![]()
|
|
||||||||
J. Biol. Chem., Vol. 277, Issue 45, 43474-43480, November 8, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, June 18, 2002, and in revised form, September 3, 2002
Human sperm, unlike the sperm of other mammals,
contain replacement histones with unknown biological functions. Here,
we report the identification of the novel human gene coding for a
testis/sperm-specific histone H2B (hTSH2B). This variant histone is
85% homologous to somatic H2B and has over 93% homology with the
testis H2B of rodents. Using genomic PCR, two genetic alleles of hTSH2B
were found in the human population. The hTSH2B gene is transcribed
exclusively in testis, and the corresponding protein is also present in
mature sperm. We expressed recombinant hTSH2B and identified this
protein with a particular H2B subtype expressed in vivo.
The subnuclear distribution of H2B variants in sperm was determined
using biochemical fractionation and immunoblotting. The H2B variant
associated with telomere-binding activity (15) was solubilized by
Triton X-100 or micrococcal nuclease extraction, whereas hTSH2B was
relatively tightly bound in nuclei. Immunofluorescence showed that
hTSH2B was concentrated in spots located at the basal nuclear area of a
subpopulation (20% of cells) of mature sperm. This fact may be of
particular importance, because the hTSH2B "positive" and "negative" sperm cells may undergo significantly different
decondensation processes following fertilization.
During mammalian spermatogenesis, chromatin undergoes
stage-specific structural reorganization. Testis-specific variants of histones, transitional proteins, and finally protamines replace somatic
histones as the DNA condenses (1, 2). The complement of spermatogenic
histones changes during differentiation, and this process has been
described in detail for rodents (1). Whereas some testis histones
(TH)1 appear in the early
stages of spermatogenesis for instance in spermatogonia (3) and some
appear at late stages (e.g. in spermatids (4, 5)), the
majority of TH are synthesized and incorporated into chromatin during
meiosis (6). Rodent testis histones are replacement subtypes that
differ in primary structure from the major somatic variants (3-5,
7-9). Although it is generally assumed that histone variants of germ
line cells contribute to the restructuring of chromatin during
spermatogenesis, their specific biological functions remain to be established.
In contrast to other mammals, mature human sperm retains a set of core
histones representing 10-15% of basic proteins (10-12). Of these,
histone H2B fraction (hSH2B) is the most abundant (10, 13). A complex
composition of the hSH2B has been indicated (12). Although 17 replication-dependent H2B genes have been identified so far
in the human genome (14), this complement contains neither testis- nor
sperm-specific genes. We were particularly interested in the
characterization of sperm H2B because of our recent finding that a
H2B-related protein is an essential part of the telomere-binding complex in human sperm (15).
In this paper, the hSH2B group has been characterized using a
combination of biochemical and immunochemical techniques. Further, a
gene for a novel human histone H2B variant belonging to this complement
has been identified on chromosome
6.2 Molecular cloning,
followed by in vitro expression, resulted in a recombinant
protein identical with one of the H2B variants isolated from mature
sperm. This protein is 85% homologous to a major somatic H2B subtype
and has over 93% homology with testis H2B of mouse and rat. We show
that this novel human H2B gene is expressed exclusively in testis, and
the protein is also found in sperm. Therefore, the protein is referred
as hTSH2B (human testis/sperm-specific H2B). Selective extraction and
immunochemical localization have revealed a specific distribution of
H2B variants in sperm nuclei. hTSH2B was found only in a subpopulation
of sperm cells, where it is located in chromatin domains in the basal
area of nuclei.
Sperm Preparation and Protein Isolation--
Sperm cells were
collected by centrifugation from bulk human semen obtained from healthy
fertile donors. Cells were washed with PBS and then in 0.25 M sucrose, 0.1 M NaCl, 2 mM EDTA,
10 mM Hepes, pH 7.5. Both buffers contained the protease
inhibitors phenylmethylsulfonyl fluoride and
1-chloro-3-tosylamido-7-amino-2-heptanone. Details of this procedure
were described earlier (16, 17).
The extraction of total basic proteins from crude nuclei with 0.5 N HCl was performed using the procedure described by
Rogakou (18). Before extraction, nuclei were incubated with 5%
To reveal the subnuclear distribution of H2B histones, a three-step
extraction procedure was used, as follows. First, nuclei were
homogenized in Triton extraction buffer (1% Triton X-100, 0.1 M NaCl, 10 mM DTT, 10 mM Hepes, pH
7.5). Protein extraction was continued for 1 h with constant
shaking. Triton-solubilized material was separated from nuclei by
centrifugation. Following Triton extraction, nuclei were washed with
0.1 M NaCl, 10 mM Hepes, pH 7.5, with nuclease
digestion buffer (10 mM Hepes-NaOH, pH 7.0, 1 mM CaCl2, 10 mM DTT) and then
resuspended in the latter buffer at a DNA concentration of 2 mg/ml.
Micrococcal nuclease (Roche Diagnostics) was added (2 units/1 unit
A260 of DNA), and digestion was performed for
2 h at 37 °C. Digestion was stopped by the addition of EDTA,
and the nuclease-solubilized material was separated from nuclei by
centrifugation. The pellet remaining after nuclease digestion was
salt-extracted in 0.6 M NaCl, 10 mM DTT, 10 mM Hepes, pH 7.5, overnight with constant shaking. Extracts
were clarified by centrifugation and stored at Purification of hTSH2B from Sperm Nuclei--
A 0.6 M NaCl nuclear extract obtained as described above was
fractionated on a reverse phase C4 HPLC column (Vydac) using a gradient
of 0-60% acetonitrile (0.1% trifluoroacetic acid) over 60 min at a
flow rate of 1 ml/min. Peak fractions were separated by SDS-PAGE and
analyzed by Western blotting.
Isolation of Genomic DNA--
Genomic DNA was isolated from
human sperm cells and purified as previously described (19).
Cloning and Bacterial Expression of Human hTSH2B--
hTSH2B was
PCR-amplified from sheared human genomic DNA using a "touchdown"
PCR method (20), ThermozymeTM DNA Polymerase (Invitrogen), and
the following primers (Invitrogen): 2B-5,
CATATGCCGGAGGTGTCATCTAAAGGTGCTA; 2B-3, GGATCCTTACTTGGAGCTGGTGTACTTAGTGACAGCCTT.
