|
Originally published In Press as doi:10.1074/jbc.M200379200 on August 12, 2002
J. Biol. Chem., Vol. 277, Issue 43, 41230-41239, October 25, 2002
Modulators of Inflammation Use Nuclear Factor- B and Activator
Protein-1 Sites to Induce the Caspase-1 and Granzyme B Inhibitor,
Proteinase Inhibitor 9*
Padma
Kannan-Thulasiraman and
David J.
Shapiro
From the Department of Biochemistry, University of Illinois,
Urbana, Illinois 61801-3602
Received for publication, January 14, 2002, and in revised form, August 12, 2002
 |
ABSTRACT |
Proteinase inhibitor 9 (PI-9) inhibits caspase-1
(interleukin (IL)-1 -converting enzyme) and granzyme B, thereby
regulating production of the pro-inflammatory cytokine IL-1 and
susceptibility to granzyme B-induced apoptosis. We show that cellular
PI-9 mRNA and protein are induced by IL-1 , lipopolysaccharide,
and 12-O-tetradecanoylphorbol-13-acetate. We identified
functional imperfect nuclear factor- B (NF- B) sites at 135 and
88 and a consensus activator protein-1 (AP-1) site at 308 in the
PI-9 promoter region. Using transient transfections in HepG2 cells to
assay PI-9 promoter mutations, we find that mutational ablation of the
AP-1 site or of either NF- B site reduces IL-1 -induced expression
of PI-9 by ~60%. Mutational ablation of the two NF- B sites and of
the AP-1 site nearly abolishes both basal and IL-1 -induced
expression of PI-9. Nuclear extracts from IL-1 -treated HepG2 cells
exhibited strong, IL-1 -inducible binding to the NF- B sites and to
the AP-1 site. Electrophoretic mobility shift assays show that after
IL-1 treatment c-Jun/c-Fos and JunD bind to the AP-1 site, whereas
the p50/p65 heterodimer binds to the two NF- B sites. Estrogens
induce PI-9, but induction of PI-9 by estrogens and IL-1 is not
synergistic. In transiently transfected, estrogen receptor-positive
HepG2ER7 cells, estrogens do not interfere with IL-1 induction,
whereas IL-1 exhibits dose-dependent repression of
estrogen-inducible PI-9 expression. Our surprising finding that the
pro-inflammatory cytokine IL-1 strongly induces PI-9 suggests a
novel mechanism for regulating inflammation and apoptosis through a
negative feedback loop controlling expression of the anti-inflammatory
and anti-apoptotic protein, PI-9.
 |
INTRODUCTION |
The cellular serine proteinase inhibitor (serpin), proteinase
inhibitor 9 (PI-9),1 is
unique in its ability to inhibit inflammation and apoptosis (1-5).
PI-9 is a potent inhibitor of caspase-1-mediated inflammation (4, 5)
and of granzyme-B-induced apoptosis (3, 6). The primary role of
caspase-1 (interleukin-1 (IL-1 )-converting enzyme, ICE protease)
is to mediate immune and inflammatory reactions by catalyzing the
maturation of the pro-inflammatory cytokines, IL-1 and IL-18.
IL-1 and IL-18 are synthesized as inactive precursors that are
converted to their active forms by proteolytic cleavage by caspase-1
(7). Recent studies implicate IL-1 in the pathogenesis of diseases
such as atherosclerosis, hepatitis, and cirrhosis of the liver (5, 8,
9). The expression of PI-9 is dysregulated and inversely related to
caspase-1 activity and IL-1 production in atherosclerotic plaques,
suggesting that PI-9 may be involved in the regulation of inflammatory
and immune responses in vivo (5).
In addition to its anti-inflammatory action, PI-9 acts as an
anti-apoptotic protein by inhibiting the serine protease, granzyme B
(3). Granzyme B is found in granules produced by cytolytic T
lymphocytes (CTLs) and natural killer (NK) cells. CTLs and NK cells use
perforin- and granzyme B-containing granules and the FAS mediated
pathway to destroy neoplastic cells, or cells infected with
intracellular pathogens (10, 11). In target cells, granzyme B induces
apoptosis in part by proteolytically cleaving several inactive
pro-caspases and thereby converting them into their active forms (12).
The expression of high levels of PI-9 in CTLs, immune-privileged cells,
and dendritic cells may protect these cells against misdirected granzyme B released during immune responses (3, 13-15). A recent study
described a close correlation between the level of expression of PI-9
or its mouse orthologue, SPI-6, and the ability of several tumor cell
lines to evade apoptosis mediated by CTL and NK cells. These data led
the investigators to suggest a role for elevated expression of PI-9 in
the ability of some tumors to evade immune attack (6).
Because PI-9 is likely to play an important role in modulating
inflammation and apoptosis, the regulation of PI-9 gene expression is
of particular interest. Previously, we showed that PI-9 is an
estrogen-inducible gene in human liver and in HepG2 human
hepatoblastoma cells (8). PI-9 gene transcription is induced by binding
of estrogen-estrogen receptor complex to a unique downstream
estrogen-responsive unit (16). In the course of that work we identified
a consensus activator protein-1 (AP-1) site at 308 and showed that
deletion of the AP-1 site did not alter estrogen induction of PI-9.
Here we report that further analysis of the PI-9 promoter region
identifies three potential imperfect nuclear factor- B (NF- B)
sites. AP-1 and NF- B are ubiquitous transcription factors and
pleiotropic regulators of the inducible expression of numerous genes
involved in the modulation of processes important in inflammatory and
host defense events (17, 18).
The AP-1 transcription factor is a heterodimer composed of members of
the Fos, Jun, and Fra families of proto-oncogenes. In different cell
and promoter contexts, AP-1 alters gene expression in response to
growth factors, cytokines, oxidative stress, and phorbol esters
(19-21). NF- B is composed of homodimeric and heterodimeric complexes of the Rel family of proteins, p65 (Rel A), p50/p105, c-Rel,
p52/100, and Rel B (21, 22). Activation of NF- B by extracellular
signals such as cytokines, phorbol esters, lipopolysaccharide (LPS),
and oxidative stress leads to the phosphorylation and subsequent degradation of its inhibitor, I B, allowing NF- B to translocate into the nucleus, bind to specific DNA sites in the promoter regions of
target genes, and activate their transcription (23, 24).
The ability of PI-9 to modulate inflammatory and apoptotic events and
the presence of putative NF- B and AP-1 elements upstream of the PI-9
transcription initiation site led us to examine the ability of agents
that modulate inflammation to regulate PI-9 gene expression. The
pro-inflammatory cytokine, IL-1 , and other pro-inflammatory agents
including LPS and TPA induced PI-9 mRNA and protein in liver cells.
