HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 45, 42686-42693, November 8, 2002

This Article Abstract Full Text (PDF) Supplemental Data All Versions of this Article: 277/45/42686    most recent M207183200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Li, Z. Articles by Wang, C. C. Search for Related Content PubMed PubMed Citation Articles by Li, Z. Articles by Wang, C. C. Social Bookmarking                      What's this?

Functional Characterization of the 11 Non-ATPase Subunit Proteins in the Trypanosome 19 S Proteasomal Regulatory Complex^*,

Ziyin Li and Ching C. Wang

From the Department of Pharmaceutical Chemistry, University of California, San Francisco, California 94143-0446

Received for publication, July 18, 2002, and in revised form, August 29, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The ubiquitin-proteasome pathway is responsible for selective degradation of short-lived and dysfunctional proteins in eukaryotes. The recently demonstrated presence of a functional 26 S proteasome in Trypanosoma brucei led to the identification and isolation of genes encoding all 11 non-ATPase (Rpn) subunit proteins in the trypanosome 19 S regulatory complex. Using the technique of RNA interference, expression of individual RPN genes was disrupted in the procyclic form of T. brucei, resulting, in each case, in intracellular accumulation of polyubiquitinated protein, cell arrest at the G₂/M phase, and eventual cell death. With the exception of Rpn10, depletion of individual Rpn proteins disrupted also trypanosome 19 S complex formation, with the complex virtually depleted in the cell lysate. This functional and structural essentiality of 10 of the 11 Rpn proteins in T. brucei differs significantly from that observed in other organisms. When Rpn10 was deficient in trypanosomes, a 19 S complex without Rpn10 was still formed, whereas cell growth was arrested. This structural dispensability but functional indispensability of Rpn10 may constitute another unique aspect of the proteasomes in T. brucei.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The ubiquitin-proteasome pathway is involved in eliminating short-lived and misfolded proteins in the cytosol and nucleus of eukaryotic cells. Proteasomal substrates are generally marked for destruction through covalent attachment of polyubiquitin chains catalyzed by a series of enzymes, the ubiquitin-activating enzyme, the ubiquitin-conjugating enzyme, and the ubiquitin ligase. The ubiquitinated protein is then degraded by the 26 S proteasome in an ATP-dependent manner (1, 2).

The 26 S proteasome is composed of the 20 S catalytic complex capped at one or both ends by the 19 S regulatory complex, which binds, unfolds, and translocates polyubiquitinated protein into the interior of the 20 S complex, where proteolysis occurs. The 20 S complex of eukaryotes is a barrel-shaped ring structure with seven distinct -subunits forming the two outer -rings and seven distinct -subunits forming the two inner catalytic -rings. The 19 S complex in Saccharomyces cerevisiae is composed of six distinct ATPase (Rpt (regulatory particle triple-A ATPase)) subunits and at least 11 non-ATPase (Rpn (regulatory particle non-ATPase)) subunits (3). Unlike the 20 S complex, whose structure and catalytic properties have been well understood, much less is known about the structural and functional organization of the 19 S complex. Nevertheless, the relative arrangement of several 19 S subunits has been deduced through assaying the protein-protein interactions (4, 5). The six Rpt subunits are present in a hexamer ring structure lying on top of the -ring and interacting with Rpn1, Rpn2, and Rpn10 to form the "base" subcomplex in S. cerevisiae, whereas the rest of the eight Rpn subunits form a "lid" subcomplex in the 19 S complex (6). Arrangement of the eight Rpn subunits in the lid was tentatively mapped by a comparative alignment with the positions of their homologs in the COP9 signalosome (7, 8). A drafted structural map of the yeast 19 S complex was recently deduced from combined data on genetic interactions and protein-protein interactions among the subunits (5), although the process of assembly remains unknown.

Specific functions have been assigned to only a few subunits in the yeast 19 S complex (2). By gene deletion analysis in S. cerevisiae (9), most 19 S subunit genes were found to be essential for the yeast, with only two exceptions, RPN9 and RPN10. The rpn9 cells grow normally at the permissive temperature, but display a strong growth defect at the nonpermissive temperature, and are arrested at the G₂/M phase of the cell cycle (3, 10, 11). The normally growing rpn10/Mcb1 mutant exhibits, however, a modest sensitivity to amino acid analogs and accumulates ubiquitin-protein conjugates, suggesting that this polyubiquitin-binding protein (Rpn10) may interact with only a subset of proteasomal substrates (12). Conditional yeast mutants of several other subunits of the 19 S complex display distinct cell cycle defects (13-17). The rpt1/Cim5-1 mutant as well as the rpt6/Cim3-1 and rpn3-4 mutants are arrested at the G₂/M phase with increased Cdc28 kinase activity (13, 14), whereas mutation in the ATP-binding site of Rpt1 results in a G₁ delay (15). The rpn12-1/nin1-1 mutant is arrested at both the G₁/S and G₂/M boundaries with reduced Cdc28 kinase activity (16), whereas the rpn11/Mpr1-1 mutant of S. cerevisiae displays a G₂/M delay and altered mitochondrial morphology (17). The Schizosaccharomyces pombe Rpn11 homolog Pad1 was found to positively regulate Pap1-dependent transcription and was implicated in the maintenance of chromosome structure (18). Some of the Rpn proteins may thus have functions unrelated to the function of the 26 S proteasome, and the complete functional profile of the 19 S complex remains unclear.

