|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 46, 43757-43762, November 15, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the § Departments of Medicine and ¶ Oncology,
The Johns Hopkins University School of Medicine, Baltimore,
Maryland 21287
Received for publication, June 17, 2002, and in revised form, September 4, 2002
In intact tissue, the extracellular matrix (ECM)
provides support and helps maintain homeostasis but is considered
biologically inert. In the setting of inflammation, not only is the ECM
the target of inflammation, but its breakdown products modulate the magnitude and quality of an immune response. Fragments of the ECM
component hyaluronan (HA) induce macrophage expression of chemokines,
cytokines, and growth factors as well greatly enhance IFN- The extracellular matrix
(ECM)1 is not only the target
of destruction during inflammation but also plays an important role in
cellular activation and signaling. A complex array of proteins and high
molecular weight proteoglycans and glycosaminoglycans, the ECM in
healthy tissues maintains homeostasis and matrix structure (1). During
inflammation, there is increased production and degradation of ECM
components such as fibronectin, collagen, and glycosaminoglycans. This
results in the accumulation of lower molecular weight products (2).
Whereas the high molecular weight forms of these glycoproteins appear
to be biologically inert to cells, the lower molecular weight ECM
breakdown components activate inflammatory cells inducing
proliferation, elaboration of cytokines and enzymes, and up-regulation
of a variety of cell surface markers (1, 3-6).
Our laboratory has focused on the biologic properties of the
glycosaminoglycan hyaluronan (HA). HA is found in a high molecular weight form in the ECM of all tissues. In its native form, it exists as
a nonsulfated glycosaminoglycan polymer made up of repeating disaccharide units of ( Thus, cellular activation and regulation within the inflammatory milieu
are influenced by the biologic activity of low molecular weight ECM
breakdown products. We have shown that HA fragments can synergize with
the cytokine interferon- In this report, we define the transcriptional mechanisms involved in
mediating the striking synergy between HA and IFN- Cell Lines--
The mouse alveolar macrophage cell line MH-S
(29) was purchased from American Type Culture Collection,
Manassas, VA. Cells were maintained in RPMI 1640 supplemented with 10%
heat-inactivated low lipopolysaccharide fetal bovine serum, 1%
penicillin-streptomycin, and 1% glutamine (Biofluids, Rockville, MD)
at 37 °C under 5% CO2. To exclude the effects of
contaminating lipopolysaccharide on experimental conditions, cell
stimulation was carried out in the presence of polymixin B (10 µg/ml, Calbiochem).
Chemicals and Reagents--
Purified HA fragments from human
umbilical cords were purchased from ICN Biomedicals, Inc. (Costa Mesa,
CA). The HA-ICN preparation is free of protein (<2%) and other
glycosaminoglycans with a peak molecular mass of 200,000 Da (30).
Recombinant mouse IFN- Northern Analysis of mRNA Production--
RNA was extracted
from confluent cell monolayers using 4 M guanidine
isothiocyanate and purified by centrifugation through a 5.7 M cesium chloride gradient. Northern blot analysis was
performed as described previously (10).
Preparation of Nuclear Extracts--
Nuclear extracts from MH-S
cells were prepared by modification of the procedure of Dignam
et al. and others (31-33). The cells were first incubated
on ice for 15 min with 10 mM HEPES (pH 8), 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA,
3.3 µg/ml apoprotinin, 10 µg/ml leupeptin, 2.5 µM
4-(2-aminoethyl)-benzenesulfonylfluoride hydrochloride, 0.5 mM sodium orthovanadate, and 1 mM
dithiothreitol. Next, an equal volume of the same solution with 2%
Triton-X was added, and the cells were mixed for 15 s and spun in
a microcentrifuge at 10,000 rpm for 30 s. The supernatant fluid
was discarded, and the nuclear pellet was resuspended in a solution
containing 20 mM HEPES, 0.4 M NaCl, 1 mM EDTA, 1 mM EGTA, protease inhibitors, 0.5 mM sodium orthovanadate, and 1 mM
dithiothreitol. The resuspended nuclear pellet was rocked for 30 min at
4 °C and then was spun at 12,000 rpm in a microcentrifuge to remove
insoluble material. The extracts were diluted 1:4 in buffer containing
20 mM HEPES, 20% glycerol, 0.1 M KCl, 0.2 mM EDTA, 0.5 mM sodium orthovanadate, and 0.1%
Triton X-100 to decrease salt concentration prior to freezing at
Electrophoretic Mobility Shift Assays--
Electrophoretic
mobility shift assays (EMSA) were conducted using 6% polyacrylamide
gels, as described previously but with some modifications (32).
Nuclear extracts (5 µg) were incubated at room temperature for 30 min
with 30,000 cpm of 32P end-labeled, double-stranded
oligonucleotide probe (10-50 pg), 0.1-1 µg of denatured salmon
sperm DNA (Invitrogen) in 10 mM Tris, 50 mM
KCl, 1.5 mM MgCl2 2 mM
dithiothreitol, 0.5 mM EDTA, 12.5% Ficoll, and 0.1%
Triton X-100 prior to gel electrophoresis at 4 °C. The following
double-stranded DNA probes were used: RNA and EMSA Analysis--
All blots were developed using the
STORM PhosphorImager (Amersham Biosciences). All comparisons
concerning band density were made for each individual gel as there was
great variation in background between gels. Quantification of each of
the bands was determined by the PhosphorImager using a fixed area with
the object average program for determining the background
(ImageQuaNT; Amersham Biosciences). In this way, the background was
determined for each individual lane and subtracted from the band
density to account for interlane background variation.
