Originally published In Press as doi:10.1074/jbc.M203581200 on August 27, 2002
J. Biol. Chem., Vol. 277, Issue 44, 41637-41644, November 1, 2002
The BmE75 Nuclear Receptors Function as Dominant Repressors of
the Nuclear Receptor BmHR3A*
Luc
Swevers
,
Kenichi
Ito§, and
Kostas
Iatrou
§¶
From the
Institute of Biology, National Centre for
Scientific Research "Demokritos," P. O. Box 60228, Aghia
Paraskevi Attikis, 153 10 Athens, Greece and § Department of
Biochemistry and Molecular Biology, University of Calgary, 3330 Hospital Drive N.W., Calgary, Alberta T2N 4N1, Canada
Received for publication, April 15, 2002, and in revised form, August 25, 2002
 |
ABSTRACT |
The orphan nuclear receptors BmE75 and
BmHR3 are induced by 20-hydroxyecdysone in the ovary of the silk moth
Bombyx mori at the beginning of pupation and show
stage-specific expression in ovarian follicles during pharate adult
development. To analyze the function of these receptors, we have
developed a transactivation assay based on the transcriptional
stimulation of a retinoic acid receptor-related receptor response
element (RORE)-linked promoter-reporter construct. Co-transfection of a
Bombyx cell line with a BmHR3A expression construct results
in constitutive activation of the reporter, whereas expression of BmE75
has no measurable effects on reporter expression. However, when the
BmE75 receptors are co-introduced with BmHR3A into the cells, the
BmHR3A-mediated transactivation is repressed. Repression of BmHR3A by
BmE75 occurs by two distinct mechanisms. Increasing doses of BmE75
efficiently displace BmHR3A bound to the RORE target site in gel
retardation assays, indicating that both receptors compete for common
DNA target sites. However, analysis of the function of deletion mutants of BmE75 in the transactivation assay indicates that repression can
also occur in the absence of the DNA-binding domain and that the
C-terminal F domain is sufficient for repression. In gel retardation assays, the two receptor types form a ternary complex on a single RORE,
suggesting that repression is also mediated by protein interactions on
the DNA target site. Yeast two-hybrid assays show that BmHR3A interacts
with BmE75 and that this interaction is dependent on the C terminus of
BmHR3A and the F domain of BmE75. Because the C terminus of BmHR3A
contains a strong activation domain, we predict that BmE75 blocks
activation by BmHR3A through competition for co-activator binding sites
located at the C terminus of BmHR3A. Our data also indicate that
the transcriptional activities of BmHR3A and BmE75 are integrated in
such a way that activation of RORE-linked target genes depends on the
relative expression levels of the two receptor types.
 |
INTRODUCTION |
The orphan nuclear receptors E75 and HR3 were originally isolated
because of their ubiquitous activation as early-response genes by
20-hydroxyecdysone (20E)1 in
target tissues of insects (1). The mRNA of E75 is typically induced within 30 min of hormone treatment, and the induction also
occurs in the presence of protein synthesis inhibitors, suggesting a
direct control of E75 gene transcription by the hormone-bound ecdysone receptor complex (2-4). The accumulation of HR3
mRNA, on the other hand, occurs more slowly (starting 2-3 h after
hormone exposure) and requires synthesis of additional factors for
maximal expression (5-7). Ecdysone-induced E75 and HR3 proteins are
subsequently thought to function as transcription factors and play
essential roles in the implementation of the 20E-induced gene
expression cascade (8).
The ovary of the silk moth Bombyx mori is a target of 20E
during early pupation (9, 10). Administration of 20E to developmentally arrested abdomens causes abrupt induction of BmE75 and BmHR3, the silk
moth homologs of the E75 and HR3 nuclear receptors, with kinetics
similar to those observed in target tissues of other insects (11, 12).
Interestingly, however, different isoforms for both types of receptors,
characterized by unique N-terminal regions, exist in the silk moth
ovary and differ in their hormone induction patterns. Among the BmE75
isoforms, BmE75A and BmE75C mRNAs are induced within 30 min by the
hormone, but the decline of the BmE75C mRNA occurs much faster than
that for the mRNA of BmE75A (12). Similarly, among the BmHR3
isoforms, BmHR3B and BmHR3C mRNAs are induced after 2-3 h, in
contrast with the mRNA of the BmHR3A isoform, which accumulates in
ovarian tissue 2 days after hormone administration (11).
In addition to the hormonal induction in the immature ovary at the
beginning of pupation, the expression of HR3 and E75 isoforms in the
silk moth ovary is also regulated in a hormone-independent fashion
during pharate adult development and can be correlated with specific
stages of oogenesis. Thus, the expression of BmHR3A coincides with
vitellogenesis (11), whereas BmE75C is only expressed during a brief
period at the transition from vitellogenesis to choriogenesis (12).
BmE75A, on the other hand, has a more ubiquitous expression pattern and
is present in both previtellogenic and vitellogenic follicles. The
expression at specific stages of oogenesis suggests a role for BmE75
and BmHR3 in the implementation of the developmental program of
follicle differentiation in the ovary.
The E75 and HR3 nuclear receptors were previously shown to bind as
monomers to similar extended nuclear hormone receptor DNA half-sites
consisting of the core motif AGGTCA preceded by an A/T-rich extension
(6, 11, 13-15). Such extended half-sites are known as retinoic acid
receptor-related receptor response elements (ROREs) because they were
originally identified as the binding sites for the ROR
receptors, the mammalian homologs of the insect HR3 receptors (16). The
ability of E75 and HR3 to bind to similar DNA target sites, combined
with the simultaneous expression of both receptors in tissues that are
challenged by hormone, raises questions regarding whether the receptors
will compete for common target sites in the DNA and the effects this competition will have on the transcriptional activation of target genes.
In this study, we tested the capacity of several Bombyx E75
and HR3 receptors for binding to a consensus RORE in gel
retardation assays and activation of a minimal promoter-reporter
construct harboring four copies of a RORE motif in its upstream region
in transient expression assays using B. mori tissue culture
cells. BmHR3A was found to bind efficiently to the RORE in
vitro and was identified as a strong constitutive activator in
tissue culture cells. The BmE75 nuclear receptors (A and C isoforms)
(12) also bind the RORE motif, but their overexpression in transient
expression assays does not result in measurable effects on reporter
gene activity. However, BmE75 is identified as an important cofactor for BmHR3A function because it efficiently represses transcriptional activation by BmHR3A. We therefore propose that the transcriptional status of BmHR3A target genes in silk moth cells is determined by the
relative levels of expression of BmHR3A and its silencing partners
BmE75A and BmE75C.
