|
Originally published In Press as doi:10.1074/jbc.M207183200 on September 3, 2002
J. Biol. Chem., Vol. 277, Issue 45, 42686-42693, November 8, 2002
Functional Characterization of the 11 Non-ATPase Subunit Proteins
in the Trypanosome 19 S Proteasomal Regulatory Complex*,
Ziyin
Li and
Ching C.
Wang
From the Department of Pharmaceutical Chemistry, University of
California, San Francisco, California 94143-0446
Received for publication, July 18, 2002, and in revised form, August 29, 2002
 |
ABSTRACT |
The ubiquitin-proteasome pathway is responsible
for selective degradation of short-lived and dysfunctional proteins in
eukaryotes. The recently demonstrated presence of a functional 26 S
proteasome in Trypanosoma brucei led to the identification
and isolation of genes encoding all 11 non-ATPase (Rpn) subunit
proteins in the trypanosome 19 S regulatory complex. Using the
technique of RNA interference, expression of individual RPN
genes was disrupted in the procyclic form of T. brucei, resulting, in each case, in intracellular
accumulation of polyubiquitinated protein, cell arrest at the
G2/M phase, and eventual cell death. With the exception of
Rpn10, depletion of individual Rpn proteins disrupted also trypanosome
19 S complex formation, with the complex virtually depleted in the cell
lysate. This functional and structural essentiality of 10 of the 11 Rpn
proteins in T. brucei differs significantly from that
observed in other organisms. When Rpn10 was deficient in trypanosomes,
a 19 S complex without Rpn10 was still formed, whereas cell growth was
arrested. This structural dispensability but functional
indispensability of Rpn10 may constitute another unique aspect of the
proteasomes in T. brucei.
 |
INTRODUCTION |
The ubiquitin-proteasome pathway is involved in eliminating
short-lived and misfolded proteins in the cytosol and nucleus of
eukaryotic cells. Proteasomal substrates are generally marked for
destruction through covalent attachment of polyubiquitin chains catalyzed by a series of enzymes, the ubiquitin-activating enzyme, the
ubiquitin-conjugating enzyme, and the ubiquitin ligase.
The ubiquitinated protein is then degraded by the 26 S proteasome in an
ATP-dependent manner (1, 2).
The 26 S proteasome is composed of the 20 S catalytic complex capped at
one or both ends by the 19 S regulatory complex, which binds, unfolds,
and translocates polyubiquitinated protein into the interior of the 20 S complex, where proteolysis occurs. The 20 S complex of eukaryotes is
a barrel-shaped ring structure with seven distinct -subunits forming
the two outer -rings and seven distinct -subunits forming the two
inner catalytic -rings. The 19 S complex in Saccharomyces
cerevisiae is composed of six distinct ATPase (Rpt
(regulatory particle triple-A
ATPase)) subunits and at least 11 non-ATPase (Rpn
(regulatory particle non-ATPase)) subunits (3). Unlike the 20 S complex, whose structure and catalytic
properties have been well understood, much less is known about the
structural and functional organization of the 19 S complex. Nevertheless, the relative arrangement of several 19 S subunits has
been deduced through assaying the protein-protein interactions (4, 5).
The six Rpt subunits are present in a hexamer ring structure lying on
top of the -ring and interacting with Rpn1, Rpn2, and Rpn10 to form
the "base" subcomplex in S. cerevisiae, whereas the rest
of the eight Rpn subunits form a "lid" subcomplex in the 19 S
complex (6). Arrangement of the eight Rpn subunits in the lid was
tentatively mapped by a comparative alignment with the positions of
their homologs in the COP9 signalosome (7, 8). A drafted structural map
of the yeast 19 S complex was recently deduced from combined data on
genetic interactions and protein-protein interactions among the
subunits (5), although the process of assembly remains unknown.
Specific functions have been assigned to only a few subunits in the
yeast 19 S complex (2). By gene deletion analysis in S. cerevisiae (9), most 19 S subunit genes were found to be essential for the yeast, with only two exceptions, RPN9 and
RPN10. The rpn9 cells grow normally at the
permissive temperature, but display a strong growth defect at the
nonpermissive temperature, and are arrested at the G2/M
phase of the cell cycle (3, 10, 11). The normally growing
rpn10/Mcb1 mutant exhibits, however, a modest
sensitivity to amino acid analogs and accumulates ubiquitin-protein conjugates, suggesting that this polyubiquitin-binding protein (Rpn10)
may interact with only a subset of proteasomal substrates (12).
Conditional yeast mutants of several other subunits of the 19 S complex
display distinct cell cycle defects (13-17). The rpt1/Cim5-1 mutant as well as the
rpt6/Cim3-1 and rpn3-4 mutants are
arrested at the G2/M phase with increased Cdc28 kinase
activity (13, 14), whereas mutation in the ATP-binding site of Rpt1 results in a G1 delay (15). The
rpn12-1/nin1-1 mutant is arrested at both the
G1/S and G2/M boundaries with reduced Cdc28
kinase activity (16), whereas the rpn11/Mpr1-1
mutant of S. cerevisiae displays a G2/M delay
and altered mitochondrial morphology (17). The
Schizosaccharomyces pombe Rpn11 homolog Pad1 was found to positively regulate Pap1-dependent transcription and was
implicated in the maintenance of chromosome structure (18). Some of the Rpn proteins may thus have functions unrelated to the function of the
26 S proteasome, and the complete functional profile of the 19 S
complex remains unclear.
Trypanosoma brucei, a parasitic protozoan and a causative
agent of African sleeping sickness, is generally regarded as a
relatively primitive eukaryote farther removed from mammals than yeast
(19). Gene expression in this organism depends primarily on
post-transcriptional regulation (20). Functions of the proteasomes in
T. brucei differ significantly from those of other
eukaryotic microorganisms (21, 22). For instance, trypanosomes have the
activated 20 S proteasomal complex as the dominant proteasomal species
(22), which is absent in all other eukaryotic microbes investigated
thus far, but finds a counterpart in mammals, playing an essential role
in major histocompatibility complex class I antigen presentation (23).
Unlike mammals, however, there are apparently only seven - and seven
-subunits in its 20 S complex reservoir, without detectable
heterogeneous isomeric forms (24, 25). There are only two catalytically
active -subunits ( 2 and 5) in the
trypanosome 20 S proteasome.1
The recently identified 26 S proteasome from trypanosomes consists of
stable 20 S and 19 S complexes, but they are readily dissociated from
each other upon cell lysis (25). The six Rpt proteins in the 19 S
complex are highly conserved and capable of complementing the
corresponding yeast mutants, with the only exception of Rpt2 (25). The
down-regulated expression of each of the seven -, seven -, and
six Rpt subunits in trypanosomes by RNA interference (RNAi)2 indicated that each
protein plays an essential function in the growth and viability of this
organism. Apparently, the depletion of each protein cannot be replaced
by any other protein in the cell (25), suggesting a rather simple
family of genes encoding the proteasomal complex without the isogenes,
whose protein products may exchange with the existing subunits in
mammalian proteasomes, resulting in a heterogeneous population (2, 26,
27). The trypanosome proteasome exists in a largely homogeneous
population (24), which is also reflected by results from RNAi (25).