The annealing temperature was decreased incrementally from 70 to
62 °C over five cycles and then held at 56 °C for an additional 25 PCR cycles. The 393-bp TSH2B gene was ligated into pCR2.1 (TopoTMTA Cloning® kit; Invitrogen) and transformed into Top10
Escherichia coli (Invitrogen). Standard methods (21) were
used to subclone the NdeI/BamHI TSH2B coding
cassette from pCR2.1 into pET3a (Novagen). TSH2B-pET3a was confirmed by
DNA sequencing and transformed into BL21(DE3) pLysS for
isopropyl-1-thio- Analysis of Tissue Expression--
A panel of tissue-specific
human First-Strand cDNA (Multiple-ChoiceTM, Origene Technologies)
was screened by PCR using 5 ng of library DNA and the 2B-5 2B-3 primer
pair as described above. In addition, Titan reverse transcriptase-PCR
(Roche Diagnostics) was performed using 100-300 ng of human testis and
kidney mRNA (CLONTECH) according to the
instructions of the manufacturer.
Analysis of the Allelic Variability of the TSH2B Gene--
To
examine TSH2B allelic variability in the human population, the
following primers were used, which correspond to regions 100 bp
upstream and 100 bp downstream of the TSH2B gene coding sequence
(purchased from Invitrogen): hTSH2Bup, CGAGACTTGGAGCTGAGGTCATTTGGA; hTSH2Bdn, AACGAAGCCCACAGCTGTTTCAGTATG.
Genomic DNA was isolated from sperm of eight unrelated subjects. PCR
was conducted using the hTSH2Bup/dn primers and a "touchdown" thermal cycle program as described above. The PCR products from these
reactions were purified using QIAquick Spin columns (Qiagen) and
sequenced with the TH2Bup primer.
Gel Electrophoresis of Proteins--
Three electrophoretic
systems have been used to analyze sperm proteins: acetic acid/urea
(AU), acetic acid/urea/Triton (AUT), and SDS. AU PAGE was performed
using 15% polyacrylamide gel containing 2.5 M urea (23),
and the protein samples contained 8 M urea. For AUT
electrophoresis (24), the separation gel contained 15% acrylamide,
6.25 M urea and 5 mM Triton X-100 and was
polymerized using thiourea and hydrogen peroxide (23). SDS-PAGE was
essentially as described by Laemmli (25), but the concentration of
Tris, pH 8.9, in the separation gel was increased to 0.75 M. For two-dimensional separation, AU or AUT PAGE was used
for the first dimension, and the proteins were stained with Coomassie
Blue R250 (Sigma). Strips from stained AU or AUT gels were washed in
water for 30 min and then in 62 mM Tris, pH 6.8, 1% SDS,
5% Protein Digestion, Peptide Extraction, Sample Preparation, and
Mass Spectrometric Measurement--
Coomassie-stained gel slices were
destained with acetonitrile and 50 mM
NH4HCO3 at a 1:1 ratio and were then dried
using a speed vacuum centrifuge. Trypsin (Roche Diagnostics) was added in a final concentration of 10 µg/ml, and the mixture was incubated overnight at 37 °C. The gel slices were extracted with 50%
acetonitrile, 5% acetic acid for 45 min, and the supernatant was
collected and lyophilized. All gel extracts were resuspended in a 0.1%
trifluoroacetic acid solution and further desalted using C18 ZipTips
(Millipore Corp.). One microliter of desalted sample was mixed with 1 µl of a saturated solution (10 mg/ml) of R-cyano-4-hydroxycinnamic acid (Sigma), which was prepared by dissolving 10 mg in 1 ml of a 1:1
solution of acetonitrile and 0.1% trifluoroacetic acid. All mass
spectrometry experiments were carried out on a PE Voyager DE-STR
Biospectrometry work station equipped with an N2 laser (337 nm, 3-ns
pulse width, 20-Hz repetition rate) in both linear and reflectron modes
(PE Biosystems, Framingham, MA). The mass spectra of proteolytic
digests were acquired in the reflectron mode with delayed extraction
(DE). The m/z values of proteolytic peptides were
calibrated externally with Calmix 1 (PE Biosystems).
Immunoblotting--
Immunoblotting was performed using a semidry
system and 0.039 M glycine, 0.048 M Tris
0.0375% (w/v) SDS, 20% methanol as a transfer buffer at 0.8 mA/cm2 for 2.5 h. The efficiency of transfer to the
Immobilon P membrane (Millipore) was checked using Ponceau S staining.
The membrane was blocked overnight with 5% nonfat milk on PBST
(Sigma). Primary antibodies were used at 1:3000 dilution in 1% milk,
PBST, 350 mM NaCl. Secondary antibodies were used at 1:5000
dilution. Membranes were incubated with antibodies for 1 h and
washed in PBST three times for 10 min each. Rabbit polyclonal
antibodies raised against purified calf thymus H2B were a gift from Dr.
E. Bers (St. Petersburg University). Mouse monoclonal anti-tyrosine
hydroxylase antibodies (TyH) were from Roche Diagnostics. In most
experiments, anti-rabbit or anti-mouse antibodies conjugated with
horseradish peroxidase (Vector) were used as secondary antibodies, and
immunodetection was performed with an ECL kit (PerkinElmer Life
Sciences). In some experiments, the localization of the anti-H2B
reactive antigen was performed using ECL, and then the membrane was
washed in PBST, additionally blocked for 1 h, incubated with mouse
anti-TyH antibodies and horse anti-mouse antibodies conjugated
with alkaline phosphatase (Vector), and developed using a color reaction.
Immunofluorescence Localization--
For the immunofluorescence
localization of histones, PBS-washed sperm cells were fixed with 0.5%
formaldehyde in PBS for 5 min. The formaldehyde was washed off, and the
cells were resuspended in PBS. Sperm nuclei were decondensed using
DTT/heparin (17, 26). Cells were incubated for 30 min at room
temperature, loaded onto a microscope slide, allowed to sit for 30 min,
briefly washed with PBS, rinsed with water, and allowed to dry. Cells
were permeabilized in ice-cold methanol for 30 min and dried again.
Before the application of primary antibodies, cells were rehydrated in
blocking solution (3% bovine serum albumin, 0.1% Tween 20, 4× SSC)
for 30 min. Monoclonal antibodies against tyrosine hydroxylase (Roche
Molecular Biochemicals) and anti-mouse antibodies labeled with
fluorescein isothiocyanate (Vector) were used at a 1:50 dilution in 1%
bovine serum albumin, 0.1% Tween 20, 4× SSC. In some experiments,
rabbit anti-H2B and anti-rabbit-FITC were used. The incubation time
with antibodies was 45 min at 37 °C. Then the slides were washed at
appropriate times in three changes of 0.1% Tween 20, 4× SSC for 5 min
each. Nuclei were counterstained with propidium iodide and observed using a fluorescent microscope. Images were captured by photography and
scanned, and digital images were processed using Adobe Photoshop 6.0 software.