Using transient transfection of reporter gene constructs containing
mutationally inactivated NF- B and AP-1 sites, we found that the
NF- B sites at 135 and 88 and the AP-1 site at 308 are all
necessary for efficient IL-1 induction of PI-9. Binding studies and
gel shift assays showed that after treatment of the cells with IL-1 ,
c-Jun, JunD, and c-Fos bind to the AP-1 site. After IL-1 treatment,
the p50/p65 NF- B heterodimer binds to the two NF- B sites. Using a
construct derived from a cellular gene induced by estrogen and
pro-inflammatory agents, we show that a pro-inflammatory agent
(IL-1 ) suppresses estrogen induction. Despite PI-9 anti-inflammatory
and anti-apoptotic effects, the pro-inflammatory cytokine IL-1
produced as a result of caspase-1 action was a potent inducer of PI-9
in several human cell lines. This study suggests a novel form of
end-product regulation. IL-1 strongly induces PI-9, which in turn
inhibits caspase-1, blocking the formation of additional active
IL-1 .
 |
EXPERIMENTAL PROCEDURES |
Generation of AP-1 and NF- B Mutations in the PI-9
Promoter--
The full-length PI-9 promoter cloned upstream of a
firefly luciferase gene in the plasmid pGL3-Basic (16) was used to
generate mutations in the AP-1 and NF- B binding sites. Mutations
were generated using the Stratagene QuikChange kit (Stratagene, La Jolla, CA) in the presence of 1 M betaine (Sigma). In each
case, the AP-1 or NF- B sequences of the PI-9 promoter were mutated to a HindIII site. The ERU was mutated at the imperfect
estrogen response element with a two-base change and at one of the
consensus estrogen response element half sites by creating a
HindIII site. The mutations in the ERU primer are
underlined:
5'-CGGGGCGGACTGGCAGGACCCTGAAGCTTCCCTGCTCCCAGC-3'. All constructs were verified by sequencing using the BIG DYE
terminator cycle sequencing kit (Applied Biosystems, Foster City, CA).
Cell Culture, Transient Transfections, and Luciferase
Assays--
Twenty-four hours before transfection, HepG2 cells (and
HepG2ER7 cells, generously provided by Dr. D. Zajchowski (8)) were plated in Dulbecco's modified Eagle's medium, 10% charcoal
dextran-treated fetal bovine serum, and penicillin-streptomycin.
Transfections were carried out using calcium phosphate coprecipitation
in 12-well plates with 50 ng of PI-9-luciferase construct, 15 ng of
pRLSV40 (Promega, Madison, WI) as internal standard, and 1.9 µg of
pTZ18U as carrier. In experiments using moxestrol, 25 ng of CMVhER was used. After 14-16 h, the transfected cells were shocked with 20% glycerol and placed in medium with or without mediators as indicated in
the figure legends. In transient transfection experiments using pyrrolidine dithiobicarbamate (PDTC), HepG2 cells were treated with 240 µM PDTC. Cells were harvested and assayed using the
dual-luciferase assay kit according to the manufacturer's protocol (Promega).
HeLa cells were cultured under the same conditions as HepG2 cells.
However, transfections were performed using Lipofectin Plus
reagent (Invitrogen) according to the manufacturer's instructions with
the following DNA concentrations: 50 ng of PI-9 promoter-luciferase construct, 10 ng of pRLSV40, and 0.3 µg of PTZ18U. Transfected cells
were incubated with or without 5 ng/ml IL-1 (R&D Systems, Minneapolis, MN) for 24 h, and dual luciferase assays were performed.
MCF-7 cells were maintained in minimal essential medium with
Hanks' salts, 10 mM Hepes, 10% heat-inactivated fetal
bovine serum, and penicillin-streptomycin. Transient transfections were performed with LipofectAMINE 2000 (Invitrogen) according to the manufacturer's instructions with 540 ng of PI-9 promoter-luciferase construct, 10 ng of pRLSV40, and 0.8 µg of pTZ18U. After the addition of liposomes, the cells were treated with 5 ng/ml IL-1 for 24 h
before harvesting the cells.
CHO-S cells were maintained in Dulbecco's modified Eagle's/F-12
medium, 10% heat-inactivated fetal bovine serum,
L-glutamine, and penicillin-streptomycin. Transient
transfections were performed using LipofectAMINE 2000, with 25 ng of
PI-9 promoter-luciferase construct, 10 ng of pRLSV40, and 0.8 µg of pTZ18U.
Quantitative Reverse Transcription-PCR--
Total RNA from
HepG2ER7 cells and from Daudi cells (maintained in RPMI, 5 mM Hepes, 1 mM sodium pyruvate, 2 mM L-glutamate, 10% heat-inactivated fetal
bovine serum, and penicillin-streptomycin) treated with TPA, IL-1 ,
or LPS for the indicated times (see Figs. 1 and 2) was extracted using
Trizol (Invitrogen) according to the manufacturer's protocol and
treated with RNase-free DNase for 15 min at 37 °C followed by
phenol-chloroform extraction. Reverse transcription was performed using
1 µg of total RNA, 5 µM random hexamer primers, and
Moloney murine leukemia virus (Invitrogen) according to the
manufacturer's directions at 37 °C for 1 h. A 1-µl aliquot
of the reverse transcription reaction was used for thermocycling. Each
PCR reaction contained 12.5 µl of 2× Taqman master mix (PE
Biosysytems, Foster City, CA), 300 nM forward and reverse
primers, and 200 nM PI-9 probe
(5'-fam-catacacaagggaaatgccctttaaaataaacca-tamra-3') (fam,
6-carboxyfluorescein; tamra, 6-carboxytetramethylrhodamine) in 25 µl
of total volume. For the internal control, 18 S rRNA was used
containing both control primers and probe (PE Biosystems, Foster city,
CA). Detection and data analysis were carried out on an ABI PRISM 7700 sequence detection system.
Western Blot Analysis--
Cell proteins were separated on a
15% SDS-polyacrylamide gel and transferred using the trans-blot
semi-dry transfer cell (Fisher) at 15 V for 15 min. The membrane was
blocked overnight with 3% nonfat milk and 0.05% Tween followed by a
1-h incubation with the primary PI-9 polyclonal antibody diluted
1:2,000 in 1% nonfat milk and 0.2% Tween in phosphate-buffered
saline. After a 15-min wash (PBS with 0.05% Tween), the membrane was
incubated for 1 h with the secondary goat-anti rabbit antibody
diluted at 1:10,000. Following a 1-h wash, antigen-antibody complexes
were detected using West Pico chemiluminescent substrate (Pierce).
Preparation of HepG2 Cell Nuclear Extract--
Nuclear extract
from HepG2 cells was prepared as described previously (25) with
modifications. Briefly, cells were washed twice with ice-cold
phosphate-buffered saline and collected after centrifugation at
300 × g for 5 min. Cells were resuspended in ice-cold
buffer containing 10 mM Hepes, pH 7.8, 10 mM
KCl, 1.5 mM MgCl2, 1 mM
dithiothreitol, 0.1 mM EDTA, 1 mM
phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, and 2 µg/ml
pepstatin and kept on ice for 15 min. Cells were lysed in 0.1% Nonidet
P-40 and vortexed for 10 s, and the nuclear pellet was recovered
after centrifugation at 13, 000 × g for 10 s at
4 °C. The nuclear pellet was resuspended in ice-cold buffer
containing 20 mM Hepes, pH 7.8, 0.4 M NaCl, 1 mM EDTA, 1.5 mM MgCl2, 1 mM dithiothreitol, 20% glycerol, 1 mM
phenylmethylsulfonyl fluoride, 10 µg/ml aprotinin, and 2 µg/ml pepstatin and incubated on ice for 20 min with shaking. Nuclear extract
was retained after centrifugation at 14,000 rpm for 5 min at 4 °C,
and the supernatant was separated into aliquots and stored at
80 °C. Protein concentration was determined by the Bradford method
(Bio-Rad).