It has the potential of being a simple model like the one from yeast for further in-depth investigation.
In this study, we have identified and isolated the 11 full-length Rpn
subunit genes from T. brucei and disrupted their expression individually to determine the effects on cell cycle progression, cell
viability, and assembly of the 19 S complex. In contrast to
observations obtained with yeast, each Rpn protein in T. brucei was found to be essential for cell viability. With the only
exception of Rpn10, depletion of each of the other 10 Rpn proteins in
trypanosomes disrupted also formation of the 19 S complex.
 |
EXPERIMENTAL PROCEDURES |
Materials--
The procyclic form of T. brucei strain
29-13, which contains the genes expressing T7 RNA polymerase and the
tetracycline repressor (28), was a gift from Dr. Paul T. Englund (Johns
Hopkins University School of Medicine). Fetal bovine serum was
purchased from Atlanta Biologicals, Inc. Mouse monoclonal antibodies
against -tubulin and ubiquitin were purchased from Sigma and
Zymed Laboratories Inc., respectively. Horseradish
peroxidase-conjugated donkey antiserum against rabbit IgG, horseradish
peroxidase-conjugated goat antiserum against mouse IgG,
[35S]methionine, and protein A-Sepharose CL-4B were from
Amersham Biosciences. Protease inhibitor mixtures were purchased from
Roche Molecular Biochemicals. All other chemicals used in this study were of the highest purity commercially available.
Cell Culture--
Procyclic T. brucei cells were
cultivated at 26 °C in Cunningham's medium supplemented with 10%
fetal bovine serum. G418 (15 µg/ml) and hygromycin B (50 µg/ml)
were added to the culture medium to maintain the T7 RNA polymerase and
tetracycline repressor gene constructs within the cells.
Cloning of the 11 Proteasomal non-ATPase (Rpn) cDNAs from
T. brucei--
Partial genomic sequences of the 11 T. brucei Rpn homologs were identified in the TIGR Trypanosome Genome
Project Sequence Databases3
by the BLAST search program using the yeast RPN genes as
queries. Based on the partial sequence information, gene-specific
primers4 were designed and
employed in reverse transcription-PCRs for rapid amplification of
cDNA ends (RACE). First-strand cDNAs were generated from the
total RNA of T. brucei with an
oligo(dT)15-adaptor primer and Moloney murine leukemia
virus reverse transcriptase. 5'-RACE was performed using a
gene-specific antisense primer in combination with the splice leader
sequence (TTAGAACAGTTTCTGTACTATATTG) known as the 5'-end of all
mRNAs in T. brucei (29). 3'-RACE was carried out
using a gene-specific sense primer in combination with the adaptor
primer, which was introduced into cDNA during reverse
transcription. The PCR fragments thus synthesized were cloned into the
pGEM-T-easy vector (Promega) for sequencing. A pair of specific primers
were then designed based on the sequence data and used to
amplify the full-length cDNA, which was then sequenced for complete
open reading frame identification.
Expression and Purification of Recombinant Rpn Proteins for
Antibody Production--
The 11 full-length T. brucei Rpn
cDNAs were each amplified by PCR, and the encoded recombinant
proteins were expressed with an added N-terminal His6 tag
in Escherichia coli strain M15 cells using the pQE30 vector
(QIAGEN Inc.) following the manufacturer's protocol. The recombinant
Rpn proteins, expressed mostly as inclusion bodies in the transformed
E. coli cell lysate, were each dissolved in 8 M
urea and purified through a Ni2+-agarose column (QIAGEN
Inc.) following the manufacturer's instructions. The purified
proteins, with their purity verified by SDS-PAGE (data not shown), were
used to produce polyclonal antibodies in rabbit (Animal Pharm
Services Inc., Healdsburg, CA). Only the antibodies against T. brucei Rpn10 and Rpn11 have now become available and were used in
this investigation.
RNA Interference--
Partial cDNA fragments (300~500 bp
in length) of the 11 T. brucei RPN genes were each amplified
by PCR using gene-specific primers with XhoI and
HindIII linkers4 and subcloned into the pZJM
vector (30) by replacing the -tubulin stuffer. For the
control plasmid, the pZJM vector was digested with
XhoI/HindIII, end-blunted with T4 DNA polymerase,
and self-ligated. The construct was linearized with NotI so
that it could be integrated into the rDNA spacer region of the T. brucei chromosome. Transfection of T. brucei by
electroporation was essentially performed according to our previous
procedures (25). The transfectants were selected with 2.5 µg/ml
phleomycin and cloned by limiting dilution. For induction of RNAi,
stable transfectants were cultured in the presence of 1.0 µg/ml
tetracycline. Cell numbers were counted at different timed
intervals using a hemocytometer.
RNA Gel Blot Analysis--
Total RNA was extracted from T. brucei cells using the TRIzol reagent (Amersham Biosciences).
Thirty µg of total RNA was denatured, separated on 1.2%
formaldehyde-agarose gel, and blotted onto nitrocellulose membranes.
Northern hybridization was carried out overnight at 42 °C in 50%
formamide, 6× SSC, 0.5% SDS, 1× Denhardt's solution, and 0.1 mg/ml
salmon sperm DNA. After stripping the probes, the same blots were
rehybridized with an -tubulin gene fragment to ensure equal RNA
sample loading.
Immunoblotting and Immunoprecipitation--
For immunoblotting,
12.5 or 8.5% acrylamide gels following SDS-PAGE were blotted and
stained as previously described (25). For immunoprecipitation, T. brucei cells were incubated in methionine-free medium for 1 h
and labeled with [35S]methionine (50 µCi/ml) at
26 °C for 4 h. The labeled cells were washed twice with
Tris-buffered saline (25 mM Tris-Cl, pH 7.6, and 100 mM NaCl) and incubated in lysis buffer (25 mM
Tris-Cl, pH 7.6, 100 mM NaCl, 1% Nonidet P-40, 1 mM dithiothreitol, and protease inhibitors) for 30 min on
ice. The cleared lysate, pre-absorbed with rabbit preimmune serum and
protein A-Sepharose beads, was incubated with rabbit antiserum
against T. brucei Rpt3 (25) at 4 °C for 1 h and
precipitated with protein A-Sepharose beads. The immunoprecipitates
thus collected were fractionated by SDS-PAGE, and the dried gels were autoradiographed.
Glycerol Density Gradient Centrifugation--
T.
brucei cells were lysed by sonication in buffer A (10 mM Tris-Cl, pH 7.4, 25 mM KCl, 10 mM NaCl, 1 mM MgCl2, 0.2 mM EDTA, 1 mM dithiothreitol, 2 mM
ATP, 1 mM
N -p-tosyl-L-lysine
chloromethyl ketone, and 1 mM phenylmethylsulfonyl fluoride) containing 20% glycerol, and the lysate was cleared by
centrifugation at 80,000 × g for 60 min. The
proteasomal complexes, collected by an additional centrifugation at
100,000 × g for 60 min, were resuspended in buffer A
containing 5% glycerol, with insoluble materials removed by
centrifugation at 80,000 × g for 30 min. The cleared
supernatant was overlaid on top of a stepwise gradient of 15~50%
glycerol and centrifuged in a Beckman TLS55 rotor at 35,000 rpm for
16 h. Fractions were collected dropwise from the bottom of the
tube, separated by SDS-PAGE, blotted onto polyvinylidene difluoride
membranes, and immunostained with the appropriate antibodies.