Gel Retardation Assay--
The assay was performed as described
previously (15, 26). Briefly, 0.5-1 ng of the labeled double-stranded
(TTAGGG)12 probe was incubated with sperm nuclear extract
(1-3 µg of total protein) in binding buffer (20 mM
HEPES, pH 7.9, 150 mM KCl, 1 mM
MgCl2, 0.1 mM EDTA, 1 mM DTT, 0.1 mg/ml bovine serum albumin, 5% glycerol, 100-200 ng of denatured
HaeIII digest of E. coli DNA). In this work, we
used extracts obtained with 1% Triton X-100, 100 mM NaCl,
which contain telomere-binding activity (15). In some experiments, 1 µl of antibodies was added to the binding mixture. After incubation
for 30 min at room temperature, the probes were loaded on a 6%
polyacrylamide gel prepared in 0.5× TGE buffer (50 mM Tris
base, 50 mM glycine, 2 mM EDTA). After electrophoresis, gels were dried and visualized by autoradiography.
Complement of H2B Histones in Human Sperm--
Total basic nuclear
proteins were extracted with 0.5 N HCl and separated by
two-dimensional PAGE (Fig.
1A). For better resolution of
histones, we used AUT gel in the first dimension and SDS-PAGE in
the second. Proteins separated by two-dimensional PAGE were immunoblotted with polyclonal antibodies to histone H2B (Fig. 1B). Several protein spots reacted with anti-H2B antibodies.
Taking into account low cross-reactivity with other proteins including histone fractions in a control sample of total HeLa nuclear proteins, we suggest that all of these polypeptides are H2B-related. The electrophoretic mobilities of some of these fractions on SDS gel are
close to that of somatic H2B, whereas others migrate more slowly,
suggesting higher apparent molecular weights of sperm H2Bs (Fig.
1B). Thus, there are several unidentified proteins in human
sperm that have common epitopes with somatic histone H2B. In this work,
we identified, cloned, and characterized one protein from this
complement.
Identification of the Novel Human Histone H2B Gene--
It was
observed (8, 27) that a monoclonal antibody against rat tyrosine
hydroxylase (TyH) recognized an epitope within the rat and mouse
testis-specific H2B (TH2B). This epitope is the peptide KGF, shared by
TyH and rodent TH2Bs and localized in the N terminus of TH2B (Fig.
2B). Recently, Van Roijen
et al. (28) showed that anti-TyH also cross-reacted with a
17-kDa protein from human testis and sperm, but this histone was not
characterized and its molecular identity remained unknown.
Following up on these reports we searched for a protein homologous to
rodent TH2B in the human genome. A BLAST search with the mouse
nucleotide sequence corresponding to the TyH reactive peptide revealed
a cDNA clone originating from a human testis library. In turn, this
cDNA highlighted a genomic sequence on chromosome 6 as a top-ranked
match. The complete coding sequence of this gene have been
deposited into GenBankTM (accession number AF397301). We
have demonstrated (see below) that this gene is specifically expressed
in testis and that the corresponding protein is present in mature human
sperm cells. Therefore, the protein is referred to as hTSH2B (human
testis/sperm-specific H2B). Sequence alignment of hTSH2B with the human
somatic H2B.1 revealed 85% identity with the highest conservation
observed at the C-terminal region of the protein (Fig. 2A).
Within the first 25 N-terminal amino acids, 10 substitutions (40%) are
found between the somatic and germ line proteins. Nine more
substitutions are spread all over the central portion of the protein
sequence. Human TSH2B shares a more extensive homology with testis H2B
from both mouse (95%) and rat (93%) (Fig. 2A). All testis
histones have phenylalanine in position 16 (Fig. 2B), which
is likely to be crucial for recognition by the monoclonal anti-TyH
antibodies. Importantly, amino acid sequence motifs in hTSH2B compared
with somatic H2B provide six new potential sites for phosphorylation and a myristoylation site (Fig. 2C).
Tissue-specific Expression of the hTSH2B Gene--
To determine
the expression profile of the novel H2B gene, we looked for the
presence of its messenger RNA in different human tissues. This was done
by PCR using commercially available first-strand cDNA libraries
from different human tissues (intestine, prostate, lung, ovary, muscle,
and testis) and by reverse transcriptase-PCR using mRNA from kidney
and testis. Fig. 3 shows that TSH2B is expressed exclusively in testis, a tissue enriched with spermatogenic cells.
Allelic Variability of the hTSH2B Gene--
The coding sequence of
human TSH2B was PCR-amplified from genomic DNA, cloned, and sequenced.
It matched with a sequence in chromosome 6 identified above. In
addition, a larger sequence (coding sequence plus 100 adjacent base
pairs from 3'- and 5'-flanking regions of the hTSH2B gene) was
PCR-amplified from genomic DNAs isolated from nine individuals and then
sequenced. Genomic sequences isolated from four individuals (including
the originally isolated clone) were identical. hTSH2B genes from five
other individuals were identical among themselves but differed from the
first group in three nucleotide substitutions within the coding region.
All three single-nucleotide substitutions were silent and located in
the last nucleotide of codons for Ile43, Ser66,
and Lys127. Thus, the hTSH2B gene has allelic variants in
the human population, but these single nucleotide polymorphisms do not
change the protein sequence.
In Vitro Expression of the hTSH2B Protein and Comparison with the
H2B of Sperm--
To further characterize hTSH2B and identify this
protein as a histone occurring in human sperm nuclei, we expressed this
protein in E. coli. A two-step purification procedure
results in the isolation of a single recombinant polypeptide (R-hTSH2B)
with mobility close to the HeLa H2B histone as judged by SDS-PAGE (Fig.
3A).
It was demonstrated above (Fig. 1B) that several H2B-related
proteins are present in mature human sperm. To identify the hTSH2B expressed in vivo, we utilized its specific reactivity with
anti-TyH antibodies. Preliminary experiments established the position
of the anti-TyH-reacting H2B in a two-dimensional gel (shown by
arrows in Fig. 1B) and indicated that this H2B
variant is enriched in 0.6 M NaCl sperm nuclear extract
(data not shown). Therefore, the 0.6 M NaCl extract was
used as the starting material for hTSH2B purification. Proteins were
separated using reverse-phase HPLC and analyzed by SDS-PAGE and Western
blotting with anti-TyH antibodies (Fig. 3B). A protein
reacting with the anti-TyH antibodies was detected in a fraction eluted
with 47% acetonitrile (Fig. 3B, inset).