Transcription Factor Binding Assays--
To measure AP-1 or
NF- B activation and their interaction with sites of the PI-9
promoter, competition experiments were performed using the Trans-AM
AP-1 c-Jun and NF- B p50 kit according to the manufacturer's
protocol (Active Motif, Carlsbad, CA). Briefly, an oligonucleotide
containing either a consensus AP-1 or NF- B site immobilized on a
96-well plate was incubated with 5 µg of untreated or 1.5 h of
IL-1 (5 ng/ml)-treated HepG2 nuclear extract in the presence of
double-stranded oligonucleotides containing as competitor either an
AP-1 or NF- B site from the PI-9 promoter or a mutated version of the
site. Binding specificity was tested in competition assays using a
60-fold excess of either the AP-1 or the NF- B site from the PI-9
promoter or its respective mutated site. Antibody specific to either
c-Jun or p65 was added followed by the addition of a secondary antibody
conjugated to horseradish peroxidase. c-Jun and p65 activation was
measured at 450 nm. The AP-1 and NF- B sites of the PI-9 promoter
used as competitors were: AP-1 ( 317 to 297),
5'-ccgtgtgactcagtgtctctt-3'; NF- B ( 144 to 121),
5'-tggttctaagtgaatcccccatat-3'; NF- B ( 97 to 74),
5'-agacccatgggaccttcccactgg-3'. The mutated AP-1 and NF- B sequences
used as competitors were 5'-cgcttgaggagtcggccggaa-3' and
5'-agttgaggccactttcccaggc-3', respectively.
Antibody Supershift Assays--
Double-stranded oligonucleotides
of the same AP-1 and NF- B sites used in the transcription factor
binding assays were labeled with [ -32P]ATP. Gel
supershift assays were carried out by incubating 20 µg of nuclear
extract from HepG2 cells in 10 mM Hepes, 50 mM
KCl, 1 mM EDTA, 1 mM dithiothreitol, 10%
glycerol, 2 µg/µl poly(dI-dC), 1 mM
phenylmethylsulfonyl fluoride, and 6 µg of BSA on ice for 15 min. A
total of 50, 000 cpm of 32P-labeled probe was then added,
and the binding reaction (20 µl) was incubated at room temperature
for 20 min. After binding, 4 µg of antibody was added and incubated
for 1 h on ice. All antibodies were purchased from Santa Cruz
Biotechnology (Santa Cruz, CA) except for the p50 and c-Fos antibody
purchased from Calbiochem and Geneka (Montreal, Québec), respectively.
 |
RESULTS |
IL-1 and LPS Induce PI-9 mRNA and Protein--
Previously
we identified a consensus AP-1 site at 308 of the PI-9 promoter
region (16). We examined the PI-9 promoter for other transcription
factor binding sites potentially involved in controlling PI-9 gene
expression. Three potential NF- B sites at 1078, 135 and 88
were identified (Fig. 1A). The
site at 135 differs from the consensus NF- B binding sequence by 1 nucleotide, whereas the other 2 sites differ from the consensus NF- B
sequence by 2 nucleotides. Because pro-inflammatory agents regulate the expression of many genes involved in inflammatory processes through AP-1 and NF- B proteins (26-30), we tested the ability of the
pro-inflammatory agents IL-1 and LPS to induce expression of the
native cellular PI-9 gene and protein in an estrogen receptor-positive
clone (HepG2ER7 (8)) of HepG2 human hepatoblastoma cells and in
a well studied B cell line, Daudi cells. Using quantitative real-time
PCR to measure PI-9 mRNA levels, IL-1 induced cellular PI-9
mRNA in HepG2ER7 cells by ~6-fold (Fig. 1B). We
previously used Northern blot analysis to show that estrogen induction
of PI-9 mRNA is rapid, and PI-9 mRNA levels remain elevated for
at least 1 day (8). Induction of PI-9 mRNA by IL-1 also was
rapid, with a 4-5-fold induction in 4 h. Induction was maximal at
~6-fold at 8 h, and PI-9 mRNA remained fully induced through
the 24 h of the experiment (Fig. 1B). Western blot
analysis showed that IL-1 induced PI-9 protein within 4 h and
that PI-9 levels remained elevated for at least 48 h (Fig.
1B).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 1.
IL-1 and LPS induce
PI-9 mRNA and protein. A, putative NF- B and AP-1
binding sites in the PI-9 promoter region. Nucleotides that differ from
the consensus NF- B binding site are underlined. The
consensus sequences for the AP-1 and NF- B elements are
5'-ACTCAGT-3'and 5'-GG(A/G)AAT(T/C)CCC-3', respectively. B,
HepG2ER7 cells (generously provided by Dr. D. Zajchowski (8)) stably
transfected to express estrogen receptor and Daudi cells
(panel C) were treated at the indicated times with 5 ng/ml
IL-1 (panel B) and 1 µg/ml LPS (panel C).
RNA was isolated from HepG2ER7 and Daudi cells and analyzed by
quantitative reverse transcription-PCR as described under
"Experimental Procedures" (panels B and C).
Proteins from IL-1 -treated HepG2ER7 cells (panel B) or
LPS-treated Daudi cells (panel C) were fractionated by
SDS-PAGE and analyzed by Western blot using polyclonal antibody to
recombinant PI-9.
|
|
Cells of the immune system contain high levels of PI-9 (3, 31). To
determine whether the cellular PI-9 gene was still inducible in these
cells, we looked at the ability of the widely studied pro-inflammatory
agent, LPS, to induce PI-9 in a well studied B cell line, Daudi cells.
LPS activation of caspase-1 leads to IL-1 secretion in several
systems (32, 33). It was therefore of interest to determine whether
this important pro-inflammatory agent would elicit induction of the
anti-inflammatory protein, PI-9. LPS treatment of Daudi cells elicited
a progressive induction of PI-9 mRNA, which increased in level
throughout the 24 h of the experiment (Fig. 1C). LPS
induced PI-9 mRNA >7-fold and strongly induced PI-9 protein (Fig.
1C). Thus, a rapid and robust induction of PI-9 mRNA and
protein is elicited by the pro-inflammatory agents, IL-1 and
LPS.
TNF- and TPA Induce PI-9 Gene Expression--
We further
analyzed induction of PI-9 by another pro-inflammatory agent that often
acts through AP-1 and NF- B sites, tumor necrosis factor-
(TNF- ). HepG2 cells were transiently transfected with a construct
containing the PI-9 promoter region, driving the expression of a
luciferase reporter gene (16), and exposed to varying concentrations of
TNF- . TNF- elicited a concentration-dependent 4-5-fold
increase in PI-9 promoter activity, with induction reaching a plateau
at 5 ng/ml TNF- (Fig.
2A).

View larger version (9K):
[in this window]
[in a new window]
|
Fig. 2.
TNF- and TPA induce
PI-9 expression. A, HepG2 cells were transfected with
our native human PI-9 promoter ( 1482 to +314)-luciferase construct
(16) with the indicated concentrations of TNF- for 24 h and
then assayed for luciferase activity. Fold induction represents the
increase in luciferase activity in response to TNF- with the
vehicle-treated sample (0.1% BSA) set equal to 1. The data represent
the mean ± S.E. of three separate transfections. B,
HepG2ER7 were treated at the indicated times with 20 nM
TPA. RNA was isolated from HepG2ER7 and analyzed by quantitative
reverse transcription-PCR as described under "Experimental
Procedures." Proteins from TPA-treated HepG2ER7 cells were
fractionated by SDS-PAGE and analyzed by Western blot using polyclonal
antibody to recombinant PI-9.
|
|
LPS, IL-1 , and TNF- are all agents related to inflammatory
processes. It was of interest to determine whether a different class of
regulatory agents known to work through AP-1 and NF- B sites could
also regulate PI-9 expression. As shown in Fig. 2B, the
phorbol ester, TPA, a well known tumor promoter, induced PI-9 mRNA
~7-fold and strongly induced PI-9 protein in HepG2ER7 cells (Fig.
2B). These data demonstrate that cellular PI-9 gene
expression is regulated by diverse agents known to act through NF- B
and AP-1 sites.