Trypanosoma brucei, a parasitic protozoan and a causative agent of African sleeping sickness, is generally regarded as a relatively primitive eukaryote farther removed from mammals than yeast (19). Gene expression in this organism depends primarily on post-transcriptional regulation (20). Functions of the proteasomes in T. brucei differ significantly from those of other eukaryotic microorganisms (21, 22). For instance, trypanosomes have the activated 20 S proteasomal complex as the dominant proteasomal species (22), which is absent in all other eukaryotic microbes investigated thus far, but finds a counterpart in mammals, playing an essential role in major histocompatibility complex class I antigen presentation (23). Unlike mammals, however, there are apparently only seven - and seven -subunits in its 20 S complex reservoir, without detectable heterogeneous isomeric forms (24, 25). There are only two catalytically active -subunits (₂ and ₅) in the trypanosome 20 S proteasome.¹ The recently identified 26 S proteasome from trypanosomes consists of stable 20 S and 19 S complexes, but they are readily dissociated from each other upon cell lysis (25). The six Rpt proteins in the 19 S complex are highly conserved and capable of complementing the corresponding yeast mutants, with the only exception of Rpt2 (25). The down-regulated expression of each of the seven -, seven -, and six Rpt subunits in trypanosomes by RNA interference (RNAi)² indicated that each protein plays an essential function in the growth and viability of this organism. Apparently, the depletion of each protein cannot be replaced by any other protein in the cell (25), suggesting a rather simple family of genes encoding the proteasomal complex without the isogenes, whose protein products may exchange with the existing subunits in mammalian proteasomes, resulting in a heterogeneous population (2, 26, 27). The trypanosome proteasome exists in a largely homogeneous population (24), which is also reflected by results from RNAi (25). It has the potential of being a simple model like the one from yeast for further in-depth investigation.

In this study, we have identified and isolated the 11 full-length Rpn subunit genes from T. brucei and disrupted their expression individually to determine the effects on cell cycle progression, cell viability, and assembly of the 19 S complex. In contrast to observations obtained with yeast, each Rpn protein in T. brucei was found to be essential for cell viability. With the only exception of Rpn10, depletion of each of the other 10 Rpn proteins in trypanosomes disrupted also formation of the 19 S complex.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Materials-- The procyclic form of T. brucei strain 29-13, which contains the genes expressing T7 RNA polymerase and the tetracycline repressor (28), was a gift from Dr. Paul T. Englund (Johns Hopkins University School of Medicine). Fetal bovine serum was purchased from Atlanta Biologicals, Inc. Mouse monoclonal antibodies against -tubulin and ubiquitin were purchased from Sigma and Zymed Laboratories Inc., respectively. Horseradish peroxidase-conjugated donkey antiserum against rabbit IgG, horseradish peroxidase-conjugated goat antiserum against mouse IgG, [³⁵S]methionine, and protein A-Sepharose CL-4B were from Amersham Biosciences. Protease inhibitor mixtures were purchased from Roche Molecular Biochemicals. All other chemicals used in this study were of the highest purity commercially available.

Cell Culture-- Procyclic T. brucei cells were cultivated at 26 °C in Cunningham's medium supplemented with 10% fetal bovine serum. G418 (15 µg/ml) and hygromycin B (50 µg/ml) were added to the culture medium to maintain the T7 RNA polymerase and tetracycline repressor gene constructs within the cells.

Cloning of the 11 Proteasomal non-ATPase (Rpn) cDNAs from T. brucei-- Partial genomic sequences of the 11 T. brucei Rpn homologs were identified in the TIGR Trypanosome Genome Project Sequence Databases³ by the BLAST search program using the yeast RPN genes as queries. Based on the partial sequence information, gene-specific primers⁴ were designed and employed in reverse transcription-PCRs for rapid amplification of cDNA ends (RACE). First-strand cDNAs were generated from the total RNA of T. brucei with an oligo(dT)₁₅-adaptor primer and Moloney murine leukemia virus reverse transcriptase. 5'-RACE was performed using a gene-specific antisense primer in combination with the splice leader sequence (TTAGAACAGTTTCTGTACTATATTG) known as the 5'-end of all mRNAs in T. brucei (29). 3'-RACE was carried out using a gene-specific sense primer in combination with the adaptor primer, which was introduced into cDNA during reverse transcription. The PCR fragments thus synthesized were cloned into the pGEM-T-easy vector (Promega) for sequencing. A pair of specific primers were then designed based on the sequence data and used to amplify the full-length cDNA, which was then sequenced for complete open reading frame identification.

Expression and Purification of Recombinant Rpn Proteins for Antibody Production-- The 11 full-length T. brucei Rpn cDNAs were each amplified by PCR, and the encoded recombinant proteins were expressed with an added N-terminal His₆ tag in Escherichia coli strain M15 cells using the pQE30 vector (QIAGEN Inc.) following the manufacturer's protocol. The recombinant Rpn proteins, expressed mostly as inclusion bodies in the transformed E. coli cell lysate, were each dissolved in 8 M urea and purified through a Ni²⁺-agarose column (QIAGEN Inc.) following the manufacturer's instructions. The purified proteins, with their purity verified by SDS-PAGE (data not shown), were used to produce polyclonal antibodies in rabbit (Animal Pharm Services Inc., Healdsburg, CA). Only the antibodies against T. brucei Rpn10 and Rpn11 have now become available and were used in this investigation.

