Element-binding Protein and ATF-2 Needed for Nicotine-triggered Elevation of Tyrosine Hydroxylase Gene Transcription in PC12 Cells
J. Biol. Chem.,
April 14, 2006;
281(15):
10188 - 10195.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Adamski and E. N. Benveniste
17{beta}-Estradiol Activation of the c-Jun N-Terminal Kinase Pathway Leads to Down-Regulation of Class II Major Histocompatibility Complex Expression
Mol. Endocrinol.,
January 1, 2005;
19(1):
113 - 124.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Taoka, T. Ichimura, A. Wakamiya-Tsuruta, Y. Kubota, T. Araki, T. Obinata, and T. Isobe
V-1, a Protein Expressed Transiently during Murine Cerebellar Development, Regulates Actin Polymerization via Interaction with Capping Protein
J. Biol. Chem.,
February 14, 2003;
278(8):
5864 - 5870.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|