The Two Proximal NF- B Sites and the AP-1 Site Are Important in
IL-1 Induction of PI-9 Gene Expression--
To characterize the
roles of the three putative NF- B sites and of the AP-1 site in
induction of PI-9 gene expression, we constructed a series of plasmids
containing mutations that inactivate the AP-1 and NF- B sites. We
transiently transfected the PI-9 promoter constructs into HepG2 cells
and examined the ability of IL-1 (at 5 ng/ml) to induce PI-9
expression (Fig. 3). Because none of the
mutant promoters we tested exhibited increased basal expression of PI-9
(data not shown), a reduced fold induction by a transfected mutant
promoter is due to less IL-1 -induced expression than is seen with
the wild-type promoter. Mutational ablation of the putative NF- B
element at 1078 had a minimal effect on IL-1 induction, indicating
that this element does not play a significant role in IL-1
regulation of PI-9. In contrast, mutational ablation of the putative
NF- B sites at either 135 or at 88 reduced IL-1 induction of
PI-9 by ~60%. Mutation of both of the proximal NF- B sites
resulted in a modest further reduction of the IL-1 response. The
effect of mutational inactivation of the AP-1 site at 308 was similar
to the effect of mutating individual NF- B sites, with PI-9
expression reduced by ~55% relative to the wild-type promoter. These
data indicate that the two proximal imperfect NF- B elements and the
consensus AP-1 site all contribute to IL-1 induction of PI-9 gene
expression. Mutational inactivation of both NF- B sites and the AP-1
site completely abolished IL-1 induction and reduced basal PI-9
promoter activity to extremely low levels (Fig. 3). Consistent with a
role for both the proximal NF- B sites and the AP-1 site in IL-1
induction of PI-9, the inhibitor of I B degradation, pyrrolidine
dithiobicarbamate, suppressed IL-1 inducibility of PI-9 by ~60%
but did not completely abolish induction (data not shown).

View larger version (11K):
[in this window]
[in a new window]
|
Fig. 3.
Both the proximal
NF- B sites and the AP-1 site are important for
regulation of PI-9 gene expression. The putative NF- B sites and
the AP-1 site in the PI-9 promoter region were mutationally inactivated
(see "Experimental Procedures"), individually or in combination.
The PI-9 promoter-luciferase constructs were transfected into HepG2
cells and incubated with or without 5 ng/ml IL-1 for 24 h. The
cells were harvested, cell extracts were prepared, and relative
luciferase activity was determined. Fold induction represents the
increase in luciferase activity for the wild-type promoter and for the
mutated construct in the presence of IL-1 , with the vehicle-treated
sample (0.1% BSA) set equal to 1. The data represent the mean ± S.E. for three separate transfections.
|
|
IL-1 Induces c-Jun and p65 Proteins That Bind to Their Sites in
the PI-9 Promoter--
To test whether proteins in nuclear extracts
from IL-1 -induced HepG2 cells exhibit enhanced interaction with the
AP-1 and NF- B sites in the 5'-flanking region of the PI-9 promoter,
we used a quantitative antibody-based assay to detect and quantify binding by c-Jun and p65, members of the AP-1 and NF- B families, respectively. Nuclear extract from control and IL-1 -treated HepG2 cells was incubated with an oligonucleotide containing the AP-1 consensus sequence in the PI-9 gene (5'-ACTCAGT-3'), bound protein was
reacted with c-Jun antibody, and the extent of c-Jun binding was
determined using a second antibody conjugated to horseradish peroxidase. Extract from IL-1 -treated HepG2 cells showed a 4-fold increase in c-Jun binding to the PI-9 AP-1 site (Fig.
4A). Binding to the
immobilized AP-1 site was specifically competed by the PI-9 AP-1 site
(Fig. 4A, PI-9 AP-1). The inability of a mutated AP-1 site to compete for binding (Fig. 4A, Mut
AP-1) supports the view that the induced protein was c-Jun.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 4.
IL-1 induces AP-1
and NF- B binding activity. HepG2 cells
were maintained for 1.5 h in medium containing 5 ng/ml lL-1
(lL-1 , +) or lacking the mediator (lL-1 , ). Nuclear extract was
prepared (see "Experimental Procedures"), and 5 µg of nuclear
extract was used to show binding to an immobilized consensus AP-1
site (identical to the PI-9 AP-1 site) (panel A) or to an
immobilized consensus NF- B site (panel B) (Active Motif,
Carlsbad, CA). A, binding specificity for the AP-1 site was
demonstrated by using the consensus AP-1 sequence from the PI-9
promoter (PI-9 AP-1;
317ccgtgtgactcagtgtctctt 297) as competitor
or an inactive mutated AP-1 site (Mut AP-1;
5'-cgcttgaggagtcggccggaa-3'). B, binding to the immobilized
consensus NF- B site (first bar in each set)
and competition with the PI-9 NF- B oligonucleotides (PI-9 NF- B
144/ 121; 144tggttctaagtgaatcccccatat 121
or PI-9 NF- B 97/ 74;
97agacccatgggaccttcccactgg 74) or with a
mutated NF- B site (Mut NF- B; 5'-agttgaggccactttcccaggc-3'). The
data represent the average ± S.E. for three separate binding
assays. OD, optical density.
|
|
To determine whether IL-1 induced p65 binding activity, we examined
the ability of proteins in extracts from control and IL-1 -treated
HepG2 cells to bind to an immobilized consensus NF- B site. Binding
of p65 to the consensus NF- B site was quantitated by incubation with
anti-p65 followed by detection with horseradish peroxidase-conjugated
second antibody. IL-1 treatment induced a 4-5-fold increase in
binding of p65 to the consensus NF- B site (Fig. 4B). Both
basal and IL-1 -induced binding to the consensus NF- B site were
effectively competed by the imperfect PI-9 NF- B sites (Fig.
4B, PI-9 NF- B 144/ 121 and
97/ 74). A mutated NF- B oligonucleotide was unable to
compete for binding (Fig. 4B, Mut NF- B).
These data indicate that IL-1 treatment of HepG2 cells induce c-Jun
and active p65 by 4-5-fold. The consensus PI-9 AP-1 site binds c-Jun,
and binding of c-Jun is specifically competed by the PI-9 AP-1 site.
Oligonucleotides containing the imperfect NF- B sites at 135 and
88 were effective competitors for binding of p65 to the immobilized
consensus NF- B site.
c-Jun, JunD, and c-Fos Bind to the AP-1 Site, whereas p50 and p65
Bind to the NF- B Site--
To identify the specific Fos/Jun/Fra
family members that bind to the AP-1 site and the members of the Rel
family that bind to the NF- B sites in the PI-9 promoter, we
performed electrophoretic mobility shift assays with labeled PI-9 AP-1
and NF- B sites and identified the bound proteins using antibody
supershifts. As shown in Figs. 5,
A and B, with a labeled oligonucleotide
containing the AP-1 site in the PI-9 promoter, specific antibodies
against c-Jun, JunD, and c-Fos produced marked supershifts, and a
weaker supershift was observed with a JunB antibody. Control PI-9
antibody did not supershift the complex formed by the IL-1 -treated
HepG2 nuclear extract. The gel shift experiments also demonstrate
strong IL-1 induction of each of the Jun/Fos family members that
bind to the PI-9 AP-1 site (Figs. 5, A and
B).

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 5.
c-Jun, JunD, c-Fos, and p50/p65 bind to the
AP-1 and NF- B sites of the PI-9 promoter.