RNA Interference-- Partial cDNA fragments (300~500 bp in length) of the 11 T. brucei RPN genes were each amplified by PCR using gene-specific primers with XhoI and HindIII linkers⁴ and subcloned into the pZJM vector (30) by replacing the -tubulin stuffer. For the control plasmid, the pZJM vector was digested with XhoI/HindIII, end-blunted with T4 DNA polymerase, and self-ligated. The construct was linearized with NotI so that it could be integrated into the rDNA spacer region of the T. brucei chromosome. Transfection of T. brucei by electroporation was essentially performed according to our previous procedures (25). The transfectants were selected with 2.5 µg/ml phleomycin and cloned by limiting dilution. For induction of RNAi, stable transfectants were cultured in the presence of 1.0 µg/ml tetracycline. Cell numbers were counted at different timed intervals using a hemocytometer.

RNA Gel Blot Analysis-- Total RNA was extracted from T. brucei cells using the TRIzol reagent (Amersham Biosciences). Thirty µg of total RNA was denatured, separated on 1.2% formaldehyde-agarose gel, and blotted onto nitrocellulose membranes. Northern hybridization was carried out overnight at 42 °C in 50% formamide, 6× SSC, 0.5% SDS, 1× Denhardt's solution, and 0.1 mg/ml salmon sperm DNA. After stripping the probes, the same blots were rehybridized with an -tubulin gene fragment to ensure equal RNA sample loading.

Immunoblotting and Immunoprecipitation-- For immunoblotting, 12.5 or 8.5% acrylamide gels following SDS-PAGE were blotted and stained as previously described (25). For immunoprecipitation, T. brucei cells were incubated in methionine-free medium for 1 h and labeled with [³⁵S]methionine (50 µCi/ml) at 26 °C for 4 h. The labeled cells were washed twice with Tris-buffered saline (25 mM Tris-Cl, pH 7.6, and 100 mM NaCl) and incubated in lysis buffer (25 mM Tris-Cl, pH 7.6, 100 mM NaCl, 1% Nonidet P-40, 1 mM dithiothreitol, and protease inhibitors) for 30 min on ice. The cleared lysate, pre-absorbed with rabbit preimmune serum and protein A-Sepharose beads, was incubated with rabbit antiserum against T. brucei Rpt3 (25) at 4 °C for 1 h and precipitated with protein A-Sepharose beads. The immunoprecipitates thus collected were fractionated by SDS-PAGE, and the dried gels were autoradiographed.

Glycerol Density Gradient Centrifugation-- T. brucei cells were lysed by sonication in buffer A (10 mM Tris-Cl, pH 7.4, 25 mM KCl, 10 mM NaCl, 1 mM MgCl₂, 0.2 mM EDTA, 1 mM dithiothreitol, 2 mM ATP, 1 mM N-p-tosyl-L-lysine chloromethyl ketone, and 1 mM phenylmethylsulfonyl fluoride) containing 20% glycerol, and the lysate was cleared by centrifugation at 80,000 × g for 60 min. The proteasomal complexes, collected by an additional centrifugation at 100,000 × g for 60 min, were resuspended in buffer A containing 5% glycerol, with insoluble materials removed by centrifugation at 80,000 × g for 30 min. The cleared supernatant was overlaid on top of a stepwise gradient of 15~50% glycerol and centrifuged in a Beckman TLS55 rotor at 35,000 rpm for 16 h. Fractions were collected dropwise from the bottom of the tube, separated by SDS-PAGE, blotted onto polyvinylidene difluoride membranes, and immunostained with the appropriate antibodies.

Fluorescence-activated Cell Sorting Analysis-- The fluorescence-activated cell sorting analysis of propidium iodide-stained trypanosome cells was carried out as described previously (31) with minor modifications. Briefly, T. brucei cells were washed twice with phosphate-buffered saline and fixed in ethanol at 4 °C for 1 h. The cells were washed twice and suspended in phosphate-buffered saline. DNase-free RNase (10 µg/ml) and propidium iodide (20 µg/ml) were added to the suspension and incubated for 30 min at room temperature. The DNA content of the propidium iodide-stained cells was analyzed with a FACScan analytical flow cytometer (BD Biosciences). The percentage of cells in the G₁, S, and G₂ phases of the cell cycle was determined using ModFitLT Version 3.0 Software (BD Biosciences).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Identification of T. brucei Genes and Cloning of the Corresponding Full-length cDNAs Encoding the 11 Rpn Subunits-- The partial nucleotide sequences encoding 11 distinct T. brucei Rpn homologs were identified in the TIGR Trypanosome Genome Project Sequence Databases by the BLAST program using the 11 yeast RPN gene sequences as queries. Based on these partial sequences, Rpn-specific primers were designed and employed in 5'- and 3'-RACE reactions for the remainder of the 5'- and 3'-sequences in each of the 11 RPN genes. A pair of primers encompassing the entire coding region were designed and used to amplify the full-length cDNA of each of the 11 Rpn homologs, resulting in the cloning and sequencing of each of the 11 full-length Rpn cDNAs. The deduced amino acid sequences from these cDNA clones were compared with those of the yeast counterparts and revealed sequence identities ranging from 46% between the Rpn11 proteins to 20% between the Rpn9 proteins (Table I). The yeast Rpn4 protein, a putative transcription factor only loosely associated with the yeast 26 S proteasome (32-34), was postulated to be a protein uninvolved in the yeast 19 S complex. We found no apparent homolog in the T. brucei genome sequence data bases. The 11 RPN genes we have identified in T. brucei thus far may represent the complete profile of Rpn subunits in the T. brucei 19 S complex mimicking that observed in the yeast 19 S complex (3).

