HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 44, 41417-41422, November 1, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/44/41417    most recent M203388200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Kwon, Y. H. Articles by Tyner, A. L. Search for Related Content PubMed PubMed Citation Articles by Kwon, Y. H. Articles by Tyner, A. L. Social Bookmarking                      What's this?

p21 Functions to Maintain Quiescence of p27-deficient Hepatocytes^*

Young Hye Kwon, Aleksandra Jovanovic, Michael S. Serfas, Hiroaki Kiyokawa, and Angela L. Tyner

From the Department of Molecular Genetics, University of Illinois, Chicago, Illinois 60607

Received for publication, April 9, 2002, and in revised form, August 9, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Hepatocytes rarely proliferate in the healthy adult liver. We explored the roles of the cyclin kinase inhibitors p21 and p27 in maintaining hepatocyte quiescence. p27 is expressed throughout the wild-type liver, but the related protein p21 was not detected. However, p21 was detected in livers of p27-deficient mice. Increased p21 protein levels did not result from an increase in p21 mRNA expression, indicating that p21 expression is regulated post-transcriptionally. p21 protein levels increased in cultured primary hepatocytes treated with the proteasome inhibitor MG132 and cycloheximide, indicating that p21 expression is regulated at the level of protein stability in liver cells. Although increased expression of cyclin-dependent kinase (Cdk) 4, Cdk2, and proliferating cell nuclear antigen was detected in p27-deficient livers, increased hepatocyte proliferation was detected only in livers of mice deficient for both p21 and p27. In p27-deficient livers, p21 was found in complexes with Cdk2 and CdK4 and can compensate for the absence of p27. Our data indicate that cyclin kinase inhibitor activity is important for maintaining hepatocyte quiescence in the adult liver. Significant increases in p21 were detected in multiple tissues of mature p27-deficient mice compared with wild-type mice, suggesting that the ability of p21 to functionally substitute for p27 is not liver-specific.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cell cycle progression is regulated by cyclin-dependent kinases (Cdks).¹ Cyclin kinase inhibitors (CKIs), which bind and inhibit the activity of Cdks, play key roles in negatively regulating cell proliferation. p21^Waf1/Cip1 is the founding member of the Cip/Kip family of CKIs that also includes p27^Kip1 and p57^Kip2 (reviewed in Refs. 1 and 2). p21 and p27 bind and inhibit a broad range of cyclin Cdk complexes in vitro and inhibit the cyclin A- and cyclin E-dependent kinase Cdk2 in vivo (reviewed in Refs. 3 and 4). p21 and p27 have also been shown to facilitate assembly of active cyclin-Cdk complexes (5, 6). In addition to its ability to inhibit Cdk2, p21 can also bind and inhibit the activity of proliferating cell nuclear antigen (PCNA) (reviewed in Refs. 7 and 8).

p21 expression is induced by DNA damage and by a variety of cytokines and growth factors, and it is often coincident with cell differentiation (reviewed in Ref. 9). It plays an essential role in inducing growth arrest after DNA damage (10, 11). Aging studies in p21-deficient mice have demonstrated a role for p21 in tumor suppression, albeit a much weaker one than that of p53 (12). Mice lacking p21 are more susceptible to chemically induced skin carcinoma (13, 14). In vivo, p21 seems to play roles in regulating renewal of keratinocytes (13) and hematopoietic cells (15). Female p21-deficient mice have decreased viability and develop a syndrome similar to human lupus because of increased T-lymphocyte proliferation after prolonged stimulation (16). In the kidney, p21 seems to regulate the balance between hyperplasia and hypoplasia, and its disruption ameliorates progression to chronic renal failure after partial renal ablation (17). In multiple tissues and cell types, p21 is induced after different types of challenges and seems to be a general sensor of stress, including CCl₄ toxicity in the liver (18).

Multiple functions for p27 in regulating growth and development have been revealed in p27-deficient mice (19-21). p27-deficient mice grow 20-40% larger than wild-type littermates because of alterations in the balance between proliferation and withdrawal from the cell cycle at critical periods of development. These mice develop intermediate lobe pituitary hyperplasia and adenoma, and female homozygous p27^/ mice are infertile. Although ovarian follicles develop, they do not progress to form corpora lutea. p27 has been shown to act as a safeguard against excessive cell proliferation after experimental induction of inflammatory injury in the kidneys of mice (22). p27-deficient and p27^+/ mice have been shown to be prone to tumor development in multiple tissues after -irradiation and other challenges (23). In general, p27 levels increase as cells become quiescent and decrease when cells are stimulated to re-enter the cell cycle (24-26). Post-transcriptional mechanisms are largely responsible for regulation of p27 expression (reviewed in Refs. 27 and 28).