20 µg of nuclear extract from control HepG2 cells or HepG2 cells
maintained for 1.5 h in IL-1 was incubated with a
32P-labeled double-stranded oligonucleotide containing the
AP-1 site from the PI-9 promoter (panels A and B)
or with labeled oligonucleotides containing the NF- B sites located
at the 135 or 88 of the PI-9 promoter (see the legend to Fig. 4) in
panels C and D, respectively. After the
protein-DNA binding reaction, there was an additional incubation with
antibodies to individual members of the Jun/Fos/Fra family
(panels A and B) or with antibodies to proteins
in the Rel/NF- B family (panels C and
D).
|
|
Different combinations of the Rel/NF- B proteins can constitute an
active NF- B heterodimer that binds to specific sequences in DNA
(34). As shown in Figs. 5, C and D, labeled
oligonucleotides containing the NF- B regions at 135 and 88 were
supershifted by antibodies against p65 (RelA) and p50. These data are
compatible with a p65/p50 heterodimer binding to the NF- B sites.
IL-1 Induces PI-9 in Diverse Cell Lines--
Although our data
showed that IL-1 induces PI-9 in HepG2 cells, PI-9 is expressed in
diverse vertebrate cells (3, 6, 13-15). It was therefore of interest
to determine whether other cells had the potential for IL-1
activation of the PI-9 promoter. Because a recent study suggested that
the endogenous PI-9 gene may be constitutively overexpressed in many
tumor cell lines (6), we carried out transient transfections of three
widely used cell lines with the full-length PI-9 promoter-luciferase
reporter construct and with the construct in which the two NF- B
sites and the AP-1 site were mutationally inactivated. IL-1 (at 5 ng/ml) induced luciferase activity from the transfected PI-9 promoter
in HepG2 cells, MCF-7, breast cancer cells, CHO-S cells, and HeLa cells by 6-, 4-, 5.5-, and 2.5-fold, respectively (Fig.
6). These data indicate that diverse
cells exhibit a capacity for IL-1 induction of PI-9 through its
NF- B and AP-1 sites. The different levels of IL-1 induction in
the four cell lines may be due to different levels of IL-1 receptor
in the cells. Because IL-1 did not induce PI-9 expression in any of
the cells transfected with the triple mutant containing nonfunctional
NF- B and AP-1 sites, the NF- B and AP-1 sites we identified are
essential for IL-1 induction in diverse cells.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 6.
IL-1 induces
expression of PI-9 in MCF-7 cells, CHO cells, and HeLa cells.
HepG2, MCF-7, CHO-S, and HeLa cells were transfected as described under
"Experimental Procedures" with the native PI-9 promoter-luciferase
construct (WT) or with the mutant in which the two NF- B
sites and the AP-1 site were inactivated (Mut, see the
bottom line in Fig. 3). The transfected cells were
maintained for 24 h in medium lacking IL-1 or containing 5 ng/ml IL-1 . The cells were harvested, and extracts were prepared and
assayed for luciferase activity. Activity is expressed as fold
induction in the presence of 5 ng/ml IL-1 relative to the
vehicle-treated sample (0.1% BSA), which was set equal to 1. The data
represent the mean ± S.E. for three separate transfections.
|
|
Induction of PI-9 by IL-1 and Moxestrol Is Not
Synergistic--
Our studies suggest two regulatory contexts for PI-9.
Estrogen-estrogen receptor complex induces PI-9 transcription by
binding to an ERU downstream of the transcription initiation site (8, 16). Second, IL-1 acts through the AP-1 and NF- B elements in the
5'-flanking region of the PI-9 gene. To determine whether these
regulatory pathways act additively or synergistically to control PI-9
gene expression, we examined the effect of the potent and poorly
metabolized estrogen, moxestrol, in the presence or absence of IL-1
on PI-9 expression in transiently transfected HepG2 cells. When
saturating concentrations of moxestrol (10 nM) and IL-1
(5 ng/ml) were added together to the culture medium, the induction of
luciferase activity from the PI-9 promoter was only slightly greater
than the induction seen with moxestrol alone (Fig.
7). At sub-maximal concentrations of
moxestrol and IL-1 , induction of PI-9 by moxestrol and IL-1 was
clearly greater than with either agent alone but was not additive (Fig.
7, 2 ng/ml IL-1 , 1 nM moxestrol). These data suggest
that moxestrol alone can elicit a near-maximal level of PI-9 gene
expression. Our previous finding that deletion of the AP-1 site did not
reduce the fold induction by moxestrol (16) is also consistent with the
view that these two regulatory regions do not act synergistically.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 7.
Moxestrol and IL-1
exhibit independent induction of PI-9. HepG2 cells were
transfected with the native full-length PI-9 promoter. The cells were
maintained in medium containing moxestrol, IL-1 , or both regulators.
At time 0 after transfection, the indicated concentrations of moxestrol
were added. The indicated concentrations of IL-1 were added after
24 h, and the cells were harvested at 48 h. These induction
times were determined to be optimal in preliminary studies. The
increase in luciferase activity is represented by fold induction in
response to IL-1 and moxestrol with the vehicle-treated sample
(0.1% BSA or ethanol) set equal to 1. The data represent the mean ± S.E. for three separate transfections.
|
|
IL-1 Represses ER Transcriptional Activity but ER Does Not
Inhibit IL-1 -induced AP-1 and NF- B Activity--
Because
moxestrol and IL-1 do not act synergistically or additively to
induce PI-9 gene expression, we examined whether the presence of
moxestrol or IL-1 interferes with induction by the other regulator.
To assess the influence of moxestrol-ER (Mox-ER) on PI-9 induction by
IL-1 without the complicating factor of Mox-ER induction through the
ERU, we constructed a mutant in which the PI-9 ERU was inactivated.
Similarly, we evaluated the influence of IL-1 on induction by Mox-ER
using mutants in which the AP-1 and NF B sites were mutated (see Fig.
3). HepG2ER7 cells, maintained in IL-1 and/or moxestrol, were
transiently transfected with PI-9 promoter-luciferase reporter
constructs containing mutations at various combinations of the ERU, the
AP-1 site, or the two NF B sites. Mutation of the ERU abolished
moxestrol induction of the PI-9 promoter but maintained IL-1
induction of PI-9 gene transcription (Fig.
8A, mERU). IL-1
inhibited induction by Mox-ER in transiently transfected HepG2ER7
cells. When the AP-1 site or either of the NF- B sites was mutated,
Mox-ER induction was always lower when IL-1 was present (Fig.
8A). To analyze the effect of IL-1 action on Mox-ER
induction independent of the ability of IL-1 to induce PI-9
expression, we used the mutant in which both the AP-1 site and the two
NF- B sites were mutationally inactivated. This mutant has completely
lost IL-1 induction (Figs. 3 and 6). IL-1 elicited a
dose-dependent reduction in Mox-ER induction of PI-9
promoter activity (Fig. 8B). These results suggest that
IL-1 -induced proteins such as NF- B and/or Fos/Fra/Jun family
members inhibit ER-mediated transcriptional activation of the PI-9
promoter. Of course, in the context of the native promoter IL-1
induces PI-9 through the AP-1 and NF- B sites, masking its negative
effect on estrogen induction through the ERU.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 8.