T. brucei Rpn1 has a slightly lower molecular mass compared with Rpn2, in agreement with the human Rpn subunits S2 and S1 (2), but in contrast to yeast Rpn1 and Rpn2 (Table I). Trypanosome Rpn1 shares only ~20% sequence identity with Rpn2, but each protein contains at the C terminus nine leucine-rich repeats possibly involved in protein-protein interactions (35). The C termini of Rpn3, Rpn5-7, and Rpn9 each contain a common structural motif, the PCI (proteasome/COP9/initiation factor) domain, which was also found in the subunits of the COP9 signalosome and eukaryotic translation initiation factor-3 (36, 37). This motif is an -helix structure of ~200 residues important for the assembly of the yeast 19 S complex and the Arabidopsis thaliana COP9 signalosome (5). Containing only the conserved C-terminal PCI domain shared by its yeast and human homologs (Fig. 1), T. brucei Rpn3 has a molecular mass considerably smaller than that of yeast Rpn3 (Table I). This C-terminal PCI domain was previously found to be sufficient for replacing the function of full-length Rpn3 in yeast at lower temperatures (38). In addition, the yeast rpn3/sun2 mutant could be complemented by its human counterpart p58/S3 missing the 150 N-terminal residues (39). T. brucei Rpn3 may be thus functionally adequate despite its smaller size. An MPN (Mpr1/Pad1 N-terminal) domain was identified at the N termini of T. brucei Rpn8 and Rpn11 and is required for protein-protein interactions in multiprotein complexes such as the 19 S complex and the COP9 signalosome (5). Finally, a ubiquitin-interacting motif (UIM) was identified at the C terminus of T. brucei Rpn10 as anticipated, which should enable the protein to bind to polyubiquitin chains (12, 40-42), thus qualifying it as a ubiquitin-binding protein. The 11 tentatively identified T. brucei Rpn proteins all contain the necessary structural motifs for their assumed functions. They may very well be the bona fide subunits of the 19 S complex from T. brucei (25).

View larger version (101K): [in this window] [in a new window]   Fig. 1.   Sequence comparison of the T. brucei Rpn3 protein with its yeast and human homologs. The alignment was generated using BoxShade software. Identical amino acid residues are shown in black boxes, and similar residues are indicated in gray boxes. Numbers on the right indicate the positions in the protein. The two opposing arrows outline the PCI domain. Tb, T. brucei; Sc, S. cerevisiae; Hs, Homo sapiens.

The Rpn Proteins Are Essential for Growth of the Procyclic Form of T. brucei-- To investigate the potential role that each of the 11 Rpn proteins may play during the growth of trypanosomes, we exploited the RNAi technique to selectively block the expression of individual RPN genes in the procyclic T. brucei cells. A 300~500-bp fragment of unique sequence from the coding region of each RPN gene⁴ was amplified by PCR and inserted into the RNAi vector pZJM (30). The insert was flanked by two opposing T7 promoters and two opposing tetracycline operators in the construct, and the resulting plasmid was linearized and introduced by electroporation into T. brucei 29-13 cells expressing both T7 RNA polymerase and the tetracycline repressor (28). The stably transfected cell lines were selected under phleomycin and cloned by limiting dilution. To induce synthesis of double-stranded RNA encoded by the insert, the transfected cells were cultured in the presence of 1.0 µg/ml tetracycline to switch on the T7 promoters. The double-stranded RNA thus synthesized is known to lead to degradation of the corresponding mRNA in T. brucei, thus blocking the expression of its encoding gene (30).

The anticipated double-stranded RNA-induced interference with RPN gene expression was first examined by Northern blot analysis of the RPN mRNA levels in the transfectant prior to and following the addition of tetracycline. The data show that, after adding tetracycline to the cultures for 2 days, each of the 11 RPN mRNAs in the 11 transfectants was decreased to a substantially lower level compared with the uninduced control (Fig. 2A, insets for Rpn9-11; and Fig. I in the Supplemental Material, insets for the rest of the Rpn proteins). There is little doubt that we were able to down-regulate the expression of each of the 11 RPN genes by the RNAi technique. This blockade of gene expression was found to be highly specific in all cases, as additional Northern blots indicated that when the expression of one RPN gene was blocked, the levels of the other 10 RPN mRNAs remained unaffected (data not shown).