Adult hepatocytes are highly differentiated cells that perform a wide variety of metabolic functions, and these cells rarely divide. Still, they can rapidly enter the cell cycle and proliferate after tissue loss caused by chemical or physical injury (reviewed in Refs. 29 and 30). Both p21 and p27 have been implicated in regulation of the rapid cell cycle progression that occurs during liver regeneration after injury (18, 31, 32). However, a functional role for these cyclin kinase inhibitors in maintaining quiescence of the mature hepatocyte has not been demonstrated. We examined the expression and functions of p21 and p27 in quiescent hepatocytes in the adult rodent liver, and we detected aberrant hepatocyte proliferation in livers of mice deficient for both p21 and p27. Our data indicate that cyclin kinase inhibitors are required for maintaining hepatocyte quiescence even in the absence of mitogenic signals associated with liver injury and tissue loss.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Animals-- Wild-type, p21^/, p27^/, and p21/p27^/ male littermates at 8-10 weeks of age were generally used for all experiments except where noted under "Results." Generation of p21^/ and p27^/ mice was described previously (11, 19). Female p27^/ mice are infertile. To obtain mice deficient for both p21 and p27, p21^/ female and p27^/ male mice were crossed, resulting in offspring that were double heterozygotes, p21^+//p27^+/. Subsequent intercross matings between double-heterozygous male and female mice produced offspring with the p21/p27^/ genotype. p21^//p27^+/ male mice were crossed with p21^//p27^+/ female mice to generate additional p21/p27^/ offspring. Genomic DNA isolation and PCR were used to confirm the genotypes of the mice. Mice were fed a commercial diet and water ad libitum and were sacrificed in the morning. The left lobe of the liver was fixed in 4% paraformaldehyde and paraffin-embedded for sectioning. Other portions of liver were frozen in liquid nitrogen and kept at 70 °C for preparation of protein lysates and total RNA.

Mice were injected intraperitoneally with 50 µg of 5-bromo-2'-deoxyuridine (BrdUrd; Sigma) per g of body weight 2 h before sacrifice for hepatocyte proliferation studies.

Immunoblotting and Immunoprecipitations-- In general, 50 µg of total liver protein was separated on 12 or 15% SDS-polyacrylamide gels and transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA). All membranes were stained with Ponceau S to confirm equal loading and transfer of protein. Immunoblotting was performed using the following primary antibodies obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA): p21 (SC-397), p27 (SC-528), Cdk2 (SC-163), Cdk4 (SC-260), Cdk6 (SC-177), cyclin A (SC-596), cyclin E (SC-481), and PCNA (SC-56). Other antibodies used included cyclin D1 (MS-210; NeoMarkers, Fremont, CA) and -actin (A-5441; Sigma). Immunoreactive bands were detected using the SuperSignal substrate (Pierce).

Immunoprecipitations were performed using the Seize^TM primary immunoprecipitation kit (Pierce) according to the manufacturer's instructions. 25 µg of anti-p21 antibody (PC55; Oncogene Research Products, San Diego, CA) or anti-p27 antibody (SC-528; Santa Cruz Biotechnology) was used for antibody coupling for each column. Rabbit IgG was used as a control.

Culture of Primary Hepatocytes and MEFs-- Primary hepatocytes from adult male and female mice (8-10 weeks old) were isolated by a two-step in situ collagenase perfusion procedure as described previously (33). Cell viability was >90% as determined by trypan blue exclusion. After attachment, cells were maintained in hormonally defined Williams E medium (34). One day after plating, cells were treated with 20 µM MG132 (BIOMOL Research Laboratories, Plymouth Meeting, PA) and/or 0.5 µg/ml cycloheximide (Sigma). The vehicle Me₂SO was added to the medium of untreated control cells. After 5.5 h, cells were washed twice with phosphate-buffered saline, collected in a lysis buffer, incubated for 20 min with agitation at 4 °C, and centrifuged for 10 min to collect total cell lysates.