Site-directed Mutagenesis--
The preparation of the nested
deletion constructs of the MIG promoter upstream of the
chloramphenicol acetyltransferase (CAT) reporter construct was
described elsewhere (34). A 284-bp 5' fragment was subcloned from a
Transient Transfections--
Transient transfections of the MH-S
cells were performed using LipofectAMINE 2000 per manufacturer
guidelines (Invitrogen). Briefly, 3 × 106
cells were plated in 6-well tissue culture dishes 1 day prior to
transfection. The cells were washed twice with Optimem (Invitrogen), incubated with the DNA/LipofectAMINE 2000 solution (5 µg of DNA and
15 µg of LipofectAMINE) for 3 h. The DNA/LipofectAMINE solution was then aspirated, and the cells were stimulated for 18 h prior to harvesting cell extracts, which were analyzed for CAT expression with enzyme-linked immunosorbent assay (Roche Molecular Biochemicals) or luciferase expression using a Dual luciferase kit (Promega and Zylux
femtomaster FB-12 luminometer).
Statistical Analysis--
Statistical analysis was performed
between groups using an analysis of variance factorial analysis program
from Statview (Abacus Concepts). A difference between groups of
p < 0.05 was considered significant.
HA-induced Synergy with IFN- The Synergy between HA Fragments and IFN- Both NF-
Similar EMSAs were performed using a 22-bp radiolabeled DNA probe
containing the Mutations in the NF- Low molecular weight HA fragments can stimulate mouse macrophages
to express numerous chemokines, and IFN- It is known that HA has the ability to activate NF- In general, it is felt that IFN- It is becoming increasingly clear that coactivation molecules such as
CREB-binding protein and p300 play important roles in integrating
diverse signals leading to transcription (44-47). In our system, we
would propose that such coactivators serve to integrate cytokine
signaling (IFN- Interestingly, the necessity of the NF- NF- We thank Dr David B. Jacoby for
critical reading of the manuscript.
*
This work was supported by Grant K08 HL03993 from the
National Institutes of Health and Grant RG-061-N from the American Lung Association.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, September 10, 2002, DOI 10.1074/jbc.M206007200
The abbreviations used are:
ECM, extracellular matrix;
HA, hyaluronan;
TNF-
NF-
B Activation Mediates the Cross-talk between
Extracellular Matrix and Interferon-
(IFN-) Leading to Enhanced
Monokine Induced by IFN- (MIG) Expression in Macrophages*
§,
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-induced
MIG expression. In this report, we demonstrate that the synergistic
induction of MIG by HA and IFN- occurs at the level of transcription
via NF-
B. Using electrophoretic mobility shift assays and reporter
assays, we have identified two NF-B sites proximal to the
IFN--responsive element-1 (RE-1) that mediate this effect.
Interestingly, our experiments also revealed a critical role for
NF-B in mediating IFN--induced MIG expression independent of HA.
These data emphasize the ability of "degraded self" to
activate/modify immune responses through the NF-B pathway.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1-4)-D-glucuronic
acid-(1-3)-N-acetyl-D-glucosamine with a
molecular mass in excess of 106 Da (7, 8). High
molecular weight HA is believed to have many functions in healthy
tissue such as water homeostasis, plasma protein distribution, and
matrix structuring (7, 9). However, at sites of inflammation and tissue
injury, lower molecular weight HA species accumulate (10-16). These
lower molecular weight forms of HA stimulate macrophages to produce
important mediators of tissue injury and repair such as macrophage
inflammatory protein-1
, macrophage inflammatory protein-1, tumor
necrosis factor- (TNF-), inducible nitric oxide synthase,
plasminogen activator inhibitor-1, and macrophage metalloelastase
(10-12, 17-19).
(IFN-) to induce the antifibrotic
chemokines monokine induced by interferon- (MIG) and
interferon-inducible protein-10 (17). MIG, which is induced in
macrophages almost exclusively by IFN-, has been implicated in
chronic inflammation and viral and protozoan infections, as well as
T-cell trafficking, chemotaxis, and activation (20-26). MIG may also
play an important role in regulating tissue granulation and remodeling
by inhibiting angiogenesis (27, 28).
on MIG gene
expression. Our data identify NF-B activation as mediating the
cross-talk between the ECM and IFN-. Furthermore, our studies have
also uncovered a previously uncharacterized critical role for NF-B
in mediating IFN--induced STAT activation of MIG independent of
HA.
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
(specific activity, 3.0 × 105 units/ml with endotoxin level less than 0.2 ng/mg) was
purchased from Invitrogen. Proteasome inhibitor-1, wortmannin, and MEK
inhibitor PD98059 were purchased from Calbiochem. Stock solutions of
reagents were tested for lipopolysaccharide contamination using
Limulus amoebocyte assay (Sigma).
70 °C.