One clear mechanism of inhibition of BmHR3A by BmE75 is predicted to
occur by competition for common DNA target sites. However, unexpectedly, it was also found that repression of the function of
BmHR3A can occur in the absence of the DNA-binding domain (DBD) of
BmE75 and that BmE75 is recruited to RORE-containing promoters through
protein-protein interactions that involve the F domain of BmE75 and the
C terminus of BmHR3A. Because the C terminus of BmHR3A harbors
determinants that are essential for transactivation, a model is
proposed in which BmE75 blocks the function of BmHR3 by preventing,
through its F domain, the recruitment of co-activators to the C
terminus of BmHR3.
 |
MATERIALS AND METHODS |
In Vitro Transcription/Translation and Gel Retardation
Assays--
Recombinant derivatives of the Bluescript plasmid
(pBS/SK+; Stratagene) containing the complete open reading
frames (ORFs) of BmHR3A, BmE75A, and BmE75C (11, 12) were linearized
with SalI or BamHI and transcribed in
vitro with T3 RNA polymerase (Amersham Biosciences). The
transcribed RNA was translated in a rabbit reticulocyte lysate
(Promega) using the manufacturer's protocol. Gel mobility shift assays
were carried out as described previously (17). The double-stranded
oligonucleotide probe ROREdro, which was derived from the
Drosophila FTZ-F1 promoter and used in the bandshift assays,
has been described previously (11). Competition assays were carried out
in the presence of a 10-fold molar excess of unlabeled oligonucleotides
or pBS/SK+ DNA.
Cell Transfections, CAT Assays, and Dot Blot
Hybridizations--
All procedures for transfection, cell harvest,
protein extraction, CAT assays, and dot blot hybridizations were as
described previously (18). For each condition, one million cells were transfected with 0.5 µg of cat gene reporter construct in
the presence or absence of 0.5 µg of each nuclear receptor expression vector and additional pBS/SK+ (to a total amount of 1.5 µg) in 0.5 ml of basal IPL-41 medium (Invitrogen) containing 15 µl
of Lipofectin (Invitrogen). Quantification of cat gene
activity was carried out by PhosphorImager analysis (Amersham
Biosciences). The probe used in dot blot hybridizations was a 0.9-kb
BamHI fragment containing the CAT ORF.
The cat gene reporter construct pBmbA/ROREdro.cat consisted
of the basal actin promoter harboring four copies of the ROREdro element in its upstream region (11). The expression plasmids for
BmHR3A, BmE75A, and BmE75C (as well as their deletion mutants; see
below), i.e. pEA.hr3a, pEA.e75a, and pEA.e75c, respectively, were based on plasmid p13315 (19), which contains a viral enhancer sequence inserted upstream of the actin promoter in pBmA (18). The
construction of plasmid pEA.hr3a has been described previously (11).
Plasmids pEA.e75a and pEA.e75c were obtained after cloning a 2.4-kb
NotI fragment encompassing the complete ORF of BmE75A and a
2.6-kb NotI fragment encompassing the complete ORF of
BmE75C, respectively, into the NotI site of the polylinker
of p13315 (12).
Yeast Two-hybrid Library Screening--
Gal4 activation
domain/cDNA fusion (prey) plasmid libraries were screened for
proteins that interact with BmE75C using the MATCHMAKER Two Hybrid
System (Clontech). A Gal4 DBD/BmE75C protein hybrid
(bait) plasmid was constructed by cloning the 2.6-kb BmE75C ORF and
3'-untranslated region into the BamHI/NotI site
of the pGBT9 plasmid (Clontech) in-frame with
Gal4-DBD. Two "prey" plasmid libraries were constructed by
directional cloning of cDNAs prepared from follicular epithelial
cells of B. mori follicles into the pGAD424 plasmid
(Clontech). One library contained cDNAs (insert lengths
0.5 kb) prepared from previtellogenic and vitellogenic follicles, whereas the other library contained cDNAs prepared from
choriogenic follicles (insert lengths
1 kb). The two libraries, each consisting of 1.6 × 107 and 1 × 107 primary clones, respectively, were mixed before
screening. An initial screening of 107 transformants
performed in the absence of 3-aminotriazole (Sigma) yielded a large
number of colonies (>20,000). The cells of these colonies were pooled
and used for a second screening in the presence of 20 mM
3-aminotriazole. From the second screening, 31 true positive clones
were isolated that produced significant levels of
-galactosidase only in the presence of the bait plasmid.
Yeast Two-hybrid Assays for
-Galactosidase--
Fresh
overnight cultures of Saccharomyces cerevisiae HF7c strain
(Clontech) harboring both pGBT9 and pGAD424 bait
and prey plasmids (Clontech), respectively, or
their fusion derivatives, were prepared in 1 ml of synthetic dropout
medium (Clontech) containing 20 µg/ml
L-histidine (Sigma). The cultures were diluted 5-fold with
water to yield turbidity of 0.25-0.35 at 600 nm. Diluted cell
suspensions (1.5 ml) were centrifuged at 5000 × g for
5 min, and cell pellets were resuspended in 200 µl of zymolase buffer (50 mM Tris-HCl, pH 7.5, 10 mM
MgCl2, and 1 M sorbitol) containing 30 mM dithiothreitol. After a 15-min incubation at room
temperature, the suspensions were recentrifuged for 5 min at 2000 × g, and the pellets were resuspended in 100 µl of
zymolase buffer containing 1 mM dithiothreitol. After the
addition of 25 units of lyticase (Sigma), samples were incubated at
30 °C for 30 min under continuous shaking. The samples were
centrifuged for 5 min at 1500 × g, and the cell
pellets were lysed by vortexing in 840 µl of Z buffer (100 mM sodium phosphate buffer, pH 7, 10 mM KCl,
and 1 mM MgSO4) containing 40 mM
-mercaptoethanol. O-Nitrophenyl
-D-galactoside (Sigma; 160 µl of a 4 mg/ml solution)
was added, and samples were incubated at room temperature. After 90 min, the reactions were quenched by the addition of 600 µl of 1 M Na2CO3.
-Galactosidase activities were measured as optical densities at 420 nm, and the obtained values were corrected for differences in turbidity of the
cultures at 600 nm. Relative activities were expressed as percentages
of the activity observed for the control sample monitoring the
interaction between p53 and SV40 large T-antigen (pVA3 and pTD1
plasmids; Clontech).
Nuclear Receptor Deletion Mutants Used in Transactivation
Assays--
To obtain the N-terminal deletion mutant of BmHR3A, a
0.4-kb PCR fragment was generated by combining the forward primer
TTGGGCCCAACATGGCCCAAATCGAGATAATACC that consists of the
translation start site (in italic, containing an
ApaI site; nt 270-281 in Ref. 11) fused to the start
of the common region (nt 381-400) with the reverse primer
CGAAGACAACGGCGACCCG (nt 809-791). The resultant PCR fragment was
digested with ApaI and XhoI and used to replace a
0.5-kb ApaI/XhoI-fragment encompassing the N
terminus of full-length BmHR3A. To obtain the C-terminal deletion
mutant of BmHR3A, a 0.1-kb PCR fragment was generated using forward
primer TCCTGGCCAAGATACCCACT (nt 1600-1619) and reverse primer
AAGCGGCCGCTTAATGCGGATGCGTCGCTTT that consists of a
NotI site, a stop codon (both in italic), and
sequences of the ligand-binding domain (nt 1682-1665). The resultant
PCR fragment was digested with BglII and NotI and
used to replace a 0.3-kb BglII/NotI fragment containing the C terminus and 3'-untranslated region of BmHR3A. BmHR3A
deletion mutants were cloned as ApaI/NotI
fragments into the SmaI/NotI sites of the
polylinker of p13315 to generate plasmids pEA.hr3a
N, pEA.hr3a
C,
and pEA.hr3a
N/C (Fig. 1B).