Mouse embryonic fibroblasts (MEFs) were prepared and cultured as described previously (35). MEFs were serum-starved for 72 h and then restimulated with 10% fetal bovine serum for 24 h.

Reverse Transcription-PCR-- Total liver RNA was isolated using TRIzol reagent (Invitrogen), and cDNA was synthesized using 2 µg of total RNA with the SuperScript preamplification system (Invitrogen) as described previously (18). For amplification of cDNA, primers for mouse p21 (upstream primer, AGTGTGCCGTTGTCTCTTCG; downstream primer, ACACCAGAGTGCAAGACAGC; annealing temperature 62 °C, 30 cycles; product, 311 bp) were used. Expression of mouse S16 ribosomal protein was examined as an internal control as described previously (18). For each combination of primers, the kinetics of PCR amplification were studied, the number of cycles corresponding to plateau was determined, and PCR was performed within the exponential range. Amplified products were separated on a 2% agarose gel and visualized with ethidium bromide staining. Quantitation was performed using Kodak 1D image analysis software (Eastman Kodak).

Immunohistochemistry-- Liver sections were pretreated for antigen recovery and accessibility. For the p21 and p27 antibodies, slides were pretreated by a 5-min incubation in pepsin solution (AutoZyme; Vector, Burlingame, CA). For BrdUrd, the best signal was obtained after microwave heating. The PerkinElmer Life Sciences tyramide signal amplification kit was used to amplify antibody staining. Primary antibody sources and dilutions were anti-p21, PC55 (Oncogene Research Products), 1:150; p27, SC-528 (Santa Cruz Biotechnology), 1:300; BrdUrd, 347583 (BD Biosciences), 1:100.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Increased p21 Expression in the p27-deficient Adult Mouse Liver-- Expression of p21 and p27 protein was examined in livers of wild-type, p21^/, and p27^/ male mice. Total proteins were isolated from four or five individuals of each genotype and subjected to immunoblotting with antibodies against p21, p27, or -actin. Although p27 protein expression was easily detected in the wild-type liver (Fig. 1A), no p21 protein could be detected, even after long exposures (Fig. 1B). However, p21 protein was detected in liver lysates prepared from p27-deficient mice (Fig. 1B). These data were confirmed using immunohistochemistry. p27 protein was detected in nuclei throughout the wild-type liver lobule and in bile duct epithelial cells, whereas no p21 expression was detected in wild-type liver samples (Fig. 2). In the p27-deficient liver, p21 protein expression was detected in hepatocyte nuclei, with highest levels near the central veins (Fig. 2).

View larger version (38K): [in this window] [in a new window]   Fig. 1.   Expression of p21 and p27 in livers of wild-type mice and mice deficient for p21 or p27. A, immunoblot analyses were performed to examine p27 expression in the livers of wild-type and p21-deficient animals. Expression of -actin was examined as a control. B, immunoblot analyses were performed to examine p21 expression in livers of wild-type and p27-deficient animals. p21 protein was detected in p27-deficient but not wild-type liver. C, p21 mRNA expression in the liver was examined using reverse transcription-PCR. Expression of the mouse S16 ribosomal protein gene was examined as an internal control. A typical ethidium bromide stained agarose gel with bands corresponding to p21 and mouse S16 ribosomal protein RNAs from five wild-type and five p27/ livers is shown. D, relative levels of p21 mRNA expressed in wild-type (WT) and p27/ mouse livers are shown, with the bar representing the mean ± S.D., with levels normalized for S16 expression.

View larger version (59K): [in this window] [in a new window]   Fig. 2.   p27 and p21 protein expression and localization in the adult mouse liver. Tyramide-amplified indirect immunostaining was used to examine p27 and p21 expression in livers of adult male mice. Left panel, p27 positive hepatocyte nuclei were detected throughout the wild-type liver lobule and in bile duct epithelium. Middle panel, p21 protein was not detected in the wild-type liver. Right panel, p21 protein was detected in hepatocyte nuclei in p27/ livers. P, portal vein; C, central vein. Scale bar, 50 µm.

p21 expression is frequently regulated at the transcriptional level (9), so we examined levels of p21 mRNA expressed in the wild-type and p27-deficient livers used in the immunoblotting experiments above (Fig. 1B) using semiquantitative reverse transcription-PCR. No increase in p21 mRNA levels was detected in RNA samples from the p27-deficient animals, compared with the wild-type animals. Expression of the mouse S16 ribosomal protein gene was examined as a control (Fig. 1, C and D). The lack of a significant change in p21 mRNA levels suggests that increased p21 protein expression in the p27-deficient mouse liver is regulated at a post-transcriptional level.