154 site,
gcagaaattccctgggatctgag; 154M mutant, gcagaaattcAAtgggatctgag; 129
site, tagggttttccccaggacgatc; and 129M mutant,
tagggttttcAAcaggacgatc. Additionally, double-stranded DNA probes of the
following consensus sequences were used for cold competition analysis:
NF-B, tagggttttccccaggacgatc and STAT-1,
catgttatgcatattcctgtaagtg (Santa Cruz Biotechnology). For supershift
analysis, nuclear extracts were simultaneously incubated with 1 µg of
the indicated antibody and the labeled probe prior to EMSA. The
following antibodies were obtained from Santa Cruz Biotechnology:
STAT-1 p84/p91, NF-B p50, NF-B p65, and NF-B p52.
1117-bp 5'MIG promoter luciferase reporter construct
(pGL-2, Promega) into the luciferase reporter gene (pGL-3; Promega) by
PCR using the following primers with Mlu and XmaI sites
added to facilitate subcloning: left primer, gcgcacgcgtttccacatccaggtagcaact; right primer,
gcgccccgggttgagtcactgtgttggagtga. Specific mutations in this 284-bp
construct were made using the Mega Primer Mutagenesis technique
described elsewhere (35). The following primers were used to
generate the mutations: M154 (left), gcagaaattcaatgggatctgag; M129
(left), tagggttttcaacaggacgatc; downstream (right),
cttagatcgcagatctcgag; upstream (left), tagcaaaataggctgtcccc. The
fidelity of the mutations was checked by sequencing on an ABI 377 automated sequencer.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
on MIG Expression Requires a Region
on the MIG Promoter between 235 and +43--
A series of deletional
mutants of the MIG promoter were made to identify the
HA-responsive elements. Both the synergistic induction of
MIG promoter activity by HA plus IFN- as well as the
IFN- induction alone were lost in promoter fragments less than 235
bp upstream of the start site (Fig. 1).
This is not surprising since HA alone does not induce MIG in MH-S
cells, and loss of the IFN--responsive element-1 (RE-1) at
198/167 on the promoter would inhibit the response to IFN- (32,
34). Thus, the area of the promoter responsible for the synergistic induction of MIG by HA and IFN- is located on the 5'-MIG
promoter between the 235 and +43 sites. Although this area includes
RE-1, we have shown previously that the RE-1 alone is not
sufficient to account for the synergistic enhancement of MIG gene
expression by HA fragments and IFN- (17).
View larger version (55K):
[in a new window]
Fig. 1.
Synergy between HA and
IFN- on MIG expression requires a region on
the MIG promoter between 235 and +43. MH-S
cells were transfected with constructs containing serial deletions of
the 5'-MIG promoter upstream of a CAT reporter. Transfected
cells were stimulated with HA (200 µg/ml) ± IFN- (500 units/ml) for 18 h. Promoter activity was assayed by CAT
enzyme-linked immunosorbent assay. These results represent the average
of six identical experiments.
on MIG Expression
Requires NF-B--
HA alone has no effect, and IFN- alone has a
minimal effect on expression of MIG mRNA, but HA dramatically
increases the effect of IFN- on MIG expression (in Fig.
2, note the typical MIG mRNA
doublet). The synergistic induction of MIG by HA plus IFN- is
completely inhibited by PS-1 (an inhibitor of the NF-B activation
pathway) but not by wortmannin (an inhibitor of
phosphatidylinositol 3-kinase) or the MEK inhibitor PD98059. Of note,
the minimal induction of MIG by IFN- alone is not inhibited by PS-1
(third lane versus sixth lane). These
data are consistent with previous results demonstrating the ability of
low molecular weight HA to induce NF-B (36). Thus, the data in Fig.
2 suggest that HA-induced NF-B activity plays a role in MIG
transcription.
View larger version (72K):
[in a new window]
Fig. 2.
The synergy between HA fragments and
IFN- on MIG expression requires
NF-B. MH-S cells were stimulated with HA
(200 µg/ml) ± IFN- (500 units/ml) for 6 h in the
presence or absence of the indicated inhibitors. RNA was isolated,
and Northern analysis was performed. This experiment is representative
of four identical experiments.
B p50/p50 Homodimers and p50/p65
Heterodimers Bind to NF-B-like Sites at 154 and 129 Sites on the
5'-MIG Promoter--
Because inhibiting NF-B activity prevented the
synergistic up-regulation of MIG by HA and IFN-, we searched the
promoter region defined in Fig. 1 for potential NF-B binding sites.
Analysis of this region reveals two NF-B-like sites at 154 and
129. Thus, we performed EMSA on nuclear extracts from MH-S
macrophages stimulated with HA ± IFN- for 1 h using a
32P-radiolabeled DNA probe encompassing the 154
NF-B-like site (5'-gcagaaattccctgggatctgag-3')
(NF-B-like sequence underlined). As shown in Fig.
3a, HA induces binding
of a complex to the 154 site, which is competed away by cold
consensus NF-B probe but not cold consensus STAT-1. Additionally,
supershifts with antibodies to the NF-B proteins p50 and p65 reveal
that the protein binding to the 154 site consists of both p50/p50
homodimers and p50/p65 heterodimers. Furthermore, when we utilized a
probe that contained a 2-bp mutation at this site, 154M
(5'-gcagaaattcAAtgggatctgag-3') (2 base pair substitution
capitalized), NF-B binding was inhibited (Fig. 3b).
View larger version (87K):
[in a new window]
Fig. 3.