View larger version (46K): [in this window] [in a new window]   Fig. 2.   RNAi with RPN gene expression and effects on T. brucei growth, cell cycle progression, and polyubiquitinated protein levels. A, profiles of cell growth in the three representative transfectants in the absence (Tet) and presence (+Tet) of 1 µg/ml tetracycline in culture medium. Timed samples were taken during incubation, and cell numbers were counted. The insets depict corresponding Northern blot analysis of mRNA levels prior to and following tetracycline induction for 2 days. The same blots were rehybridized with an -tubulin (TUB) DNA fragment as an internal sampling control. Control represents data from T. brucei cells transfected with the pZJM empty vector. B, depletion of the target protein by RNAi. T. brucei cells harboring the RNAi constructs of RPN10 or RPN11 fragments were induced with tetracycline for 4 days (Rpn10) or 3 days (Rpn11) and lysed by sonication. Immunoblotting was performed on 10 µg of total proteins with rabbit antisera against purified recombinant T. brucei Rpn10 and Rpn11 proteins, respectively. Immunostaining of -tubulin (-tub) was performed on the same membrane as a sampling control. C, effect of Rpn depletion on the cell cycle progression of procyclic T. brucei cells. T. brucei cell lines harboring the RNAi constructs were grown in the presence of 1 µg/ml tetracycline. Cells were harvested after 6 days of tetracycline induction for Rpn9 and Rpn10 RNAi transfectants and after 3 days for the Rpn11 RNAi transfectant. Cells were washed with phosphate-buffered saline, stained with propidium iodide, and analyzed using a FACScan. A total of 25,000 cells were counted. The insets show the percentages of cells at different phases of the cell cycle. D, effect of Rpn depletion on polyubiquitinated protein levels in T. brucei. The transfected T. brucei cells were induced with 1 µg/ml tetracycline for 3 days and lysed by sonication. Immunoblotting was carried out on 10 µg of total proteins with mouse anti-ubiquitin monoclonal antiserum. The same membranes were also immunostained with mouse anti--tubulin monoclonal antiserum as sampling controls.

Immunoblot analysis of the Rpn protein levels in the transfected cells was then performed (Fig. 2B). The results show that, in the transfectant in which the level of RPN10 mRNA was low, there was little Rpn10 protein detectable (~5%) on the immunoblot after 4 days of tetracycline induction. The Rpn11 protein in the corresponding transfectant was depleted to an undetectable level after RNAi induction for 3 days. This observed RNAi reduction of both mRNA and protein from a specific gene in T. brucei is consistent with our previous experimental results on the genes encoding proteasomal -, -, and Rpt subunits (25), as well as those reported on the down-regulated expression of other T. brucei genes by RNAi (30, 43, 44).

The potential effect of the down-regulated expression of individual RPN genes on the growth of T. brucei was then examined. As demonstrated by the data presented in Fig. 2A as well as in Fig. I in the Supplemental Material, tetracycline induction of RNAi was always followed by significantly inhibited cell growth in all 11 cases. Three Rpn-deficient cell lines (rpn5, rpn9, and rpn10) could still grow slowly, however, 3 days after the onset of tetracycline induction. But all 11 cell lines eventually died after 7 days with tetracycline, whereas the control grew equally well with or without tetracycline, suggesting that each of the 11 Rpn proteins performs an essential function in the growth of procyclic T. brucei cells.

When these results are compared with those from the gene knockout experiments on S. cerevisiae (2), there are nine RPN genes whose knockout mutations have been proven lethal to the yeast. But the rpn9 mutant remains viable with a slower growth rate (3, 10), whereas the rpn10 mutant remains perfectly viable and grows as well as the wild type (12). This distinction between trypanosomes and yeast will be further pursued below.

Effect of Rpn Depletion on Cell Cycle Progression-- The function of the 26 S proteasome is required for degradation of many cell cycle regulatory proteins such as the cyclins and certain cyclin-dependent kinase inhibitors and thus plays critical roles in regulating cell cycle progression (45). Mutations in several 19 S Rpt and Rpn subunit genes result in distinct cell cycle defects in yeast (11, 13-17), suggesting that different 19 S subunits may be responsible for specific degradation of different cell cycle regulator proteins. The fact that the growth of all 11 Rpn-deficient T. brucei cells was inhibited suggested that depletion of each Rpn protein may arrest the cells at certain specific phases of the cell cycle. To ascertain the point of arrest in the Rpn-deficient cells, each of the 11 Rpn-depleted cell lines was subjected to FACScan analysis. The results show that, although >70% of the cell population maintained the 2N DNA content (G₁ phase) and only ~15% of the cells had the 4N DNA content (G₂ phase) prior to tetracycline induction (Fig. 2C, Control), depletion of individual Rpn proteins invariably decreased the 2N cells to 13.8-26.0% and increased the 4N cells to 52.7-79.2% (Fig. 2C for Rpn9-11 and Fig. II in the Supplemental Material for the rest of the Rpn proteins). A more detailed FACScan analysis of the timed samples for the depletion of each of the 11 tetracycline-induced Rpn proteins showed a steady-state decrease in the number of G₁ cells accompanied by a simultaneous, equivalent increase in the number of G₂ cells (data not shown). Thus, the T. brucei cells with each of the 11 Rpn proteins depleted can still progress successfully through the G₁/S phase transition, but are arrested at the G₂/M phase of the cell cycle. To further narrow down the point of arrest in these Rpn-deficient cells, we checked the propidium iodide-stained cells under a fluorescence microscope and found that all Rpn-deficient cells contained only one nucleus (data not shown), even though most of them had 4N DNA, suggesting that depletion of each Rpn protein blocks the cell cycle at G₂/metaphase, before division of the replicated nuclei.