IL-1 represses
ER-mediated activation of PI-9 gene transcription. A,
HepG2ER7 cells were transiently transfected in the presence of 10 nM moxestrol (filled bars), 5 ng/ml IL-1
(open bars), or both agents (hatched bars) with
the indicated mutated PI-9 luciferase constructs (WT, wild
type; mERU, mutation of ERU; mAP-1, mutated AP-1;
mNF- B 88, mutation of the NF- B
site at 88; mNF- B 88/ 135,
mutation of the NF- B sites at 88 and 135;
mNF- B 88/ 135/mAP-1, mutation of
the NF- B sites at 88 and 135 and the AP-1 site. The increase in
luciferase activity is represented by fold induction in response to
IL-1 and moxestrol with the vehicle-treated sample (0.1% BSA
or ethanol) set equal to 1. The data represent the mean ± S.E.
for three separate transfections. B, HepG2ER7 cells were
transiently transfected with the
mNF- B 88/ 135mAP-1-promoter luciferase construct
in the presence of 10 nM moxestrol and the
indicated concentrations of IL-1 (0-20 ng/ml). Relative activity
represents the activity of moxestrol-ER induction of PI-9 gene
expression in the presence of the indicated concentrations of IL-1
with the moxestrol-treated sample in the absence of added IL-1 set
equal to 100%.
|
|
 |
DISCUSSION |
Although its properties and biological roles are only beginning to
be identified, PI-9 is emerging as an important modulator of
inflammatory and apoptotic processes (3-6, 15). PI-9 inhibits caspase-1 and thereby reduces the production of pro-inflammatory cytokines important in maturation and migration of cells of the immune
system. PI-9 also inhibits granzyme B and thereby interferes with
granzyme B-mediated apoptosis when a cell is targeted by the immune
system. Together these effects of PI-9 represent a powerful multi-level
system for modulating the interrelated inflammatory and apoptotic
functions of caspase-1 and granzyme B (3-6,15). Despite its
importance, little was known about the regulation of PI-9 gene
expression. A novel downstream estrogen responsive unit and an upstream
AP-1 site we recently described (16) were the only reported regulatory
elements in the human PI-9 gene. It was therefore of unusual interest
to examine the PI-9 promoter region for functional regulatory elements
susceptible to control by agents important in inflammatory and
apoptotic processes.
Because we identified a consensus AP-1 site and three potential
imperfect NF- B sites in the 5'-flanking region of the human PI-9
promoter, we tested the ability of pro-inflammatory agents known to
activate gene expression through NF- B and AP-1 sites to induce
expression of PI-9. IL-1 , LPS, TNF- , and TPA effectively induced
PI-9. The rapid induction of PI-9 mRNA was accompanied by induction
of PI-9 protein. Consistent with our findings, after completion of this
work, two very recent papers on granzyme B-mediated apoptosis suggested
that LPS induces PI-9 in some tumors and in dendritic cells (Refs. 6
and 15; for review, see Ref. 35). However, these studies were limited
to qualitative demonstrations of increases in PI-9 mRNA or protein
and did not involve analysis of the PI-9 promoter, protein-DNA
interaction studies, or investigation of the effects of IL-1 or
other regulators. These workers suggested that LPS induction of PI-9
might protect dendritic cells against granzyme B released by CTLs or
host cells. PI-9 may therefore exert its anti-inflammatory and
anti-apoptotic effects both by reducing the production of
pro-inflammatory cytokines that help attract CTLs and NK cells to
target cells and by inhibiting the ability of their granzyme B to
induce apoptosis of target cells.
PI-9 inhibits caspase-1, and IL-1 is produced by caspase-1 cleavage
of the inactive IL-1 precursor. We therefore elected to focus on
IL-1 induction of PI-9 gene expression as an unusual example of
end-product regulation of gene expression. Our identification of
functional imperfect NF- B sites at 135 and 88 and a consensus AP-1 site at 308 of the PI-9 5'-flanking region (Fig. 1A)
was of interest since inducible expression of several AP-1 regulated genes, including 1-antichymotrypsin (28),
glutathione transferase (29), and collagenase (36), involves juxtaposed
regulatory motifs. Mutational inactivation of the NF- B sites at
135 and 88 and the AP-1 site at 308, both individually and in
combination, indicates that all three sites are important in regulating
PI-9 gene expression in most and perhaps all cells.
Using oligonucleotides with sequences corresponding to the AP-1 site of
the PI-9 promoter and antibodies specific for members of the
Fos/Jun/Fra families, c-Jun, JunD, and c-Fos were identified as the
components of DNA-protein complexes in HepG2 cells. Because Jun family members bind to AP-1 sites with a much higher
affinity when associated with members of the Fos family (37), in HepG2 cells, a Jun/Fos heterodimer likely mediates regulation at the AP-1 site in the PI-9 promoter.
The IL-1 -signaling pathway activates both AP-1 proteins and NF- B
transcription factor. NF- B is of central importance in immune and
inflammatory responses (23, 24). Our findings suggest that
IL-1 -induced expression of PI-9 is mediated by activation of NF- B
and binding of activated NF- B to imperfect NF- B sites in the
5'-flanking region of the PI-9 promoter. The NF- B elements at 135
and 88 could be recognized and bound by the NF- B p50/p65 heterodimer complex. Both the individual AP-1 family members and the
NF- B p50/p65 heterodimer complex were strongly induced by IL-1 .
It is becoming increasingly evident that NF- B not only exerts a
pro-apoptotic function but also exercises an anti-apoptotic role
through induction of anti-apoptotic genes such as
c-IAP, XIAP, Bcl2, and
c-FLIP (38). Thus, it is not surprising that the
anti-apoptotic PI-9 gene is induced in part by NF- B.
Liganded ER or glucocorticoid receptor are reported to antagonize
cytokine-induced NF- B or AP-1 activity. The steroid receptors are
thought to act as antagonists through physical interaction between
NF- B and the steroid hormone receptor (39-42). Because induction of
PI-9 by moxestrol and IL-1 was less than additive, it seemed
possible that the estrogen-ER complex might antagonize induction by
IL-1 and that IL-1 might antagonize induction by ER. With both an
estrogen responsive unit downstream of the transcription start site (8,
16) and two functional NF- B elements and an AP-1 site upstream of
the transcription start site, the PI-9 promoter is an excellent system
in which to test the effect of estrogen-ER complex on induction
mediated by both NF- B and AP-1 sites. Using a PI-9 promoter
construct with a mutationally inactivated estrogen responsive unit, we
find that Mox-ER is unable to repress IL-1 induction of PI-9 gene
expression. Although there have been no previous studies of estrogen
down-regulation of a cellular gene responsive to both estrogens and
NF- B, synergistic activation of transcription by an NF- B site and
an AP-1 site was resistant to glucocorticoid receptor-mediated
repression (42). It, therefore, seems likely that the inability of ER
to mediate repression of the PI-9 promoter is due to the presence of
the two NF- B sites and the AP-1 site working together.
Interestingly, IL-1 exhibits effective, dose-dependent
repression of Mox-ER induction of PI-9 expression. Using a synthetic
construct containing a consensus estrogen response element and a
consensus NF- B site, a recent study reports that estrogen and
pro-inflammatory agents antagonize each other's ability to activate
the promoter (39).
Our finding that ER and the NF- B system both regulate PI-9 gene
expression provides a novel point of intersection between estrogen
action and control of inflammatory processes. The inability of IL-1
and estrogens to act synergistically or even additively may reflect a
need to prevent cells from producing levels of PI-9 so high that they
completely block IL-1 production and make the cells fully resistant
to granzyme B-mediated apoptosis.
By inducing production of IL-1 through caspase-1 cleavage of its
inactive precursor, pro-inflammatory agents such as LPS and TNF- can
cause a wide variety of inflammatory conditions (43). The importance of
maintaining IL-1 homeostasis to prevent systemic inflammatory
reactions is illustrated by the existence of multiple regulatory
mechanisms for attenuating IL-1 production. These regulators include
pro-caspase-1 and caspase-1 inhibitory proteins like PI-9 (3, 4),
ICEBERG (44) and COP (caspase recruitment domain only protein)
(45) as well as the IL-1 receptor antagonist (46).