Both NF- B p50/p50
homodimers and p50/p65 heterodimers bind to the 154
NF-B-like site on the 5'-MIG
promoter. EMSA was performed using nuclear extracts from
MH-S cells stimulated with HA (200 µg/ml) ± IFN- (500 units/ml) for 1 h and radiolabeled DNA probes from the
MIG promoter containing the 154 NF-B-like site
(a) or a mutant 154 site (b). Cold competition
was performed with unlabeled probes consisting of consensus NF-B or
STAT-1 and supershifts with the indicated antibodies. This
experiment is representative of four identical experiments.
129 site
(5'-tagggttttccccaggacgatc-3') (NF-B-like
sequence underlined) from the MIG promoter and nuclear extracts from MH-S macrophages stimulated with HA ± IFN- for 1 h. As seen in Fig. 4a,
HA induced the up-regulation of a protein-DNA complex that is competed
away by cold consensus NF-B but not cold consensus STAT-1.
Furthermore, supershifts with antibodies to p50, p65, and STAT-1
reveal that this protein consists of both p50/p50 and p50/p65 dimers.
Once again the binding of NF-B to this site appears specific in that
an identical probe with a 2-bp mutation at the predicted NF-B site,
129M (5'-tagggttttcAAcaggacgatc-3') (2 base pair
substitution capitalized), completely abrogates binding (Fig.
4b). Interestingly, at both the 129 and 154 sites in the unstimulated and IFN- alone stimulated conditions, there is also a
faint band running at the same level as the NF-B (Figs.
3a and 4a), and indeed these bands are
cold-competed with consensus NF-B (data not shown).
View larger version (89K):
[in a new window]
Fig. 4.
Both NF- B p50/p50
homodimers and p50/p65 heterodimers bind to the 129
NF-B-like site on the 5'-MIG
promoter. EMSA was performed using nuclear extracts from
MH-S cells stimulated with HA (200 µg/ml) ± IFN- (500 units/ml) for 1 h and radiolabeled DNA probes from the
MIG promoter containing the 129 NF-kB-like site
(a) or a mutant 129 site (b). Cold competition
was performed with unlabeled probes consisting of consensus NF-B or
STAT-1 and supershifts with the indicated antibodies. This
experiment is representative of four identical experiments.
154 and 129 NF-B-like Sites on the MIG
Promoter Inhibit Both the Synergistic Induction of MIG Expression by HA
and IFN- as Well as MIG Induction by IFN- Alone--
To
determine the functional significance of HA-induced NF-B proteins
binding to the 154 and 129 sites of the MIG promoter, we
designed a promoter construct using the 284 to +43 fragment of the
MIG promoter upstream of a firefly luciferase reporter gene
(p284). We then mutated the NF-B-like sites at 154 (pM154), 129
(pM129), and both 154 and 129 (pM129/154), identical to the mutant
probes used in the EMSA studies. Independent mutations at either of
these two sites slightly decrease the synergy between HA and IFN-,
and mutations at both the 154 and 129 sites completely eliminated
the synergy (Fig. 5). Surprisingly
independent and dual mutations at these sites also decreased IFN-
induction of MIG expression. In the IFN--stimulated cells, there was
significant difference between wild type promoter (p284)
versus mutants: pM154 (p = 0.0023), pM129
(p < 0.0001), and pM129/154 (p < 0.0001). The inhibition was most pronounced in the constructs with the dual mutations in both the 154 and the 129 sites but is also evident in the 129 mutant and to a lesser degree in the 154 mutant.
These data complement the EMSA data and suggest that NF-B binding at
both the 154 and 129 sites is necessary for the synergy between HA
and IFN-. Furthermore, they demonstrate a role for NF-B in the
full induction of induction of MIG by IFN- alone.
View larger version (34K):
[in a new window]
Fig. 5.
The 154 and 129
NF-B-like sites on the MIG
promoter are necessary for synergistic induction of MIG
expression by HA plus IFN- as well as MIG
induction by IFN- alone. MH-S cells were
transfected with constructs containing 284 bp of the 5'-MIG
promoter ± point mutations in the 154 (pM154), the 129
(pM129), or the 154 + 129 (pM154/129) sites upstream of a
luciferase reporter. Transfected cells were stimulated with HA (200 µg/ml) ± IFN- (500 units/ml) for 18 h. Promoter
activity was assayed by luciferase activity. These data are the result
of four identical experiments.
B p50 Is Present in Resting and IFN--stimulated
Macrophages--
The functional data in Fig. 5 suggest that the 154
and 129 NF-B binding sites contribute to MIG induction by IFN-
alone. Although we did not observe an increase in NF-B with IFN-
stimulation alone, in both Figs. 3 and 4 there appears to
be constitutive NF-B binding. To further evaluate this possibility,
we performed EMSA on nuclear extracts from MH-S macrophages stimulated
with IFN- with and without HA for 1 h using
32P-radiolabeled DNA probes containing the consensus
sequence for NF-B. As shown in Fig. 6,
there is a light band in the unstimulated and IFN- alone stimulated
lanes that migrates in a similar fashion to the darker bands (NF-B)
present in the HA-stimulated lanes. Furthermore, these faint bands in
the unstimulated and IFN- alone lanes are competed by cold NF-B,
and in addition, antibodies to p50 but not p65 supershift the band in
the IFN- ± HA lanes. Therefore, in unstimulated and
IFN- alone stimulated cells, the NF-B family member p50 is
present.
