|
Originally published In Press as doi:10.1074/jbc.M208551200 on August 28, 2002
J. Biol. Chem., Vol. 277, Issue 47, 45034-45040, November 22, 2002
Identification of Ribosomal Proteins Specific to
Higher Eukaryotic Organisms*
Cyril
Gueydan §,
Corinne
Wauquier ,
Christelle
De Mees¶,
Georges
Huez , and
Véronique
Kruys
From the Laboratoire de Chimie Biologique and the
¶ Laboratoire de Biologie du Développement, Institut de
Biologie et de Médecine Moléculaires, Université
Libre de Bruxelles, 12 rue des Profs. Jeener et Brachet,
6041 Gosselies, Belgium
Received for publication, August 21, 2002
 |
ABSTRACT |
This report describes the identification of
a novel protein named PS1D (GenbankTM
accession number AJ272345), which is composed of an S1-like RNA-binding domain, a (cysteine)×3-(histidine) CCCH-zinc finger, and a
very basic carboxyl domain. PS1D is expressed as two isoforms, probably
resulting from the alternative splicing of mRNA. The long PS1D
isoform differs from the short one by the presence of 48 additional
amino acids at its amino-terminal extremity. Analysis of PS1D
subcellular distribution by cell fractionation reveals that this
protein belongs to the core of the eukaryotic 60S ribosomal subunit.
Interestingly, PS1D protein is a highly conserved protein among
mammalians as murine, human, and simian PS1D homologues share more than
95% identity. In contrast, no homologous protein is found in lower
eukaryotes such as yeast and Caenorhabditis elegans. These
observations indicate that PS1D is the first eukaryotic ribosomal
protein that is specific to higher eukaryotes.
 |
INTRODUCTION |
In recent years the molecular comprehension of the synthesis,
structure, and function of the ribosome has progressed tremendously (see Ref. 1 for review). Hence, the three-dimensional structure of the
archaeal and bacterial ribosomal subunits determined by x-ray
crystallography confirmed that the catalytic activity of ribosome
mainly relies on the rRNA, implying that the ribosome is a ribozyme
(2-5). The ribosomal proteins
(rps)1 are mostly distributed
on the subunit surface, except for the active cleft and the interface
between the two subunits. At present, the main function of rps seems to
be the stabilization of highly compact rRNA structures by filling the
gaps between RNA domains. Most rps interact with RNA. However, whereas
some of them are globular, others are composed of globular bodies with
flexible extensions devoid of tertiary structure. These extensions
penetrate into the interior, filling the gaps between neighboring RNA
structures (2).
Despite a high degree of sequence conservation, the ribosomal RNA
present in the large ribosomal subunit has undergone a significant increase in size during the course of evolution (Escherichia
coli 23 S rRNA, 2904 kb; Yeast 26 S rRNA, 3393 kb; Mouse 28 S
rRNA, 4712 kb) (6). Because one of the primary functions of rps is to
stabilize the highly compact rRNA structure, it is not surprising to
notice that the transition from prokaryotes to lower eukaryotes has
also resulted in an increase in the total number of rps (54 in E. coli and 78 in yeast) (7, 8). Although the transition from low to
high eukaryotes resulted also in a significant increase in size of 28 S
rRNA, mammalian ribosomes count only one additional rp, L28, which is
absent in Saccharomyces cerevisiae. However, a homologue of
rat L28 is found in Saccharomyces pombe (see
"Discussion").
Here we describe the identification and characterization of two protein
isoforms present in the large ribosomal subunit of the mammalian
ribosome that have no identified equivalent in yeast.
 |
EXPERIMENTAL PROCEDURES |
Material--
Enzymes were purchased from Invitrogen and Roche.
Oligonucleotides were purchased from Invitrogen and Genset. The
synthetic peptide use to immunize rabbits was purchased from
Eurogentec. The anti-P0 human serum was purchased from Immunovision.
The anti-L28 antibody (kind gift of Dr. D. Nadano) is described in
(9).
DNA Constructs--
The pcDNA3.1-PS1D was generated by PCR
amplification of the PS1D coding sequence using the following
oligonucleotides: CCGCTCGAGATGTCGTCCTGTCGAGTGGATAAG (forward,
short isoform); GCCGCTCGAGATGGAGAACTTGCCTGCACTG (forward, long
isoform); GCTCTAGATTCCTTGTGCTTCTTCTTGTGCTTC (reverse, both isoforms).