This work leads us to suggest the existence of a novel negative
feedback loop in which IL-1 produced by activated caspase-1 negatively regulates its own production by inducing expression of the
caspase-1 inhibitor, PI-9. The kinetics of induction of PI-9 protein,
whose level begins to increase 4-8 h after the addition of LPS or
IL-1 to the culture medium, is consistent with this idea. LPS
usually induces rapid activation of caspase-1 and a burst of IL-1
production and secretion (32, 33). We speculate that one way to limit
the ability of this system to produce potentially toxic levels of
IL-1 for extended periods of time is for IL-1 to induce an
inhibitor of its own production, PI-9.
Our intriguing finding that pro-inflammatory agents including IL-1 ,
LPS, and TNF- induce expression of the gene coding for the
anti-inflammatory protein PI-9 suggests that the PI-9 system may serve
as a brake to restrain and attenuate unrestricted and potentially
deleterious inflammatory processes, such as septic shock, and apoptotic
responses. The diverse agents that induce PI-9, including, estrogens,
TPA, IL-1 , LPS, and TNF- , suggest that regulated production of
PI-9 may have a central role in modulating inflammatory processes and
apoptosis mediated by cells of the immune system.
 |
ACKNOWLEDGEMENT |
We are grateful to Dr. R. Dodson for many
helpful comments on the manuscript.
 |
FOOTNOTES |
*
This research was supported by NICHD, National Institutes of
Health Grant HD-16720.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Biochemistry,
University of Illinois, 600 S. Mathews Ave., Urbana, IL 61801-3602. Tel.: 217-333-1788; Fax: 217-244-5858; E-mail:
djshapir@uiuc.edu.
Published, JBC Papers in Press, August 12, 2002, DOI 10.1074/jbc.M200379200
 |
ABBREVIATIONS |
The abbreviations used are:
PI-9, proteinase
inhibitor 9;
IL-1 , interleukin-1 ;
CTL, cytolytic T lymphocytes;
NK, natural killer;
AP-1, activator protein-1;
NF- B, nuclear
factor- B;
LPS, lipopolysaccharide;
TPA, 12-O-tetradecanoylphorbol-13-acetate;
ERU, estrogen
responsive unit;
TNF- , tumor necrosis factor- ;
ER, estrogen
receptor;
Mox, moxestrol;
CHO, Chinese hamster ovary;
BSA, bovine serum
albumin.
 |
REFERENCES |
| 1.
|
Silverman, G. A.,
Bird, P. I.,
Carrell, R. W.,
Church, F. C.,
Coughlin, P. B.,
Gettins, P. G. W.,
Irving, J. A.,
Lomas, D. A.,
Luke, C. J.,
Moyer, M. W.,
Pemberton, P. A.,
Remold-O'Donnell, E.,
Salvensen, G. S.,
Travis, J.,
and Whisstock, J. C.
(2001)
J. Biol. Chem.
276,
33293-33296[Free Full Text]
|
| 2.
|
Potempa, J.,
Korzus, E.,
and Travis, J.
(1994)
J. Biol. Chem.
269,
15957-15960[Free Full Text]
|
| 3.
|
Bird, C. H.,
Sutton, V. R.,
Sun, J.,
Hirst, C. E.,
Novak, A.,
Kumar, S.,
Trapani, J. A.,
and Bird, P. I.
(1998)
Mol. Cell. Biol.
18,
6387-6398[Abstract/Free Full Text]
|
| 4.
|
Annand, R. R.,
Dahlen, J. R.,
Sprecher, C. A., De,
Dreu, P.,
Foster, D. C.,
Mankovich, J. A.,
Talania, R. V.,
Kisiel, W.,
and Giegle, D. A.
(1999)
Biochem. J.
342,
655-665
|
| 5.
|
Young, J. L.,
Sukhova, G. K.,
Foster, D.,
Kisiel, W.,
Libby, P.,
and Schobeck, U.
(2000)
J. Exp. Med.
191,
1535-1544[Abstract/Free Full Text]
|
| 6.
|
Medema, J. P.,
de Jong, J.,
Pettenburg, L. T. C.,
Verdegaal, E. M. E.,
Gorter, A.,
Bres, S. A.,
Franken, K. L. M. C.,
Hahne, M.,
Albar, J. P.,
Melief, C. J. M.,
and Offringa, R.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
11515-11520[Abstract/Free Full Text]
|
| 7.
|
Thornberry, N. A.,
Bull, H. G.,
Calaycay, J. R.,
Chapman, K. T.,
Howard, A. D.,
Kostura, M. J.,
Miller, D. K.,
Molineaux, S. M.,
Weidner, J. R.,
Aunins, J.,
Elliston, K. O.,
Ayala, J. M.,
Casano, F. J.,
Chin, J.,
Ding, G. J. F.,
Egger, L. A.,
Gaffney, E. P.,
Limjuco, G.,
Palyha, O. C.,
Raju, S. M.,
Rolando, A. M.,
Salley, J. P.,
Yamin, T.,
Lee, T. D.,
Shively, J. E.,
Maccross, M.,
Mumford, R. A.,
Schmidt, J. A.,
and Tocci, M.-J.
(1992)
Nature
356,
768-774[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Kanamori, H.,
Krieg, S.,
Mao, C.,
DiPippo, V. A.,
Wang, S.,
Zajchowski, D. A.,
and Shapiro, D. J.
(2000)
J. Biol. Chem.
275,
5867-5873[Abstract/Free Full Text]
|
| 9.
|
Kumar, V.,
Cotran, R. S.,
and Robbins, S. L.
(1997)
Basic Pathology
, W. B. Saunders Co., Philadelphia, PA
|
| 10.
|
Nagata, S.
(1997)
Cell
88,
355-365[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Lowin, B.,
Hahne, M.,
Mattmann, C.,
and Tschopp, J.
(1994)
Nature
370,
650-652[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Yang, X.,
Stennicke, H. R.,
Wang, B.,
Green, D. R.,
Janicke, R. U.,
Srinivasan, A.,
Seth, P.,
Salvensen, G. S.,
and Froelich, G. J.
(1998)
J. Biol. Chem.
273,
34278-34283[Abstract/Free Full Text]
|
| 13.
|
Hirst, C. E.,
Buzza, M. S.,
Sutton, V. R.,
Trapani, J. A.,
Loveland, K. L.,
and Bird, P. I.
(2001)
Mol. Hum. Reprod.
7,
1133-1142[Abstract/Free Full Text]
|
| 14.
|
Bladergroen, B. A.,
Strik, M. C.,
Bovenschen, N.,
van Berkum, O.,
Scheffer, G. L.,
Meijer, C. J.,
Hack, C. E.,
and Kummer, J. A.
(2001)
J. Immunol.
166,
3218-3225[Abstract/Free Full Text]
|
| 15.
|
Medema, J. P.,
Schuurhuis, D. H.,
Rea, D.,
van Tongeren, J.,
de Jong, J.,
Bres, S. A.,
Laban, S.,
Toes, R. E. M.,
Toebes, M.,
Schumacher, T. N. M.,
Bladergroen, B. A.,
Ossendorp, F.,
Kummer, J. A.,
Melief, C. J. M.,
and Offringa, R.
(2001)
J. Exp. Med.
194,
657-667[Abstract/Free Full Text]
|
| 16.
|
Kreig, S. A.,
Kreig, A. J.,
and Shapiro, D. J.
(2001)
Mol. Endocrinol.
15,
1971-1982[Abstract/Free Full Text]
|
| 17.
|
Zen, K.,
Karsan, A.,
Stempien-Otero, A.,
Yee, E.,
Tupper, J., Li, X.,
Eunson, T.,
Kay, M. A.,
Wilson, C. B.,
Winn, R. K.,
and Harlan, J. M.