View larger version (97K):
[in a new window]
Fig. 6.
NF- B p50 is present
in resting and IFN--stimulated
macrophages. EMSA was performed using nuclear extracts from MH-S
cells stimulated with HA (200 µg/ml) ± IFN- (500 units/ml)
for 1 h and a radiolabeled DNA probe containing consensus NF-B.
Cold competition was performed with unlabeled probes consisting of
consensus NF-B or STAT-1 and supershifts with the indicated
antibodies. This experiment is representative of three identical
experiments.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
can regulate HA-induced chemokine expression (10, 11, 17, 37). Although HA alone does not
induce MIG expression in murine macrophages, it does synergize with
IFN- to further induce MIG expression at the level of transcription
(17).
B, and indeed, in
the present studies, pharmacologic inhibition of this signal
transduction pathway inhibited the ability of HA to synergize with
IFN- to up-regulate MIG (12, 36, 38, 39). Sequence analysis of the
MIG proximal promoter revealed two potential NF-B-like binding sites at 129 and 154. Using EMSA, we found increased binding at these sites in extracts from HA-stimulated cells.
Furthermore, transient transfection assays confirmed the functional
role of these binding sites in mediating the synergistic effect between HA and IFN- as mutations in both sites were required to completely eliminate the synergy. Surprisingly, the 129 and 154 sites were also necessary for the full induction of MIG by IFN- alone.
Mutations at either of these sites individually decreased
IFN--induced MIG expression. Mutations at both the 129 and 154
sites together dramatically inhibited IFN--induced MIG. Thus, even
in the absence of HA-induced NF-B activation, our data suggest that
NF-B plays an important role in the full induction of MIG by
IFN-.
signaling acts via STAT-1 and
does not activate NF-B (40-43). This concept is consistent with our
own EMSA data that did not show an up-regulation of NF-B binding
upon stimulation with IFN- alone. However, our data suggest that
upon stimulation with IFN-, NF-B family members cooperate with
IFN--induced STAT-1 to induce MIG expression perhaps via the
recruitment of a coactivator. Inhibition of the individual sites (154
or 129) leads to a decrease in IFN--induced MIG expression.
Furthermore, mutating both the 129 and the 154 sites simultaneously
completely inhibits NF-B binding, resulting in marked diminution of
IFN--induced MIG expression. Upon stimulation with HA, IB is
degraded, and p50/p65 heterodimers are free to translocate to the
nucleus and bind to the MIG promoter. We propose that the
activated p50/p65 heterodimers account for HA-induced synergy of MIG
expression (Fig. 7). Consistent with this
model are our results using the drug PS-1, which inhibited HA-induced synergy but did not inhibit IFN--induced MIG expression (Fig. 2).
PS-1 acts by blocking the degradation of IB and hence the ability of
p50/p65 heterodimers to translocate to the nucleus. Based on the work
of Wong et al. (34), our results are somewhat surprising.
Using transient transfection assays, this group determined that the
RE-1 was necessary and sufficient for IFN--induced MIG expression
(independent of the 129 and 154 sites) (34). However, their
reporter assays employed either multimers of the RE-1 or the RE-1
upstream of a thymidine kinase promoter, and perhaps such constructs
served to emphasize the role of STAT-1 in MIG transcription,
mitigating the potential role of NF-B (34).
View larger version (13K):
[in a new window]
Fig. 7.
A model for the synergistic induction of MIG
by HA and IFN- . In cells stimulated with both IFN- and low
molecular weight HA, HA-induced activation of NF-B p50/p65
heterodimers synergize with IFN--induced STAT-1, possibly via
a coactivator, markedly increasing MIG expression.
) and environmental signals induced by the
extracellular matrix (HA). Indeed, both CREB-binding protein and p300
bind to STAT and NF-B to promote transcription (44-47). Nguyen and
Benveniste (48, 49) have proposed such a model for the regulation of
the CD40 promoter by IFN-. They have shown that IFN--induced CD40
transcription requires both STAT-1 and NF-B (48, 49). In their
model, however, NF-B binding is the result of IFN--induced
TNF- production that in turn leads to the activation of NF-B (48,
49). In our experiments, we do not believe TNF- is playing a role in
MIG activation since we have shown previously that
IFN--induced MIG and the synergy between HA and IFN- occur in the
presence of TNF- neutralizing antibodies as well as in experiments
using macrophages from TNF- knockout mice (17).