Depletion of Rpn Leads to Accumulation of Polyubiquitinated Proteins-- Polyubiquitinated protein has been identified as the primary substrate of the 26 S proteasome in eukaryotes. Our previous study indicated that each of the seven -subunits, seven -subunits, and six Rpt proteins in the 26 S proteasome of T. brucei is essential for intracellular degradation of polyubiquitinated proteins (25). To determine the effect of individual Rpn depletion on the degradation of polyubiquitinated proteins, total cellular proteins were collected from each of the 11 transfectant cell lines with or without tetracycline induction, separated by SDS-PAGE, blotted onto polyvinylidene difluoride membranes, and stained with mouse anti-ubiquitin monoclonal antiserum. The polyubiquitinated protein, running in a smeared pattern at the top of the gel upon SDS-PAGE, was stained only slightly by the antibody in the control and the 11 uninduced transfectants. The intensity of the stain was enhanced significantly in all 11 transfectants after tetracycline induction for 3 days (Fig. 2D for Rpn9-11 and Fig. III in the Supplemental Material for the rest of the Rpn proteins). This accumulation of polyubiquitinated proteins, which likely resulted from their reduced degradation, may be attributed to loss of function of the 19 S complex upon depletion of one of the Rpn subunits due to either formation of an inactive partial 19 S complex or failure to form any complex at all. Further structural analysis of the 19 S complex in each of the 11 Rpn-deficient cell lines may shed some light on these uncertainties.

Effect of Rpn Depletion on the Assembly of the 19 S Complex-- From the [³⁵S]methionine-labeled wild-type T. brucei cell lysate, anti-Rpt3 antiserum can precipitate the 19 S complex with 14 distinguishable radiolabeled protein bands (ranging from 30 to 110 kDa) upon SDS-PAGE (Fig. 3A). This band pattern resembles that of the purified yeast 19 S complex (3). Rpn10 and Rpn11 were readily identified because of the availability of specific antibodies against them. The rest of the protein bands were tentatively assigned by their molecular masses predicted from the encoding cDNAs (Fig. 3A). Using this experimental technique, we analyzed the integrity of the 19 S complex after depletion of individual Rpn proteins. The results demonstrate that, with the exception of Rpn10, few proteins were appreciably co-immunoprecipitated with Rpt3 when any one of the other 10 Rpn proteins was depleted (Fig. 3B for Rpn9-11 and Fig. IV in the Supplemental Material for the rest of the Rpn proteins). Each of these 10 Rpn proteins thus may play an essential role in the assembly of the entire 19 S complex. In the absence of Rpn10, however, almost all the protein bands brought down originally by anti-Rpt3 serum in the control experiment were accounted for in the precipitate (except for Rpn10) (Fig. 3B), suggesting that assembly of the main bulk of the T. brucei 19 S complex can be accomplished without Rpn10.

View larger version (85K): [in this window] [in a new window]   Fig. 3.   Immunoprecipitation of the 19 S complex from Rpn-depleted, [35S]methionine-labeled T. brucei cells with anti-Rpt3 antibody. The transfected T. brucei cells were grown without () or with (+) 1 µg/ml tetracycline and incubated for 4 days (for Rpn9 and Rpn10) or 3 days (for Rpn11 and Control) and labeled with [35S]methionine. Cells were lysed in lysis buffer, and lysate samples (500 µg of total proteins each) were first cleared with preimmune serum and then incubated with anti-Rpt3 polyclonal antibody and protein A-Sepharose CL-4B beads. The immunoprecipitates were resolved by SDS-PAGE, autoradiographed, and compared in the uninduced and induced samples. A duplicate sample of the immunoprecipitates upon SDS-PAGE was blotted and immunostained with anti-Rpt3 polyclonal antibody as an internal sampling control. A, designations of the Rpt and Rpn proteins upon SDS-PAGE; B, effect of Rpn depletion on formation of the 19 S complex. The arrowheads point to the protein bands that were depleted by tetracycline induction of RNAi. The asterisks indicate the positions of the Rpt3 protein.

To further characterize the lack of effect of Rpn10 depletion on the assembly of the 19 S complex, mixtures of the 20 S complex, the activated 20 S proteasomal complex, and the 19 S complex from the lysates of Rpn10- and Rpn11-depleted T. brucei cells were fractionated by glycerol gradient centrifugation. The subunit proteins in each collected fraction were separated by SDS-PAGE, blotted, and immunostained with the appropriate antibodies. The results presented in Fig. 4A indicate that, prior to adding tetracycline, the cells had Rpn10, Rpn11, Rpt3, and Rpt4 all located primarily in fractions 4-6, where the 19 S complex is located (25), whereas the 6-subunit was found largely in fractions 5-7, where the 20 S complex is found (25). Following depletion of Rpn10 by tetracycline induction of RNAi, the level of this particular protein was significantly reduced, but Rpn11, Rpt3, and Rpt4 were still located in the 19 S fractions (Fig. 4B), suggesting that a quasi 19 S complex containing these subunits is still formed. When Rpn11 was depleted, however, Rpn10, Rpt3, and Rpt4 remained much closer to the top of the glycerol gradient (Fig. 4C), where the free monomeric forms of these proteins are known to be located from our previous study (25). These results provide another indication that Rpn11 is essential, whereas Rpn10 is not essential, for the assembly of the 19 S complex in T. brucei. They also suggest that when Rpn11 is missing, the Rpt proteins may also remain in their monomeric forms.