Fluorescence-activated Cell Sorting Analysis--
The
fluorescence-activated cell sorting analysis of propidium
iodide-stained trypanosome cells was carried out as described previously (31) with minor modifications. Briefly, T. brucei cells were washed twice with phosphate-buffered saline and fixed in
ethanol at 4 °C for 1 h. The cells were washed twice and
suspended in phosphate-buffered saline. DNase-free RNase (10 µg/ml)
and propidium iodide (20 µg/ml) were added to the suspension and
incubated for 30 min at room temperature. The DNA content of the
propidium iodide-stained cells was analyzed with a FACScan analytical
flow cytometer (BD Biosciences). The percentage of cells in the
G1, S, and G2 phases of the cell cycle was
determined using ModFitLT Version 3.0 Software (BD Biosciences).
 |
RESULTS |
Identification of T. brucei Genes and Cloning of the Corresponding
Full-length cDNAs Encoding the 11 Rpn Subunits--
The partial
nucleotide sequences encoding 11 distinct T. brucei Rpn
homologs were identified in the TIGR Trypanosome Genome Project Sequence Databases by the BLAST program using the 11 yeast RPN gene sequences as queries. Based on these partial
sequences, Rpn-specific primers were designed and employed in 5'- and
3'-RACE reactions for the remainder of the 5'- and 3'-sequences in each of the 11 RPN genes. A pair of primers encompassing the
entire coding region were designed and used to amplify the full-length cDNA of each of the 11 Rpn homologs, resulting in the cloning and
sequencing of each of the 11 full-length Rpn cDNAs. The deduced amino acid sequences from these cDNA clones were compared with those of the yeast counterparts and revealed sequence identities ranging from 46% between the Rpn11 proteins to 20% between the Rpn9
proteins (Table I). The yeast Rpn4
protein, a putative transcription factor only loosely associated with
the yeast 26 S proteasome (32-34), was postulated to be a protein
uninvolved in the yeast 19 S complex. We found no apparent homolog in
the T. brucei genome sequence data bases. The 11 RPN genes we have identified in T. brucei thus
far may represent the complete profile of Rpn subunits in the T. brucei 19 S complex mimicking that observed in the yeast 19 S
complex (3).
T. brucei Rpn1 has a slightly lower molecular mass compared
with Rpn2, in agreement with the human Rpn subunits S2 and S1 (2), but in contrast to yeast Rpn1 and Rpn2 (Table
I). Trypanosome Rpn1 shares only ~20%
sequence identity with Rpn2, but each protein contains at the C
terminus nine leucine-rich repeats possibly involved in protein-protein
interactions (35). The C termini of Rpn3, Rpn5-7, and Rpn9 each
contain a common structural motif, the PCI
(proteasome/COP9/initiation factor)
domain, which was also found in the subunits of the COP9 signalosome
and eukaryotic translation initiation factor-3 (36, 37). This motif is
an -helix structure of ~200 residues important for the assembly of
the yeast 19 S complex and the Arabidopsis thaliana COP9
signalosome (5). Containing only the conserved C-terminal PCI
domain shared by its yeast and human homologs (Fig.
1), T. brucei Rpn3 has a molecular mass considerably smaller than that of yeast Rpn3 (Table I).
This C-terminal PCI domain was previously found to be sufficient for
replacing the function of full-length Rpn3 in yeast at lower temperatures (38). In addition, the yeast
rpn3/sun2 mutant could be complemented by its
human counterpart p58/S3 missing the 150 N-terminal residues (39).
T. brucei Rpn3 may be thus functionally adequate despite its
smaller size. An MPN (Mpr1/Pad1
N-terminal) domain was identified at the N termini of
T. brucei Rpn8 and Rpn11 and is required for protein-protein
interactions in multiprotein complexes such as the 19 S complex and the
COP9 signalosome (5). Finally, a ubiquitin-interacting motif (UIM) was
identified at the C terminus of T. brucei Rpn10 as
anticipated, which should enable the protein to bind to polyubiquitin
chains (12, 40-42), thus qualifying it as a ubiquitin-binding protein.
The 11 tentatively identified T. brucei Rpn proteins all
contain the necessary structural motifs for their assumed functions.
They may very well be the bona fide subunits of the 19 S
complex from T. brucei (25).

View larger version (101K):
[in this window]
[in a new window]
|
Fig. 1.
Sequence comparison of the T. brucei Rpn3 protein with its yeast and human
homologs. The alignment was generated using BoxShade software.
Identical amino acid residues are shown in black boxes, and
similar residues are indicated in gray boxes.
Numbers on the right indicate the positions in the protein.
The two opposing arrows outline the PCI domain.
Tb, T. brucei; Sc, S. cerevisiae; Hs, Homo sapiens.
|
|
The Rpn Proteins Are Essential for Growth of the Procyclic Form of
T. brucei--
To investigate the potential role that each of the 11 Rpn proteins may play during the growth of trypanosomes, we exploited the RNAi technique to selectively block the expression of individual RPN genes in the procyclic T. brucei cells. A
300~500-bp fragment of unique sequence from the coding region of each
RPN gene4 was amplified by PCR and inserted into
the RNAi vector pZJM (30). The insert was flanked by two opposing T7
promoters and two opposing tetracycline operators in the construct, and
the resulting plasmid was linearized and introduced by electroporation
into T. brucei 29-13 cells expressing both T7 RNA polymerase
and the tetracycline repressor (28). The stably transfected cell lines
were selected under phleomycin and cloned by limiting dilution. To
induce synthesis of double-stranded RNA encoded by the insert, the
transfected cells were cultured in the presence of 1.0 µg/ml
tetracycline to switch on the T7 promoters. The double-stranded RNA
thus synthesized is known to lead to degradation of the corresponding
mRNA in T. brucei, thus blocking the expression of its
encoding gene (30).
The anticipated double-stranded RNA-induced interference with
RPN gene expression was first examined by Northern blot
analysis of the RPN mRNA levels in the transfectant
prior to and following the addition of tetracycline. The data show
that, after adding tetracycline to the cultures for 2 days, each of the
11 RPN mRNAs in the 11 transfectants was decreased to a
substantially lower level compared with the uninduced control (Fig.
2A, insets for Rpn9-11; and Fig. I in the Supplemental Material,
insets for the rest of the Rpn proteins). There is
little doubt that we were able to down-regulate the expression of each
of the 11 RPN genes by the RNAi technique. This blockade of
gene expression was found to be highly specific in all cases, as
additional Northern blots indicated that when the expression of one
RPN gene was blocked, the levels of the other 10 RPN mRNAs remained unaffected (data not shown).

View larger version (46K):
[in this window]
[in a new window]
|
Fig. 2.
RNAi with RPN gene
expression and effects on T. brucei growth,
cell cycle progression, and polyubiquitinated protein levels.
A, profiles of cell growth in the three representative
transfectants in the absence ( Tet) and presence
(+Tet) of 1 µg/ml tetracycline in culture medium. Timed
samples were taken during incubation, and cell numbers were counted.