The PCR products were digested by XhoI and XbaI
and ligated in the pCDNA3.1/Myc-His plasmid (Invitrogen) cut with the same enzymes. The PtrcHis-PS1D was generated by PCR amplification using the following oligonucleotides: CGGGATCCCGAGAACTTGCCTGCACTGTATAC (forward), and GCAAGCTTTTCCTTGTGCTTCTTCTTGTGC (reverse). The PCR product was digested by BamHI and HindIII and
ligated in the pTrcHIS2A plasmid (Invitrogen) cut with the same
enzymes. The PS1D-GFP constructs were generated by inserting
PCR-amplified fragments encoding different domains of the PS1D protein
(Fig. 4C) into the pEGFP-C3 vector (Clontech Laboratories, Palo Alto, CA). The
following oligonucleotides were used in the PCRs:
GCCGCTCGAGATGGAGAACTTGCCTGCACTG (forward, eGFP-PS1D Nterm,
eGFP-PS1D 1); CTCGAGCCTGAAGAGGAAGAGGAAAAAG (forward, eGFP-PS1D 2);
GCTCTAGATTCCTTGTGCTTCTTCTTGTGCTTC (reverse, eGFP-PS1D, eGFP-PS1D 2);
CCTCTAGATCAGAGAATACTTGGTTCC (reverse, eGFP-PS1D 1); CGGGATCCGGCCTGAGACCATGGAGAAC (forward, eGFP-PS1D Nterm);
GCGGATCCTCCTTGTGCTTCTTCTTGTGCT (reverse, eGFP-PS1D Nterm). All of
the DNA constructs were verified by DNA sequencing.
RNA Analysis--
Tissue RNA blot was purchased from
Clontech and was first hybridized with an
antisense PS1D riboprobe. For normalization, the blot
was then hybridized with an actin cDNA probe synthesized with a
Rediprime kit (Amersham Biosciences).
DNA Transfection and Fluorescence Microscopy--
Cos-7 cells
were transfected using the Fugene (Roche) according to the
manufacturer's instructions. Fluorescence microscopy was
performed as described in (10).
Antibody Preparation and Western Blotting--
Rabbits were
immunized with a 15-mer peptide (Fig. 1) coupled to keyhole
limpet hemocyanin carrier protein and complemented with complete Freund
adjuvant (Difco Laboratories, Detroit, MI). Two boost injections
were performed, respectively, 2 and 4 weeks after the first
immunization using the same peptide complemented with incomplete Freund
adjuvant. Blood was harvested 2 weeks after the last injection and
conserved overnight at 4 °C for clotting. Serum was harvested by
low-speed centrifugation of the clotted blood. Immunoglobulins were
precipitated with ammonium sulfate, and anti-PS1D antibodies were
further purified by affinity chromatography on a PS1D-peptide-Sepharose
column prepared as described in (11).
Purified anti-PS1D antibodies were dialyzed overnight against
phosphate-buffered saline, concentrated to 0.5 mg/ml with
polyethylene-glycol, and stored at 20 °C in 50% glycerol, 0.01%
azide. This antibody solution was used in Western blot experiments
(dilution 1/100) according to a protocol described elsewhere (12).
Cell Fractionation and Ribosome Isolation--
Cytoplasmic and
nuclear extracts from NIH3T3 cells were prepared as follows: cells were
incubated in lysis buffer (10 mM Hepes, pH 7.6, 60 mM KCl, 1 mM EDTA, 0.075% Nonidet P-40, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl
fluoride) for 3 min on ice and centrifuged at 300 × g.
The cytoplasmic supernatant was harvested. The nuclear fraction was
recovered by vigorous vortexing in 20 mM Tris, 400 mM NaCl, 1 mM EDTA, 25% glycerol, incubated on
ice for 10 min, and further centrifuged at 13,000 × g
for 10 min to pellet genomic DNA. To isolate the ribosomal fraction,
the cytoplasmic extract was first centrifuged at 13,000 × g to pellet mitochondria. The supernatant was then layered
on top of a 1 M sucrose cushion and centrifuged at
200,000 × g to pellet ribosomes as described by Madjar in (11).
Ribosomal Subunit Fractionation--
Ribosomes were disrupted by
incubation in 60 mM EDTA on ice for 30 min. Ribosomes were
then layered on top of a 15-30% sucrose gradient (gradient length is
9 cm) and were ultra-centrifuged at 100,000 × g for
17 h in a SW41 rotor. The 30-ml gradient was harvested in 1-ml
aliquots, and the OD at 260 nm was determined for each fraction.
Ribosomal RNA was extracted by the Trizol method (200 µl of each
fraction), and the samples were analyzed by agarose gel
electrophoresis. Ribosomal proteins were recovered by ethanol precipitation (90% final, 1 h at 80 °C), dissolved in
Laemmli buffer, and analyzed by Western blot.
 |
RESULTS |
Identification and Characterization of PS1D--
A cDNA
encoding PS1D was isolated in the course of a cDNA library
screening to identify murine RNA-binding proteins (12). The cDNA
was entirely sequenced and appeared to be identical to EST clone
W88172. The largest open reading frame present in the sequence encoded
a putative protein of 193 amino acids. An InterProScan of this
polypeptide sequence against the Prosite database revealed the presence
of three different domains (13). The amino-terminal sequence
contains an RNA-binding domain highly homologous to that of bacterial
ribosomal protein S1 and which is also found in other RNA-binding
proteins (14). A (cysteine)×2-(histidine)-(cysteine) (CCHC)-type zinc
finger is present in the middle of the open reading frame (ORF), and
two bipartite nuclear localization signals are identified in the basic
carboxyl-terminal end of the sequence. Because of the presence of this
S1 RNA-binding domain, the putative protein was named PS1D.