View larger version (54K): [in this window] [in a new window]   Fig. 4.   Immunostaining of Rpn and Rpt proteins in the proteasomal complexes separated by glycerol gradient centrifugation. The T. brucei cell lines depleted of Rpn10 and Rpn11 were each incubated with 1.0 µg/ml tetracycline for 6 and 4 days, respectively. Lysates of the cells were fractionated by glycerol gradient centrifugation; fractionated by SDS-PAGE; blotted; and immunostained with rabbit antisera against T. brucei Rpn10, Rpn11, Rpt3, Rpt4, and the 20 S 6-subunit. A, uninduced control cells; B, Rpn10-deficient cells; C, Rpn11-deficient cells.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In this study, we identified and isolated the full-length cDNAs encoding 11 Rpn proteins in the procyclic form of T. brucei and employed the technique of RNAi to block the expression of each of the 11 Rpn proteins for phenotypes. Several lines of evidence confirmed the identity of these 11 T. brucei Rpn proteins. First, each of the 11 Rpn proteins exhibited significant sequence homology to their yeast counterparts, especially in the conserved structural motifs such as leucine-rich repeats, PCI and MPN domains, and UIMs (Table I). Second, depletion of individual Rpn proteins promoted intracellular accumulation of polyubiquitinated proteins in T. brucei (Fig. 2D), suggesting the essential involvement of each Rpn protein in the 26 S proteasome-catalyzed proteolysis of polyubiquitinated proteins. Third, depletion of individual Rpn proteins disrupted assembly of the 19 S complex in all but one case, with Rpn10 (Figs. 3B and 4 (B and C) and Fig. IV in the Supplemental Material). Finally, Rpn10 and Rpn11 comigrated with Rpt3 and Rpt4 in an apparent 19 S complex upon glycerol gradient centrifugation (Fig. 4A).

Each of the 11 Rpn proteins was found to be essential for the viability of T. brucei cells, whereas deletion of the 11 individual proteasomal RPN genes in S. cerevisiae results in lethality in only 9 of the 11 mutants (2), with the two exceptions of the rpn9 and rpn10 mutants (Table II). Yeast Rpn9 and Rpn10 are known to interact with each other in the 19 S complex (10), but the rpn9 rpn10 double mutant does not display a marked synthetic lethality (3). The function of Rpn10 becomes essential for yeast growth only when the function of Rpn12 is compromised (46). Like Rpn10 in T. brucei, yeast Rpn10 is the only 19 S subunit that possesses a UIM capable of binding to polyubiquitin chains (3, 12). However, the 19 S ATPase subunit Rpt5 in mammalian cells, although lacking a UIM, was found to be capable of being cross-linked with polyubiquitin chains (47). Rpn10 is cross-linked with polyubiquitin chains only when it is not part of the 19 S complex, suggesting that its ubiquitin chain-binding site may be occluded in the 19 S complex. Several proteasome-interacting proteins in S. cerevisiae, such as Rad23, Dsk2, and Ddi1, contain ubiquitin-like and ubiquitin-associated domains. They have an overlapping function with Rpn10 by binding to polyubiquitinated proteins and targeting them to the 26 S proteasome (48-50). The presence of these helper proteins may explain why Rpn10 is not essential in yeast. Given the essentiality of Rpn10 for trypanosome viability, Rpn10 could be the major, if not the only, ubiquitin-binding protein associated with the 26 S proteasome in T. brucei. This postulation is supported by the exclusive association of Rpn10 with the 19 S complex in T. brucei: no free monomeric Rpn10 was detectable upon glycerol density gradient fractionation of the T. brucei cell lysate (Fig. 4A). In contrast, a substantial amount of Rpn10 protein was found unassociated with the proteasome in S. cerevisiae, S. pombe, and Drosophila (12, 46, 51), implying an additional function for Rpn10 other than that associated with the proteasome in these organisms. Of the several living organisms under comparison (10, 46, 52), these structurally and functionally similar Rpn10 homologs were found to play an essential role only in T. brucei, suggesting a proteasomal system in T. brucei depending primarily on Rpn10 for binding to polyubiquitinated proteins. However, in view of the complicated data from cross-linking ubiquitin chains with mammalian proteasome subunits (47), a more complex mechanism of polyubiquitin binding to trypanosome proteasomes cannot be ruled out at present.

Depletion of any one of the 11 Rpn proteins in T. brucei enriched the cell population at the G₂/M phase of the cell cycle (Fig. 2C). This observation agrees with our previous result showing that treatment of the procyclic form of T. brucei with the proteasome-specific inhibitor lactacystin arrests the cells at the G₂/M phase (31). Our recent studies demonstrated that depletion of any one of the seven proteasomal -subunits, seven -subunits, or six Rpt proteins by RNAi (25) also results in the arrest of the procyclic form of T. brucei in the G₂/M phase.¹ Apparently, 26 S proteasome-mediated degradation of certain regulatory protein(s) may be crucial for the normal progression of procyclic T. brucei cells across the G₂/M boundary. Our previous interesting observation (31) indicating that lactacystin arrests the bloodstream form of T. brucei cells at both the G₁/S and G₂/M phases was also confirmed by our recent RNAi studies.¹ This suggests a required 26 S proteasome degradation of an additional regulatory protein(s) controlling the passage of the bloodstream form of T. brucei cells across the G₁/S phase. This additional requirement is apparently not present in the procyclic form.

The cell cycle defects have been identified for only 4 of the 11 rpn mutants of S. cerevisiae (Table II). Although the growth of the rpn3-4, rpn9, and rpn11/Mpr1-1 mutants is arrested at the G₂/M phase (11, 14, 17), that of the rpn12-1/nin1-1 mutant is arrested at both the G₁/S and G₂/M boundaries (16). In yeast, proteasomal degradation of the G₁ cyclin-dependent kinase inhibitor Sic1, the anaphase inhibitor Pds1, and the B-type cyclin Clb2 is required for transition from G₁ to S phase, transition from metaphase to anaphase, and exit from mitosis, respectively (45). Pds1 and Clb2 are significantly stabilized, whereas the turnover of Sic1 is unaffected in rpn3-4 and rpn9 mutant cells, which may explain why these mutants are arrested at the G₂/M phase (11, 14). The yeast rpn12-1/nin1-1 mutant fails in turning over both Sic1 and Pds1 and may thus provide the basis for cell arrest at both G₁/S and G₂/M (16). It remains to be seen whether a Pds1 functional homolog and similar B-type cyclins are also present in procyclic T. brucei and whether their degradation by proteasomes is required for cell cycle progression through G₂/M.

Regarding the structural aspect, interactions between the following subunits in the 19 S complex have been noted in S. cerevisiae: Rpt1 with Rpn1 and Rpn12, Rpt2 with Rpn1, Rpt4 with Rpn2, and Rpt6 with Rpn2 (4, 5). There is no interaction of Rpt3 or Rpt5 with any of the Rpn subunits identified. If one assumes from the yeast data that Rpn1 and Rpn2 are the only two building blocks laid on top of the Rpt hexamer ring, our current data on T. brucei should indicate that association of Rpn1 and Rpn2 with the Rpt ring requires also the presence of all other Rpn proteins except Rpn10. Depletion of Rpn9 in T. brucei resulted in no detectable 19 S complex (Fig. 3B), but yeast rpn9 cells contain a 26 S proteasome that is shifted to lighter fractions on a glycerol density gradient (10). This incomplete proteasomal complex (which lacks also Rpn10) is, however, functionally adequate in maintaining cell viability (3, 10, 11). In the yeast rpn11/Mpr1-1 mutant, the frameshift-mutated Rpn11 protein is absent in the purified proteasomal complex, but the base of the 19 S complex is still formed (53), whereas depletion of Rpn11 in T. brucei resulted in no detectable complex, and both Rpt3 and Rpt4 were present in apparent monomeric forms (Fig. 4C). There are apparently significant discrepancies in 19 S complex assembly between yeast and T. brucei.

Rpn10 from yeast is known to make contact with Rpn1, Rpn9, Rpn11, and Rpn12, but not with the Rpt ring (4, 5). In the yeast rpn10 mutant, the mutant 26 S proteasome has its lid readily peeled off from its base in 0.4 M NaCl (6). However, the lid can also be detached from the intact human 26 S proteasome under high salt (7, 54), suggesting that depletion of Rpn10 is not the prerequisite for dissociation of the lid from the base in the proteasome, although yeast Rpn10 is believed to strengthen the association (6). Thus, structurally, yeast Rpn10 and T. brucei Rpn10 may be equivalent in terms of their nonessential roles in 19 S complex assembly. This also implies that Rpn10 may be generally present on the exterior of the 19 S complex, which appears logical in view of its function in binding to the polyubiquitin chains.

	ACKNOWLEDGEMENT

We thank Professor Paul T. Englund for providing the pZJM vector and T. brucei strain 29-13.

	FOOTNOTES

^* This work was supported by National Institutes of Health Grant RO1 AI-21786.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The on-line version of this article (available at http://www.jbc.org) contains Supplemental Figs. I-IV.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank^TM/EBI Data Bank with accession number(s) AF404111-AF404120 and AF410930.

To whom correspondence should be addressed: Dept. of Pharmaceutical Chemistry, UCSF, 513 Parnassus Ave., San Francisco, CA 94143-0446. Tel.: 415-476-1321; Fax: 415-476-3382; E-mail: ccwang@cgl.ucsf.edu.

Published, JBC Papers in Press, September 3, 2002, DOI 10.1074/jbc.M207183200

¹ C. C. Wang, unpublished data.

³ Available at www.tigr.org/tdb/mdb/tbdb/index.shtml.

⁴ Sequence information is available upon request.

	ABBREVIATIONS

The abbreviations used are: RNAi, RNA interference; RACE, rapid amplification of cDNA ends; UIM, ubiquitin-interacting motif.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit