HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 45, 43474-43480, November 8, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/45/43474    most recent M206065200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zalensky, A. O. Articles by Bradbury, E. M. Search for Related Content PubMed PubMed Citation Articles by Zalensky, A. O. Articles by Bradbury, E. M. Social Bookmarking                      What's this?

Human Testis/Sperm-specific Histone H2B (hTSH2B)

MOLECULAR CLONING AND CHARACTERIZATION^*

Andrei O. Zalensky^§, Joseph S. Siino, Arunas A. Gineitis, Irina A. Zalenskaya, Nikolai V. Tomilin^¶, Peter Yau, and E. Morton Bradbury

From the  Department of Biological Chemistry, School of Medicine, University of California Davis, Davis, California 95616, ^¶ Institute of Cytology, Russian Academy of Sciences, St. Petersburg 194064, Russia, and  Biosciences Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87545

Received for publication, June 18, 2002, and in revised form, September 3, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Human sperm, unlike the sperm of other mammals, contain replacement histones with unknown biological functions. Here, we report the identification of the novel human gene coding for a testis/sperm-specific histone H2B (hTSH2B). This variant histone is 85% homologous to somatic H2B and has over 93% homology with the testis H2B of rodents. Using genomic PCR, two genetic alleles of hTSH2B were found in the human population. The hTSH2B gene is transcribed exclusively in testis, and the corresponding protein is also present in mature sperm. We expressed recombinant hTSH2B and identified this protein with a particular H2B subtype expressed in vivo. The subnuclear distribution of H2B variants in sperm was determined using biochemical fractionation and immunoblotting. The H2B variant associated with telomere-binding activity (15) was solubilized by Triton X-100 or micrococcal nuclease extraction, whereas hTSH2B was relatively tightly bound in nuclei. Immunofluorescence showed that hTSH2B was concentrated in spots located at the basal nuclear area of a subpopulation (20% of cells) of mature sperm. This fact may be of particular importance, because the hTSH2B "positive" and "negative" sperm cells may undergo significantly different decondensation processes following fertilization.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

During mammalian spermatogenesis, chromatin undergoes stage-specific structural reorganization. Testis-specific variants of histones, transitional proteins, and finally protamines replace somatic histones as the DNA condenses (1, 2). The complement of spermatogenic histones changes during differentiation, and this process has been described in detail for rodents (1). Whereas some testis histones (TH)¹ appear in the early stages of spermatogenesis for instance in spermatogonia (3) and some appear at late stages (e.g. in spermatids (4, 5)), the majority of TH are synthesized and incorporated into chromatin during meiosis (6). Rodent testis histones are replacement subtypes that differ in primary structure from the major somatic variants (3-5, 7-9). Although it is generally assumed that histone variants of germ line cells contribute to the restructuring of chromatin during spermatogenesis, their specific biological functions remain to be established.

In contrast to other mammals, mature human sperm retains a set of core histones representing 10-15% of basic proteins (10-12). Of these, histone H2B fraction (hSH2B) is the most abundant (10, 13). A complex composition of the hSH2B has been indicated (12). Although 17 replication-dependent H2B genes have been identified so far in the human genome (14), this complement contains neither testis- nor sperm-specific genes. We were particularly interested in the characterization of sperm H2B because of our recent finding that a H2B-related protein is an essential part of the telomere-binding complex in human sperm (15).

In this paper, the hSH2B group has been characterized using a combination of biochemical and immunochemical techniques. Further, a gene for a novel human histone H2B variant belonging to this complement has been identified on chromosome 6.² Molecular cloning, followed by in vitro expression, resulted in a recombinant protein identical with one of the H2B variants isolated from mature sperm. This protein is 85% homologous to a major somatic H2B subtype and has over 93% homology with testis H2B of mouse and rat. We show that this novel human H2B gene is expressed exclusively in testis, and the protein is also found in sperm. Therefore, the protein is referred as hTSH2B (human testis/sperm-specific H2B). Selective extraction and immunochemical localization have revealed a specific distribution of H2B variants in sperm nuclei. hTSH2B was found only in a subpopulation of sperm cells, where it is located in chromatin domains in the basal area of nuclei.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Sperm Preparation and Protein Isolation-- Sperm cells were collected by centrifugation from bulk human semen obtained from healthy fertile donors. Cells were washed with PBS and then in 0.25 M sucrose, 0.1 M NaCl, 2 mM EDTA, 10 mM Hepes, pH 7.5. Both buffers contained the protease inhibitors phenylmethylsulfonyl fluoride and 1-chloro-3-tosylamido-7-amino-2-heptanone. Details of this procedure were described earlier (16, 17).

The extraction of total basic proteins from crude nuclei with 0.5 N HCl was performed using the procedure described by Rogakou (18). Before extraction, nuclei were incubated with 5% -mercaptoethanol to disrupt the disulfide network formed by protamines.

To reveal the subnuclear distribution of H2B histones, a three-step extraction procedure was used, as follows. First, nuclei were homogenized in Triton extraction buffer (1% Triton X-100, 0.1 M NaCl, 10 mM DTT, 10 mM Hepes, pH 7.5). Protein extraction was continued for 1 h with constant shaking. Triton-solubilized material was separated from nuclei by centrifugation. Following Triton extraction, nuclei were washed with 0.1 M NaCl, 10 mM Hepes, pH 7.5, with nuclease digestion buffer (10 mM Hepes-NaOH, pH 7.0, 1 mM CaCl₂, 10 mM DTT) and then resuspended in the latter buffer at a DNA concentration of 2 mg/ml. Micrococcal nuclease (Roche Diagnostics) was added (2 units/1 unit A₂₆₀ of DNA), and digestion was performed for 2 h at 37 °C. Digestion was stopped by the addition of EDTA, and the nuclease-solubilized material was separated from nuclei by centrifugation. The pellet remaining after nuclease digestion was salt-extracted in 0.6 M NaCl, 10 mM DTT, 10 mM Hepes, pH 7.5, overnight with constant shaking. Extracts were clarified by centrifugation and stored at 80 °C. All extraction buffers contained EDTA-free protease inhibitor mixture (Roche Diagnostics).

Purification of hTSH2B from Sperm Nuclei-- A 0.6 M NaCl nuclear extract obtained as described above was fractionated on a reverse phase C4 HPLC column (Vydac) using a gradient of 0-60% acetonitrile (0.1% trifluoroacetic acid) over 60 min at a flow rate of 1 ml/min. Peak fractions were separated by SDS-PAGE and analyzed by Western blotting.

Isolation of Genomic DNA-- Genomic DNA was isolated from human sperm cells and purified as previously described (19).

Cloning and Bacterial Expression of Human hTSH2B-- hTSH2B was PCR-amplified from sheared human genomic DNA using a "touchdown" PCR method (20), Thermozyme^TM DNA Polymerase (Invitrogen), and the following primers (Invitrogen): 2B-5, CATATGCCGGAGGTGTCATCTAAAGGTGCTA; 2B-3, GGATCCTTACTTGGAGCTGGTGTACTTAGTGACAGCCTT.

The annealing temperature was decreased incrementally from 70 to 62 °C over five cycles and then held at 56 °C for an additional 25 PCR cycles. The 393-bp TSH2B gene was ligated into pCR2.1 (Topo^TMTA Cloning® kit; Invitrogen) and transformed into Top10 Escherichia coli (Invitrogen). Standard methods (21) were used to subclone the NdeI/BamHI TSH2B coding cassette from pCR2.1 into pET3a (Novagen). TSH2B-pET3a was confirmed by DNA sequencing and transformed into BL21(DE3) pLysS for isopropyl-1-thio--D-galactopyranoside-inducible protein expression (Novagen). A 50-ml overnight culture was used to inoculate 2 liters of 2× YT medium supplemented with ampicillin (100 µg/ml) and chloramphenicol (35 µg/ml). The culture was grown to an optical density of 0.5 (measured at 600 nm), induced with 230 mM isopropyl-1-thio--D-galactopyranoside for 3 h, and harvested by centrifugation. The bacterial pellet was resuspended in 50 ml of 50 mM Tris, pH 7.5, 100 mM NaCl, 1 mM EDTA, 1 mM benzamidine, and 1 mM -mercaptoethanol, freeze-thawed, and homogenized. TSH2B inclusion bodies were isolated from the bacterial lysate and dissolved in unfolding buffer (7 M guanidinium hydrochloride, 20 mM Tris, pH 7.5, 10 mM -mercaptoethanol) (7 ml/liter of processed cells) according to a published method (22). The dissolved crude protein was filtered and loaded onto a Superose 12 (Amersham Biosciences) fast protein liquid chromatography column (2.5 × 100 cm) in a running buffer of 7 M urea, 1.2 M NaCl, 20 mM sodium acetate, pH 5.2, 5 mM -mercaptoethanol, 1 mM EDTA. Peak fractions were examined by SDS-PAGE, and the TSH2B fractions were combined, dialyzed against distilled water and lyophilized. The protein was then further purified by reverse phase HPLC as described above, but using a 30-60% gradient of acetonitrile over 60 min. Peak fractions were analyzed by SDS-PAGE, and pure hTSH2B fractions were combined and lyophilized.

Analysis of Tissue Expression-- A panel of tissue-specific human First-Strand cDNA (Multiple-Choice^TM, Origene Technologies) was screened by PCR using 5 ng of library DNA and the 2B-5 2B-3 primer pair as described above. In addition, Titan reverse transcriptase-PCR (Roche Diagnostics) was performed using 100-300 ng of human testis and kidney mRNA (CLONTECH) according to the instructions of the manufacturer.

Analysis of the Allelic Variability of the TSH2B Gene-- To examine TSH2B allelic variability in the human population, the following primers were used, which correspond to regions 100 bp upstream and 100 bp downstream of the TSH2B gene coding sequence (purchased from Invitrogen): hTSH2Bup, CGAGACTTGGAGCTGAGGTCATTTGGA; hTSH2Bdn, AACGAAGCCCACAGCTGTTTCAGTATG.

Genomic DNA was isolated from sperm of eight unrelated subjects. PCR was conducted using the hTSH2Bup/dn primers and a "touchdown" thermal cycle program as described above. The PCR products from these reactions were purified using QIAquick Spin columns (Qiagen) and sequenced with the TH2Bup primer.

Gel Electrophoresis of Proteins-- Three electrophoretic systems have been used to analyze sperm proteins: acetic acid/urea (AU), acetic acid/urea/Triton (AUT), and SDS. AU PAGE was performed using 15% polyacrylamide gel containing 2.5 M urea (23), and the protein samples contained 8 M urea. For AUT electrophoresis (24), the separation gel contained 15% acrylamide, 6.25 M urea and 5 mM Triton X-100 and was polymerized using thiourea and hydrogen peroxide (23). SDS-PAGE was essentially as described by Laemmli (25), but the concentration of Tris, pH 8.9, in the separation gel was increased to 0.75 M. For two-dimensional separation, AU or AUT PAGE was used for the first dimension, and the proteins were stained with Coomassie Blue R250 (Sigma). Strips from stained AU or AUT gels were washed in water for 30 min and then in 62 mM Tris, pH 6.8, 1% SDS, 5% -mercaptoethanol for 60 min before application to the second dimension SDS gel.

Protein Digestion, Peptide Extraction, Sample Preparation, and Mass Spectrometric Measurement-- Coomassie-stained gel slices were destained with acetonitrile and 50 mM NH₄HCO₃ at a 1:1 ratio and were then dried using a speed vacuum centrifuge. Trypsin (Roche Diagnostics) was added in a final concentration of 10 µg/ml, and the mixture was incubated overnight at 37 °C. The gel slices were extracted with 50% acetonitrile, 5% acetic acid for 45 min, and the supernatant was collected and lyophilized. All gel extracts were resuspended in a 0.1% trifluoroacetic acid solution and further desalted using C18 ZipTips (Millipore Corp.). One microliter of desalted sample was mixed with 1 µl of a saturated solution (10 mg/ml) of R-cyano-4-hydroxycinnamic acid (Sigma), which was prepared by dissolving 10 mg in 1 ml of a 1:1 solution of acetonitrile and 0.1% trifluoroacetic acid. All mass spectrometry experiments were carried out on a PE Voyager DE-STR Biospectrometry work station equipped with an N2 laser (337 nm, 3-ns pulse width, 20-Hz repetition rate) in both linear and reflectron modes (PE Biosystems, Framingham, MA). The mass spectra of proteolytic digests were acquired in the reflectron mode with delayed extraction (DE). The m/z values of proteolytic peptides were calibrated externally with Calmix 1 (PE Biosystems).

Immunoblotting-- Immunoblotting was performed using a semidry system and 0.039 M glycine, 0.048 M Tris 0.0375% (w/v) SDS, 20% methanol as a transfer buffer at 0.8 mA/cm² for 2.5 h. The efficiency of transfer to the Immobilon P membrane (Millipore) was checked using Ponceau S staining. The membrane was blocked overnight with 5% nonfat milk on PBST (Sigma). Primary antibodies were used at 1:3000 dilution in 1% milk, PBST, 350 mM NaCl. Secondary antibodies were used at 1:5000 dilution. Membranes were incubated with antibodies for 1 h and washed in PBST three times for 10 min each. Rabbit polyclonal antibodies raised against purified calf thymus H2B were a gift from Dr. E. Bers (St. Petersburg University). Mouse monoclonal anti-tyrosine hydroxylase antibodies (TyH) were from Roche Diagnostics. In most experiments, anti-rabbit or anti-mouse antibodies conjugated with horseradish peroxidase (Vector) were used as secondary antibodies, and immunodetection was performed with an ECL kit (PerkinElmer Life Sciences). In some experiments, the localization of the anti-H2B reactive antigen was performed using ECL, and then the membrane was washed in PBST, additionally blocked for 1 h, incubated with mouse anti-TyH antibodies and horse anti-mouse antibodies conjugated with alkaline phosphatase (Vector), and developed using a color reaction.

Immunofluorescence Localization-- For the immunofluorescence localization of histones, PBS-washed sperm cells were fixed with 0.5% formaldehyde in PBS for 5 min. The formaldehyde was washed off, and the cells were resuspended in PBS. Sperm nuclei were decondensed using DTT/heparin (17, 26). Cells were incubated for 30 min at room temperature, loaded onto a microscope slide, allowed to sit for 30 min, briefly washed with PBS, rinsed with water, and allowed to dry. Cells were permeabilized in ice-cold methanol for 30 min and dried again. Before the application of primary antibodies, cells were rehydrated in blocking solution (3% bovine serum albumin, 0.1% Tween 20, 4× SSC) for 30 min. Monoclonal antibodies against tyrosine hydroxylase (Roche Molecular Biochemicals) and anti-mouse antibodies labeled with fluorescein isothiocyanate (Vector) were used at a 1:50 dilution in 1% bovine serum albumin, 0.1% Tween 20, 4× SSC. In some experiments, rabbit anti-H2B and anti-rabbit-FITC were used. The incubation time with antibodies was 45 min at 37 °C. Then the slides were washed at appropriate times in three changes of 0.1% Tween 20, 4× SSC for 5 min each. Nuclei were counterstained with propidium iodide and observed using a fluorescent microscope. Images were captured by photography and scanned, and digital images were processed using Adobe Photoshop 6.0 software.

Gel Retardation Assay-- The assay was performed as described previously (15, 26). Briefly, 0.5-1 ng of the labeled double-stranded (TTAGGG)₁₂ probe was incubated with sperm nuclear extract (1-3 µg of total protein) in binding buffer (20 mM HEPES, pH 7.9, 150 mM KCl, 1 mM MgCl₂, 0.1 mM EDTA, 1 mM DTT, 0.1 mg/ml bovine serum albumin, 5% glycerol, 100-200 ng of denatured HaeIII digest of E. coli DNA). In this work, we used extracts obtained with 1% Triton X-100, 100 mM NaCl, which contain telomere-binding activity (15). In some experiments, 1 µl of antibodies was added to the binding mixture. After incubation for 30 min at room temperature, the probes were loaded on a 6% polyacrylamide gel prepared in 0.5× TGE buffer (50 mM Tris base, 50 mM glycine, 2 mM EDTA). After electrophoresis, gels were dried and visualized by autoradiography.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Complement of H2B Histones in Human Sperm-- Total basic nuclear proteins were extracted with 0.5 N HCl and separated by two-dimensional PAGE (Fig. 1A). For better resolution of histones, we used AUT gel in the first dimension and SDS-PAGE in the second. Proteins separated by two-dimensional PAGE were immunoblotted with polyclonal antibodies to histone H2B (Fig. 1B). Several protein spots reacted with anti-H2B antibodies. Taking into account low cross-reactivity with other proteins including histone fractions in a control sample of total HeLa nuclear proteins, we suggest that all of these polypeptides are H2B-related. The electrophoretic mobilities of some of these fractions on SDS gel are close to that of somatic H2B, whereas others migrate more slowly, suggesting higher apparent molecular weights of sperm H2Bs (Fig. 1B). Thus, there are several unidentified proteins in human sperm that have common epitopes with somatic histone H2B. In this work, we identified, cloned, and characterized one protein from this complement.

View larger version (10K): [in this window] [in a new window]   Fig. 1.   Complement of H2B related polypeptides in human sperm. A, proteins extracted from human sperm cells with 0.5 N HCl and separated using two-dimensional AUT/SDS-PAGE, Coomassie staining. B, parallel two-dimensional gel immunoblotted with polyclonal anti-H2B antibodies. Several H2B-related proteins were revealed. The arrows show the position of hTSH2B, which was established by reprobing of the blot with anti-TyH antibodies.

Identification of the Novel Human Histone H2B Gene-- It was observed (8, 27) that a monoclonal antibody against rat tyrosine hydroxylase (TyH) recognized an epitope within the rat and mouse testis-specific H2B (TH2B). This epitope is the peptide KGF, shared by TyH and rodent TH2Bs and localized in the N terminus of TH2B (Fig. 2B). Recently, Van Roijen et al. (28) showed that anti-TyH also cross-reacted with a 17-kDa protein from human testis and sperm, but this histone was not characterized and its molecular identity remained unknown.

View larger version (26K): [in this window] [in a new window]   Fig. 2.   Characteristics of the hTSH2B sequence and tissue-specific expression of hTSH2B gene. A, alignment of the protein sequence translated from the novel human H2B gene (hTSH2B) with sequences of human somatic hH2B.1 and testis-specific H2B variants of mouse (mTH2B) and rat (rTH2B). Changeable amino acids are shown in red. B, comparison of homologous peptides from histones H2B and tyrosine hydroxylase (TyH) that are responsible for recognition by anti-TyH antibodies. The substitution of Phe by Ser in somatic H2B completely eliminates anti-TyH epitope. C, new sites of potential phosphorylation (P) and myristoylation (MYR) that are specific to hTSH2B in comparison with somatic H2B.1. D, PCR products obtained using hTSH2B-specific primers and cDNA of different human tissues. Testis-specific hTSH2B expression (right lane) produces a 390-bp DNA that is identical in mobility with the PCR product amplified from genomic DNA control.

Following up on these reports we searched for a protein homologous to rodent TH2B in the human genome. A BLAST search with the mouse nucleotide sequence corresponding to the TyH reactive peptide revealed a cDNA clone originating from a human testis library. In turn, this cDNA highlighted a genomic sequence on chromosome 6 as a top-ranked match. The complete coding sequence of this gene have been deposited into GenBank^TM (accession number AF397301). We have demonstrated (see below) that this gene is specifically expressed in testis and that the corresponding protein is present in mature human sperm cells. Therefore, the protein is referred to as hTSH2B (human testis/sperm-specific H2B). Sequence alignment of hTSH2B with the human somatic H2B.1 revealed 85% identity with the highest conservation observed at the C-terminal region of the protein (Fig. 2A). Within the first 25 N-terminal amino acids, 10 substitutions (40%) are found between the somatic and germ line proteins. Nine more substitutions are spread all over the central portion of the protein sequence. Human TSH2B shares a more extensive homology with testis H2B from both mouse (95%) and rat (93%) (Fig. 2A). All testis histones have phenylalanine in position 16 (Fig. 2B), which is likely to be crucial for recognition by the monoclonal anti-TyH antibodies. Importantly, amino acid sequence motifs in hTSH2B compared with somatic H2B provide six new potential sites for phosphorylation and a myristoylation site (Fig. 2C).

Tissue-specific Expression of the hTSH2B Gene-- To determine the expression profile of the novel H2B gene, we looked for the presence of its messenger RNA in different human tissues. This was done by PCR using commercially available first-strand cDNA libraries from different human tissues (intestine, prostate, lung, ovary, muscle, and testis) and by reverse transcriptase-PCR using mRNA from kidney and testis. Fig. 3 shows that TSH2B is expressed exclusively in testis, a tissue enriched with spermatogenic cells.

View larger version (15K): [in this window] [in a new window]   Fig. 3.   Purification of recombinant and native hTSH2B. A, R-hTSH2B was expressed in E. coli and purified using gel filtration followed by reverse phase HPLC (see "Experimental Procedures" for details). SDS-PAGE separation, Coomassie staining is shown as follows: from left to right, HeLa histones, crude E. coli extract, and purified R-hTSH2B. B, purification of native hTSH2B from the 0.6 M NaCl extract of human sperm nuclei. Proteins were separated using reverse phase HPLC, and fractions were analyzed by SDS-PAGE followed by Western blotting with anti-TyH antibodies (shown in the inset), which selectively recognize TSH2B. The hTSH2B enriched fraction (shown by an arrow) eluted at 47% acetonitrile.

Allelic Variability of the hTSH2B Gene-- The coding sequence of human TSH2B was PCR-amplified from genomic DNA, cloned, and sequenced. It matched with a sequence in chromosome 6 identified above. In addition, a larger sequence (coding sequence plus 100 adjacent base pairs from 3'- and 5'-flanking regions of the hTSH2B gene) was PCR-amplified from genomic DNAs isolated from nine individuals and then sequenced. Genomic sequences isolated from four individuals (including the originally isolated clone) were identical. hTSH2B genes from five other individuals were identical among themselves but differed from the first group in three nucleotide substitutions within the coding region. All three single-nucleotide substitutions were silent and located in the last nucleotide of codons for Ile⁴³, Ser⁶⁶, and Lys¹²⁷. Thus, the hTSH2B gene has allelic variants in the human population, but these single nucleotide polymorphisms do not change the protein sequence.

In Vitro Expression of the hTSH2B Protein and Comparison with the H2B of Sperm-- To further characterize hTSH2B and identify this protein as a histone occurring in human sperm nuclei, we expressed this protein in E. coli. A two-step purification procedure results in the isolation of a single recombinant polypeptide (R-hTSH2B) with mobility close to the HeLa H2B histone as judged by SDS-PAGE (Fig. 3A).

It was demonstrated above (Fig. 1B) that several H2B-related proteins are present in mature human sperm. To identify the hTSH2B expressed in vivo, we utilized its specific reactivity with anti-TyH antibodies. Preliminary experiments established the position of the anti-TyH-reacting H2B in a two-dimensional gel (shown by arrows in Fig. 1B) and indicated that this H2B variant is enriched in 0.6 M NaCl sperm nuclear extract (data not shown). Therefore, the 0.6 M NaCl extract was used as the starting material for hTSH2B purification. Proteins were separated using reverse-phase HPLC and analyzed by SDS-PAGE and Western blotting with anti-TyH antibodies (Fig. 3B). A protein reacting with the anti-TyH antibodies was detected in a fraction eluted with 47% acetonitrile (Fig. 3B, inset). Reprobing of the membrane with anti-H2B antibodies identified the same band. The polypeptide composition of partially purified hTSH2B (HPLC fraction 47; Fig. 3B) is shown in Fig. 5A, right lane.

Both in vitro expressed R-hTSH2B and partially purified hTSH2B were separated using two-dimensional PAGE (Fig. 4). AU PAGE was used as the first dimension (Fig. 4A). The areas of AU gel corresponding to the core histones were cut out and subjected to SDS-PAGE in the second dimension. The second dimension gel was immunoblotted using anti-H2B and anti-TyH antibodies (Fig. 4B). Antibodies against H2B (Fig. 4B, top panels) recognize the somatic H2B of HeLa cells and both recombinant TSH2B and hTSH2B purified from sperm. Antibodies against tyrosine hydroxylase recognize only the two latter proteins (Fig. 4B, bottom panels). Since these proteins react with both antibodies, they belong to the H2B group and also have the unique anti-TyH epitope as expected from the sequence data (Fig. 2).

View larger version (18K): [in this window] [in a new window]   Fig. 4.   Comparison of recombinant and native hTSH2B. A, separation of recombinant and native (HPLC fraction 47, Fig. 3B) hTSH2B using AU PAGE, Coomassie staining. The parts of the gel applied to the second dimension (B) are indicated by dotted rectangles. B, immunoblotting of proteins separated in two-dimensional PAGE. Proteins were visualized using anti-H2B antibodies (upper panels), and then the same blots were reprobed with anti-TyH antibodies (bottom panels).

The protein spots corresponding to R-hTSH2B, native hTSH2B, and HeLa H2B were cut from a stained two-dimensional gel proteolyzed and subjected to mass spectrometric analysis (see "Experimental Procedures" for details). Data analysis of the masses from the tryptic peptides was performed using Protein Prospector software (University of California, San Francisco). Five peptides with m/z values corresponding to the theoretically predicted peptides containing the unique N-terminal hTSH2B sequence (Fig. 2A) and six peptides within amino acids 30-50 were found to be identical between the R-hTSH2B and native hTSH2B. An additional 15 peptides corresponding to the central and C-terminal regions of H2B shared by all three proteins were also identified. Therefore, the in vitro expressed R-hTSH2B matches with one of the H2B variants present in mature spermatozoa of humans (hTSH2B, shown in Figs. 1B and 5).

Interestingly, sperm hTSH2B is represented by two closely migrating polypeptides (Figs. 1B and 4B). At the present time, we do not know whether they result from sequence variants, different post-translational modifications, or partial degradation.

Subnuclear Distribution of hTSH2B-- The association of TSH2B with a particular chromatin domain may be indicative of its function. We were interested in whether hTSH2B is identical with the histone H2B variant previously described by us as a part of the telomere-binding complex in human sperm (15). Therefore, we followed the fractionation scheme used for the identification of telomere proteins (15, 26) and assayed the extracts for the presence of hTSH2B.

First, membrane-associated proteins were extracted with 1% Triton X-100, 100 mM NaCl (hS-Triton), and then nuclei were digested with micrococcal nuclease (hS-nuclease) and the remaining nuclear material was extracted with 0.6 M NaCl (hS-NaCl). Proteins fractionated in this way were separated by SDS-PAGE and immunoblotted using anti-H2B and anti-TyH antibodies (Fig. 5A). hTSH2B (the only sperm H2b variant reacting with anti-TyH) was not found either in the hS-Triton or hS-nuclease fractions, but it was present in 0.6 M NaCl fraction. Therefore, the hTSH2B is relatively tightly bound to sperm chromatin. Treatments with detergent and/or nuclease (the latter solubilize about 20% of total DNA) extract an H2B-related protein of higher molecular weight than hTSH2B, most probably the telomere-associated histone H2B variant suggested in our earlier work (15). Molecular characterization of this protein is in progress.

View larger version (20K): [in this window] [in a new window]   Fig. 5.   Distribution of H2B variants in human sperm nuclei. A, Western blotting of proteins separated in SDS-PAGE using anti-H2B and anti-TyH antibodies. Human sperm cells were successively extracted with Triton-X100 (hS-Triton), micrococcal nuclease (hS-nuclease), and 0.6 M NaCl (hS-NaCl). Only portions where H2B signals were located are shown (12-17-kDa molecular mass range). B, gel retardation assay using telomere DNA as a substrate and human sperm extract (hS-Triton) enriched in telomere-binding activity (15). Anti-H2B and anti-TyH antibodies were added to binding reactions where indicated.

To further verify that hTSH2B is not involved in the formation of the sperm telomere-binding complex, we used a sensitive gel retardation assay (Fig. 5B). Double-stranded TTAGGG telomere DNA was incubated with proteins extracted from human sperm by Triton X-100. The telomere-binding complex (15) was visualized in native electrophoresis (Fig. 5B). Fig. 6B demonstrates that the presence of polyclonal anti-H2B antibodies in binding reaction inhibits the formation of the complex between telomere DNA and sperm proteins (15). In contrast, anti-TyH antibodies do not influence the formation of the telomere-binding complex and its mobility (Fig. 5B). Therefore, hTSH2B is not a part of this complex.

View larger version (22K): [in this window] [in a new window]   Fig. 6.   Nuclear localization of H2B variants in human sperm. Indirect immunofluorescence using polyclonal anti-H2B (A) and monoclonal anti-TyH (B-D) antibodies is shown. Cells were decondensed using 10 mM DTT (B) or 10 mM DTT plus 0.03 mg/ml heparin (A, C, and D). Yellow/green, protein signals; red, total DNA. Bar, 5 µm. A, polyclonal antibodies reveal a complex localization resulting from overlapping patterns of different H2B variants. B-D, antibodies specific to the hTSH2B variant show its localization in the basal nuclear area of selected sperm cells.

Immunolocalization of hTSH2B in Mature Sperm Cells-- In human sperm cells, core histone H4 is evenly distributed throughout nuclei (15). In contrast, polyclonal anti-H2B antibodies reveal a punctate localization that in some cells overlaps with a smeared staining of nuclei (15) (Fig. 6A). Some of the H2B loci colocate with the positions of telomere sequences revealed by fluorescence in situ hybridization (15). From the results presented above (Fig. 1B), it is clear that anti-H2B recognizes several distinct H2B-related polypeptides in human sperm. Therefore, Fig. 6A represents the superposition of several patterns of localization. Anti-TyH antibodies are monospecific for the hTSH2B variant (28) (see above). Thus, they are suitable for the selective localization of this protein. Fig. 6, B-D gives an example of the localization of hTSH2B in the mature sperm cells of a fertile donor. Interestingly, not all of the sperm cells are positive for the presence of hTSH2B. This surprising fact was first observed by Van Roijen et al. (28). hTSH2B-negative cells are not the result of poor antibody penetration due to variations in nuclear compactness. Indeed, in samples where the in vitro performed decondensation of nuclei was more extensive (Fig. 6, C and D), the coexistence of the hTSH2B-positive and -negative cells is even more evident. Importantly, cells of both types have identical, normal cellular and nuclear morphology. Anti-TyH antibodies preferentially illuminate the basal part of nuclei adjacent to the sperm tail attachment point (Fig. 6C), leaving the apical area on the nucleus free of hTSH2B. In some cells, with an apparently lower concentration of protein, the localization of hTSH2B in small spots is visible (Fig. 6D). Therefore, it may be suggested that hTSH2B is associated with specific chromatin domains.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Histone H2B Variants in Mammalian Male Germ Line Cells-- We have identified and described a novel member of the human histone gene family, hTSH2B, a variant that is specific to testis and sperm cells. The hTSH2B gene is a unique gene located on chromosome 6, which also contains the major human histone gene cluster (6). This hTSH2B is the first protein from the spectrum of residual histones present in the mature sperm of humans (10-12) to be characterized. Protein sequence comparison reveals a strong (95%) homology of hTSH2B with testis-specific H2B from rat (30) and mouse (9); the most significant difference is the absence of Cys at position 34 of the human protein. There is a weaker homology with somatic histone H2B (85%). This may indicate an early divergence and independent evolution of germ line-specific and somatic H2B in mammals. Remarkably, an early biochemical study of a crude H2B isolated from liver and germ line cells of human and rat came to a similar conclusion (13). The most pronounced differences between somatic and spermatogenic cell-specific H2Bs are found in their N-terminal regions (Fig. 2A). This domain on the outside of the histone octamer is involved in interactions with DNA and is important for the mitotic condensation of chromosomes (31). It remains to be seen how this difference in N-terminal sequence influences chromatin packaging.

The N-terminal segment of hTSH2B is unique for the presence of two potential phosphorylation sites (Ser⁵ and Ser⁶) and the GATIS sequence that is a possible site for internal myristoylation. Four additional sites of potential phosphorylation that are specific to hTSH2B are located in the central and C-terminal regions (Fig. 2C). Most of the phosphorylation sites unique for the hTSH2B are substrates for protein kinase C. It would be interesting to know whether hTSH2B can be phosphorylated by Aurora kinases (32), especially by the testis-specific Aurora C kinase (33).

Humans are unique among studied mammals in that the replacement of histones by protamines during spermatogenesis is not complete. As a result, about 10-15% of the basic proteins in mature sperm are histones (11, 12). Among these are histones belonging to the H2B family (10). Based on patterns of electrophoretic separation and amino acid analysis of partially purified proteins, Gatewood et al. (12) suggested the presence of several H2B subfractions. However, sperm H2B may be confused with other basic proteins that overlap with histones in different gel systems, for example centromeric protein CENP-A and/or protein SP-19 (16, 17).

Here, by using polyclonal antibodies specific to H2B (Fig. 1B), we have shown the presence of several distinct H2B-related polypeptides in mature human sperm. One of the H2B variants (hTSH2B) was identified and characterized. We have shown earlier (15) that an H2B-related protein is part of the telomere-binding complex in human sperm. The data presented here demonstrate that the telomere-associated H2B of human sperm is distinct from hTSH2B. Yet another spermatid-specific variant of histone H2B was described in rodent testis (4, 5), which has a 12-amino acid addition at the C terminus. However, antibodies raised against this specific peptide (4) do not recognize any proteins in a Western blot of total human sperm proteins (data not shown). In addition, a homologous gene for this protein in humans was not found in GenBank^TM.

Expression and Variability of the hTSH2B Gene-- Using reverse transcriptase-PCR, we were able to study the profile of hTSH2B gene expression in seven human tissues (Fig. 2D). Obvious expression has been registered only in testis. The modes of expression and regulation of a homologous H2B gene were studied in detail in rodents (7, 30, 34-37). In mature animals, TH2B mRNA first accumulated in B spermatogonia (37). The unique affinity of testis-specific H2Bs to anti-TyH antibodies (determined by Phe¹⁶; Fig. 1B) allowed a study of protein expression during spermatogenesis using immunohistochemistry (8, 28). In rat, deposition of this protein on chromatin was found in early primary spermatocytes, but protein staining disappeared in round spermatids (8). In humans, this histone is present throughout spermatogenesis, from spermatogonia (28) to mature sperm (Ref. 28 and this work).

Using genomic PCR, we found single nucleotide polymorphisms in the hTSH2B gene in codons for Ile⁴³, Ser⁶⁶, and Lys¹²⁷, indicating the existence of two genetic alleles of hTSH2B in the human population. These nucleotide substitutions were silent and did not change the primary structure of the protein. To our knowledge, this is the first single nucleotide polymorphism identified in histone genes.

Subnuclear Distribution of Histones in Human Sperm-- The residual histones in human sperm seem to be unevenly distributed in the nuclei, and different variants are associated with distinct chromatin domains, which was supported by both biochemical and indirect immunofluorescence data.

Some of the human sperm core histones are weakly bound and may be solubilized by extraction with low salt buffers starting at 0.1 M NaCl (38). In this respect, they are different from the histones of somatic cells, which require much higher salt concentrations for extraction. For example, an as yet uncharacterized variant of human sperm H2B is extracted by 1% Triton X-100, 0.1 M NaCl (Ref. 15 and Fig. 5A), partially co-localizes with telomere DNA, and participates in the telomere-binding complex (15). However, it is not known whether this H2B variant is associated with other histone fractions and whether it is incorporated into nucleosomes. Nonnucleosomal histone variants have been recently demonstrated such as an acrosome-associated H2B in bull sperm (39) and H1.X that is a component of cytoplasmic filaments in Caenorhabditis elegans (40).

Our earlier data proved that part of the telomere chromosomal domain in human sperm preserved nucleosomal organization and that the full complement of four core histones was present in telomere nucleosomes (29). The molecular identities of these histone variants remain to be established.

The histone hTSH2B identified in this work is comparatively tightly bound to chromatin and is extracted only by buffers containing 0.6 M NaCl (Fig. 5). Monoclonal anti-TyH antibodies that are specific to the hTSH2B variant showed the localization of this protein in spots concentrated in the basal area of sperm nuclei (Fig. 6, C and D). A basal localization of the same antigen was demonstrated earlier (28). It is noteworthy that in human sperm the localization of hTSH2B is different from the even distribution of both protamines (17) and histone H4 (15), from the punctate localization of the H2B variant associated with telomeres (15), and from the localization of CENP-A (H3 variant) in dimers and linear arrays (17).

Finally, after successive extractions of human sperm nuclei with detergent, nuclease, and 0.6 M NaCl, some core histones still remain associated with DNA (data not shown). It is possible that some of these may be associated with nucleosomes in the centromeric domains of chromosomes that are buried deep inside the nucleus (41). Indeed, CENP-A is a variant of histone H3 that is incorporated in centromeric nucleosomes (42, 43) and is retained in human sperm (17).

Perspectives-- hTSH2B was shown to be present in about 20% of mature spermatozoa, whereas 80% of cells do not have this protein (Ref. 28 and data in Fig. 6). This fact may be of particular importance; if both types of sperm cells participate in fertilization, modes of chromatin decondensation and genome unpacking of the hTSH2B "positive" and "negative" cells could be significantly different.

Despite a long history of studies concerning histone variants associated with male germ line cells in mammals, their functions remain largely unknown. The temporal character of the synthesis and accumulation of these replacement variants in chromatin indicates that some might participate in meiosis, some in chromatin remodeling during the histone-protamine transition in spermiogenesis and some in specific structural organization of the genome required for fertilization. In humans, conclusive experiments are hindered by the limitation of in vivo approaches and by the minute amounts of starting material for biochemical studies. It was expected that significant progress could be achieved using gene knockouts in model animals. Still, recent data showed that in mice with disrupted testis-specific H1 gene, spermatogenesis proceeds normally, the mice are fertile and do not show abnormalities until adulthood (44-46). However, the knockout of the replacement histone H2A.X results, among other phenotypes, in the development of infertile male mice (47).

In this work, the first member of the human spermatogenic cell-specific histone family was cloned, expressed, and characterized using a combination of genomic and biochemical techniques. Applying similar approaches for the molecular description of the full histone complement in human sperm should be possible and is an important step for understanding their function in vivo.

	FOOTNOTES

^* This work was supported in part by National Institutes of Health Grant HD39830 (to A. O. Z.) and by Department of Energy Grant FG 0301ER 63070 (to E. M. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ To whom correspondence should be addressed: Dept. of Biological Chemistry, School of Medicine, University of California, Davis, CA 95616. Tel.: 530-752-3314; Fax: 530-752-3516; E-mail: aozalensky@ucdavis.edu.

Published, JBC Papers in Press, September 3, 2002, DOI 10.1074/jbc.M206065200

² GenBank^TM accession number AF397301.

	ABBREVIATIONS

The abbreviations used are: TH, testis histone(s); hTSH2B, human testis/sperm-specific H2B; R-hTSH2B, recombinant hTSH2B; hSH2B, human sperm H2B; TyH, tyrosine hydroxylase; AU, acetic acid/urea; AUT, acetic acid/urea/Triton; hS-Triton (hS-nuclease, hS-NaCl), human sperm proteins extracted with Triton X-100 (micrococcal nuclease, 0.6 M NaCl); DTT, dithiothreitol; HPLC, high pressure liquid chromatography.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. Lu, Y. M. Xie, X. Li, J. Luo, X. Q. Shi, X. Hong, Y. H. Pan, and X. Ma Mass spectrometry analysis of dynamic post-translational modifications of TH2B during spermatogenesis Mol. Hum. Reprod., June 1, 2009; 15(6): 373 - 378. [Abstract] [Full Text] [PDF]

				R. Catena, E. Escoffier, C. Caron, S. Khochbin, I. Martianov, and I. Davidson HMGB4, a Novel Member of the HMGB Family, Is Preferentially Expressed in the Mouse Testis and Localizes to the Basal Pole of Elongating Spermatids Biol Reprod, February 1, 2009; 80(2): 358 - 366. [Abstract] [Full Text] [PDF]

				L. Ramos, G.W. van der Heijden, A. Derijck, J.H. Berden, J.A.M. Kremer, J. van der Vlag, and P. de Boer Incomplete nuclear transformation of human spermatozoa in oligo-astheno-teratospermia: characterization by indirect immunofluorescence of chromatin and thiol status Hum. Reprod., February 1, 2008; 23(2): 259 - 270. [Abstract] [Full Text] [PDF]

				D. T. Carrell, B. R. Emery, and S. Hammoud Altered protamine expression and diminished spermatogenesis: what is the link? Hum. Reprod. Update, May 1, 2007; 13(3): 313 - 327. [Abstract] [Full Text] [PDF]

				S. Singleton, A. Zalensky, G.F. Doncel, M. Morshedi, and I.A. Zalenskaya Testis/sperm-specific histone 2B in the sperm of donors and subfertile patients: variability and relation to chromatin packaging Hum. Reprod., March 1, 2007; 22(3): 743 - 750. [Abstract] [Full Text] [PDF]

				J. Govin, E. Escoffier, S. Rousseaux, L. Kuhn, M. Ferro, J. Thevenon, R. Catena, I. Davidson, J. Garin, S. Khochbin, et al. Pericentric heterochromatin reprogramming by new histone variants during mouse spermiogenesis J. Cell Biol., January 29, 2007; 176(3): 283 - 294. [Abstract] [Full Text] [PDF]

				J. Ausio Histone variants--the structure behind the function Brief Funct Genomic Proteomic, September 1, 2006; 5(3): 228 - 243. [Abstract] [Full Text] [PDF]

				R. Oliva Protamines and male infertility Hum. Reprod. Update, July 1, 2006; 12(4): 417 - 435. [Abstract] [Full Text] [PDF]

				X. Zhang, M. S. Gabriel, and A. Zini Sperm Nuclear Histone to Protamine Ratio in Fertile and Infertile Men: Evidence of Heterogeneous Subpopulations of Spermatozoa in the Ejaculate J Androl, May 1, 2006; 27(3): 414 - 420. [Abstract] [Full Text] [PDF]

				J. E. Lowell, F. Kaiser, C. J. Janzen, and G. A. M. Cross Histone H2AZ dimerizes with a novel variant H2B and is enriched at repetitive DNA in Trypanosoma brucei J. Cell Sci., December 15, 2005; 118(24): 5721 - 5730. [Abstract] [Full Text] [PDF]

				T. Okada, P. L. Bhalla, and M. B. Singh Transcriptional Activity of Male Gamete-specific Histone gcH3 Promoter in Sperm Cells of Lilium longiflorum Plant Cell Physiol., May 1, 2005; 46(5): 797 - 802. [Abstract] [Full Text] [PDF]

				P. E. Warburton, J. Giordano, F. Cheung, Y. Gelfand, and G. Benson Inverted Repeat Structure of the Human Genome: The X-Chromosome Contains a Preponderance of Large, Highly Homologous Inverted Repeats That Contain Testes Genes Genome Res., October 1, 2004; 14(10a): 1861 - 1869. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/45/43474    most recent M206065200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Zalensky, A. O. Articles by Bradbury, E. M. Search for Related Content PubMed PubMed Citation Articles by Zalensky, A. O. Articles by Bradbury, E. M. Social Bookmarking                      What's this?