To identify the 5' end of PS1D mRNA, PCR reactions were performed
with the cDNA library using a forward primer hybridizing in the
cloning vector and a reverse primer hybridizing near the 5' end of the
first isolated cDNA. The first 24 nucleotides of the longest
PCR product obtained with these primers was identical to the cDNA
previously isolated, but they contained a 179-nucleotide insertion at
position 25. This insertion results in a 42-amino acid lengthening of
the ORF at the amino-terminal side (Fig.
1). A Blast comparison (15) of the long
and short isolated cDNA against the EST database revealed the
existence of two EST populations with 5' ends corresponding to the ends
of the long and the short cDNAs. Taken together, these observations
indicate that PS1D can be transcribed as two alternatively spliced
mRNAs, probably encoding two PS1D isoforms.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 1.
The nucleotide sequence of PS1D
cDNA. The predicted amino acid sequence is given under the
nucleotide sequence in single-letter code. The underlined
sequence is not present in the PS1D mRNA encoding the short
isoform. The initiation codons of the long and the short isoforms and
the sequence corresponding to a putative poly A signal are
boxed. The peptide sequence used for raising
antibodies is dot underlined. The putative nuclear
bipartite signal sequences are underlined in brackets. The
S1 domain is stipple shaded, and the zinc finger sequence is
hatch shaded. The sequence corresponding to the PS1D 2
mutant is gray shaded. (See Fig. 4C.)
|
|
PS1D mRNA Tissue Distribution--
The expression of PS1D
mRNA was examined by Northern blot analysis using poly(A)+ RNA
isolated from various mouse tissues and PS1D antisense riboprobe (see
"Experimental Procedures"). As shown in Fig.
2 (upper panel), mRNA of
~1.5 kb was detected in all tissues with significant differences in
abundance. PS1D mRNA mostly accumulates in the liver, brain, and
heart. PS1D mRNA expression is moderate in the kidney and testis
and very weak in the spleen, lung, and skeletal muscle. Normalization
of the Northern blot with an actin probe confirmed the significant
variations in PS1D expression between tissues (Fig. 2, lower
panel). It should be mentioned that resolution of the Northern
blot did not allow the detection of two mRNA species because these
differ by only 179 nucleotides. However, reverse transcription-PCR
experiments performed on total RNA extracted from NIH3T3 cells
confirmed the existence of these two mRNA and suggested that the
mRNA encoding the long isoform was the most abundant in this cell
line (data not shown).

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 2.
Differential expression of PS1D mRNA in
various tissues. Multiple tissue Northern blot was hybridized with
a PS1D riboprobe (upper panel). After autoradiography, the
probe was stripped off and the membrane was rehybridized with an actin
cDNA probe (lower panel).
|
|
Expression of PS1D Isoforms--
To confirm that PS1D ORFs can be
decoded into proteins, the long and short coding sequences were
subcloned in the pcDNA3.1 expression vector in phase with a c-myc
tag. These DNA constructs were transfected into Cos-7 cells, and the
expression of PS1D isoforms was analyzed by Western blot using either
9E10 or anti-PS1D antibodies (see "Experimental Procedures"). As
shown in Fig. 3, both constructs lead to
the synthesis of proteins detectable with the two antibodies. However,
the long and the short isoforms migrated on SDS-PAGE with apparent
molecular masses of 40 and 35 kDa, respectively. Taking into account
the 3-kDa mass of the myc tag, PS1D proteins are thus resolved as 37- and 32-kDa proteins, the 5-kDa difference between the two isoforms
corresponding to the 48-amino-acid sequence separating the two
ATG initiation codons (Fig. 1). The expression of PS1D cDNA
encoding the long isoform in bacteria leads to the synthesis of a
protein migrating at a molecular mass of 42-43 kDa, which is slightly
higher than the eukaryotic form (Fig. 3B). The
discrepancy between the theoretical masses of PS1D isoforms (26.5 and
21.2 kDa for the long and short isoforms, respectively) and their
apparent molecular masses on SDS-PAGE most probably results from the
very basic nature of PS1D proteins. Moreover, the higher
electrophoretic mobility of the eukaryotic form as compared with the
bacterial one suggests that PS1D proteins are post-translationally
modified, probably by methylation and/or acetylation of lysine
residues. Indeed, such modifications are commonly observed on several
ribosomal proteins (16, 17) and are known to increase mobility in SDS
gels.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 3.
Expression of epitope-tagged PS1D protein in
COS-7 cells and E. coli. Eukaryotic expression vectors
encoding the myc-tagged PS1D short or long isoforms were transfected in
COS-7 cells by the Fugene method. A, the proteins were
detected by Western blot using either the 9E10 anti-myc tag antibody
(left panel) or a specific anti-PS1D antibody
(right panel). B, expression of epitope-tagged
PS1D protein large isoform in COS-7 cells and E. coli. The proteins were detected by Western blot using an
anti-PS1D antibody.
|
|
PS1D Protein Sub-cellular Localization--
COS-7 cells were
transfected with chimeric PS1D/GFP expression plasmids in which a PS1D
sequence was inserted in 5' or 3' of the GFP sequence (PS1D/GFP C-ter
and PS1D/GFP N-ter, respectively). The localization of PS1D/GFP fusion
proteins was determined by fluorescent microscopy. As shown in Fig.
4A, PS1D-GFP C-ter accumulates both in the cytoplasm and the nucleus, predominantly at the level of
nucleoli (upper panel, right), whereas the
unmodified GFP protein remains in the cytoplasm (upper
panel, left). Surprisingly, the PS1D/GFP N-ter fusion
protein is only detectable in the nucleus, mostly in the nucleoli
(lower panel, left), suggesting that the GFP
extension placed at the amino-terminal side of PS1D protein precludes
its association to ribosomal subparticles and its transfer to the
cytoplasm. Treatment of the cells with saponin and ethidium bromide
significantly altered the fluorescent signal in the nucleus except at
the level of the nucleoli, further confirming the nucleolar accumulation of PS1D/GFP (lower right).

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4.
Localization of GFP/PS1D fusion proteins in
COS-7 cells. A, eukaryotic expression vector encoding
different GFP fusion proteins were transfected in COS-7 cells. GFP
fluorescence analysis was performed using a standard fluorescein
isothiocyanate (FITC) filter. Nuclear localization was confirmed by
treating the cells with saponin (0.2%) and ethidium bromide
(lower right panel). B, COS-7 cells were
transfected with different GFP expression vectors. Two days after
transfection, cells were treated with actinomycin-D (1 µg/ml,
3.5 h; middle panels), -amanitin (10 µg/ml,
3.5 h; right panels), or left untreated (left
panels). C, schematic representation of the PS1D
sequences fused to GFP. Numbers indicate the amino acid positions in
the long PS1D isoform peptidic sequence. The S1 domain is stipple
shaded.
|
|
As ribosomal RNA synthesis and ribosome assembly constitute the main
metabolic activities of nucleoli, we determined whether GFP/PS1D
nucleolar localization was dependent upon ongoing rRNA transcription.
COS-7 cells transfected with PS1D/GFP N-ter construct were
treated with actinomycin-D or -amanitin, two transcriptional inhibitors differentially blocking RNA polymerase I activity. Whereas
PS1D/GFP nucleolar localization was not altered by RNA polII-inhibiting
concentrations of -amanitin (Fig. 4B, compare left and right panels), doses of actinomycin D,
known to inhibit RNA polymerase I activity, completely abolished
GFP/PS1D accumulation in the nucleoli but not in other parts of the
nucleus (Fig. 4B, middle panels). These results
indicated that the nucleolar localization of the GFP/PS1D fusion is
coupled to rRNA synthesis.
Sequence determinants specifying PS1D nucleolar localization were
mapped by analyzing the distribution of truncated forms of PS1D/GFP
N-ter protein (Fig. 4C). These experiments revealed that the
82 carboxyl-terminal amino acids fused to GFP (PS1D 2) accumulated in
the nucleoli as the full-length protein (Fig. 4B, compare
left upper and middle panels). In contrast, the
PSD1 1-GFP protein containing only the 159 amino-terminal amino acids
remained mostly cytoplasmic (left lower panel). This
observation confirmed the presence of a nuclear localization signal in
the basic domain of the protein as predicted with the InterProScan
algorithm and also demonstrated that the nucleolar accumulation is
dependent on an element present in the carboxyl-terminal portion of PS1D.
Nucleolar accumulation of proteins is a common feature of either
ribosomal proteins or proteins involved in the maturation of rRNA (18).
These latter proteins usually remain localized in the nucleus, whereas
the ribosomal proteins are re-imported in the cytoplasm as assembled
ribosomal subunits. To determine whether PS1D belongs to one or the
other class of proteins, the distribution of native PS1D was analyzed
by cell fractionation. NIH3T3 cells were fractionated into cytoplasmic
and nuclear extracts, and distribution of PS1D protein was analyzed by
Western blot. Moreover, the fractionated extracts were verified by
Western blot analysis of nuclear and cytoplasmic proteins, c-myc and
IkB, respectively. As shown in Fig.
5A, PS1D is predominantly
found in the cytoplasmic fraction. Further fractionation of the
cytoplasmic extract by ultracentrifugation at 200,000 × g through a sucrose cushion revealed that PS1D segregated
into the same ribosomal pellet as the L28 ribosomal protein (Fig.
5B). Moreover, PS1D proteins remain associated with
ribosomes upon high salt wash (600 mM KCl) in the presence or the absence of EDTA (50 mM) (Fig. 5C),
indicating that PS1D isoforms, like P0 protein, are core components of
the ribosome.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 5.
Subcellular localization of PS1D proteins
determined by cell fractionation. A, nuclear and
cytoplasmic extracts of NIH3T3 cells were prepared as described under
"Experimental Procedures." Nuclear and cytoplasmic extracts
corresponding to a same number of cells were resolved by SDS page and
submitted to Western blotting using either a polyclonal anti-PS1D
antibody, anti-myc (Santa Cruz Biotechnology), or anti-IkB antibodies
(Santa Cruz Biotechnology). Arrows indicate the proteins
revealed in the Western blots: upper panel, PS1D;
middle panel, c-myc; and lower panel, IkB.
B, ribosomes were isolated from NIH3T3 cytoplasmic extracts
by centrifugation at 200,000 × g through a 1 M sucrose cushion. The ribosomal pellet was dissolved in a
volume of Laemmli buffer equivalent to the volume of the supernatant.
The same volume of supernatant and ribosomal fractions was analyzed by
Western blot using anti-PS1D antibody or an anti-ribosomal L28
antibody. C, ultracentifuged ribosomal pellet was dissolved
in high-salt buffer in the presence or absence of EDTA (50 mM), incubated for 30 min on ice, and ultracentrifuged
through a 1 M sucrose cushion. PS1D was assayed by Western
blot analysis of equal volumes of supernatant and resuspended pellet.
As a control, P0 ribosomal protein was analyzed in the different
fractions.
|
|
To determine whether PS1D belongs to the 40 or 60s ribosomal subunit,
the ribosomal pellet was dissociated with EDTA and fractionated on
15-30% linear sucrose gradient. Separation of the large and small
ribosomal subunits was monitored by OD measurement at 260 nm (Fig.
6A) and analysis of total RNA
in each fraction by agarose electrophoresis (Fig. 6B).
Western blot analysis of each fraction with anti-PS1D and anti-P0
antibodies revealed that PS1D isoforms, the same as P0, is exclusively
found in fractions containing 60S subunits (Fig. 6C).
Altogether, these data indicate that PS1D proteins participate to the
formation of the core of the 60 S ribosomal subunit.

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 6.
Association of PS1D proteins with the 60S
ribosomal subunit. Ribosomes isolated from NIH3T3 cells were
dissociated with EDTA and centrifuged on a linear 15-30% sucrose
gradient. A, OD at 260 nm of the different fractions after
centrifugation. B, RNA from the different fractions was
extracted with Trizol and visualized by agarose gel electrophoresis and
ethidium bromide staining. The positions of the ribosomal 18 S and 28 S
RNA are indicated. C and D, Western blot analysis
of the fractions using either the anti-PS1D polyclonal antibody
or an anti-ribosomal P0 antibody.
|
|
Analysis of PS1D Distribution in Different Species--
A database
search was performed to investigate the existence of PS1D in other
species. Surprisingly, Blast analysis of the GenBank EMBL database with
the PS1D cDNA sequence revealed only the existence of human and
simian PS1D homologs (accession numbers AK022506 and AB060897) having
high degree of similarity with the murine sequence (data not shown).
The predicted protein sequence encoded by these cDNAs (accession
numbers Q9NP64 and BAB46900) has more than 96% identity with the
murine PS1D long or short isoforms. Furthermore, a Blast search of the
human cDNA nucleotide sequence against the human ESTs database
revealed a second subset of human cDNA with a shorter 5' region
(for example, see accession numbers AW005427, BE858870, and BI160080). The predicted translation of this group of ESTs defines an open reading
frame in which the first AUG corresponds to the initiation codon
for the short PS1D isoform (data not shown). The human PS1D gene might thus lead to the synthesis of two alternatively
spliced transcripts as in mouse.
Interestingly, a Pblast search of PS1D protein against the
S. cerevisiae ORF database (19) or the
C. elegans wormpep database (release 61;
20,040 sequences) failed to identify any homologous protein, suggesting
that the 60 S ribosomal subunit of these organisms does not contain
equivalents of PS1D proteins.
 |
DISCUSSION |
This report describes the identification of a novel protein
belonging to the 60 S ribosomal subunit. Indeed, cell fractionation experiments revealed that PS1D is a cytoplasmic protein
co-sedimenting with ribosomes upon ultracentrifugation
(Fig. 5, A and B). Moreover, PS1D was
exclusively found in 60 S-enriched fractions after
ultracentrifugation of dissociated ribosomes on 15-30% sucrose
gradient (Fig. 6) and remained associated to ribosomes upon high salt
wash (Fig. 5C). Sherton and Wool (Ref. 20 and references
therein) showed that mammalian ribosomal subunits dissociated in
0.88 M KCl and separated by centrifugation can re-associate
to form translationally active ribosomes once they are returned to
physiological salt concentration. However, it is clear that increasing
the ionic strength to the equivalent of 0.5 M KCl induces
the dissociation of a number of accessory factors from ribosomal
subunits (21, 22). Altogether, these observations indicate that PS1D is
a protein belonging to the core of the 60 S ribosomal subunit. This is
further supported by the structural features of PS1D. Like several
ribosomal proteins, PS1D contains a very basic domain, a glutamic
acid-rich repeat, and a zinc finger (7). In addition, its
amino-terminal domain contains a RNA binding motif originally
identified in bacterial rp S1 (23). This S1 motif most probably confers
to PS1D the RNA binding activity that allowed its identification in our
screening experiment. The carboxyl-terminal part of PS1D, which is very basic, confers a nucleolar localization to PS1D/GFP fusion proteins (Fig. 4). This subcellular localization is another common feature of
ribosomal proteins that transit to the nucleolus to be assembled with
nascent rRNA. Many rps contain a bipartite nuclear localization signal
that is characterized by a sequence started by two basic residues
followed by a 10-amino-acid non-conserved spacer and an element of five
residues, of which three are basic (24). It should be noted that the
PS1D carboxyl-terminal domain contains two such motifs that might
mediate PS1D nucleolar translocation (see Fig. 1).
In contrast to PS1D/GFP C-ter fusion protein, the PS1D/GFP N-ter
protein is sequestered in the nucleus, most probably because of its
inability to be assembled into ribosomal subunits.
It should be noticed that analysis of native PS1D distribution by cell
fractionation failed to reveal any PS1D protein in the nucleus (Fig.
5A), thereby indicating that in natural conditions the
nuclear transit of PS1D proteins is very brief.
Two distinct populations of murine PS1D cDNAs or ESTs can be
isolated or found in the databases. These cDNAs differ from each other by a 179-nucleotide-long insertion in PS1D 5' untranslated region
(Fig. 1), leading to the synthesis of two isoforms. The long isoform
contains a amino-terminal extension of 48 amino acids modifying the S1
motif and is significantly more abundant than the short one in all
tissues and cell lines examined (Figs. 5 and 6 and data not shown). At
this point, it is not known whether both isoforms can be assembled at
different ratios in a 60 S subunit or whether only one of the two
isoforms is incorporated in one subunit. In the latter case, ribosomes
would be heterogeneous for PS1D protein, most of them containing a PS1D
long isoform. So far, only two rps have been shown to be encoded as two
isoforms: human S 24, which is encoded by alternatively spliced
mRNAs (25) and human S 4, which results from two transcribed genes,
one on the X and a second on the Y chromosome (26). Whereas S 24 isoforms differ from each other only by the presence of three
additional amino acids at the C terminus of the long isoform, S 4Y and
S 4X differ at 19 of 263 positions. Both S4X and
S4Y genes are transcribed in human males, and S 4 isoforms
appear to be functionally interchangeable (27). PS1D is the first rp so
far described that is expressed as two isoforms in several mammalian
species. Moreover, the amino-terminal extremity of the two isoforms
differ from each other by the presence or the absence of 48 amino
acids in the S1 domain. Although the functional importance of these 48 additional amino acids remains to be investigated, we speculate that
PS1D is the first mammalian rp described so far that may result in
ribosome functional heterogeneity.
Analysis of PS1D mRNA accumulation in different tissues revealed a
significant variability of expression. This variability might reflect
the abundance of ribosomes in each tissue, because a similar profile of
expression was found for another rp mRNA, L28 (data not shown).
So far, 80 rps have been identified in the mammalian ribosome, and 47 belong to the large 60 S subunit. Most of these proteins were first
identified and purified in rat by Wool and co-workers (20, 28, 29). The
sequence of these proteins was established either by complete edman
degradation of overlapping peptides or partial peptide sequencing and
subsequent cDNA cloning. Although the reason why they did not
identify PS1D is not obvious, it might result from their extraction
procedure to isolate ribosomal proteins. Indeed, several protocols have
been described to isolate such components, and the one they used in
their study might not have been efficient to extract PS1D proteins.
Among the 80 eukaryotic ribosomal proteins identified so far, 31 have
no homologues in the prokaryotic ribosome. However, all eukaryotic rps
are largely conserved between yeast and rat, two evolutionarily distant
eukaryotic species. Indeed, the average identity of related rps from
rat and S. cerevisiae is 60%, the range going
from 40% for rp P1 to 88% for L41 (7). Until now, only the mammalian
L28 protein had no equivalent in the S. cerevisiae protein database. However, a L28 homologue exists
in S. pombe (accession number T37749). PS1D is
thus the unique rp for which no homologue can be found in lower
eukaryotes such as yeast and C. elegans. Indeed,
the only proteins presenting similarities to PS1D is the C. elegans protein mog-5, a 1200-amino-acid RNA helicase
homologous to the human protein HRH1 and yeast Prp22p. However, the
alignment of PS1D with these proteins revealed that these similarities
cover only their S1 domains. Moreover, both mog-5 and Prp22P proteins
are much larger than PS1D (Prp22p, 1145 amino acids; Rrp5p, 1729 amino
acids; PS1D, 241 amino acids), and other features distinguish these
proteins from PS1D. Prp22p contains a DEAD helicace and a
helicase carboxyl domain not found in PS1D; Rrp5p contains 8 repeats of
the S1 motif, whereas PS1D contains only 1 such motif. Finally, both
proteins have identified human homologues, HRH1 for Prp22p and BAA11502
for Rrp5p. It is worth mentioning that no PS1D homologue could be found
in the translated subset of Xenopus ESTs. However, the lower
number of EST entries existing for this species (220,182 sequences released in August 2002) does not allow formal exclusion of
the presence of PS1D homologue in that species. Altogether, these data
indicate that PS1D is rp specific to higher eukaryotes and that
ribosomes from lower and higher eukaryotes display structural
differences that might be exploited in the design of new ribosomal
antibiotics (30).
It should be mentioned that the primary and secondary structure of 28 S
rRNA has been modified in the course of evolution of eukaryotes.
Indeed, 28 S rRNA of higher eukaryotes is significantly longer than in
lower eukaryotes because of the insertion of 12 distinct domains within
an otherwise very conserved 28 S molecule. Furthermore, comparison of
28 S rRNA from two vertebrates, Xenopus and mouse,
reveals the extension of only three of these domains (6). This rRNA
elongation has been accompanied by the synthesis of additional
proteins. Whereas some of these eukaryote-specific rps might be
involved in the stabilization of the 28 S rRNA structure, others might
be involved in other processes such as translation initiation or
translational regulation. The structural analysis of higher eukaryotic
ribosomal subunits should provide more information about the role of
these rps including PS1D.
 |
ACKNOWLEDGEMENTS |
We thank Drs. Denis Lafontaine and Bruce
Beutler for helpful discussions and Dr. D. Christophe
and C. Christophe-Hobertus for a plasmid gift and advice for
the fluorescence microscopy experiments.
 |
FOOTNOTES |
*
This work was funded by the European Community (Contract
QLK3-2000-00721), the Fund for Medical Scientific Research (Belgium, Grant 3.4618.01), and the Actions de Recherches Concertées (Grant 00-05/250).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AJ272345.
§
To whom correspondence should be addressed. Tel.: 322-6509806; Fax:
322-6509800; E-mail: cgueydan@ulb.ac.be.
Published, JBC Papers in Press, August 28, 2002, DOI 10.1074/jbc.M208551200
 |
ABBREVIATIONS |
The abbreviations used are:
rps, ribosomal
proteins;
rp, ribosomal protein;
EMBL, European Molecular
Biology Laboratory;
EST, expressed sequence tag;
GFP, green fluorescent
protein.
 |
REFERENCES |
| 1.
|
Lafontaine, D. L.,
and Tollervey, D.
(2001)
Nat. Rev. Mol. Cell. Biol.
2,
514-520[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Ban, N.,
Nissen, P.,
Hansen, J.,
Capel, M.,
Moore, P. B.,
and Steitz, T. A.
(1999)
Nature
400,
841-847[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Schluenzen, F.,
Tocilj, A.,
Zarivach, R.,
Harms, J.,
Gluehmann, M.,
Janell, D.,
Bashan, A.,
Bartels, H.,
Agmon, I.,
Franceschi, F.,
and Yonath, A.
(2000)
Cell
102,
615-623[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Wimberly, B. T.,
Brodersen, D. E.,
Clemons, W. M., Jr.,
Morgan-Warren, R. J.,
Carter, A. P.,
Vonrhein, C.,
Hartsch, T.,
and Ramakrishnan, V.
(2000)
Nature
407,
327-339[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Yusupov, M. M.,
Yusupova, G. Z.,
Baucom, A.,
Lieberman, K.,
Earnest, T. N.,
Cate, J. H.,
and Noller, H. F.
(2001)
Science
292,
883-896[Abstract/Free Full Text]
|
| 6.
|
Hassouna, N.,
Michot, B.,
and Bachellerie, J. P.
(1984)
Nucleic Acids Res.
12,
3563-3583[Abstract/Free Full Text]
|
| 7.
|
Wool, I. G.,
Chan, Y. L.,
and Gluck, A.
(1995)
Biochem. Cell Biol.
73,
933-947[Medline]
[Order article via Infotrieve]
|
| 8.
|
Mager, W. H.,
Planta, R. J.,
Ballesta J-P, G.,
Lee, J. C.,
Mizuta, K.,
Suzuki, K.,
Warner, J. R.,
and Woolford, J.
(1997)
Nucleic Acids Res.
25,
4872-4875[Abstract/Free Full Text]
|
| 9.
|
Nadano, D.,
Ishihara, G.,
Aoki, C.,
Yoshinaka, T.,
Irie, S.,
and Sato, T. A.
(2000)
Jpn. J. Cancer Res.
91,
802-810[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Christophe-Hobertus, C.,
Duquesne, V.,
Pichon, B.,
Roger, P. P.,
and Christophe, D.
(1999)
Eur. J. Biochem.
265,
491-497[Medline]
[Order article via Infotrieve]
|
| 11.
|
Celis, J. E.
(1994)
Cell biology, a laboratory handbook
, 1st Ed
, pp. 657-691, Academic Press, San Diego, CA
|
| 12.
|
Gueydan, C.,
Droogmans, L.,
Chalon, P.,
Huez, G.,
Caput, D.,
and Kruys, V.
(1999)
J. Biol. Chem.
274,
2322-2326[Abstract/Free Full Text]
|
| 13.
|
Zdobnov, E. M.,
and Apweiler, R.
(2001)
Bioinformatics
17,
847-848[Abstract/Free Full Text]
|
| 14.
|
Bycroft, M.,
Hubbard, T. J.,
Proctor, M.,
Freund, S. M.,
and Murzin, A. G.
(1997)
Cell
88,
235-242[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Altschul, S. F.,
Gish, W.,
Miller, W.,
Myers, E. W.,
and Lipman, D. J.
(1990)
J. Mol. Biol.
215,
403-410[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Arnold, R. J.,
Polevoda, B.,
Reilly, J. P.,
and Sherman, F.
(1999)
J. Biol. Chem.
274,
37035-37040[Abstract/Free Full Text]
|
| 17.
|
Williamson, N. A.,
Raliegh, J.,
Morrice, N. A.,
and Wettenhall, R. E.
(1997)
Eur. J. Biochem.
246,
786-793[Medline]
[Order article via Infotrieve]
|
| 18.
|
Olson, M. O.,
Dundr, M.,
and Szebeni, A.
(2000)
Trends Cell Biol.
10,
189-196[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Mewes, H.,
Frishman, D.,
Gruber, C.,
Geier, B.,
Haase, D.,
Kaps, A.,
Lemcke, K.,
Mannhaupt, G.,
Pfeiffer, F.,
Schuller, C.,
Stocker, S.,
and Weil, B.
(2000)
Nucleic Acids Res.
28,
37-40[Abstract/Free Full Text]
|
| 20.
|
Sherton, C.,
and Wool, I. G.
(1972)
J. Biol. Chem.
247,
4460-4467[Abstract/Free Full Text]
|
| 21.
|
Zhang, W.,
Wagner, B. J.,
Ehrenman, K.,
Schaefer, A. W.,
DeMaria, C. T.,
Crater, D.,
DeHaven, K.,
Long, L.,
and Brewer, G.
(1993)
Mol. Cell. Biol.
13,
7652-7665[Abstract/Free Full Text]
|
| 22.
|
Siomi, M.,
Zhang, Y.,
Siomi, H.,
and Dreyfuss, G.
(1996)
Mol. Cell. Biol.
16,
3825-3832[Abstract]
|
| 23.
|
Subramanian, A. R.
(1983)
Prog. Nucleic Acid Res. Mol. Biol.
28,
101-142[Medline]
[Order article via Infotrieve]
|
| 24.
|
Dingwall, C.,
and Laskey, R. A.
(1991)
Trends Biochem. Sci.
16,
478-481[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Xu, L., He, G. P., Li, A.,
and Ro, H. S.
(1994)
Nucleic Acids Res.
22,
646-655[Abstract/Free Full Text]
|
| 26.
|
Fisher, E. M.,
Beer-Romero, P.,
Brown, L. G.,
Ridley, A.,
McNeil, J. A.,
Lawrence, J. B.,
Willard, H. F.,
Bieber, F. R.,
and Page, D. C.
(1990)
Cell
63,
1205-1218[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Zinn, A. R.,
Alagappan, R. K.,
Brown, L. G.,
Wool, I.,
and Page, D. C.
(1994)
Mol. Cell. Biol.
14,
2485-2492[Abstract/Free Full Text]
|
| 28.
|
Tsurugi, K.,
Collatz, E.,
Todokoro, K.,
and Wool, I. G.
(1977)
J. Biol. Chem.
252,
3961-3969[Abstract/Free Full Text]
|
| 29.
|
Tsurugi, K.,
Collatz, E.,
Wool, E. G.,
and Lin, A.
(1976)
J. Biol. Chem.
251,
7940-7946[Abstract/Free Full Text]
|
| 30.
|
Bottger, E. C.,
Springer, B.,
Prammananan, T.,
Kidan, Y.,
and Sander, P.
(2001)
EMBO Rep.
2,
318-323[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
T. Zhang, N. Delestienne, G. Huez, V. Kruys, and C. Gueydan
Identification of the sequence determinants mediating the nucleo-cytoplasmic shuttling of TIAR and TIA-1 RNA-binding proteins
J. Cell Sci.,
December 1, 2005;
118(23):
5453 - 5463.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|