To examine possible mechanisms regulating p21 protein expression in the wild-type liver, primary hepatocytes from male and female mice were placed into culture and treated with MG132, an inhibitor of proteasome-dependent proteolysis. It has been shown that MG132 treatment leads to stabilization of p21 protein (36) but not to an increase in p21 mRNA levels (37). An increase in p21 protein levels was detected after treatment of hepatocytes with MG132, suggesting that p21 protein levels are regulated by proteasome-mediated degradation in wild-type hepatocytes (Fig. 3A). To determine whether translation of p21 transcripts contributed to the increase in p21 protein levels detected after MG132 treatment, hepatocytes were cultured with MG132 and cycloheximide, an inhibitor of protein synthesis. Increased p21 protein was detected in the presence of MG132 and cycloheximide providing additional support that p21 is regulated at the level of protein stability in hepatocytes (Fig. 3, B and C).

View larger version (37K): [in this window] [in a new window]   Fig. 3.   Regulation of p21 expression levels by proteasomal mediated degradation in hepatocytes. A, primary hepatocytes were isolated from two male and three female mice, placed in culture and treated with the proteasome inhibitor MG132. Increased p21 levels were detected by immunoblotting after MG132 treatment. -Actin expression was examined as a control. B, to determine the contribution of new translation to the increase in p21 protein levels after treatment with MG132, cultured primary hepatocytes from three male mice were left untreated or treated with MG132, cycloheximide (CHX), or MG132 + cycloheximide. Increased p21 levels were detected when hepatocytes were treated with both MG132 and cycloheximide indicating that inhibition of proteasomal mediated degradation results in increased p21 levels in hepatocytes. Expression of -actin was examined as a control. C, relative levels of p21 protein normalized to -actin expression with bars representing the mean ± S.D. are shown.

An increase in p21 expression has not been previously reported for p27^/ tissues or cells. We examined p21 protein levels in serum-starved and stimulated p27^/ MEFs (Fig. 4A). We could not detect increased p21 expression as observed in the liver, suggesting that increased p21 expression in the absence of p27 might be liver-specific. However, when we compared p21 protein levels in a variety of differentiated tissues from mature (8-19 weeks of age) wild-type and p27-deficient mice, we discovered higher levels of p21 protein in multiple tissues of p27-deficient mice (Fig. 4B). Thus, increased accumulation of p21 may be important for cell cycle control in multiple tissues of the p27-deficient mouse.

View larger version (44K): [in this window] [in a new window]   Fig. 4.   p21 expression in p27-deficient mouse embryonic fibroblasts and tissues. A, expression of p21, PCNA, and -actin were examined in wild-type (WT) and p27-deficient mouse embryonic fibroblasts and liver extracts by immunoblotting. Increased p21 levels were detected in the p27-deficient liver extract, but not in serum-starved (0 h) or stimulated (24 h) p27-deficient MEFs. A longer exposure was required to detect p21 in liver tissue than in MEFs. Increased levels of PCNA were also detected in the p27-deficient liver. B, protein lysates were prepared from differentiated tissues of wild-type and p27-deficient mice, and p21 levels were compared by immunoblotting. Increased p21 protein levels were detected in multiple tissues of mature p27/ mice. Expression of p27 and -actin expression were examined as controls. Membranes were also stained to confirm equal loading of protein as the -actin antibody does not recognize adult cardiac actin.

p27-deficient Hepatocytes Seem Primed to Replicate, but Aberrant Proliferation Is Not Detected in Animals with an Intact p21 Gene-- We compared baseline expression levels of a number of cell cycle regulatory proteins including Cdk2, Cdk4, Cdk6, cyclin A, cyclin D1, cyclin E, and PCNA in four mice of each genotype (wild-type, p21^/, p27^/, and p21/p27^/) (Fig. 5). -Actin expression levels were examined as a control for protein loading. Increased expression of cyclin A was detected in all animals deficient for either p21 or p27. Increases in Cdk2 and PCNA expression were also apparent in livers of p27^/ and p21/p27 ^/ mice. Increased expression of proliferation-associated proteins suggested that there might be an increase in hepatic proliferation in mice lacking p27.

View larger version (66K): [in this window] [in a new window]   Fig. 5.   Increased expression of proliferation-associated proteins in the livers of p21- and p27-deficient mice. Expression of proliferation-associated proteins Cdk2, Cdk4, Cdk6, cyclin A, cyclin D1, cyclin E, PCNA, and -actin was examined using immunoblotting and extracts from four mice of each genotype (wild type, p21/, p27/, and p21/p27/). Reproducible increases in Cdk2 and PCNA protein levels were detected in extracts from livers of mice deficient for p27.

To determine whether the increase in proliferation-associated protein expression leads to increased cell proliferation in the normally quiescent liver, animals were injected with BrdUrd and then sacrificed after 2 h (Fig. 6). Significant numbers of BrdUrd-labeled hepatocytes were detected only in livers of mice deficient for both p21 and p27 (Fig. 6A). Although rare proliferating cells could be detected in livers of untreated wild-type mice and mice deficient for either p21 or p27, the majority of these rare cells were not hepatocytes.

View larger version (53K): [in this window] [in a new window]   Fig. 6.   Increased proliferation in the livers of mice lacking both p21 and p27. Animals were injected with BrdUrd and sacrificed after 2 h. A, tyramide-amplified indirect immunostaining of BrdUrd is shown in livers of wild-type, p21/, p27/, and p21/p27/ animals. BrdUrd immunoreactivity was detected with fluorescein isothiocyanate (white), whereas nuclei were stained with 4,6 diamidino-2-phenylindole (gray). Greatest numbers of replicating cells are observed in livers of p21/p27-deficient mice (arrowheads). B, BrdUrd-labeled cells were counted in 30 fields for each genotype. The majority of fields counted in the p21/p27-deficient liver sections contained two or three labeled cells, whereas no labeled cells could be detected in most fields counted on sections from the other three genotypes.

The total number of BrdUrd-labeled cells was counted in 30 random fields in liver sections from each of the four genotypes (Fig. 6B). In p21/p27^/ untreated livers most fields contained two or three BrdUrd-labeled nuclei. In comparison, most fields were negative in the other three genotypes. Similar results were obtained in separate experiments in which untreated mice were injected with [³H]thymidine 1 h before sacrifice (data not shown). The few fields from p27^/ liver sections containing more than four labeled cells contained arteries and veins, and the majority of the labeled cells were not hepatocytes. The increase in the number of sporadically proliferating hepatocytes in the untreated livers of mice lacking both p21 and p27 suggests that the increase in p21 expression detected in the untreated p27^/ liver can compensate for the absence of p27 and inhibit sporadic proliferation.

p21 Associates with CyclinE/Cdk2 and Cdk4 in p27-deficient Livers-- Expression of cyclins and Cdks was detected in the wild-type mouse liver (Fig. 4), but hepatocyte proliferation was detected only in the absence of both p21 and p27. We were unable to detect consistent increases in Cdk2 activity in the whole-tissue extracts from p21/p27-deficient livers, probably in part because the number of proliferating cells represented only a small fraction of the total cells (data not shown). In addition, evidence suggests that p21 and p27 are also positive regulators of cyclin/Cdk complexes, facilitating their assembly (reviewed in Refs. 3 and 4). We detected p27 in complexes with Cdk2 and Cdk4 in the livers of wild-type and p21-deficient animals using immunoprecipitation followed by immunoblotting (Fig. 7). In p27-deficient mice, a significant increase in p21 protein levels was detected, and p21 was found in complexes containing Cdk2 and Cdk4 in extracts from p27-deficient liver. Cyclin E was also detected associated with p21 in coimmunoprecipitation experiments (data not shown). Although p21 and p27 have been shown to play a positive role in the assembly of cyclin D-Cdk4 complexes, association of these CKIs with Cdk2 complexes is inhibitory and p21/p27-deficient MEFs have been shown to contain increased levels of Cdk2 activity (6). Our data suggest that increased levels of p21 protein in the p27-deficient liver inhibit proliferation by inhibiting Cdk2.