(1999)
J. Biol. Chem.
274,
28808-28815[Abstract/Free Full Text]
|
| 18.
|
Koj, A.
(1996)
Biochim. Biophys. Acta
1317,
84-94[Medline]
[Order article via Infotrieve]
|
| 19.
|
Abate, C.,
Patel, L.,
Rauscher, F. J., III,
and Curran, T.
(1990)
Science
249,
1157-1161[Abstract/Free Full Text]
|
| 20.
|
Karin, M.
(1995)
J. Biol. Chem.
270,
16483-16486[Free Full Text]
|
| 21.
|
Johnson, P. F.,
and McNight, S. L.
(1989)
Annu. Rev. Biochem.
58,
799-839[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Miyamoto, S.,
and Verma, I. M.
(1995)
Adv. Cancer Res.
66,
255-292[Medline]
[Order article via Infotrieve]
|
| 23.
|
Baeuerle, P. A.,
and Baltimore, D.
(1996)
Cell
87,
13-20[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Régnier, C. H.,
Song, H. Y.,
Gao, X.,
Goedder, D. V.,
Cao, Z.,
and Rothe, M.
(1997)
Cell
90,
373-383[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Andrews, N. C.,
and Faller, D. V
(1991)
Nucleic Acids Research
19,
2499[Free Full Text]
|
| 26.
|
Stein, B.,
and Yang, M. X.
(1995)
Mol. Cell. Biol.
15,
4971-4979[Abstract]
|
| 27.
|
Ni, A.,
Chao, L.,
and Chao, J.
(1998)
J. Biol. Chem.
273,
2784-2791[Abstract/Free Full Text]
|
| 28.
|
Kordula, T.,
Bugno, M.,
Rydel, R. E.,
and Travis, J.
(2000)
J. Neurosci.
20,
7510-7516[Abstract/Free Full Text]
|
| 29.
|
Suzuki, T.,
Morimura, S.,
Diccianni, M. B.,
Yamada, R.,
Hochi, S.,
Hirabayashi, M.,
Yuki, A.,
Nomura, K.,
Kitagawa, T.,
Imagawa, M.,
and Muramatsu, M.
(1996)
J. Biol. Chem.
271,
1626-1632[Abstract/Free Full Text]
|
| 30.
|
Marks-Konczalik, J.,
Chu, S. C.,
and Moss, J.
(1998)
J. Biol. Chem.
273,
22201-22208[Abstract/Free Full Text]
|
| 31.
|
Sun, J.,
Bird, C. H.,
Sutton, V.,
McDonald, L.,
Coughlin, P. B., De,
Jong, T. A.,
Trapani, J. A.,
and Bird, P. I.
(1996)
J. Biol. Chem.
271,
27802-27809[Abstract/Free Full Text]
|
| 32.
|
Schumann, R. R.,
Belka, C.,
Reuter, D.,
Lamping, N.,
Kirschning, C. J.,
Weber, J. R.,
and Pfeil, D.
(1998)
Blood
91,
577-584[Abstract/Free Full Text]
|
| 33.
|
Puren, A. J.,
Fantuzzi, G.,
and Dinarello, C. A.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
2256-2261[Abstract/Free Full Text]
|
| 34.
|
Baichwal, V. R.,
and Baeuerle, P. A.
(1997)
Current Biology
7,
R94-R96[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Bird, P. I.
(2002)
Mod. Asp. Immunobiol.
2,
136-139
|
| 36.
|
Auble, D. T.,
and Brinckerhoff, C. E.
(1991)
Biochemistry
30,
4629-4635[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Gentz, R.,
Rauscher, F.,
Abate, C.,
and Curran, T.
(1989)
Science
243,
1695-1699[Abstract/Free Full Text]
|
| 38.
|
Karin, M.,
and Lin, A.
(2002)
Nat. Immunol.
3,
221-227[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Harnish, D. C.,
Scicchitano, M. S.,
Adelman, S. J.,
Lyttle, C. R.,
and Karathanasis, S. K.
(2000)
Endocrinology
141,
3403-3411[Abstract/Free Full Text]
|
| 40.
|
Tsai, M.,
and O'Malley, B.
(1994)
Annu. Rev. Biochem.
63,
451-486[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Wissink, S.,
van Heerde, E. C.,
van der Burg, B.,
and van der Saag, P. T.
(1998)
Mol. Endocrinol.
12,
355-363[Abstract/Free Full Text]
|
| 42.
|
Scheinman, R. I.,
Gualberto, A.,
Jewell, C. M.,
Cidlowski, J. A.,
and Baldwin, A. S., Jr.
(1995)
Mol. Cell. Biol.
15,
943-953[Abstract]
|
| 43.
|
Dinarello, C. A.,
and Wolff, S. M. N.
(1993)
N. Engl. J. Med.
328,
106-113[Free Full Text]
|
| 44.
|
Humke, E. W.,
Shriver, S. K.,
Starovasnik, M. A.,
Fairbrother, W. J.,
and Dikit, V. M.
(2000)
Cell
103,
99-111[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Lee, S. H.,
Stehlik, C.,
and Reed, J. C.
(2001)
J. Biol. Chem.
276,
34495-34500[Abstract/Free Full Text]
|
| 46.
|
Burger, D.,
and Dayer, J.
(2001)
in
Cytokine Reference: A Compendium of Cytokine and Other Mediators of Host Defense
(Oppenheim, J. J.
, and Feldmann, M., eds), Vol. 1
, pp. 319-336, Academic Press, Inc., San Diego, CA
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
X. Jiang, N. M. Patterson, Y. Ling, J. Xie, W. G. Helferich, and D. J. Shapiro
Low Concentrations of the Soy Phytoestrogen Genistein Induce Proteinase Inhibitor 9 and Block Killing of Breast Cancer Cells by Immune Cells
Endocrinology,
November 1, 2008;
149(11):
5366 - 5373.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Jiang, B. A. Orr, D. M. Kranz, and D. J. Shapiro
Estrogen Induction of the Granzyme B Inhibitor, Proteinase Inhibitor 9, Protects Cells against Apoptosis Mediated by Cytotoxic T Lymphocytes and Natural Killer Cells
Endocrinology,
March 1, 2006;
147(3):
1419 - 1426.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Barrie, H. W. Stout, M. S. Abougergi, B. C. Miller, and D. L. Thiele
Antiviral Cytokines Induce Hepatic Expression of the Granzyme B Inhibitors, Proteinase Inhibitor 9 and Serine Proteinase Inhibitor 6
J. Immunol.,
May 15, 2004;
172(10):
6453 - 6459.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Krieg, S. A. Krieg, B. S. Ahn, and D. J. Shapiro
Interplay between Estrogen Response Element Sequence and Ligands Controls in Vivo Binding of Estrogen Receptor to Regulated Genes
J. Biol. Chem.,
February 6, 2004;
279(6):
5025 - 5034.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Eldering, C. A. Spek, H. L. Aberson, A. Grummels, I. A. Derks, A. F. de Vos, C. J. McElgunn, and J. P. Schouten
Expression profiling via novel multiplex assay allows rapid assessment of gene regulation in defined signalling pathways
Nucleic Acids Res.,
December 1, 2003;
31(23):
e153 - e153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. E. Hirst, M. S. Buzza, C. H. Bird, H. S. Warren, P. U. Cameron, M. Zhang, P. G. Ashton-Rickardt, and P. I. Bird
The Intracellular Granzyme B Inhibitor, Proteinase Inhibitor 9, Is Up-Regulated During Accessory Cell Maturation and Effector Cell Degranulation, and Its Overexpression Enhances CTL Potency
J. Immunol.,
January 15, 2003;
170(2):
805 - 815.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|