Reprobing of the membrane with anti-H2B antibodies identified the same
band. The polypeptide composition of partially purified hTSH2B
(HPLC fraction 47; Fig. 3B) is shown in Fig. 5A,
right lane.
Both in vitro expressed R-hTSH2B and partially purified
hTSH2B were separated using two-dimensional PAGE (Fig.
4). AU PAGE was used as the first
dimension (Fig. 4A). The areas of AU gel corresponding to
the core histones were cut out and subjected to SDS-PAGE in the second
dimension. The second dimension gel was immunoblotted using anti-H2B
and anti-TyH antibodies (Fig. 4B). Antibodies against H2B
(Fig. 4B, top panels) recognize the somatic H2B of HeLa cells and both recombinant TSH2B and hTSH2B purified from sperm. Antibodies against tyrosine hydroxylase recognize only the two latter proteins (Fig. 4B, bottom
panels). Since these proteins react with both antibodies,
they belong to the H2B group and also have the unique anti-TyH epitope
as expected from the sequence data (Fig. 2).
The protein spots corresponding to R-hTSH2B, native hTSH2B, and HeLa
H2B were cut from a stained two-dimensional gel proteolyzed and
subjected to mass spectrometric analysis (see "Experimental Procedures" for details). Data analysis of the masses from the tryptic peptides was performed using Protein Prospector software (University of California, San Francisco). Five peptides with m/z values corresponding to the theoretically
predicted peptides containing the unique N-terminal hTSH2B sequence
(Fig. 2A) and six peptides within amino acids 30-50 were
found to be identical between the R-hTSH2B and native hTSH2B. An
additional 15 peptides corresponding to the central and C-terminal
regions of H2B shared by all three proteins were also identified.
Therefore, the in vitro expressed R-hTSH2B matches with one
of the H2B variants present in mature spermatozoa of humans (hTSH2B,
shown in Figs. 1B and 5).
Interestingly, sperm hTSH2B is represented by two closely migrating
polypeptides (Figs. 1B and 4B). At the present
time, we do not know whether they result from sequence
variants, different post-translational modifications, or partial degradation.
Subnuclear Distribution of hTSH2B--
The association of TSH2B
with a particular chromatin domain may be indicative of its function.
We were interested in whether hTSH2B is identical with the histone H2B
variant previously described by us as a part of the telomere-binding
complex in human sperm (15). Therefore, we followed the fractionation
scheme used for the identification of telomere proteins (15, 26) and
assayed the extracts for the presence of hTSH2B.
First, membrane-associated proteins were extracted with 1% Triton
X-100, 100 mM NaCl (hS-Triton), and then nuclei were
digested with micrococcal nuclease (hS-nuclease) and the remaining
nuclear material was extracted with 0.6 M NaCl (hS-NaCl).
Proteins fractionated in this way were separated by SDS-PAGE and
immunoblotted using anti-H2B and anti-TyH antibodies (Fig.
5A). hTSH2B (the only sperm H2b variant reacting with anti-TyH) was not found either in the hS-Triton or hS-nuclease fractions, but it was present in 0.6 M NaCl fraction. Therefore, the hTSH2B is relatively
tightly bound to sperm chromatin. Treatments with detergent and/or
nuclease (the latter solubilize about 20% of total DNA) extract an
H2B-related protein of higher molecular weight than hTSH2B, most
probably the telomere-associated histone H2B variant suggested in our
earlier work (15). Molecular characterization of this protein is in progress.
To further verify that hTSH2B is not involved in the formation of the
sperm telomere-binding complex, we used a sensitive gel retardation
assay (Fig. 5B). Double-stranded TTAGGG telomere DNA was
incubated with proteins extracted from human sperm by Triton X-100. The
telomere-binding complex (15) was visualized in native electrophoresis
(Fig. 5B). Fig. 6B
demonstrates that the presence of polyclonal anti-H2B antibodies in
binding reaction inhibits the formation of the complex between telomere
DNA and sperm proteins (15). In contrast, anti-TyH antibodies do not influence the formation of the telomere-binding complex and its mobility (Fig. 5B). Therefore, hTSH2B is not a part of this
complex.
Immunolocalization of hTSH2B in Mature Sperm Cells--
In human
sperm cells, core histone H4 is evenly distributed throughout nuclei
(15). In contrast, polyclonal anti-H2B antibodies reveal a punctate
localization that in some cells overlaps with a smeared staining of
nuclei (15) (Fig. 6A). Some of the H2B loci colocate with
the positions of telomere sequences revealed by fluorescence in
situ hybridization (15). From the results presented above
(Fig. 1B), it is clear that anti-H2B recognizes several
distinct H2B-related polypeptides in human sperm. Therefore, Fig.
6A represents the superposition of several patterns of
localization. Anti-TyH antibodies are monospecific for the hTSH2B
variant (28) (see above). Thus, they are suitable for the selective
localization of this protein. Fig. 6, B-D gives an
example of the localization of hTSH2B in the mature sperm cells of a
fertile donor. Interestingly, not all of the sperm cells are positive
for the presence of hTSH2B. This surprising fact was first observed by
Van Roijen et al. (28). hTSH2B-negative cells are not the
result of poor antibody penetration due to variations in nuclear
compactness. Indeed, in samples where the in vitro performed
decondensation of nuclei was more extensive (Fig. 6, C and
D), the coexistence of the hTSH2B-positive and -negative
cells is even more evident. Importantly, cells of both types have
identical, normal cellular and nuclear morphology. Anti-TyH antibodies
preferentially illuminate the basal part of nuclei adjacent to the
sperm tail attachment point (Fig. 6C), leaving the apical
area on the nucleus free of hTSH2B. In some cells, with an apparently
lower concentration of protein, the localization of hTSH2B in small
spots is visible (Fig. 6D). Therefore, it may be suggested
that hTSH2B is associated with specific chromatin domains.
Histone H2B Variants in Mammalian Male Germ Line Cells--
We
have identified and described a novel member of the human histone gene
family, hTSH2B, a variant that is specific to testis and sperm cells.
The hTSH2B gene is a unique gene located on chromosome 6, which also
contains the major human histone gene cluster (6). This hTSH2B is the
first protein from the spectrum of residual histones present in the
mature sperm of humans (10-12) to be characterized. Protein sequence
comparison reveals a strong (95%) homology of hTSH2B with
testis-specific H2B from rat (30) and mouse (9); the most significant
difference is the absence of Cys at position 34 of the human protein.