The insets depict corresponding Northern blot analysis of
mRNA levels prior to and following tetracycline induction for 2 days. The same blots were rehybridized with an -tubulin
(TUB) DNA fragment as an internal sampling control.
Control represents data from T. brucei cells
transfected with the pZJM empty vector. B, depletion of the
target protein by RNAi. T. brucei cells harboring the RNAi
constructs of RPN10 or RPN11 fragments were
induced with tetracycline for 4 days (Rpn10) or 3 days
(Rpn11) and lysed by sonication. Immunoblotting was
performed on 10 µg of total proteins with rabbit antisera against
purified recombinant T. brucei Rpn10 and Rpn11 proteins,
respectively. Immunostaining of -tubulin ( -tub) was
performed on the same membrane as a sampling control. C,
effect of Rpn depletion on the cell cycle progression of procyclic
T. brucei cells. T. brucei cell lines harboring
the RNAi constructs were grown in the presence of 1 µg/ml
tetracycline. Cells were harvested after 6 days of tetracycline
induction for Rpn9 and Rpn10 RNAi transfectants and after 3 days for
the Rpn11 RNAi transfectant. Cells were washed with phosphate-buffered
saline, stained with propidium iodide, and analyzed using a FACScan. A
total of 25,000 cells were counted. The insets show the
percentages of cells at different phases of the cell cycle.
D, effect of Rpn depletion on polyubiquitinated protein
levels in T. brucei. The transfected T. brucei
cells were induced with 1 µg/ml tetracycline for 3 days and lysed by
sonication. Immunoblotting was carried out on 10 µg of total proteins
with mouse anti-ubiquitin monoclonal antiserum. The same membranes were
also immunostained with mouse anti- -tubulin monoclonal antiserum as
sampling controls.
|
|
Immunoblot analysis of the Rpn protein levels in the transfected cells
was then performed (Fig. 2B). The results show that, in the
transfectant in which the level of RPN10 mRNA was low, there was little Rpn10 protein detectable (~5%) on the immunoblot after 4 days of tetracycline induction. The Rpn11 protein in the corresponding transfectant was depleted to an undetectable level after
RNAi induction for 3 days. This observed RNAi reduction of both
mRNA and protein from a specific gene in T. brucei is consistent with our previous experimental results on the genes encoding
proteasomal -, -, and Rpt subunits (25), as well as those
reported on the down-regulated expression of other T. brucei
genes by RNAi (30, 43, 44).
The potential effect of the down-regulated expression of individual
RPN genes on the growth of T. brucei was then
examined. As demonstrated by the data presented in Fig. 2A
as well as in Fig. I in the Supplemental Material, tetracycline
induction of RNAi was always followed by significantly inhibited cell
growth in all 11 cases. Three Rpn-deficient cell lines
(rpn5, rpn9, and rpn10) could still
grow slowly, however, 3 days after the onset of tetracycline induction.
But all 11 cell lines eventually died after 7 days with tetracycline,
whereas the control grew equally well with or without tetracycline,
suggesting that each of the 11 Rpn proteins performs an essential
function in the growth of procyclic T. brucei cells.
When these results are compared with those from the gene knockout
experiments on S. cerevisiae (2), there are nine
RPN genes whose knockout mutations have been proven lethal
to the yeast. But the rpn9 mutant remains viable with a
slower growth rate (3, 10), whereas the rpn10 mutant
remains perfectly viable and grows as well as the wild type (12). This
distinction between trypanosomes and yeast will be further pursued below.
Effect of Rpn Depletion on Cell Cycle Progression--
The
function of the 26 S proteasome is required for degradation of many
cell cycle regulatory proteins such as the cyclins and certain
cyclin-dependent kinase inhibitors and thus plays critical
roles in regulating cell cycle progression (45). Mutations in several
19 S Rpt and Rpn subunit genes result in distinct cell cycle defects in
yeast (11, 13-17), suggesting that different 19 S subunits may be
responsible for specific degradation of different cell cycle regulator
proteins. The fact that the growth of all 11 Rpn-deficient T. brucei cells was inhibited suggested that depletion of each Rpn
protein may arrest the cells at certain specific phases of the cell
cycle. To ascertain the point of arrest in the Rpn-deficient cells,
each of the 11 Rpn-depleted cell lines was subjected to FACScan
analysis. The results show that, although >70% of the cell population
maintained the 2N DNA content (G1 phase) and only ~15%
of the cells had the 4N DNA content (G2 phase) prior to
tetracycline induction (Fig. 2C, Control),
depletion of individual Rpn proteins invariably decreased the 2N cells
to 13.8-26.0% and increased the 4N cells to 52.7-79.2% (Fig.
2C for Rpn9-11 and Fig. II in the Supplemental
Material for the rest of the Rpn proteins). A more detailed
FACScan analysis of the timed samples for the depletion of each of the
11 tetracycline-induced Rpn proteins showed a steady-state decrease in
the number of G1 cells accompanied by a simultaneous,
equivalent increase in the number of G2 cells (data not
shown). Thus, the T. brucei cells with each of the 11 Rpn
proteins depleted can still progress successfully through the
G1/S phase transition, but are arrested at the
G2/M phase of the cell cycle. To further narrow down the
point of arrest in these Rpn-deficient cells, we checked the propidium
iodide-stained cells under a fluorescence microscope and found that all
Rpn-deficient cells contained only one nucleus (data not shown), even
though most of them had 4N DNA, suggesting that depletion of each Rpn protein blocks the cell cycle at G2/metaphase, before
division of the replicated nuclei.
Depletion of Rpn Leads to Accumulation of Polyubiquitinated
Proteins--
Polyubiquitinated protein has been identified as the
primary substrate of the 26 S proteasome in eukaryotes. Our previous study indicated that each of the seven -subunits, seven
-subunits, and six Rpt proteins in the 26 S proteasome of T. brucei is essential for intracellular degradation of
polyubiquitinated proteins (25). To determine the effect of
individual Rpn depletion on the degradation of polyubiquitinated
proteins, total cellular proteins were collected from each of the 11 transfectant cell lines with or without tetracycline induction,
separated by SDS-PAGE, blotted onto polyvinylidene difluoride
membranes, and stained with mouse anti-ubiquitin monoclonal antiserum.
The polyubiquitinated protein, running in a smeared pattern at the top
of the gel upon SDS-PAGE, was stained only slightly by the antibody in
the control and the 11 uninduced transfectants. The intensity of the
stain was enhanced significantly in all 11 transfectants after
tetracycline induction for 3 days (Fig. 2D for Rpn9-11 and
Fig. III in the Supplemental Material for the rest of the Rpn
proteins). This accumulation of polyubiquitinated proteins, which
likely resulted from their reduced degradation, may be
attributed to loss of function of the 19 S complex upon depletion of
one of the Rpn subunits due to either formation of an inactive partial
19 S complex or failure to form any complex at all. Further structural
analysis of the 19 S complex in each of the 11 Rpn-deficient cell lines
may shed some light on these uncertainties.
Effect of Rpn Depletion on the Assembly of the 19 S
Complex--
From the [35S]methionine-labeled wild-type
T. brucei cell lysate, anti-Rpt3 antiserum can precipitate
the 19 S complex with 14 distinguishable radiolabeled protein bands
(ranging from 30 to 110 kDa) upon SDS-PAGE (Fig.