View larger version (64K): [in this window] [in a new window]   Fig. 7.   p21 is associated with Cdk2 and Cdk4 in the livers of p27-deficient animals. Immunoprecipitation of p27 or p21 from wild-type (WT), p21/, and p27/ adult mouse liver extracts was followed by immunoblotting with antibodies specific for p27, p21, Cdk2, and Cdk4.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Adult hepatocytes are quiescent and rarely divide under normal conditions. We detected p27 in the nuclei of hepatocytes throughout the adult mouse liver. We determined that p27 expression in quiescent hepatocytes is at least partially responsible for the lack of hepatocyte replication, although disruption of the p27 gene alone did not lead to a significant increase in hepatocyte proliferation. This was because p27-deficient hepatocytes express the related CKI p21, which was undetectable in the wild-type liver. Many sporadically proliferating hepatocytes were detected in animals lacking both p21 and p27, indicating that at least one of these CKIs was required for the maintenance of mature hepatocyte quiescence. An increase in p21 was detected in multiple tissues of mature p27-deficient mice and may represent a general mechanism by which tissues maintain cell cycle control in the absence of p27. We detected p21 protein in Cdk2 and Cdk4 complexes in p27-deficient livers, where it can play an active role in the inhibition of cell cycle progression.

A number of recent reports have emphasized the importance of regulation of p21 protein stability in growth control (38-41). Expression of p21 can be regulated by both ubiquitin-dependent and -independent proteasomal mediated degradation (36, 42-44). We determined that absence of p21 in wild-type liver may be attributed to proteasomal mediated degradation in liver cells, because p21 levels increased in hepatocytes treated with MG132 and cycloheximide. We examined several possible mechanisms that could contribute to changes in p21 protein turnover in the liver, including association of p21 with CCAAT/enhancer binding protein , and AKT activity (data not shown). CCAAT/enhancer binding protein  can bind and regulate levels of p21 protein and is expressed at high levels in quiescent hepatocytes (45). However, we were unable to detect differences in the expression of CCAAT/enhancer binding protein  or association of p21 with CCAAT/enhancer binding protein  between wild-type and p27^/ animals. Recent reports indicate that AKT activity may regulate p21 protein turnover (41, 46, 47), but we were unable to detect any changes in AKT activity or AKT association with p21 in p27-deficient livers.

Cooperation between CKIs has been demonstrated in various tissues. p27 and p57 have been shown to act together to control proliferation in lens fiber cells and placental trophoblasts (48), whereas p21 and p57 play redundant functions in regulating differentiation of skeletal muscle and lung alveoli (49). p19^Ink4d and p27 cooperate to maintain quiescence of differentiated neurons (50). Functional collaboration between p18^Ink4C and either p27 or p21 has also been demonstrated in vivo (51). p21 has been reported to be important for maintaining hematopoietic stem cell quiescence (15), although p27 is important for regulating hematopoietic progenitor cell proliferation (52). Here, we have shown that increased p21 expression can compensate for the lack of p27 to maintain quiescence of mature hepatocytes.

Recently, p27-deficient hepatocytes were shown to more efficiently repopulate diseased mouse livers in transplantation studies, and it has been suggested that p27-deficient hepatocytes may prove to be beneficial for the treatment of human liver diseases (53, 54). Our findings indicate that p27 is important for preventing hepatocyte proliferation in the physiological environment of the uninjured liver and that p21 accumulates in its absence to assume its role. As attempts are made to generate cells useful for human hepatocyte transplantation, it will be important to recognize that either p27 or p21 should be expressed in hepatocytes to prevent aberrant proliferation after repopulation of diseased liver has occurred.

Although rarely mutated in cancers, reduced expression of p27 has been correlated with poor survival among patients with breast, prostate, or colorectal carcinomas (reviewed in Refs. 27 and 28). Decreased expression of p27 protein has also been associated with poor prognosis in hepatocellular carcinomas (55-57). In mouse liver, the natural compensatory induction of p21 expression in the liver is sufficient to keep aberrant proliferation in check. Modulation of p27 and/or p21 expression in hepatocytes could have potential therapeutic benefits for patients with liver cancer.

	ACKNOWLEDGEMENTS

We are indebted to Dr. Andrei Gartel for helpful discussions and Dr. Tyler Jacks for providing the p21-deficient mice.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant R01-DK56283 (to A. L. T.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Dept. of Molecular Genetics, M/C 669, University of Illinois College of Medicine, 900 S. Ashland Ave., Chicago, IL 60607. Tel.: 312-996-7964; Fax: 312-413-0353; E-mail: atyner@uic.edu.

Published, JBC Papers in Press, August 28, 2002, DOI 10.1074/jbc.M203388200

	ABBREVIATIONS

The abbreviations used are: Cdk, cyclin-dependent kinase; CKI, cyclin kinase inhibitors; PCNA, proliferating cell nuclear antigen; MEF, mouse embryonic fibroblast; BrdUrd, bromodeoxyuridine.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				L. Sang, H. A. Coller, and J. M. Roberts Control of the Reversibility of Cellular Quiescence by the Transcriptional Repressor HES1 Science, August 22, 2008; 321(5892): 1095 - 1100. [Abstract] [Full Text] [PDF]

				M. K. James, A. Ray, D. Leznova, and S. W. Blain Differential Modification of p27Kip1 Controls Its Cyclin D-cdk4 Inhibitory Activity Mol. Cell. Biol., January 1, 2008; 28(1): 498 - 510. [Abstract] [Full Text] [PDF]

				W. Stehr, N. P. Bernal, C. R. Erwin, K. Q. Bernabe, J. Guo, and B. W. Warner Roles for p21waf1/cip1 and p27kip1 during the adaptation response to massive intestinal resection Am J Physiol Gastrointest Liver Physiol, May 1, 2006; 290(5): G933 - G941. [Abstract] [Full Text] [PDF]

				W. Yang, A. Velcich, I. Lozonschi, J. Liang, C. Nicholas, M. Zhuang, L. Bancroft, and L. H. Augenlicht Inactivation of p21WAF1/cip1 Enhances Intestinal Tumor Formation in Muc2-/- Mice Am. J. Pathol., April 1, 2005; 166(4): 1239 - 1246. [Abstract] [Full Text] [PDF]

				S. Gilbert, A. Loranger, and N. Marceau Keratins Modulate c-Flip/Extracellular Signal-Regulated Kinase 1 and 2 Antiapoptotic Signaling in Simple Epithelial Cells Mol. Cell. Biol., August 15, 2004; 24(16): 7072 - 7081. [Abstract] [Full Text] [PDF]

				V. V. Kalinichenko, M. L. Major, X. Wang, V. Petrovic, J. Kuechle, H. M. Yoder, M. B. Dennewitz, B. Shin, A. Datta, P. Raychaudhuri, et al. Foxm1b transcription factor is essential for development of hepatocellular carcinomas and is negatively regulated by the p19ARF tumor suppressor Genes & Dev., April 1, 2004; 18(7): 830 - 850. [Abstract] [Full Text] [PDF]

				Y. H. Kwon, A. Jovanovic, M. S. Serfas, and A. L. Tyner The Cdk Inhibitor p21 Is Required for Necrosis, but It Inhibits Apoptosis following Toxin-induced Liver Injury J. Biol. Chem., August 8, 2003; 278(32): 30348 - 30355. [Abstract] [Full Text] [PDF]

				E. J. Kim, I.-J. Kang, H. J. Cho, W. K. Kim, Y.-L. Ha, and J. H. Y. Park Conjugated Linoleic Acid Downregulates Insulin-Like Growth Factor-I Receptor Levels in HT-29 Human Colon Cancer Cells J. Nutr., August 1, 2003; 133(8): 2675 - 2681. [Abstract] [Full Text] [PDF]

				H. J. Cho, W. K. Kim, E. J. Kim, K. C. Jung, S. Park, H. S. Lee, A. L. Tyner, and J. H. Y. Park Conjugated linoleic acid inhibits cell proliferation and ErbB3 signaling in HT-29 human colon cell line Am J Physiol Gastrointest Liver Physiol, June 1, 2003; 284(6): G996 - G1005. [Abstract] [Full Text] [PDF]

				S. Jirawatnotai, D. S. Moons, C. O. Stocco, R. Franks, D. B. Hales, G. Gibori, and H. Kiyokawa The Cyclin-dependent Kinase Inhibitors p27Kip1 and p21Cip1 Cooperate to Restrict Proliferative Life Span in Differentiating Ovarian Cells J. Biol. Chem., May 2, 2003; 278(19): 17021 - 17027. [Abstract] [Full Text] [PDF]

This Article