There is a weaker homology with somatic histone H2B (85%). This may
indicate an early divergence and independent evolution of germ
line-specific and somatic H2B in mammals. Remarkably, an early
biochemical study of a crude H2B isolated from liver and germ line
cells of human and rat came to a similar conclusion (13). The most
pronounced differences between somatic and spermatogenic cell-specific
H2Bs are found in their N-terminal regions (Fig. 2A). This
domain on the outside of the histone octamer is involved in
interactions with DNA and is important for the mitotic
condensation of chromosomes (31). It remains to be seen how this
difference in N-terminal sequence influences chromatin packaging.
The N-terminal segment of hTSH2B is unique for the presence of two
potential phosphorylation sites (Ser5 and Ser6)
and the GATIS sequence that is a possible site for internal myristoylation. Four additional sites of potential phosphorylation that
are specific to hTSH2B are located in the central and C-terminal regions (Fig. 2C). Most of the phosphorylation sites unique
for the hTSH2B are substrates for protein kinase C. It would be
interesting to know whether hTSH2B can be phosphorylated by Aurora
kinases (32), especially by the testis-specific Aurora C kinase
(33).
Humans are unique among studied mammals in that the replacement of
histones by protamines during spermatogenesis is not complete. As a
result, about 10-15% of the basic proteins in mature sperm are
histones (11, 12). Among these are histones belonging to the H2B family
(10). Based on patterns of electrophoretic separation and amino acid
analysis of partially purified proteins, Gatewood et al.
(12) suggested the presence of several H2B subfractions. However, sperm
H2B may be confused with other basic proteins that overlap with
histones in different gel systems, for example centromeric protein
CENP-A and/or protein SP-19 (16, 17).
Here, by using polyclonal antibodies specific to H2B (Fig.
1B), we have shown the presence of several distinct
H2B-related polypeptides in mature human sperm. One of the H2B variants
(hTSH2B) was identified and characterized. We have shown earlier (15) that an H2B-related protein is part of the telomere-binding complex in
human sperm. The data presented here demonstrate that the
telomere-associated H2B of human sperm is distinct from hTSH2B. Yet
another spermatid-specific variant of histone H2B was described in
rodent testis (4, 5), which has a 12-amino acid addition at the C
terminus. However, antibodies raised against this specific peptide (4)
do not recognize any proteins in a Western blot of total human sperm proteins (data not shown). In addition, a homologous gene for this
protein in humans was not found in GenBankTM.
Expression and Variability of the hTSH2B Gene--
Using reverse
transcriptase-PCR, we were able to study the profile of hTSH2B gene
expression in seven human tissues (Fig. 2D). Obvious
expression has been registered only in testis. The modes of expression
and regulation of a homologous H2B gene were studied in detail in
rodents (7, 30, 34-37). In mature animals, TH2B mRNA first
accumulated in B spermatogonia (37). The unique affinity of
testis-specific H2Bs to anti-TyH antibodies (determined by
Phe16; Fig. 1B) allowed a study of protein
expression during spermatogenesis using immunohistochemistry (8, 28).
In rat, deposition of this protein on chromatin was found in early
primary spermatocytes, but protein staining disappeared in round
spermatids (8). In humans, this histone is present throughout
spermatogenesis, from spermatogonia (28) to mature sperm (Ref. 28 and
this work).
Using genomic PCR, we found single nucleotide polymorphisms in the
hTSH2B gene in codons for Ile43, Ser66, and
Lys127, indicating the existence of two genetic alleles of
hTSH2B in the human population. These nucleotide substitutions were
silent and did not change the primary structure of the protein. To our knowledge, this is the first single nucleotide polymorphism identified in histone genes.
Subnuclear Distribution of Histones in Human Sperm--
The
residual histones in human sperm seem to be unevenly distributed in the
nuclei, and different variants are associated with distinct chromatin
domains, which was supported by both biochemical and indirect
immunofluorescence data.
Some of the human sperm core histones are weakly bound and may be
solubilized by extraction with low salt buffers starting at 0.1 M NaCl (38). In this respect, they are different from the
histones of somatic cells, which require much higher salt concentrations for extraction. For example, an as yet uncharacterized variant of human sperm H2B is extracted by 1% Triton X-100, 0.1 M NaCl (Ref. 15 and Fig. 5A), partially
co-localizes with telomere DNA, and participates in the
telomere-binding complex (15). However, it is not known whether this
H2B variant is associated with other histone fractions and whether it
is incorporated into nucleosomes. Nonnucleosomal histone variants have
been recently demonstrated such as an acrosome-associated H2B in bull
sperm (39) and H1.X that is a component of cytoplasmic filaments in Caenorhabditis elegans (40).
Our earlier data proved that part of the telomere chromosomal domain in
human sperm preserved nucleosomal organization and that the full
complement of four core histones was present in telomere nucleosomes
(29). The molecular identities of these histone variants remain to be established.
The histone hTSH2B identified in this work is comparatively tightly
bound to chromatin and is extracted only by buffers containing
Finally, after successive extractions of human sperm nuclei with
detergent, nuclease, and 0.6 M NaCl, some core histones
still remain associated with DNA (data not shown). It is possible that some of these may be associated with nucleosomes in the centromeric domains of chromosomes that are buried deep inside the nucleus (41).
Indeed, CENP-A is a variant of histone H3 that is incorporated in
centromeric nucleosomes (42, 43) and is retained in human sperm
(17).
Perspectives--
hTSH2B was shown to be present in about 20% of
mature spermatozoa, whereas 80% of cells do not have this protein
(Ref. 28 and data in Fig. 6). This fact may be of particular
importance; if both types of sperm cells participate in fertilization,
modes of chromatin decondensation and genome unpacking of the hTSH2B "positive" and "negative" cells could be significantly different.
Despite a long history of studies concerning histone variants
associated with male germ line cells in mammals, their functions remain
largely unknown. The temporal character of the synthesis and
accumulation of these replacement variants in chromatin indicates that
some might participate in meiosis, some in chromatin remodeling during
the histone-protamine transition in spermiogenesis and some in specific
structural organization of the genome required for fertilization. In
humans, conclusive experiments are hindered by the limitation of
in vivo approaches and by the minute amounts of starting
material for biochemical studies. It was expected that significant
progress could be achieved using gene knockouts in model animals.
Still, recent data showed that in mice with disrupted testis-specific
H1 gene, spermatogenesis proceeds normally, the mice are fertile
and do not show abnormalities until adulthood (44-46). However, the
knockout of the replacement histone H2A.X results, among other
phenotypes, in the development of infertile male mice (47).
In this work, the first member of the human spermatogenic cell-specific
histone family was cloned, expressed, and characterized using a
combination of genomic and biochemical techniques. Applying similar
approaches for the molecular description of the full histone complement
in human sperm should be possible and is an important step for
understanding their function in vivo.
*
This work was supported in part by National Institutes of
Health Grant HD39830 (to A. O. Z.) and by Department of Energy Grant FG 0301ER 63070 (to E. M. B.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed: Dept. of Biological
Chemistry, School of Medicine, University of California, Davis, CA
95616. Tel.: 530-752-3314; Fax: 530-752-3516; E-mail: aozalensky@ucdavis.edu.
Published, JBC Papers in Press, September 3, 2002, DOI 10.1074/jbc.M206065200
2
GenBankTM accession number
AF397301.
The abbreviations used are:
TH, testis histone(s);
hTSH2B, human testis/sperm-specific H2B;
R-hTSH2B, recombinant hTSH2B;
hSH2B, human sperm H2B;
TyH, tyrosine hydroxylase;
AU, acetic acid/urea;
AUT, acetic acid/urea/Triton;
hS-Triton
(hS-nuclease, hS-NaCl), human sperm proteins extracted with
Triton X-100 (micrococcal nuclease, 0.6 M NaCl);
DTT, dithiothreitol;
HPLC, high pressure liquid chromatography.
Human Testis/Sperm-specific Histone H2B (hTSH2B)
MOLECULAR CLONING AND CHARACTERIZATION*
§,
,
,
,
¶,
, and
Department of Biological Chemistry, School
of Medicine, University of California Davis, Davis, California
95616, ¶ Institute of Cytology, Russian Academy of Sciences, St.
Petersburg 194064, Russia, and
Biosciences Division, Los
Alamos National Laboratory, Los Alamos, New Mexico 87545
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-mercaptoethanol to disrupt the disulfide network formed by protamines.
80 °C. All
extraction buffers contained EDTA-free protease inhibitor mixture
(Roche Diagnostics).
-D-galactopyranoside-inducible protein
expression (Novagen). A 50-ml overnight culture was used to inoculate 2 liters of 2× YT medium supplemented with ampicillin (100 µg/ml) and
chloramphenicol (35 µg/ml). The culture was grown to an optical
density of 0.5 (measured at 600 nm), induced with 230 mM
isopropyl-1-thio-
-D-galactopyranoside for 3 h, and
harvested by centrifugation. The bacterial pellet was resuspended in 50 ml of 50 mM Tris, pH 7.5, 100 mM NaCl, 1 mM EDTA, 1 mM benzamidine, and 1 mM
-mercaptoethanol, freeze-thawed, and homogenized. TSH2B inclusion
bodies were isolated from the bacterial lysate and dissolved in
unfolding buffer (7 M guanidinium hydrochloride, 20 mM Tris, pH 7.5, 10 mM
-mercaptoethanol) (7 ml/liter of processed cells) according to a published method (22). The
dissolved crude protein was filtered and loaded onto a Superose 12 (Amersham Biosciences) fast protein liquid chromatography column
(2.5 × 100 cm) in a running buffer of 7 M urea, 1.2 M NaCl, 20 mM sodium acetate, pH 5.2, 5 mM
-mercaptoethanol, 1 mM EDTA. Peak
fractions were examined by SDS-PAGE, and the TSH2B fractions were
combined, dialyzed against distilled water and lyophilized. The
protein was then further purified by reverse phase HPLC as described
above, but using a 30-60% gradient of acetonitrile over 60 min. Peak
fractions were analyzed by SDS-PAGE, and pure hTSH2B fractions were
combined and lyophilized.
-mercaptoethanol for 60 min before application to the second
dimension SDS gel.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

View larger version (10K):
[in a new window]
Fig. 1.
Complement of H2B related polypeptides in
human sperm. A, proteins extracted from human sperm
cells with 0.5 N HCl and separated using two-dimensional
AUT/SDS-PAGE, Coomassie staining. B, parallel
two-dimensional gel immunoblotted with polyclonal anti-H2B antibodies.
Several H2B-related proteins were revealed. The arrows show
the position of hTSH2B, which was established by reprobing of the blot
with anti-TyH antibodies.

View larger version (26K):
[in a new window]
Fig. 2.
Characteristics of the hTSH2B sequence and
tissue-specific expression of hTSH2B gene. A, alignment
of the protein sequence translated from the novel human H2B gene
(hTSH2B) with sequences of human somatic hH2B.1 and
testis-specific H2B variants of mouse (mTH2B) and rat
(rTH2B). Changeable amino acids are shown in red.
B, comparison of homologous peptides from histones H2B and
tyrosine hydroxylase (TyH) that are responsible for recognition by
anti-TyH antibodies. The substitution of Phe by Ser in somatic H2B
completely eliminates anti-TyH epitope. C, new sites of
potential phosphorylation (P) and myristoylation
(MYR) that are specific to hTSH2B in comparison with somatic
H2B.1. D, PCR products obtained using hTSH2B-specific
primers and cDNA of different human tissues. Testis-specific hTSH2B
expression (right lane) produces a 390-bp DNA
that is identical in mobility with the PCR product amplified from
genomic DNA control.

View larger version (15K):
[in a new window]
Fig. 3.
Purification of recombinant and native
hTSH2B. A, R-hTSH2B was expressed in E. coli
and purified using gel filtration followed by reverse phase HPLC (see
"Experimental Procedures" for details). SDS-PAGE separation,
Coomassie staining is shown as follows: from left to
right, HeLa histones, crude E. coli extract, and
purified R-hTSH2B. B, purification of native hTSH2B from the
0.6 M NaCl extract of human sperm nuclei. Proteins were
separated using reverse phase HPLC, and fractions were analyzed by
SDS-PAGE followed by Western blotting with anti-TyH antibodies (shown
in the inset), which selectively recognize TSH2B. The hTSH2B
enriched fraction (shown by an arrow) eluted at 47%
acetonitrile.

View larger version (18K):
[in a new window]
Fig. 4.
Comparison of recombinant and native
hTSH2B. A, separation of recombinant and native (HPLC
fraction 47, Fig. 3B) hTSH2B using AU PAGE, Coomassie
staining. The parts of the gel applied to the second dimension
(B) are indicated by dotted
rectangles. B, immunoblotting of proteins
separated in two-dimensional PAGE. Proteins were visualized using
anti-H2B antibodies (upper panels), and then the
same blots were reprobed with anti-TyH antibodies (bottom
panels).

View larger version (20K):
[in a new window]
Fig. 5.