3A). This band pattern
resembles that of the purified yeast 19 S complex (3). Rpn10 and Rpn11 were readily identified because of the availability of specific antibodies against them. The rest of the protein bands were tentatively assigned by their molecular masses predicted from the encoding cDNAs (Fig. 3A). Using this experimental technique, we
analyzed the integrity of the 19 S complex after depletion of
individual Rpn proteins. The results demonstrate that, with the
exception of Rpn10, few proteins were appreciably co-immunoprecipitated with Rpt3 when any one of the other 10 Rpn proteins was depleted (Fig.
3B for Rpn9-11 and Fig. IV in the Supplemental Material for
the rest of the Rpn proteins). Each of these 10 Rpn proteins thus may
play an essential role in the assembly of the entire 19 S complex. In
the absence of Rpn10, however, almost all the protein bands brought
down originally by anti-Rpt3 serum in the control experiment were
accounted for in the precipitate (except for Rpn10) (Fig.
3B), suggesting that assembly of the main bulk of the
T. brucei 19 S complex can be accomplished without
Rpn10.

View larger version (85K):
[in this window]
[in a new window]
|
Fig. 3.
Immunoprecipitation of the 19 S complex from
Rpn-depleted, [35S]methionine-labeled T. brucei cells with anti-Rpt3 antibody. The
transfected T. brucei cells were grown without ( ) or with
(+) 1 µg/ml tetracycline and incubated for 4 days (for Rpn9
and Rpn10) or 3 days (for Rpn11 and
Control) and labeled with [35S]methionine.
Cells were lysed in lysis buffer, and lysate samples (500 µg of total
proteins each) were first cleared with preimmune serum and then
incubated with anti-Rpt3 polyclonal antibody and protein A-Sepharose
CL-4B beads. The immunoprecipitates were resolved by SDS-PAGE,
autoradiographed, and compared in the uninduced and induced samples. A
duplicate sample of the immunoprecipitates upon SDS-PAGE was blotted
and immunostained with anti-Rpt3 polyclonal antibody as an internal
sampling control. A, designations of the Rpt and Rpn
proteins upon SDS-PAGE; B, effect of Rpn depletion on
formation of the 19 S complex. The arrowheads point to the
protein bands that were depleted by tetracycline induction of RNAi. The
asterisks indicate the positions of the Rpt3 protein.
|
|
To further characterize the lack of effect of Rpn10 depletion on the
assembly of the 19 S complex, mixtures of the 20 S complex, the
activated 20 S proteasomal complex, and the 19 S complex from the
lysates of Rpn10- and Rpn11-depleted T. brucei cells were fractionated by glycerol gradient centrifugation. The subunit proteins
in each collected fraction were separated by SDS-PAGE, blotted, and
immunostained with the appropriate antibodies. The results presented in
Fig. 4A indicate that, prior
to adding tetracycline, the cells had Rpn10, Rpn11, Rpt3, and Rpt4 all
located primarily in fractions 4-6, where the 19 S complex is located
(25), whereas the 6-subunit was found largely in fractions 5-7,
where the 20 S complex is found (25). Following depletion of Rpn10 by
tetracycline induction of RNAi, the level of this particular protein
was significantly reduced, but Rpn11, Rpt3, and Rpt4 were still located
in the 19 S fractions (Fig. 4B), suggesting that a quasi 19 S complex containing these subunits is still formed. When Rpn11 was
depleted, however, Rpn10, Rpt3, and Rpt4 remained much closer to the
top of the glycerol gradient (Fig. 4C), where the free
monomeric forms of these proteins are known to be located from our
previous study (25). These results provide another indication that
Rpn11 is essential, whereas Rpn10 is not essential, for the assembly of
the 19 S complex in T. brucei. They also suggest that when
Rpn11 is missing, the Rpt proteins may also remain in their monomeric
forms.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 4.
Immunostaining of Rpn and Rpt proteins in the
proteasomal complexes separated by glycerol gradient
centrifugation. The T. brucei cell lines depleted of
Rpn10 and Rpn11 were each incubated with 1.0 µg/ml tetracycline for 6 and 4 days, respectively. Lysates of the cells were fractionated by
glycerol gradient centrifugation; fractionated by SDS-PAGE; blotted;
and immunostained with rabbit antisera against T. brucei
Rpn10, Rpn11, Rpt3, Rpt4, and the 20 S 6-subunit. A,
uninduced control cells; B, Rpn10-deficient cells;
C, Rpn11-deficient cells.
|
|
 |
DISCUSSION |
In this study, we identified and isolated the full-length
cDNAs encoding 11 Rpn proteins in the procyclic form of T. brucei and employed the technique of RNAi to block the expression
of each of the 11 Rpn proteins for phenotypes. Several lines of
evidence confirmed the identity of these 11 T. brucei Rpn
proteins. First, each of the 11 Rpn proteins exhibited significant
sequence homology to their yeast counterparts, especially in the
conserved structural motifs such as leucine-rich repeats, PCI and MPN
domains, and UIMs (Table I). Second, depletion of individual Rpn
proteins promoted intracellular accumulation of polyubiquitinated
proteins in T. brucei (Fig. 2D), suggesting
the essential involvement of each Rpn protein in the 26 S
proteasome-catalyzed proteolysis of polyubiquitinated proteins. Third,
depletion of individual Rpn proteins disrupted assembly of the 19 S
complex in all but one case, with Rpn10 (Figs. 3B and 4
(B and C) and Fig. IV in the Supplemental
Material). Finally, Rpn10 and Rpn11 comigrated with Rpt3 and Rpt4 in an
apparent 19 S complex upon glycerol gradient centrifugation (Fig.
4A).
Each of the 11 Rpn proteins was found to be essential for the viability
of T. brucei cells, whereas deletion of the 11 individual proteasomal RPN genes in S. cerevisiae results in
lethality in only 9 of the 11 mutants (2), with the two exceptions of
the rpn9 and rpn10 mutants (Table
II). Yeast Rpn9 and Rpn10 are known to
interact with each other in the 19 S complex (10), but the
rpn9 rpn10 double mutant does not display a
marked synthetic lethality (3). The function of Rpn10 becomes essential
for yeast growth only when the function of Rpn12 is compromised (46). Like Rpn10 in T. brucei, yeast Rpn10 is the only 19 S
subunit that possesses a UIM capable of binding to polyubiquitin chains (3, 12). However, the 19 S ATPase subunit Rpt5 in mammalian cells,
although lacking a UIM, was found to be capable of being cross-linked
with polyubiquitin chains (47). Rpn10 is cross-linked with
polyubiquitin chains only when it is not part of the 19 S complex,
suggesting that its ubiquitin chain-binding site may be occluded in the
19 S complex. Several proteasome-interacting proteins in S. cerevisiae, such as Rad23, Dsk2, and Ddi1, contain ubiquitin-like
and ubiquitin-associated domains. They have an overlapping function
with Rpn10 by binding to polyubiquitinated proteins and targeting them
to the 26 S proteasome (48-50). The presence of these helper proteins
may explain why Rpn10 is not essential in yeast. Given the essentiality
of Rpn10 for trypanosome viability, Rpn10 could be the major, if not
the only, ubiquitin-binding protein associated with the 26 S proteasome
in T. brucei. This postulation is supported by the exclusive
association of Rpn10 with the 19 S complex in T. brucei: no
free monomeric Rpn10 was detectable upon glycerol density gradient
fractionation of the T. brucei cell lysate (Fig.
4A). In contrast, a substantial amount of Rpn10 protein was
found unassociated with the proteasome in S. cerevisiae,
S. pombe, and Drosophila (12, 46, 51), implying an additional function for Rpn10 other than that associated with the
proteasome in these organisms. Of the several living organisms under
comparison (10, 46, 52), these structurally and functionally similar
Rpn10 homologs were found to play an essential role only in
T. brucei, suggesting a proteasomal system in
T. brucei depending primarily on Rpn10 for binding to
polyubiquitinated proteins. However, in view of the complicated data
from cross-linking ubiquitin chains with mammalian proteasome subunits
(47), a more complex mechanism of polyubiquitin binding to trypanosome
proteasomes cannot be ruled out at present.
Depletion of any one of the 11 Rpn proteins in T. brucei
enriched the cell population at the G2/M phase of the cell
cycle (Fig. 2C). This observation agrees with our previous
result showing that treatment of the procyclic form of T. brucei with the proteasome-specific inhibitor lactacystin arrests
the cells at the G2/M phase (31). Our recent studies
demonstrated that depletion of any one of the seven proteasomal
-subunits, seven -subunits, or six Rpt proteins by RNAi (25) also
results in the arrest of the procyclic form of T. brucei in
the G2/M phase.1 Apparently, 26 S
proteasome-mediated degradation of certain regulatory protein(s) may be
crucial for the normal progression of procyclic T. brucei
cells across the G2/M boundary. Our previous interesting observation (31) indicating that lactacystin arrests the bloodstream form of T. brucei cells at both the G1/S and
G2/M phases was also confirmed by our recent RNAi
studies.1 This suggests a required 26 S proteasome
degradation of an additional regulatory protein(s) controlling the
passage of the bloodstream form of T. brucei cells across
the G1/S phase. This additional requirement is apparently
not present in the procyclic form.
The cell cycle defects have been identified for only 4 of the 11 rpn mutants of S. cerevisiae (Table II). Although
the growth of the rpn3-4, rpn9, and
rpn11/Mpr1-1 mutants is arrested at the
G2/M phase (11, 14, 17), that of the
rpn12-1/nin1-1 mutant is arrested at both the
G1/S and G2/M boundaries (16). In yeast,
proteasomal degradation of the G1
cyclin-dependent kinase inhibitor Sic1, the anaphase
inhibitor Pds1, and the B-type cyclin Clb2 is required for transition
from G1 to S phase, transition from metaphase to anaphase,
and exit from mitosis, respectively (45). Pds1 and Clb2 are
significantly stabilized, whereas the turnover of Sic1 is unaffected in
rpn3-4 and rpn9 mutant cells, which may
explain why these mutants are arrested at the G2/M phase (11, 14). The yeast rpn12-1/nin1-1 mutant fails
in turning over both Sic1 and Pds1 and may thus provide the basis for
cell arrest at both G1/S and G2/M (16). It
remains to be seen whether a Pds1 functional homolog and similar B-type
cyclins are also present in procyclic T. brucei and whether
their degradation by proteasomes is required for cell cycle progression
through G2/M.
Regarding the structural aspect, interactions between the following
subunits in the 19 S complex have been noted in S. cerevisiae: Rpt1 with Rpn1 and Rpn12, Rpt2 with Rpn1, Rpt4 with
Rpn2, and Rpt6 with Rpn2 (4, 5). There is no interaction of Rpt3 or Rpt5 with any of the Rpn subunits identified. If one assumes from the
yeast data that Rpn1 and Rpn2 are the only two building blocks laid on
top of the Rpt hexamer ring, our current data on T. brucei should indicate that association of Rpn1 and Rpn2 with the Rpt ring
requires also the presence of all other Rpn proteins except Rpn10.
Depletion of Rpn9 in T. brucei resulted in no detectable 19 S complex (Fig. 3B), but yeast rpn9 cells
contain a 26 S proteasome that is shifted to lighter fractions on a
glycerol density gradient (10). This incomplete proteasomal complex
(which lacks also Rpn10) is, however, functionally adequate in
maintaining cell viability (3, 10, 11). In the yeast
rpn11/Mpr1-1 mutant, the
frameshift-mutated Rpn11 protein is absent in the purified proteasomal
complex, but the base of the 19 S complex is still formed (53), whereas
depletion of Rpn11 in T. brucei resulted in no detectable
complex, and both Rpt3 and Rpt4 were present in apparent monomeric
forms (Fig. 4C). There are apparently significant discrepancies in 19 S complex assembly between yeast and T. brucei.
Rpn10 from yeast is known to make contact with Rpn1, Rpn9, Rpn11, and
Rpn12, but not with the Rpt ring (4, 5). In the yeast
rpn10 mutant, the mutant 26 S proteasome has its lid
readily peeled off from its base in 0.4 M NaCl (6).
However, the lid can also be detached from the intact human 26 S
proteasome under high salt (7, 54), suggesting that depletion of Rpn10
is not the prerequisite for dissociation of the lid from the base in
the proteasome, although yeast Rpn10 is believed to strengthen the
association (6). Thus, structurally, yeast Rpn10 and T. brucei Rpn10 may be equivalent in terms of their nonessential roles in 19 S complex assembly. This also implies that Rpn10 may be
generally present on the exterior of the 19 S complex, which appears
logical in view of its function in binding to the polyubiquitin chains.
 |
ACKNOWLEDGEMENT |
We thank Professor Paul T. Englund for
providing the pZJM vector and T. brucei strain 29-13.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant RO1 AI-21786.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The on-line version of this article (available at
http://www.jbc.org) contains Supplemental Figs. I-IV.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF404111-AF404120 and AF410930.
To whom correspondence should be addressed: Dept. of
Pharmaceutical Chemistry, UCSF, 513 Parnassus Ave., San Francisco, CA 94143-0446. Tel.: 415-476-1321; Fax: 415-476-3382; E-mail:
ccwang@cgl.ucsf.edu.
Published, JBC Papers in Press, September 3, 2002, DOI 10.1074/jbc.M207183200
1
C. C. Wang, unpublished data.
3
Available at
www.tigr.org/tdb/mdb/tbdb/index.shtml.
4
Sequence information is available upon request.
 |
ABBREVIATIONS |
The abbreviations used are:
RNAi, RNA
interference;
RACE, rapid amplification of cDNA ends;
UIM, ubiquitin-interacting motif.
 |
REFERENCES |
| 1.
|
Glickman, M. H.,
and Ciechanover, A.
(2002)
Physiol. Rev.
82,
373-428[Abstract/Free Full Text]
|
| 2.
|
Voges, D.,
Zwickl, P.,
and Baumeister, W.
(1999)
Annu. Rev. Biochem.
68,
1015-1068[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Glickman, M. H.,
Rubin, D. M.,
Fried, V. A.,
and Finley, D.
(1998)
Mol. Cell. Biol.
18,
3149-3162[Abstract/Free Full Text]
|
| 4.
|
Ferrell, K.,
Wilkinson, C. R. M.,
Dubiel, W.,
and Gordon, C.
(2000)
Trends Biochem. Sci.
25,
83-88[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Fu, H.,
Reis, N.,
Lee, Y.,
Glickman, M. H.,
and Vierstra, R. D.
(2001)
EMBO J.
20,
7096-7107[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Glickman, M. H.,
Rubin, D. M.,
Coux, O.,
Wefes, I.,
Pfeifer, G.,
Cjeka, Z.,
Baumeister, W.,
Fried, V. A.,
and Finley, D.
(1998)
Cell
94,
615-623[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Kapelari, B.,
Bech-Otschir, D.,
Hegerl, R.,
Schade, R.,
Dumdey, R.,
and Dubiel, W.
(2000)
J. Mol. Biol.
300,
1169-1178[CrossRef][Medline]
[Order article via Infotrieve]
|
| 8.
|
Bech-Otschir, D.,
Seeger, M.,
and Dubiel, W.
(2002)
J. Cell Sci.
115,
467-473[Abstract/Free Full Text]
|
| 9.
|
Burns, N.,
Grimwade, B.,
Ross-MacDonald, P. B.,
Choi, E. Y.,
Finberg, K.,
Roeder, G. S.,
and Snyder, M.
(1994)
Genes Dev.
8,
1087-1105[Abstract/Free Full Text]
|
| 10.
|
Takeuchi, J.,
Fujimuro, M.,
Yokosawa, H.,
Tanaka, K.,
and Toh-e, A.
(1999)
Mol. Cell. Biol.
19,
6575-6584[Abstract/Free Full Text]
|
| 11.
|
Takeuchi, J.,
and Toh-e, A.
(2001)
Biochimie (Paris)
83,
333-340
|
| 12.
|
van Nocker, S.,
Sadis, S.,
Rubin, R. M.,
Glickman, M., Fu, H.,
Coux, O.,
Wefes, I.,
Finley, D.,
and Vierstra, R. D.
(1996)
Mol. Cell. Biol.
16,
6020-6028[Abstract]
|
| 13.
|
Ghislain, M.,
Udvardy, A.,
and Mann, C.
(1993)
Nature
366,
358-361[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Bailly, E.,
and Reed, S. I.
(1999)
Mol. Cell. Biol.
19,
6872-6890[Abstract/Free Full Text]
|
| 15.
|
Rubin, D. M.,
Glickman, M. H.,
Larsen, C. N.,
Dhruvakumar, S.,
and Finley, D.
(1998)
EMBO J.
17,
4909-4919[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Kominami, K.,
DeMartino, G. N.,
Moomaw, C. R.,
Slaughter, C. A.,
Shimbara, N.,
Fujimuro, M.,
Yokosawa, H.,
Hisamatsu, H.,
Tanahashi, N.,
Shimizu, Y.,
Tanaka, K.,
and Toh-e, A.
(1995)
EMBO J.
14,
3105-3115[Medline]
[Order article via Infotrieve]
|
| 17.
|
Rinaldi, T.,
Ricci, C.,
Porro, D.,
Bolotin-Fukuhara, M.,
and Frontali, L.
(1998)
Mol. Biol. Cell
9,
2917-2931[Abstract/Free Full Text]
|
| 18.
|
Shimanuki, M.,
Saka, Y.,
Yanagida, M.,
and Toda, T.
(1995)
J. Cell Sci.
108,
569-579[Abstract]
|
| 19.
|
Sogin, M. L.,
Gunderson, J. H.,
Elwood, H. J.,
Alonso, R. A.,
and Peattie, D. A.
(1989)
Science
243,
75-77[Abstract/Free Full Text]
|
| 20.
|
Berberof, M.,
Vanhamme, L.,
Tebabi, P.,
Pays, A.,
Jefferies, D.,
Welburn, S.,
and Pays, E.
(1995)
EMBO J.
14,
2925-2934[Medline]
[Order article via Infotrieve]
|
| 21.
|
Hua, S. B., To, W.-Y.,
Nguyen, T.,
Wong, M. L.,
and Wang, C. C.
(1996)
Mol. Biochem. Parasitol.
78,
33-46[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
To, W.-Y.,
and Wang, C. C.
(1997)
FEBS Lett.
404,
253-262[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Preckel, T.,
Fung-Leung, W.-P.,
Cai, Z.,
Vitiello, A.,
Salter-Cid, C.,
Winqvist, O.,
Wolfe, T. G.,
Von Herrath, M.,
Angulo, A.,
Ghazal, P.,
Lee, J. D.,
Fourie, A. M., Wu, Y.,
Pang, J.,
Ngo, K.,
Peterson, P. A.,
Früh, K.,
and Yang, Y.
(1999)
Science
286,
2162-2165[Abstract/Free Full Text]
|
| 24.
|
Huang, L.,
Jacob, R. J.,
Pegg, S. C.-H.,
Baldwin, M. A.,
Wang, C. C.,
Burlingame, A. L.,
and Babbitt, P. C.
(2001)
J. Biol. Chem.
276,
28327-28339[Abstract/Free Full Text]
|
| 25.
|
Li, Z.,
Zou, C.-B.,
Yao, Y.,
Hoyt, M. A.,
McDonough, S.,
Mackey, Z. B.,
Coffino, P.,
and Wang, C. C.
(2002)
J. Biol. Chem.
277,
15486-15498[Abstract/Free Full Text]
|
| 26.
|
Monaco, J. J.,
and Nandi, D.
(1995)
Annu. Rev. Genet.
29,
729-754[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Pamer, E.,
and Cresswell, P.
(1998)
Annu. Rev. Immunol.
16,
323-358[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Wirtz, E.,
Leal, S.,
Ochatt, C.,
and Cross, G. A.
(1999)
Mol. Biochem. Parasitol.
99,
89-101[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Campbell, D. A.,
Thornton, D. A.,
and Boothroyd, J. C.
(1984)
Nature
311,
350-355[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Wang, Z.,
Morris, J. C.,
Drew, M. E.,
and Englund, P. T.
(2000)
J. Biol. Chem.
275,
40174-40179[Abstract/Free Full Text]
|
| 31.
|
Mutomba, M. C., To, W.-Y.,
Hyun, W. C.,
and Wang, C. C.
(1997)
Mol. Biochem. Parasitol.
90,
491-504[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Fujimuro, M.,
Tanaka, K.,
Yokosawa, H.,
and Toh-e, A.
(1998)
FEBS Lett.
423,
149-154[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Mannhaupt, G.,
Schnall, R.,
Karpov, V.,
Vetter, I.,
and Feldmann, H.
(1999)
FEBS Lett.
450,
27-34[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Xie, Y.,
and Varshavsky, A.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
3056-3061[Abstract/Free Full Text]
|
| 35.
|
Lupas, A.,
Baumeister, W.,
and Hofmann, K.
(1997)
Trends Biochem. Sci.
22,
195-196[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Hofmann, K.,
and Baucher, P.
(1998)
Trends Biochem. Sci.
23,
204-205[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Kim, T.-H.,
Hofmann, K.,
von Arnim, A. G.,
and Chamovitz, D. A.
(2001)
Trends Plant Sci.
6,
379-386[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Kawamura, M.,
Kominami, K.,
Takeuchi, J.,
and Toh-e, A.
(1996)
Mol. Gen. Genet.
251,
146-152[Medline]
[Order article via Infotrieve]
|
| 39.
|
Kominami, K.,
Okura, N.,
Kawamura, M.,
DeMartino, G. N.,
Slaughter, C. A.,
Shimbara, N.,
Chung, C. H.,
Fujimuro, M.,
Yokosawa, H.,
Shimizu, Y.,
Tanahashi, N.,
Tanaka, K.,
and Toh-e, A.
(1997)
Mol. Biol. Cell
8,
171-187[Abstract]
|
| 40.
|
van Nocker, S.,
Deveraux, Q.,
Rechsteiner, M.,
and Vierstra, R. D.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
856-860[Abstract/Free Full Text]
|
| 41.
|
Young, P.,
Deveraux, Q.,
Beal, R. E.,
Pickart, C. M.,
and Rechsteiner, M.
(1998)
J. Biol. Chem.
273,
5461-5467[Abstract/Free Full Text]
|
| 42.
|
Fu, H.,
Sadies, S.,
Rubin, D. M.,
Glickman, M.,
van Nocker, S.,
Finley, D.,
and Vierstra, R. D.
(1998)
J. Biol. Chem.
273,
1970-1981[Abstract/Free Full Text]
|
| 43.
|
Shi, H.,
Djikeng, A.,
Mark, T.,
Wirtz, E.,
Tschudi, C.,
and Ullu, E.
(2000)
RNA (N. Y.)
6,
1069-1076
|
| 44.
|
Wang, Z.,
and Englund, P. T.
(2001)
EMBO J.
20,
4674-4683[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Koeep, D. M.,
Harper, J. W.,
and Elledge, S. J.
(1999)
Cell
97,
431-434[CrossRef][Medline]
[Order article via Infotrieve]
|
| 46.
|
Wilkinson, C. R. M.,
Ferrell, K.,
Penney, M.,
Wallace, M.,
Dubiel, W.,
and Gordon, C.
(2000)
J. Biol. Chem.
275,
15182-15192[Abstract/Free Full Text]
|
| 47.
|
Lam, Y. A.,
Lawson, T. G.,
Velayutham, M.,
Zweier, J. L.,
and Pickart, C. M.
(2002)
Nature
416,
763-767[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Lambertson, D.,
Chen, L.,
and Madura, K.
(1999)
Genetics
153,
69-79[Abstract/Free Full Text]
|
| 49.
|
Chen, L.,
and Madura, K.
(2002)
Mol. Cell. Biol.
22,
4902-4913[Abstract/Free Full Text]
|
| 50.
|
Saeki, Y.,
Saitoh, A.,
Toh-e, A.,
and Yokosawa, H.
(2002)
Biochem. Biophys. Res. Commun.
293,
986-992[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Haracska, L.,
and Udvardy, A.
(1997)
FEBS Lett.
412,
331-336[CrossRef][Medline]
[Order article via Infotrieve]
|
| 52.
|
Girod, P.-A., Fu, H.,
Zryd, J.-P.,
and Vierstra, R. D.
(1999)
Plant Cell
11,
1457-1471[Abstract/Free Full Text]
|
| 53.
|
Verma, R.,
Aravind, L.,
Oania, R.,
McDonald, W. H.,
Yates, J. R., III,
Koonin, E. V.,
and Deshaies, R. J.
(2002)
Science
298,
611-615[Abstract/Free Full Text]
|
| 54.
|
Henke, W.,
Ferrel, K.,
Bech-Otschir, D.,
Seeger, M.,
Schade, R.,
Jungblut, P.,
Naumann, M.,
and Dubiel, W.
(1999)
Mol. Biol. Rep.
26,
29-34[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Z. Li and C. C. Wang
KMP-11, a Basal Body and Flagellar Protein, Is Required for Cell Division in Trypanosoma brucei
Eukaryot. Cell,
November 1, 2008;
7(11):
1941 - 1950.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Li, S. Gourguechon, and C. C. Wang
Tousled-like kinase in a microbial eukaryote regulates spindle assembly and S-phase progression by interacting with Aurora kinase and chromatin assembly factors
J. Cell Sci.,
November 1, 2007;
120(21):
3883 - 3894.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Li and C. C. Wang
Changing Roles of Aurora-B Kinase in Two Life Cycle Stages of Trypanosoma brucei.
Eukaryot. Cell,
July 1, 2006;
5(7):
1026 - 1035.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Kumar and C. C. Wang
Depletion of Anaphase-promoting Complex or Cyclosome (APC/C) Subunit Homolog APC1 or CDC27 of Trypanosoma brucei Arrests the Procyclic Form in Metaphase but the Bloodstream Form in Anaphase
J. Biol. Chem.,
September 9, 2005;
280(36):
31783 - 31791.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Isono, N. Saito, N. Kamata, Y. Saeki, and A. Toh-e
Functional Analysis of Rpn6p, a Lid Component of the 26 S Proteasome, Using Temperature-sensitive rpn6 Mutants of the Yeast Saccharomyces cerevisiae
J. Biol. Chem.,
February 25, 2005;
280(8):
6537 - 6547.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Isono, Y. Saeki, H. Yokosawa, and A. Toh-e
Rpn7 Is Required for the Structural Integrity of the 26 S Proteasome of Saccharomyces cerevisiae
J. Biol. Chem.,
June 25, 2004;
279(26):
27168 - 27176.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Tu and C. C. Wang
The Involvement of Two cdc2-related Kinases (CRKs) in Trypanosoma brucei Cell Cycle Regulation and the Distinctive Stage-specific Phenotypes Caused by CRK3 Depletion
J. Biol. Chem.,
May 7, 2004;
279(19):
20519 - 20528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Lundgren, P. Masson, C. A. Realini, and P. Young
Use of RNA Interference and Complementation To Study the Function of the Drosophila and Human 26S Proteasome Subunit S13
Mol. Cell. Biol.,
August 1, 2003;
23(15):
5320 - 5330.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Li and C. C. Wang
A PHO80-like Cyclin and a B-type Cyclin Control the Cell Cycle of the Procyclic Form of Trypanosoma brucei
J. Biol. Chem.,
May 30, 2003;
278(23):
20652 - 20658.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kim, J.-W. Ahn, U.-H. Jin, D. Choi, K.-H. Paek, and H.-S. Pai
Activation of the Programmed Cell Death Pathway by Inhibition of Proteasome Function in Plants
J. Biol. Chem.,
May 23, 2003;
278(21):
19406 - 19415.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. C. Wang, Z. Bozdech, C.-l. Liu, A. Shipway, B. J. Backes, J. L. Harris, and M. Bogyo
Biochemical Analysis of the 20 S Proteasome of Trypanosoma brucei
J. Biol. Chem.,
April 25, 2003;
278(18):
15800 - 15808.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Smalle, J. Kurepa, P. Yang, T. J. Emborg, E. Babiychuk, S. Kushnir, and R. D. Vierstra
The Pleiotropic Role of the 26S Proteasome Subunit RPN10 in Arabidopsis Growth and Development Supports a Substrate-Specific Function in Abscisic Acid Signaling
PLANT CELL,
April 1, 2003;
15(4):
965 - 980.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|