B binding sites in the
IFN--induced expression of MIG suggests that these NF-B binding sequences are not empty but rather occupied by NF-B family members, as suggested in Figs. 3, 4, and 6. Recently it has been shown that p50
homodimers can bind DNA and in fact are necessary for transcriptional
activation of the bcl-2 gene (50, 51). Thus, potentially
constitutively expressed NF-B family members such as p50 homodimers
or p50 complexed with an as yet unidentified protein are playing a
direct role in IFN--induced transcription or an indirect role by
bending the DNA in such a way that improves STAT-1 binding and
allows for increased transcription. The faint bands binding to the
154 and 129 sites using extracts from unstimulated and
IFN--stimulated cells (Figs. 3 and 4) as well as the experiments using consensus NF-B probe (Fig. 6) demonstrate that at
the very least, p50 is available for binding in the IFN--stimulated
cells. Whether this binding is in the form of p50 homodimers or
heterodimers consisting of p50 and other NF-B family members is
currently under investigation. Nevertheless, such a model might even
predict a role for a coactivator even in the absence of NF-B
signaling. The marked induction of MIG in the presence of HA and
IFN-, as opposed to IFN- alone, may be the result of cooperative
induction of MIG by the HA-induced NF-B p50/p65 heterodimers
promoting more efficient coactivator binding or perhaps even a
different co-activator. Experiments are underway to demonstrate the
ability of p300 to not only mediate IFN- plus HA-mediated
up-regulation of MIG but also the up-regulation of MIG by IFN- alone.
B signaling is emerging as an important mechanism by which cells
of the immune system detect foreign invaders. It has been shown that
lipopolysaccharide, CpG DNA, and bacteria-derived flagelin all activate
the innate immune response via toll-like receptors and NF-B
signaling (52-54). In our model, "degraded self" in the
form of low molecular weight HA serves a similar role by activating
NF-B signaling and modulating macrophage function. The importance of
low molecular weight HA in participating in the immune response has
recently been dramatically demonstrated in a bleomycin model of lung
injury in the CD44 knockout mice (55). These mice are unable to remove
degraded HA and thus accumulate low molecular weight HA in their lungs
that results in uncontrolled inflammation and death after bleomycin
lung injury (55). In this light, ECM breakdown products are revealed as
not only the targets of inflammation but as important modulators of the
inflammatory process.
ACKNOWLEDGEMENT
FOOTNOTES
To whom correspondence should be addressed: 600 North Wolfe
St., Jefferson Bldg. B1-170, Baltimore, MD 21287. Tel.: 410-502-7037; Fax: 410-502-7048.
ABBREVIATIONS
, tumor necrosis
factor-;
IFN-, interferon-;
RE-1, IFN--response
element-1;
MIG, monokine induced by IFN-;
CAT, chloramphenicol
acetyltransferase;
STAT, signal transducers and activators of
transcription;
MEK, mitogen-activated protein kinase/extracellular
signal-regulated kinase kinase;
CREB, cAMP-response element-binding
protein;
EMSA, electrophoretic mobility shift assay.
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Hidenori, K.,
Raines, E. W.,
Bornfeldt, K. E.,
Roberts, J. M.,
and Ross, R.
(1996)
Cell
87,
1069-1078[CrossRef][Medline]
[Order article via Infotrieve]
2.
Hance, A. J.,
and Crystal, R. G.
(1975)
Am. Rev. Respir. Dis.
112,
657-668[Medline]
[Order article via Infotrieve]
3.
Clark, R.,
Wikner, N.,
Doherty, D.,
and Norris, D.
(1988)
J. Biol. Chem.
263,
12115-12123 4.
Laskin, D.,
Soltys, R.,
Berg, R.,
and Riley, D.
(1994)
Am. J. Respir. Cell Mol. Biol.
10,
58-64[Abstract]
5.
West, D.,
Hampson, I.,
Arnold, F.,
and Kumar, S.
(1985)
Science
228,
1324-1326 6.
Rennard, S. I.,
Hunninghake, P. B.,
Bitterman, P. B.,
and Crystal, R. G.
(1981)
Proc. Natl. Acad. Sci. U. S. A.
78,
7147-7151 7.
Laurent, T.,
and Fraser, J.
(1992)
FASEB J.
6,
2397-2404[Abstract]
8.
Lazaar, A.,
Alvelda, S.,
Pilewski, J.,
Brennan, B.,
Pure, E.,
and Panettieri, R.
(1994)
J. Exp. Med.
180,
807-816 9.
Laurent, T. C.
(1995)
Ann. Rheum. Dis.
54,
429 10.
Horton, M. R.,
Burdick, M. D.,
Strieter, R. M.,
Bao, C.,
and Noble, P. W.
(1998)
J. Immunol.
160,
3023-3030 11.
McKee, C.,
Penno, M.,
Cowman, M.,
Burdick, M.,
Strieter, R.,
Bao, C.,
and Noble, P.
(1996)
J. Clin. Invest.
98,
2403-2413[Medline]
[Order article via Infotrieve]
12.
McKee, C.,
Lowenstein, C.,
Horton, M., Wu, J.,
Bao, C.,
Chin, B.,
Choi, A.,
and Noble, P.
(1997)
J. Biol. Chem.
272,
8013-8018 13.
Noble, P.,
Lake, F.,
Henson, P.,
and Riches, D.
(1993)
J. Clin. Invest.
91,
2368-2377[Medline]
[Order article via Infotrieve]
14.
Balazs, E. A.,
Watson, D.,
Duff, I. F.,
and Roseman, S.
(1967)
Arthritis Rheum.
10,
357-376[Medline]
[Order article via Infotrieve]
15.
Bjermer, L.,
Lundgren, R.,
and Hallgren, R.
(1989)
Thorax
44,
126-131 16.
Gazzinelli, R. T.,
Oswald, I. P.,
James, S. L.,
and Shen, A.
(1992)
J. Immunol.
148,
1752
17.
Horton, M. R.,
McKee, C. M.,
Bao, C.,
Liao, F.,
Farber, J. M.,
Hodge-DuFour, J.,
Pure, E.,
Oliver, B. L.,
Wright, T. M.,
and Noble, P. W.
(1998)
J. Biol. Chem.
273,
35088-35094 18.
Horton, M. R.,
Shapiro, S.,
Bao, C.,
Lowenstein, C. J.,
and Noble, P. W.
(1999)
J. Immunol.
162,
4171-4176 19.
Horton, M. R.,
Olman, M. A.,
Bao, C.,
White, K. E.,
Choi, A. M.,
Chin, B. Y.,
Noble, P. W.,
and Lowenstein, C. J.
(2000)
Am. J. Physiol.
279,
L707-L715 20.
Vanguri, P.,
and Farber, J. M.
(1990)
J. Biol. Chem.
265,
15049-15056 21.
Narumi, S.,
Tominaga, Y.,
Tamaru, M.,
Shimai, S.,
Okmura, H.,
Nishioji, K.,
Itoh, Y.,
and Okanoue, T.
(1997)
J. Immunol.
158,
5536-5544[Abstract]
22.
Luster, A. D.,
Unkeleee, J. C.,
and Ravetch, J. V.
(1985)
Nature
315,
672-676[CrossRef][Medline]
[Order article via Infotrieve]
23.
Liao, F.,
Rabin, R. L.,
Yannelli, J. R.,
Koniaris, L. G.,
Vanguri, P.,
and Farber, J. M.
(1995)
J. Exp. Med.
182,
1301-1314 24.
Amichay, D.,
Gazzinelli, R.,
Karupiah, G.,
Moench, T.,
Sher, A.,
and Farber, J.
(1996)
J. Immol.
157,
4511-4520
25.
Asensio, V.,
and Campbell, I.
(1997)
J. Virol.
71,
7832-7840[Abstract]
26.
Loetscher, M.,
Gerber, B.,
Leotscher, P.,
Jones, S. A.,
Piali, L.,
Clark-Lewis, I.,
Baggiolini, M.,
and Moser, B.
(1996)
J. Exp. Med.
184,
963-969 27.
Strieter, R. M.,
Polverini, P. J.,
Kunkel, S. L.,
Arenberg, D. A.,
Burdick, M. D.,
Kasper, J.,
Dzuiba, J.,
Van Damme, J.,
Walz, A.,
Marriott, D.,
Chan, S.,
Roczniak, S.,
and Shanafelt, A. B.
(1995)
J. Biol. Chem.
270,
27348-27357 28.
Strieter, R. M.,
Polverini, P. J.,
Arenberg, D. A.,
and Kunkel, S. L.
(1995)
Shock
4,
155-160[Medline]
[Order article via Infotrieve]
29.
Mbawuike, I.,
and Herscowitz, H.
(1989)
J. Leukocyte Biol.
46,
119-127[Abstract]
30.
Lee, H.,
and Cowman, M.
(1994)
Anal. Biochem.
219,
278-287[CrossRef][Medline]
[Order article via Infotrieve]
31.
Powell, J. D.,
Lerner, C. G.,
Ewoldt, G. R.,
and Schwartz, R. H.
(1999)
J. Immunol.
163,
6631-6639 32.
Guyer, N. B.,
Severns, C. W.,
Wong, P.,
Feghali, C. A.,
and Wright, T. M.
(1995)
J. Immunol.
155,
3472-3480[Abstract]
33.
Dignam, J. D.,
Lebovitz, R. M.,
and Roeder, R. G.
(1983)
Nucleic Acids Res.
11,
1475-1489 34.
Wong, P.,
Severns, C. W.,
Guyer, N. B.,
and Wright, T. M.
(1994)
Mol. Cell. Biol.
14,
914-922 35.
Picard, V.,
and Bock, S.
(1999)
in
PCR Cloning Protocols
(White, B., ed), Vol. 67
, pp. 183-188, Humana Press, Totowa, NJ
36.
Noble, P. W.,
McKee, C. M.,
Cowman, M.,
and Shin, H. S.
(1996)
J. Exp. Med.
183,
2373-2378 37.
Hodge-DuFour, J., P. W., N.,
Horton, M. R.,
Bao, C.,
Wysoka, M.,
Burdick, M. D.,
Strieter, R. M.,
Trinchieri, G.,
and Puré, E.
(1997)
J. Immunol.
15,
2492-2500
38.
Oertli, B.,
Beck-Schimmer, B.,
Fan, X.,
and Wuthrich, R. P.
(1998)
J. Immunol.
161,
3431-3437 39.
Termeer, C.,
Benedix, F.,
Sleeman, J.,
Fieber, C.,
Voith, U.,
Ahrens, T.,
Miyake, K.,
Freudenberg, M.,
Galanos, C.,
and Simon, J. C.
(2002)
J. Exp. Med.
195,
99-111 40.
Imada, K.,
and Leonard, W. J.
(2000)
Mol. Immunol.
37,
1-11[CrossRef][Medline]
[Order article via Infotrieve]
41.
Ransohoff, R. M.
(1998)
N. Engl. J. Med.
338,
616-618 42.
Schindler, C.
(1999)
Exp. Cell Res.
253,
7-14[CrossRef][Medline]
[Order article via Infotrieve]
43.