Distribution of H2B variants in human sperm
nuclei. A, Western blotting of proteins separated in
SDS-PAGE using anti-H2B and anti-TyH antibodies. Human sperm cells were
successively extracted with Triton-X100 (hS-Triton), micrococcal
nuclease (hS-nuclease), and 0.6 M NaCl (hS-NaCl). Only
portions where H2B signals were located are shown (12-17-kDa molecular
mass range). B, gel retardation assay using telomere DNA as
a substrate and human sperm extract (hS-Triton) enriched in
telomere-binding activity (15). Anti-H2B and anti-TyH antibodies were
added to binding reactions where indicated.

View larger version (22K):
[in a new window]
Fig. 6.
Nuclear localization of H2B variants in human
sperm. Indirect immunofluorescence using polyclonal anti-H2B
(A) and monoclonal anti-TyH (B-D) antibodies is
shown. Cells were decondensed using 10 mM DTT
(B) or 10 mM DTT plus 0.03 mg/ml heparin
(A, C, and D).
Yellow/green, protein signals; red,
total DNA. Bar, 5 µm. A, polyclonal antibodies
reveal a complex localization resulting from overlapping patterns of
different H2B variants. B-D, antibodies specific to the
hTSH2B variant show its localization in the basal nuclear area of
selected sperm cells.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
0.6
M NaCl (Fig. 5). Monoclonal anti-TyH antibodies that are specific to the hTSH2B variant showed the localization of this protein
in spots concentrated in the basal area of sperm nuclei (Fig. 6,
C and D). A basal localization of the same
antigen was demonstrated earlier (28). It is noteworthy that in human
sperm the localization of hTSH2B is different from the even
distribution of both protamines (17) and histone H4 (15), from the
punctate localization of the H2B variant associated with telomeres
(15), and from the localization of CENP-A (H3 variant) in dimers and linear arrays (17).
![]()
FOOTNOTES
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Meistrich, M.
(1989)
in
Histones and Other Basic Nuclear Proteins
(Hnilica, L. S.
, Stein, G. S.
, and Stein, J. L., eds)
, pp. 165-182, CRC Press, Inc., Boca Raton, FL
2.
Wouters-Tyrou, D.,
Martinage, A.,
Chevaillier, P.,
and Sautiere, P.
(1998)
Biochimie
80,
117-128[Medline]
[Order article via Infotrieve]
3.
Meistrich, M. L.,
Bucci, L. R.,
Trostle-Weige, P. K.,
and Brock, W. A.
(1985)
Dev. Biol.
112,
230-240[CrossRef][Medline]
[Order article via Infotrieve]
4.
Moss, S. B.,
Challoner, P. B.,
and Groudine, M.
(1989)
Dev. Biol.
133,
83-92[CrossRef][Medline]
[Order article via Infotrieve]
5.
Unni, E.,
Zhang, Y.,
Kangasniemi, M.,
Saperstein, W.,
Moss, S. B.,
and Meistrich, M. L.
(1995)
Biol. Reprod.
53,
820-826[Abstract]
6.
Doenecke, D.,
Albig, W.,
Bode, C.,
Drabent, B.,
Franke, K.,
Gavenis, K.,
and Witt, O.
(1997)
Histochem Cell Biol.
107,
1-10[CrossRef][Medline]
[Order article via Infotrieve]
7.
Kim, Y. J.,
Hwang, I.,
Tres, L. L.,
Kierszenbaum, A. L.,
and Chae, C. B.
(1987)
Dev. Biol.
124,
23-34[CrossRef][Medline]
[Order article via Infotrieve]
8.
Unni, E.,
Mayerhofer, A.,
Zhang, Y.,
Bhatnagar, Y. M.,
Russell, L. D.,
and Meistrich, M. L.
(1995)
Mol. Reprod. Dev.
42,
210-219[CrossRef][Medline]
[Order article via Infotrieve]
9.
Choi, Y. C., Gu, W.,
Hecht, N. B.,
Feinberg, A. P.,
and Chae, C. B.
(1996)
DNA Cell Biol.
15,
495-504[Medline]
[Order article via Infotrieve]
10.
Tanphaichitr, N.,
Sobhon, P.,
Taluppeth, N.,
and Chalermisarachai, P.
(1978)
Exp. Cell Res.
117,
347-356[CrossRef][Medline]
[Order article via Infotrieve]
11.
Gusse, M.,
Sautiere, P.,
Belaiche, D.,
Martinage, A.,
Roux, C.,
Dadoune, J. P.,
and Chevaillier, P.
(1986)
Biochim. Biophys. Acta
884,
124-134[Medline]
[Order article via Infotrieve]
12.
Gatewood, J. M.,
Cook, G. R.,
Balhorn, R.,
Schmid, C. W.,
and Bradbury, E. M.
(1990)
J. Biol. Chem.
265,
20662-20666 13.
Wattanaseree, J.,
and Svasti, J.
(1983)
Arch. Biochem. Biophys.
225,
892-897[CrossRef][Medline]
[Order article via Infotrieve]
14.
Albig, W.,
Trappe, R.,
Kardalinou, E.,
Eick, S.,
and Doenecke, D.
(1999)
Biol. Chem.
380,
7-18[CrossRef][Medline]
[Order article via Infotrieve]
15.
Gineitis, A. A.,
Zalenskaya, I. A.,
Yau, P. M.,
Bradbury, E. M.,
and Zalensky, A. O.
(2000)
J. Cell Biol.
151,
1591-1598 16.
Zalensky, A. O.,
Yau, P.,
Breneman, J. W.,
and Bradbury, E. M.
(1993)
Mol. Reprod. Dev.
36,
164-173[CrossRef][Medline]
[Order article via Infotrieve]
17.
Zalensky, A. O.,
Breneman, J. W.,
Zalenskaya, I. A.,
Brinkley, B. R.,
and Bradbury, E. M.
(1993)
Chromosoma
102,
509-518[CrossRef][Medline]
[Order article via Infotrieve]
18.
Rogakou, E. P.,
Redon, C.,
Boon, C.,
Johnson, K.,
and Bonner, W. M.
(2000)
BioTechniques
28,
38-40[Medline]
[Order article via Infotrieve]
19.
Kozik, A.,
Bradbury, E. M.,
and Zalensky, A. O.
(1998)
Mol. Reprod. Dev.
51,
98-104[CrossRef][Medline]
[Order article via Infotrieve]
20.
Roux, K. H.,
and Hecker, K. H.
(1997)
Methods Mol. Biol.
67,
39-45[Medline]
[Order article via Infotrieve]
21.
Ausubel, F.,
Brent, R.,
Kingston, R. E.,
Moore, D. D.,
Seidman, J. G.,
Smith, J. A.,
and Strahl, K.
(1989)
Current Protocols in Molecular Biology
, John Wiley and Sons, Inc., New York
22.
Luger, K.,
Rechsteiner, T. J.,
and Richmond, T. J.
(1999)
Methods Enzymol.
304,
3-19[Medline]
[Order article via Infotrieve]
23.
Hurley, C. K.
(1977)
Anal. Biochem.
80,
624-626[CrossRef][Medline]
[Order article via Infotrieve]
24.
Zweidler, A.
(1978)
Methods Cell Biol.
17,
223-233[Medline]
[Order article via Infotrieve]
25.
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
26.
Zalensky, A. O.,
Tomilin, N. V.,
Zalenskaya, I. A.,
Teplitz, R. L.,
and Bradbury, E. M.
(1997)
Exp. Cell Res.
232,
29-41[CrossRef][Medline]
[Order article via Infotrieve]
27.
Mayerhofer, A.,
and Russell, L. D.
(1990)
J. Cell Biol.
110,
81B
28.
van Roijen, H. J.,
Ooms, M. P.,
Spaargaren, M. C.,
Baarends, W. M.,
Weber, R. F.,
Grootegoed, J. A.,
and Vreeburg, J. T.
(1998)
Hum. Reprod.
13,
1559-1566 29.
Zalenskaya, I. A.,
Bradbury, E. M.,
and Zalensky, A. O.
(2000)
Biochem. Biophys. Res. Commun.
279,
213-218[CrossRef][Medline]
[Order article via Infotrieve]
30.
Hwang, I.,
and Chae, C. B.
(1989)
Mol. Cell. Biol.
9,
1005-1013 31.
de la Barre, A. E.,
Angelov, D.,
Molla, A.,
and Dimitrov, S.
(2001)
EMBO J.
20,
6383-6393[CrossRef][Medline]
[Order article via Infotrieve]
32.
Nigg, E. A.
(2001)
Nat. Rev. Mol. Cell. Biol.
2,
21-32[CrossRef][Medline]
[Order article via Infotrieve]
33.
Tseng, T. C.,
Chen, S. H.,
Hsu, Y. P.,
and Tang, T. K.
(1998)
DNA Cell Biol.
17,
823-833[Medline]
[Order article via Infotrieve]
34.
Choi, Y. C.,
and Chae, C. B.
(1991)
J. Biol. Chem.
266,
20504-20511 35.
Huh, N. E.,
Hwang, I. W.,
Lim, K.,
You, K. H.,
and Chae, C. B.
(1991)
Nucleic Acids Res.
19,
93-98 36.
Lim, K.,
and Chae, C. B.
(1992)
J. Biol. Chem.
267,
15271-15273 37.
Marret, C.,
Avallet, O.,
Perrard-Sapori, M. H.,
and Durand, P.
(1998)
Mol. Reprod. Dev.
51,
22-35[CrossRef][Medline]
[Order article via Infotrieve]
38.
Gatewood, J. M.,
Cook, G. R.,
Balhorn, R.,
Bradbury, E. M.,
and Schmid, C. W.
(1987)
Science
236,
962-964 39.
Aul, R. B.,
and Oko, R. J.
(2002)
Dev. Biol.
242,
376-387[CrossRef][Medline]
[Order article via Infotrieve]
40.
Jedrusik, M. A.,
Vogt, S.,
Claus, P.,
and Schulze, E.
(2002)
J. Cell Sci.
115,
2881-2891 41.
Zalensky, A. O.,
Allen, M. J.,
Kobayashi, A.,
Zalenskaya, I. A.,
Balhorn, R.,
and Bradbury, E. M.
(1995)
Chromosoma
103,
577-590[Medline]
[Order article via Infotrieve]
42.
Palmer, D. K.,
O'Day, K.,
Wener, M. H.,
Andrews, B. S.,
and Margolis, R. L.
(1987)
J. Cell Biol.
104,
805-815 43.
Yoda, K.,
Ando, S.,
Morishita, S.,
Houmura, K.,
Hashimoto, K.,
Takeyasu, K.,
and Okazaki, T.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
7266-7271 44.
Lin, Q.,
Sirotkin, A.,
and Skoultchi, A. I.
(2000)
Mol. Cell. Biol.
20,
2122-2128 45.
Drabent, B.,
Saftig, P.,
Bode, C.,
and Doenecke, D.
(2000)
Histochem. Cell Biol.
113,
433-442[Medline]
[Order article via Infotrieve]
46.
Fantz, D. A.,
Hatfield, W. R.,
Horvath, G.,
Kistler, M. K.,
and Kistler, W. S.
(2001)
Biol. Reprod.
64,
425-431 47.
Celeste, A.,
Petersen, S.,
Romanienko, P. J.,
Fernandez-Capetillo, O.,
Chen, H. T.,
Sedelnikova, O. A.,
Reina-San-Martin, B.,
Coppola, V.,
Meffre, E.,
Difilippantonio, M. J.,
Redon, C.,
Pilch, D. R.,
Olaru, A.,
Eckhaus, M.,
Camerini-Otero, R. D.,
Tessarollo, L.,
Livak, F.,
Manova, K.,
Bonner, W. M.,
Nussenzweig, M. C.,
and Nussenzweig, A.
(2002)
Science
296,
922-927
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
L. Ramos, G.W. van der Heijden, A. Derijck, J.H. Berden, J.A.M. Kremer, J. van der Vlag, and P. de Boer Incomplete nuclear transformation of human spermatozoa in oligo-astheno-teratospermia: characterization by indirect immunofluorescence of chromatin and thiol status Hum. Reprod., February 1, 2008; 23(2): 259 - 270. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Carrell, B. R. Emery, and S. Hammoud Altered protamine expression and diminished spermatogenesis: what is the link? Hum. Reprod. Update, May 1, 2007; 13(3): 313 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Singleton, A. Zalensky, G.F. Doncel, M. Morshedi, and I.A. Zalenskaya Testis/sperm-specific histone 2B in the sperm of donors and subfertile patients: variability and relation to chromatin packaging Hum. Reprod., March 1, 2007; 22(3): 743 - 750. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Govin, E. Escoffier, S. Rousseaux, L. Kuhn, M. Ferro, J. Thevenon, R. Catena, I. Davidson, J. Garin, S. Khochbin, et al. Pericentric heterochromatin reprogramming by new histone variants during mouse spermiogenesis J. Cell Biol., January 29, 2007; 176(3): 283 - 294. [Abstract] [Full Text] [PDF] |
||||
|
|