To obtain N-terminal deletion mutants of BmE75, 0.6- and 0.4-kb PCR
fragments were generated using one of the forward primers (AAGCGGCCGCGACTATGGAATTTGACGGTACCACG and
AAGCGGCCGCGACTATGAGCAGAGATGCTGTG) that consist of a
NotI site, the translation start of BmE75C (both in
italic; translation start corresponds to nt 225-231 of the sequence of BmE75C; Ref. 12), and either the start of the common region
of BmE75 (first primer, nt 499-522 of BmE75C) or the start of the
hinge region (second primer, nt 724-738) combined with the common
reverse primer GAAGCCAGGGATGAGGCCGG (nt 1080-1061). The PCR fragments
were digested with NotI and MluI and used to replace a 0.8-kb NotI/MluI fragment encompassing
the N terminus of BmE75C.
To obtain the expression plasmid for the F domain of BmE75, the
cDNA clone of BmE75C in pBS/SK+ was digested with
HincII (nt 1558, in the first codon of the F domain) and
XhoI (polylinker of pBS/SK+) to release the
sequences upstream of the F domain of BmE75. A double-stranded
oligonucleotide that contains a XhoI 5' overhang, a
NotI site, the translation start of BmE75C (the latter two
in italic), the last codon of the ligand-binding domain, and
the first base of the F domain with the sequence
5'-TCGAGCGGCCGCGACTATGCGTC-3' 3'-CGCCGGCGCTGATACGCAG-5' was subsequently ligated
upstream of the F domain between the HincII and
XhoI sites.
To obtain C-terminal deletion mutants of BmE75, a 0.2-kb PCR fragment
was generated by combining forward primer CGGCCTGGCCTGCGAAAC (nt
1351-1368 in BmE75C) with reverse primer
AAGCGGCCGCTCAACGCAATAACTCCTTATGTTC that consists of a
NotI site, a stop codon (both in italic), and sequences at the end of the ligand-binding domain (nt 1558-1537). The
PCR fragment was digested with NruI and NotI and
used to replace a 1.6-kb NruI/NotI fragment
encompassing the C terminus (F domain) and 3'-untranslated region of BmE75.
To obtain the expression plasmid for the DNA-binding domain/hinge
region of E75, the pBS/SK+ clone that contains the
N-terminal-deleted mutant of BmE75 was digested completely with
MluI (nt 901 in BmE75C) and partially with NotI
(polylinker) to remove the F domain, the ligand-binding domain, and 26 bp at the 3' end of the hinge region. A double-stranded oligonucleotide
containing a MluI 5' overhang (italic), the seven C-terminal codons of the hinge region, a stop codon, and a
NotI 5' overhang (the latter two in italic) with
the sequence 5' CGCGTGATCGCGTCGCTTCCATGCGATGAGC 3' 3'
ACTAGCGCAGCGAAGGTACGCTACTCGCCGG 5' was subsequently
ligated downstream of the DNA-binding domain/hinge region using the
MluI and NotI sites.
BmE75 deletion mutants were cloned as NotI fragments in
plasmid p13315 to generate the expression vectors pEA.e75
N,
pEA.e75
N/DBD, pEA.e75a
F, pEA.e75c
F, pEA.e75
N/F,
pEA.e75
N/DBD/F, pEA.e75(F), and pEA.e75(DBD-H) (Fig.
3A).
Nuclear Receptor Deletion Mutants Used in Yeast Two-hybrid
Assays--
A 1.6-kb ApaI/NotI fragment
encompassing the complete ORF of BmHR3A was ligated to the
BamHI/SalI site of the pGAD424 vector in-frame
with the Gal4 activation domain through a
BamHI/ApaI adaptor at the 5' end and an
NotI/SalI adaptor at the 3' end to generate
plasmid Prey/HR3A. A 1.4-kb ApaI/NotI fragment
containing BmHR3A with the last 26 C-terminal amino acids (aa) deleted
(described above) was cloned in similar fashion to generate plasmid
Prey/HR3A
C. To obtain plasmid Prey/HR3(LBD), PCR was employed using
the primers 5'-GGAGGGTGACATTAGCAAGG-3' and
5'-TCCGTGCGTGTAATCTAAAAC-3' to generate a fragment that contained
the LBD and its surrounding regions (22 aa of the hinge region and 10 aa of the F domain). The fragment was subsequently cloned into the
SmaI site of pGAD424 in-frame with the Gal4 activation domain.
To generate pGBT9 derivatives that produce Gal4-DBD/E75 fusion
proteins, a BamHI restriction site (italic, see
below) was introduced at the translation start of BmE75A, BmE75C, and
BmE75D by PCR. PCR fragments were produced using the forward primer
5'-GTTGGATCCTGATGTCTCCGGATAGT-3' for BmE75A or
5'-GTTGGATCCCTATGCAGTGTTATCCG-3' for BmE75C and the reverse
primer 5'-GTTGTCGACCGTGGTACCGTCAAATTC-3' for BmE75A or
5'-GACGGTTCTTCGAATGATGG-3' for BmE75C. The PCR fragments were digested with BamHI and KpnI (A isoform) or
BamHI and ApaI (C isoform) and used to replace
the N termini of the different BmE75 isoforms. BmE75 isoforms with a
BamHI site introduced at their N terminus were subsequently
digested with BamHI and NotI and cloned, through
the use of a NotI/SalI adaptor, into
BamHI-SalI-digested pGBT9 vector in-frame with
the DBD of Gal4 to generate plasmids Bait/E75A and Bait/E75C.
To generate plasmids Bait/E75
N and Bait/E75
N/DBD/H, plasmid
Bait/E75C was digested with BamHI/KpnI or
BamHI/MluI, respectively, to release N-terminal
sequences and was self-ligated with the help of suitable adaptors to
ensure the continuity of the ORF with the Gal4 DBD.
To obtain plasmid Bait/E75
N/F, a 1.05-kb
BamHI/HincII fragment of Bait/E75
N was cloned
into the BamHI/PstI site of pGBT9 after
blunt-ending of the PstI site by T4 DNA polymerase (Roche Molecular Biochemicals). To obtain plasmid Bait/E75
N/LBD/F, plasmid Bait/E75
N was digested with MluI and NotI,
blunt-ended with T4 DNA polymerase, and self-ligated. Plasmid
Bait/E75(F) was generated by subcloning a 1.3-kb
HincII/NotI fragment of BmE75C into the BamHI/NotI site of pGBT9 through the use of a
BamHI/HincII adaptor.
 |
RESULTS |
Recombinant BmHR3A Recognizes a RORE Motif and Causes
RORE-dependent Activation of a Reporter Gene--
To
examine whether BmHR3A is capable of recognizing RORE DNA target sites,
bandshift experiments were carried out using BmHR3A produced by
in vitro transcription/translation. The RORE selected for
the gel retardation assay was derived from the Drosophila FTZ-F1 promoter (the "A" element; Ref. 13) and corresponded to a
perfect match to the consensus vertebrate RORE (6). As shown
in Fig. 1A, BmHR3A binds
FTZ-F1 RORE in a specific manner.

View larger version (30K):
[in this window]
[in a new window]
|
Fig. 1.
BmHR3A binds to a canonical RORE motif and
functions as a constitutive activator in Bm5 cells. A,
gel retardation assays in which BmHR3A translation mixture (lanes
2-4) or unprogrammed reticulocyte lysate (lane 1) was
assayed for binding the -FTZ-F1 promoter-derived RORE motif. Binding
reactions were competed with 10× excess of specific RORE sequence
(Competitor) or nonspecific (Bluescript) DNA as
indicated. The complex formed by in vitro-translated BmHR3A
is indicated by an arrow. B, schematic drawing of
BmHR3A full-length receptor and its deletion mutants, which were tested
in transactivation assays. The two domains that are characteristic for
members of the nuclear receptor superfamily, the DBD and the LBD, are
indicated. C, stimulation of the RORE-linked promoter-CAT
reporter construct by full-length BmHR3A or its deletion mutants in Bm5
cells. CAT activities are compared with that observed for the
promoter-reporter construct in the absence of cotransfected expression
construct (basal activity = 1). Results shown are average ± S.E. and are derived from at least three independent experiments.
|
|
To investigate whether BmHR3A is capable of activating RORE-linked
reporter genes, transient expression experiments were carried out. In
these experiments, a BmHR3A expression vector (pEA.hr3a) was
transfected into silk moth tissue culture cells (Bm5 cells) together
with a reporter construct containing four copies of the FTZ-F1 RORE
linked to a basal promoter (pBmAb/ROREdro). As demonstrated previously (11), BmHR3A activates the RORE-linked promoter by ~75-fold (76.1 ± 1.3, n = 9; Fig.
1C).
Most nuclear receptors contain two distinct regions that are involved
in the activation of transcription: a ligand-independent activation
function 1 (AF-1) residing in the N terminus, and a ligand-dependent activation function 2 (AF-2) residing in
the ligand-binding domain (20). Whereas different subregions in the
ligand-binding domain contribute to AF-2, the integrity of an
amphipathic
-helix at the C terminus of the ligand-binding domain
(helix 12 in the conserved structure of the ligand-binding domain of
nuclear receptors) (21) was shown to be indispensable for
ligand-dependent activation. A similar amphipathic
-helix, characterized by the conserved motif

XE
(
being a hydrophobic amino acid and
X being a nonconserved amino acid) (20), is also present at
the C terminus of the ligand-binding domain of BmHR3A (LYKELF; aa
residues 474-479 in Ref. 11).
To determine whether similar activation functions exist in BmHR3A,
mutant BmHR3A receptors encompassing a deletion of the isoform-specific
region at the N terminus and/or a deletion of the 22 C-terminal amino
acids that included the short F domain and the LYKELF motif at the end
of the ligand-binding domain (BmHR3A
N, BmHR3A
C and BmHR3A
N/C;
Fig. 1B) were tested in the transactivation assay for their
capacity to stimulate transcription from the RORE-coupled promoter
construct. Whereas the N terminus deletion mutant was capable of
stimulating transcription of the reporter construct as efficiently as
full-length BmHR3A (72.6 ± 1.1, n = 3), only very
minor stimulation of transcription was observed for the C-terminal deletion mutants (stimulation by 3.1 ± 0.8 (n = 3) for BmHR3A
C and 2.9 ± 1.1 (n = 3) for
BmHR3A
N/C). These results suggest that the activation functions of
BmHR3A reside in its C terminus (AF-2) and that its N terminus is not
involved in transcriptional activation in any significant manner.
The Nuclear Receptors BmHR3A and BmE75 Compete for DNA Binding and
Form a Ternary Complex on a Single RORE Motif in Gel Retardation
Assay--
To deduce whether the BmE75 nuclear receptors interact as
avidly as BmHR3A with the consensus RORE, we performed
bandshift assays using the FTZ-F1 RORE element as probe together with
in vitro-transcribed/translated BmE75A and BmE75C. The
results shown in Fig. 2A
demonstrate that BmE75A and BmE75C specifically bind the RORE sequence.
The amount of shifted complex in these experiments was less than that
seen for BmHR3A, presumably because of the lower amount of protein
produced by the in vitro transcription/translation mixtures
(Fig. 2A, lanes 2-7; compare with Fig. 2,
lane 8 and Fig. 1A, lanes 2-4).

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 2.
The nuclear receptors BmHR3A and BmE75
compete for DNA binding and form a ternary complex on a single RORE
motif in gel retardation assay. A, specific DNA binding
by the nuclear receptors BmE75A and BmE75C and formation of a ternary
complex in the presence of high amounts of BmHR3A protein. Unprogrammed
translation mixture (5 µl; lane 1) or translation mixtures
programmed with BmE75A (5 µl; lanes 2-4 and 9)
or BmE75C (5 µl; lanes 5-7 and 10) were
assayed for binding to the Drosophila -FTZ-F1
promoter-derived RORE motif in the absence (lanes 2-7) or
presence (lanes 8 and 9) of an equivalent amount
of BmHR3A translation mixture (5 µl). Binding reactions were competed
with 10× excess of specific RORE sequence (Competitor) or
nonspecific DNA (Bluescript) as indicated. Specific
complexes formed by the single nuclear receptors are indicated by
asterisks. Ternary complexes formed by BmHR3A and BmE75A or
BmE75C are indicated by arrows. B, competition
for DNA binding between the nuclear receptors BmHR3A and BmE75C.
Translation mixture programmed with BmHR3A RNA (1 µl) was incubated
with increasing amounts of translation mixtures programmed with BmE75C
RNA (1, 3, 5, and 10 µl; lanes 3-6) and assayed for
binding to a limited amount of the RORE probe. Lane 7 shows
the binding of 5 µl of BmE75C mixture in the absence of BmHR3A.
Specific complexes formed by BmHR3A and BmE75C are indicated by
asterisks. The formation of a supershifted complex in
lane 6 is marked with an arrow. The
arrowheads indicate the position of a nonspecific complex
that is also observed with unprogrammed lysate.
|
|
To investigate whether binding of BmE75 to the RORE can interfere with
the binding of BmHR3A, a small amount of BmHR3A (1 µl of translation
mixture) was incubated with a limiting concentration of RORE probe and
increasing concentrations of BmE75C protein (1-10 µl of translation
mixture). As shown in Fig. 2B, the complex corresponding to
BmHR3A was gradually displaced by the BmE75 complex at increasing
doses, indicating that both proteins can compete with each other for
binding the RORE motif (Fig. 2B). However, weak supershifted
activity could also be observed when high doses of BmE75 were added to
BmHR3A (arrow in Fig. 2B), suggesting the formation of ternary complexes. When higher amounts of BmHR3A translation mixtures (5 µl) were used in the gel retardation assay together with high amounts of BmE75 (5 µl), a new complex of slower mobility was indeed clearly observed, indicating the presence of a
BmHR3A/BmE75(A or C) ternary complex on the target DNA (Fig. 2A, lanes 9 and 10). Because the
bandshifts were carried out with a probe containing a single RORE, the
latter results indicate that BmHR3A and BmE75 interact with each other.
Repression of BmHR3A-dependent
Transactivation by BmE75--
When BmE75 expression
constructs were transfected into the Bm5 cells together with the
RORE-linked promoter-reporter construct, reporter gene activity was not
measurably affected (data not shown). Because BmE75 was shown to
interact with the RORE in bandshift assays (Fig. 2), we assume that
BmE75 is recruited to the RORE elements present upstream of the
promoter but may not be capable of influencing transcription because it
lacks the activation and/or repression functions normally present in
other nuclear receptors.
To investigate the possibility that BmE75 affects the function of
BmHR3A, BmE75 and BmHR3A expression constructs were co-transfected into
the Bm5 cells together with the RORE promoter-driven reporter construct. The results of the co-transfection experiments shown in Fig.
3B demonstrate that all
isolated BmE75 isoforms significantly inhibit the BmHR3A-mediated,
RORE-dependent activation of the reporter gene.
Interestingly, differences were detected among the BmE75 isoforms
regarding their capacity to inhibit BmHR3A-mediated gene activation.
Thus, BmE75C functions as a 2-3-fold stronger repressor than BmE75A
(12.8 ± 1.9-fold repression (n = 7) by the C
isoform compared with 5.2 ± 0.7-fold (n = 10) for
the A isoform; Fig. 3B).

View larger version (25K):
[in this window]
[in a new window]
|
Fig. 3.
Repression of BmHR3A-dependent
transactivation by BmE75. A, schematic drawing of BmE75
full-length receptors (A and C isoforms) and their deletion mutants,
which were tested for repression of BmHR3A-dependent
transactivation in Bm5 cells. The two domains that are characteristic
for members of the nuclear receptor superfamily, the DBD and the LBD,
are indicated. The isoform-specific N terminus of BmE75A or BmE75C is
also differentially indicated. B, repression of
BmHR3A-dependent activation of the RORE-linked promoter-CAT
reporter construct by BmE75 full-length receptors or their deletion
mutants. Fold repression is expressed relative to the activity obtained
after co-transfection of the reporter plasmid and the BmHR3A expression
plasmid only, in the absence of any BmE75 expression plasmid (no
repression = 1). Results shown are average ± S.E. and are
derived from at least three independent experiments.
|
|
To investigate which domains of BmE75 are responsible for repression,
deletion mutants of BmE75 were co-expressed with BmHR3A in the tissue
culture cells. Our results show that BmE75 receptors with their N
termini deleted still function as potent repressors (13.2 ± 1.9-fold reduction (n = 5) in BmHR3A function
for BmE75
N; Fig. 3B). Importantly, further deletion of
the DNA-binding domain did not affect the repression activity
(12.2 ± 1.1-fold repression (n = 3) by
BmE75
N/DBD; Fig. 3B), indicating that DNA binding is not
required for BmE75 to repress activation by BmHR3A.
By contrast, C-terminal deletions compromise the capacity of BmE75 to
silence BmHR3A. Although repression is still significant, it is
diminished to only 1.8 ± 0.2-fold (n = 3) and
2.0 ± 0.2-fold (n = 4) in the F domain deletion
mutants of BmE75A and BmE75
N, respectively. Deletion of the F domain
has a less significant effect for BmE75C, although the capacity to
repress transactivation is reduced by ~2-fold (to 5.5 ± 1.5-fold repression (n = 3)) in the F domain deletion
mutant compared with full-length BmE75C (Fig. 3B).
In view of our finding that the F domain contributes significantly to
the BmE75-mediated repression of BmHR3A, we investigated the
possibility that the F domain alone is sufficient for effecting the
silencing of the BmHR3A function. As shown in Fig. 3B,
potent repression of BmHR3-mediated gene activation was observed upon co-transfection of the cells with the F domain of BmE75. Repression by
the F domain (9.7 ± 0.6 (n = 4)) was comparable
with that of the full-length BmE75 receptors. By contrast, no
repression was observed when two other constructs of BmE75, consisting
of either the DBD/hinge or hinge/LBD regions, were tested in the
transactivation assay (Fig. 3B). Finally, the repression
activity of the F domain was specific to BmHR3A-mediated gene
activation because overexpression of the F domain did not influence the
activity of the Bombyx actin promoter, which is not
regulated by BmHR3A (data not shown).
In conclusion, the experiments with the BmE75 deletion mutants show
that the F domain of BmE75 contains most of the determinants for
repression of the transcriptional activity of BmHR3A and is sufficient
for function. However, deletion of the F domain from the full-length
receptors does not completely abolish repression, indicating that
partial repression of BmHR3A function is also accomplished by
competition for DNA binding sites. In this respect, it should be noted
that in the case of BmE75C, which exhibits stronger DNA binding than
BmE75A (Fig. 2A), deletion of the F domain results in a
lesser reduction of its repression activity relative to BmE75A (Fig.
3).
Interaction between BmHR3A and BmE75 Nuclear Receptors in Yeast
Two-hybrid Assays--
During an initial screening of a yeast
two-hybrid expression library of follicular cell cDNA using
full-length BmE75C as bait, two classes of clones encoding interacting
proteins were obtained. The first class, represented by ~90% of the
positive clones, contained clones encoding the nuclear receptor BmHR3.
The second class, represented by the remaining 10% of positives,
consisted of clones encoding a putative adaptor protein containing
multiple SH3 domains.2
Interestingly, two isoforms of BmHR3 preys differing from each other in
their hinge regions were isolated in the yeast two-hybrid screen. The
first one corresponded to the previously characterized A isoform (11),
whereas the second one contained a hinge region that is similar to that
described for the C isoform of Choristoneura fumiferana HR3
receptor (83% aa identity; Ref. 15).
To map the interaction domain of BmE75, full-length BmE75 isoforms and
a series of deletion mutants were tested for interaction with BmHR3A in
the yeast two-hybrid assays. As shown in Fig.
4B, all isoforms interact with
full-length BmHR3A in these assays, but the interaction is much
stronger for the A isoform than for the C isoform. Deletion of the
isoform-specific N terminus of BmE75 did not result in a decrease in
the interaction between the two receptors (Fig. 4B). By
contrast, deletion of the F domain (baits BmE75
N/F and
BmE75
N/LBD/F; Fig. 4A) strongly compromised the
interaction with BmHR3A (Fig. 4B). Most importantly, the F domain alone was capable of interacting strongly with BmHR3A (Fig. 4B).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 4.
Interaction between BmHR3A and BmE75 in
yeast two-hybrid assays: mapping of the interaction domain of BmE75.
A, schematic drawing of full-length and mutant BmHR3A
or BmE75 receptors that were used in the experiments. The DBD and LBD
are indicated. B, yeast two-hybrid assays in which the
interactions of BmE75 receptors and their deletion mutants were
measured with full-length BmHR3A. Relative -galactosidase activities
are expressed as percentages of the activity observed for the control
interaction between p53 and SV40 large T-antigen. Results shown are
average ± S.E. and are derived from at least three independent
experiments.
|
|
Curiously, whereas the F domain alone showed strong interaction with
BmH3A, the same domain in combination with the ligand-binding domain
(bait BmE75
N/DBD/H) did not show much activity when combined with
BmHR3A (Fig. 4B). This may be due to steric hindrance
exerted by the ligand-binding domain of BmE75.
Finally, to map the interaction domain of BmHR3, full-length BmHR3A,
the C-terminal region of BmHR3 that is common to the A and C isoforms
(from the C-terminal part of the hinge region to the end of the F
domain), or BmHR3A with a short deletion at the C terminus were tested
for interaction with the BmE75
N mutant or the F domain alone in the
yeast two-hybrid system (Fig. 5, B and C). These assays clearly showed that the
BmE75-interacting domain resides in the C-terminal half of BmHR3,
starting from the 20 C-terminal aa of the hinge region that is common
to all BmHR3 isoforms (Fig. 5, A and B). Most
importantly, a smaller deletion encompassing the the 22 C-terminal aa
of BmHR3A including the amphipathic
-helical activation domain (prey
BmHR3A
C) resulted in the abolishment of the interaction of BmHR3
with BmE75 (Fig. 5, B and C).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 5.
Interaction between BmHR3A and BmE75 in yeast
two-hybrid assays: mapping of the interaction domain of BmHR3A.
A, schematic drawing of BmHR3A or BmE75 receptor mutants
that were used in the experiments. The DBD and LBD are indicated.
B and C, yeast two-hybrid assays in which the
interactions of BmHR3A mutants were measured with BmE75 N
(B) or the F domain of BmE75 (C). Relative
-galactosidase activities are expressed as percentages of the
activity observed for the control interaction between p53 and SV40
large T-antigen. Results shown are average ± S.E. and are derived
from at least three independent experiments.
|
|
In conclusion, the results of the yeast two-hybrid interaction assays
suggest a new function for the F domain of BmE75 nuclear receptors, the
mediation of the interaction with the C-terminal activation region of BmHR3.
 |
DISCUSSION |
Previous studies in Drosophila have shown that the
interaction between the nuclear receptors HR3 and E75 plays an
important role in the implementation of the 20E-induced regulatory
cascade. Using transgenic flies, it was shown that
Drosophila DHR3 is an activator of the gene encoding the
mid-prepupal competence factor
-FTZ-F1 (13, 22-24). However,
activation of
-FTZ-F1 by DHR3 is prevented by overexpression of
E75B, an isoform of E75 that lacks a functional DNA-binding domain
(22). The inhibition of DHR3 by E75B is therefore thought to function
as a timing mechanism for the induction of
-FTZ-F1, which is
dependent on the persistence of DHR3 and the disappearance of E75B.
With regard to the mechanism by which E75B represses DHR3, it was found
that in bandshift assays the two receptors form a ternary complex on
ROREs that exist in the
-FTZ-F1 promoter, suggesting that repression
is carried out through DHR3-E75B interactions on this promoter
(22).
Our results on the interactions between BmE75 and BmHR3 in yeast and in
Bombyx tissue culture cells confirm and expand the findings
in transgenic flies. Using silk moth homologs of HR3 and E75 and an
artificial promoter-reporter construct, we have shown that BmHR3A is a
potent transactivator of RORE motif-containing promoters that becomes
repressed upon simultaneous expression of BmE75. Repression of the
BmHR3-activating function is mediated by the two BmE75 isoforms tested
(A and C; Fig. 3). Because the B isoform of E75 differs from the other
isoforms by a unique N terminus that replaces the first half of the
DNA-binding domain (2, 25, 26), our findings indicate that the unique
N-terminal sequences of E75B are not necessary for
repression. Based on the structural features of the E75B isoform of
B. mori, which has also been described recently (27), we
predict that this isoform will also function as an efficient repressor
of BmHR3-mediated transactivation.
With regard to the mechanism by which BmE75 represses BmHR3A, we have
shown that overexpression of the F domain alone is sufficient to
achieve efficient repression of BmHR3A (Fig. 3). Thus, despite the fact
that BmE75 is capable of binding to the RORE element, DNA binding by
BmE75 is not required for repression. The fact that BmE75A and BmE75C
form ternary complexes with BmHR3A on a single RORE in bandshift assays
(Fig. 2A) also indicates that repression can be mediated
through protein interactions. However, the fact that BmE75 is capable
of competing efficiently with BmHR3A for binding to the RORE motif in
bandshift assays (Fig. 2A) and the observation that BmE75
mutants with an intact DNA-binding domain but with the F domain deleted
still mediate considerable repression of HR3-mediated activation (Fig.
3) indicate that competition for common DNA binding sites also
contributes to repression.
The yeast two-hybrid assays have shown that the F domain of BmE75
interacts with the C terminus of BmHR3A (Fig. 4). Interestingly, deletion of the 22 C-terminal aa of BmHR3A results in the abolishment of the interaction with the F domain of BmE75 (Fig. 4). The BmHR3A mutant lacking the same C-terminal aa is also defective in
transactivation of the RORE-linked reporter construct in tissue culture
cells (Fig. 3), indicating that binding by the F domain of BmE75 occurs at the transactivation domain of BmHR3A. The deletion in BmHR3A that
abolishes transactivation and interaction with BmE75 covers the short F
domain and 12 aa at the C terminus of the ligand-binding domain and
encompasses an amphipathic
-helix that is conserved among nuclear
receptors (20). The integrity of this
-helix has been shown to be a
requirement for transactivation and interaction between the
ligand-binding domain and intermediary transcriptional factors or
co-activators (21, 28, 29). We therefore propose that in analogy with
other (mammalian) nuclear receptors, the amphipathic
-helix at the C
terminus of BmHR3A is involved in the stimulation of transcription
through interactions with co-activators and that the binding of the F
domain of BmE75 prevents the recruitment of the co-activators that are
needed for stimulation of transcriptional activity.
A similar mechanism of transcriptional repression through blocking of
binding sites for co-activator proteins has also been reported for the
nuclear receptor SHP (small heterodimerization partner) (30). Despite
the fact that SHP consists only of a ligand-binding domain, it
effectively represses the estrogen receptor through binding to the
C-terminal transactivation
-helix of estrogen receptor and competing
out co-activator binding to the estrogen-bound ligand-binding domain of
the estrogen receptor. Interestingly, the binding of SHP to the
co-activator binding site occurs via LXXLL-related motifs.
The LXXLL motifs that exist in nuclear receptor co-activators are the primary determinants for high-affinity binding to
the ligand-binding domain of the receptors (29, 31-33). Furthermore, intermediary transcriptional factors that mediate repression of nuclear
receptors (co-repressors) associate with the unliganded receptors
through similar motifs (34). Although an exact copy of the
LXXLL motif was not found in BmE75, a similar motif,
LXXVL, exists in a region in the middle of the F domain of
BmE75 that is evolutionarily conserved (25). In BmE75, this motif is
flanked by proline residues that may allow it to fold as an independent domain, a proposed prerequisite for efficient recognition of the coactivator-binding site (33). Mutation of this motif through site-directed mutagenesis will determine whether it is directly involved in the interaction with BmHR3A and in the repression of its
transcriptional activation.
The mammalian homologs of BmHR3 and BmE75 are the ROR/retinoid Z
receptor and the Rev-Erb/Rev-Erb-related receptor, respectively (2, 16). The antagonism between the two types of receptors seems to be
conserved between insects and mammals because ROR acts as a
constitutive activator whose major activation function resides at its C
terminus, similar to HR3 (35, 36), whereas Rev-Erb functions as a
repressor (37, 38). When co-expressed, Rev-Erb represses
transcriptional activation by ROR (35). However, Rev-Erb lacks the F
domain, and inhibition of ROR seems to be achieved mainly through
competition for common DNA-binding sites. On certain response elements,
on the other hand, Rev-Erb functions as a constitutive repressor by the
active recruitment of co-repressor proteins to the ligand-binding
domain (38, 39). However, no such "active" repression function was
observed for BmE75 on the reporter constructs used in our experiments.
During the early phases of the ecdysone response in the
Bombyx ovary, the nuclear receptors BmE75A and BmE75C become
induced immediately upon hormone addition, whereas the accumulation of BmHR3 occurs with a delay of 2 h (11, 12). Similarly, the decline
in expression occurs faster for BmE75 than for BmHR3. Because BmE75A
and BmE75C act as efficient repressors of BmHR3, it can be predicted
that, as was reported for Drosophila E75B (22), the BmHR3
function is effectively blocked during the early phases of the
20E-induced cascade, whereas it is relieved during the later phases of
the response. A similar situation also exists during vitellogenesis in
the Bombyx ovary, which is initiated 2 days after the first
exposure to 20E (11). During vitellogenesis, the levels of BmHR3A
mRNA increase steadily as follicle development progresses and reach
their maximum levels at stages
13/
18 (11). The A isoform of
BmE75 is also expressed during vitellogenesis, but its expression
actually declines during the stages when BmHR3A expression is highest
(12). Interestingly, the period with the highest ratio in expression
levels of BmHR3A relative to BmE75A coincides with the induction of the
mRNA for BmFTZ-F1 (40), indicating that the mechanism for
activation of BmFTZ-F1 during ovarian development in Bombyx
occurs in a fashion similar to that of
-FTZ-F1 during metamorphosis
in Drosophila.
During vitellogenesis, the accumulation of BmHR3A mRNA also
coincides with the expression of the gene encoding the follicle cell-specific yolk protein ESP, whereas it is reciprocal to the accumulation of the mRNA of the chorion gene regulator BmGATA
(11). Based on these observations, we propose that BmHR3A could act, in
concert with cell and promoter-specific cofactors, as both an activator
of the ESP gene and a repressor of the BmGATA
gene. BmE75A, which is
co-expressed with BmHR3A during vitellogenesis, is therefore predicted
to be recruited more efficiently to the BmGATA
promoter than to the
ESP promoter. Preliminary experiments indeed suggest that repression of
the BmGATA
promoter occurs in Bm5 cells upon overexpression of
BmHR3A and BmE75A.3 A role for
repression through HR3 receptors is not unprecedented because it
has been demonstrated that during Drosophila metamorphosis, DHR3 receptors down-regulate the expression of the early response genes
E74, E75, and Broad-Complex, presumably through a mechanism that
involves direct interaction with the ecdysone receptor (13, 22).
Finally, it is also clear that BmE75 receptors play functional roles
during Bombyx oogenesis that are independent of BmHR3. The C
isoform of BmE75 becomes markedly up-regulated at the end of
vitellogenesis and the beginning of choriogenesis (12), when no BmHR3
protein can be detected in the follicular cells (11). Interestingly, in
yeast two-hybrid screens, a putative adaptor protein containing
multiple SH3 domains was isolated that interacts with the proline-rich
N terminus of BmE75C.2 The expression pattern of the
putative adaptor protein during oogenesis also overlaps with that of
BmE75C (40). Thus, the data indicate a role for BmE75C as a key player
in a transduction cascade that is independent of 20E and BmHR3 and
governs the transition from vitellogenesis to choriogenesis.
 |
FOOTNOTES |
*
This work was supported by the General Secretariat of
Research and Technology, Greek Ministry of Development.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed. Tel.:
30-1-650-3583; Fax: 30-1-651-1767; E-mail:
iatrou@mail.demokritos.gr.
Published, JBC Papers in Press, August 27, 2002, DOI 10.1074/jbc.M203581200
2
K. Ito and K. Iatrou, unpublished results.
3
L. Swevers and K. Iatrou, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
20E, 20-hydroxyecdysone;
RORE, retinoic acid receptor-related receptor
response element;
DBD, DNA-binding domain;
LBD, ligand-binding domain;
nt, nucleotide;
aa, amino acid(s);
ORF, open reading frame;
CAT, chloramphenicol acetyltransferase;
ROR, RAR-related orphan
receptor;
FTZ-F1, fushi tarazu-factor 1.
 |
REFERENCES |
| 1.
|
Henrich, V. C.,
and Brown, N. E.
(1995)
Insect Biochem. Mol. Biol.
25,
881-897[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Segraves, W. A.,
and Hogness, D. S.
(1990)
Genes Dev.
4,
204-219[Abstract/Free Full Text]
|
| 3.
|
Palli, S. R.,
Ladd, T. R.,
Ricci, A. R.,
Sohi, S. S.,
and Retnakaran, A.
(1997)
Dev. Genet.
20,
36-46[Medline]
[Order article via Infotrieve]
|
| 4.
|
Zhou, B.,
Hiruma, K.,
Jindra, M.,
Shinoda, T.,
Segraves, W. A.,
Malone, F.,
and Riddiford, L. M.
(1998)
Dev. Biol.
193,
127-138[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Palli, S. R.,
Hiruma, K.,
and Riddiford, L. M.
(1992)
Dev. Biol.
150,
306-318[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Horner, M. A.,
Chen, T.,
and Thummel, C. S.
(1995)
Dev. Biol.
168,
490-502[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Huet, F.,
Ruiz, C.,
and Richards, G.
(1995)
Development
121,
1195-1204[Abstract]
|
| 8.
|
Thummel, C. S.
(1997)
Bioessays
19,
669-672[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Tsuchida, K.,
Nagata, M.,
and Suzuki, A.
(1987)
Arch. Insect Biochem. Biophysiol.
5,
167-177
|
| 10.
|
Swevers, L.,
and Iatrou, K.
(1998)
Mech. Dev.
72,
3-13[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Eystathioy, T.,
Swevers, L.,
and Iatrou, K.
(2001)
Mech. Dev.
103,
107-115[Medline]
[Order article via Infotrieve]
|
| 12.
| Swevers, L., Eystathioy, T., and Iatrou, K. (2002) Insect
Biochem. Mol. Biol., in press
|
| 13.
|
Lam, G.,
Jiang, C.,
and Thummel, C. S.
(1997)
Development
124,
1757-1769[Abstract]
|
| 14.
|
Palli, S. R.,
Ladd, T. R.,
and Retnakaran, A.
(1997)
Insect Biochem. Physiol
35,
33-44
|
| 15.
|
Palli, S. R.,
Ladd, T. R.,
Sohi, S. S.,
Cook, B. J.,
and Retnakaran, A.
(1996)
Insect Biochem. Mol. Biol.
26,
485-499[Medline]
[Order article via Infotrieve]
|
| 16.
|
Giguère, V.,
Tini, M.,
Flock, G.,
Ong, E.,
Evans, R. M.,
and Otulakowski, G.
(1994)
Genes Dev
8,
538-553[Abstract/Free Full Text]
|
| 17.
|
Swevers, L.,
Cherbas, L.,
Cherbas, P.,
and Iatrou, K.
(1996)
Insect Biochem. Mol. Biol.
26,
217-221[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Johnson, R.,
Meidinger, R. G.,
and Iatrou, K.
(1992)
Virology
190,
815-823[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Lu, M.,
Farrell, P.,
Johnson, R.,
and Iatrou, K.
(1997)
J. Biol. Chem.
272,
30724-30728[Abstract/Free Full Text]
|
| 20.
|
Mangelsdorf, D. J.,
and Evans, R. M.
(1995)
Cell
83,
841-850[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Wurtz, J.-M.,
Bourguet, W.,
Renaud, J.-P.,
Vivat, V.,
Chambon, P.,
Moras, D.,
and Gronemeyer, H.
(1996)
Nat. Struct. Biol.
3,
87-94[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
White, K. P.,
Hurban, P.,
Watanabe, T.,
and Hogness, D. S.
(1997)
Science
276,
114-117[Abstract/Free Full Text]
|
| 23.
|
Kageyama, Y.,
Masuda, S.,
Hirose, S.,
and Ueda, H.
(1997)
Genes Cells
2,
559-569[Abstract]
|
| 24.
|
Lam, G.,
Hall, B. L.,
Bender, M.,
and Thummel, C. S.
(1999)
Dev. Biol.
212,
204-216[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Segraves, W. A.,
and Woldin, C.
(1993)
Insect Biochem. Mol. Biol.
23,
91-97[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Jindra, M.,
Sehnal, F.,
and Riddiford, L. M.
(1994)
Eur. J. Biochem.
221,
665-675[Medline]
[Order article via Infotrieve]
|
| 27.
| Ogaj, S., Matsuoka, T., and Fujiwara, H. (2000) GenBankTM
accession no. BAA89263
|
| 28.
|
Torchia, J.,
Glass, C.,
and Rosenfeld, M. G.
(1998)
Curr. Opin. Cell Biol.
10,
373-383[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Glass, C. K.,
and Rosenfeld, M. G.
(2000)
Genes Dev.
14,
121-141[Free Full Text]
|
| 30.
|
Johansson, L.,
Båvner, A.,
Thomsen, J. S.,
Färnegårdh, M.,
Gustafsson, J.-A.,
and Treuter, E.
(2000)
Mol. Cell. Biol.
20,
1124-1133[Abstract/Free Full Text]
|
| 31.
|
Darimont, B. D.,
Wagner, R. L.,
Apriletti, J. W.,
Stallcup, M. R.,
Kushner, P. J.,
Baxter, J. D.,
Fletterick, R. J.,
and Yamamoto, K. R.
(1998)
Genes Dev.
12,
3343-3356[Abstract/Free Full Text]
|
| 32.
|
McInerney, E. M.,
Rose, D. W.,
Flynn, S. E.,
Westin, S.,
Mullen, T.-M.,
Krones, A.,
Inostroza, J.,
Torchia, J.,
Nolte, R. T.,
Assa-Munt, N.,
Milburn, M. V.,
Glass, C. K.,
and Rosenfeld, M. G.
(1998)
Genes Dev.
12,
3357-3368[Abstract/Free Full Text]
|
| 33.
|
Nolte, R. T.,
Wisely, G. B.,
Westin, S.,
Cobb, J. E.,
Lambert, M. H.,
Kurokawa, R.,
Rosenfeld, M. G.,
Willson, T. M.,
Glass, C. K.,
and Milburn, M. V.
(1998)
Nature
395,
137-143[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Hu, X.,
and Lazar, M. A.
(1999)
Nature
402,
93-96[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Atkins, G. B., Hu, X.,
Guenther, M. G.,
Rachez, C.,
Freedman, L. P.,
and Lazar, M. A.
(1999)
Mol. Endocrinol.
13,
1550-1557[Abstract/Free Full Text]
|
| 36.
|
Forman, B. M.,
Chen, J.,
Blumberg, B.,
Kliewer, S. A.,
Henshaw, R.,
Ong, E. S.,
and Evans, R. M.
(1994)
Mol. Endocrinol.
8,
1253-1261[Abstract]
|
| 37.
|
Harding, H. P.,
and Lazar, M. A.
(1995)
Mol. Cell. Biol.
15,
4791-4802[Abstract]
|
| 38.
|
Burke, L. J.,
Downes, M.,
Laudet, V.,
and Muscat, G. E. O.
(1998)
Mol. Endocrinol.
12,
248-262[Abstract/Free Full Text]
|
| 39.
|
Zamir, I.,
Harding, H. P.,
Atkins, G. B.,
Hörlein, A.,
Glas, C. K.,
Rosenfeld, M. G.,
and Lazar, M. A.
(1996)
Mol. Cell. Biol.
16,
5458-5465[Abstract]
|
| 40.
|
Swevers, L.,
and Iatrou, K.
(1999)
Insect Biochem. Mol. Biol.
29,
955-963[CrossRef]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?