Deb, A.,
Haque, S. J.,
Mogensen, T.,
Silverman, R. H.,
and Williams, B. R.
(2001)
J. Immunol.
166,
6170-6180 44.
Shenkar, R.,
Yum, H. K.,
Arcaroli, J.,
Kupfner, J.,
and Abraham, E.
(2001)
Am. J. Physiol.
281,
L418-L426 45.
Paulson, M.,
Pisharody, S.,
Pan, L.,
Guadagno, S.,
Mui, A. L.,
and Levy, D. E.
(1999)
J. Biol. Chem.
274,
25343-25349 46.
Luo, G.,
and Yu-Lee, L.
(2000)
Mol. Endocrinol.
14,
114-123 47.
Ghosh, A. K.,
Yuan, W.,
Mori, Y.,
Chen, S.,
and Varga, J.
(2001)
J. Biol. Chem.
276,
11041-11048 48.
Nguyen, V. T.,
and Benveniste, E. N.
(2000)
J. Biol. Chem.
275,
23674-23684 49.
Nguyen, V. T.,
and Benveniste, E. N.
(2002)
J. Biol. Chem.
277,
13796-13803 50.
Michalopoulos, I.,
and Hay, R. T.
(1999)
Nucleic Acids Res.
27,
503-509 51.
Kurland, J. F.,
Kodym, R.,
Story, M. D.,
Spurgers, K. B.,
McDonnell, T. J.,
and Meyn, R. E.
(2001)
J. Biol. Chem.
276,
45380-45386 52.
An, H., Yu, Y.,
Zhang, M., Xu, H., Qi, R.,
Yan, X.,
Liu, S.,
Wang, W.,
Guo, Z.,
Guo, J.,
Qin, Z.,
and Cao, X.
(2002)
Immunology
106,
38-45[CrossRef][Medline]
[Order article via Infotrieve]
53.
Jones, B. W.,
Means, T. K.,
Heldwein, K. A.,
Keen, M. A.,
Hill, P. J.,
Belisle, J. T.,
and Fenton, M. J.
(2001)
J. Leukocyte Biol.
69,
1036-1044 54.
Gewirtz, A. T.,
Navas, T. A.,
Lyons, S.,
Godowski, P. J.,
and Madara, J. L.
(2001)
J. Immunol.
167,
1882-1885 55.
Teder, P.,
Vandivier, R. W.,
Jiang, D.,
Liang, J.,
Cohn, L.,
Pure, E.,
Henson, P. M.,
and Noble, P. W.
(2002)
Science
296,
155-158
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  K. A. Scheibner, S. Boodoo, S. Collins, K. E. Black, Y. Chan-Li, P. Zarek, J. D. Powell, and M. R. Horton The Adenosine A2a Receptor Inhibits Matrix-Induced Inflammation in a Novel Fashion Am. J. Respir. Cell Mol. Biol., March 1, 2009; 40(3): 251 - 259. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Kanda and S. Watanabe Prolactin Enhances Interferon-{gamma}-Induced Production of CXC Ligand 9 (CXCL9), CXCL10, and CXCL11 in Human Keratinocytes Endocrinology, May 1, 2007; 148(5): 2317 - 2325. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Li, D. K. Pritchard, X. Wang, D. R. Park, R. E. Bumgarner, S. M. Schwartz, and W. C. Liles cDNA microarray analysis reveals fundamental differences in the expression profiles of primary human monocytes, monocyte-derived macrophages, and alveolar macrophages J. Leukoc. Biol., January 1, 2007; 81(1): 328 - 335. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Boodoo, E. W. Spannhake, J. D. Powell, and M. R. Horton Differential regulation of hyaluronan-induced IL-8 and IP-10 in airway epithelial cells Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L479 - L486. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Scheibner, M. A. Lutz, S. Boodoo, M. J. Fenton, J. D. Powell, and M. R. Horton Hyaluronan Fragments Act as an Endogenous Danger Signal by Engaging TLR2 J. Immunol., July 15, 2006; 177(2): 1272 - 1281. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. B. Kwak, S. W. Lee, H. M. Jin, H. Ha, S. H. Lee, S. Takeshita, S. Tanaka, H.-M. Kim, H.-H. Kim, and Z. H. Lee Monokine induced by interferon-{gamma} is induced by receptor activator of nuclear factor {kappa}B ligand and is involved in osteoclast adhesion and migration Blood, April 1, 2005; 105(7): 2963 - 2969. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Proost, S. Verpoest, K. V. de Borne, E. Schutyser, S. Struyf, W. Put, I. Ronsse, B. Grillet, G. Opdenakker, and J. V. Damme Synergistic induction of CXCL9 and CXCL11 by Toll-like receptor ligands and interferon-{gamma} in fibroblasts correlates with elevated levels of CXCR3 ligands in septic arthritis synovial fluids J. Leukoc. Biol., May 1, 2004; 75(5): 777 - 784. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. E. Pummill and P. L. DeAngelis Alteration of Polysaccharide Size Distribution of a Vertebrate Hyaluronan Synthase by Mutation J. Biol. Chem., May 23, 2003; 278(22): 19808 - 19814. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. M. Turino and J. O. Cantor Hyaluronan in Respiratory Injury and Repair Am. J. Respir. Crit. Care Med., May 1, 2003; 167(9): 1169 - 1175. [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |