 |
INTRODUCTION |
Mitochondria and chloroplasts are unique among eukaryotic
organelles in possessing their own genomes. These extra-chromosomal DNAs are expressed by the organelle-specific transcription and translational machinery (1-5). The yeast
mt1 genome encodes seven
protein subunits of the energy-transducing enzyme complexes imbedded in
the inner membrane, one ribosomal protein (i.e. Var1) of the
small mitoribosomal subunit, two rRNAs (i.e. 21 S and 15 S
rRNAs for the large and small subunits, respectively), a complete set
of tRNAs, and an RNA subunit of mt RNase P (1, 5). The rest of the mt
proteins (i.e. ~97%) are encoded by the nuclear genome,
translated in the cytoplasm, and then imported into different
compartments of mitochondria using protein-specific import mechanisms
(6-10). Because the vast majority of mt proteins are the products of
nuclear genes, mt protein import represents a fundamental subject of
investigation in the cellular protein trafficking and the biogenesis of
the organelle.
In recent years a great deal of experimental effort has unveiled some
distinct features of the mt protein import pathway. Most of the
nuclear-encoded mt proteins so far studied are synthesized with an
N-terminal presequence that is positively charged with a notable
absence of negatively charged residues and has the potential to form an
amphipathic 
-helix (6, 7, 10). The mt matrix proteins are imported
into mitochondria by a general import pathway composed of cytoplasmic
chaperones, two hetero-oligomeric membrane complexes (a TOM complex in
the outer membrane and a TIM complex in the inner membrane), and the mt
chaperones. In the cytosol the translocation competent conformation of
the precursor is maintained by one or more cytoplasmic
ATP-dependent chaperone proteins (6-8). The N-terminal
presequence of the precursor interacts with a receptor on the cytosolic
surface of the mt outer membrane (11-13). This interaction then
catalyzes the inward movement of preprotein through the
membrane-integrated TOM/TIM channel complexes at the contact sites of
the mt outer and inner membranes. Protein import across both mt
membranes into the matrix is facilitated by dynamic interaction between
the TOM and TIM complexes (14), which provide an aqueous channel in the
hydrophobic lipid bilayer for protein transport (15). Further
translocation of preprotein into the mt matrix requires a membrane
potential across the inner membrane, ATP hydrolysis, and mt chaperones
(6-10). In the final event of the import process the N-terminal
presequence of the imported protein is often proteolytically removed by
the mt processing peptidase to generate a mature protein (16, 17).
We have been investigating mt transcription in budding yeast,
Saccharomyces cerevisiae. It was found that a nonanucleotide (TATAAGTAA(+2)) promoter (18, 19) and a single mt RNA polymerase consisting of two protein subunits (a 145-kDa core polymerase and a
43-kDa transcription factor Mtf1p) (20-25) are necessary for mt
gene-specific transcription. Both subunits of the mt RNA polymerase are
nuclear gene products and imported into the mt matrix after synthesis
in the cytosol. Interestingly, the initiating methionine is the only
amino acid missing from the mature Mtf1p purified from the isolated
mitochondria (25) suggesting that mt import of Mtf1p occurs without
cleavage of a targeting sequence. To understand the import mechanism of
Mtf1p, we have extended our earlier observation (26) by studying Mtf1p
import in the simultaneous absence of mt membrane potential,
ATP, and physiological temperature, of much more comprehensive deletion
mutagenesis, including internal deletions, following urea denaturation
and its capacity to drive the import of a fusion protein containing a
mouse cytoplasmic protein (i.e. DHFR). Mt fractionation
demonstrated that the in vitro synthesized protein is
translocated to the same sub-mitochondrial site as the endogenous
protein. Together with the earlier observation (26) Mtf1p import
appears to be robust requiring little direct investment of energy or
other commonly used import factors. We suggest that the
energy-requiring step is in the formation during synthesis of an
import-competent conformation of Mtf1p. The Mtf1p import mechanism
appears to represent a unique example of mt protein trafficking and translocation.
| |
EXPERIMENTAL PROCEDURES |
Materials--
The vector pGEM3 and the rabbit reticulocyte
lysate (RRL)-based transcription-translation (TNT)-coupled
protein expression system were purchased from Promega, Inc., Madison,
WI. Redivue L-[35S]methionine (37 TBq/mmol,
1000Ci/mmol, and 10 mCi/ml) was obtained from Amersham Biosciences. The
restriction enzymes and Vent polymerase were purchased from New England
BioLabs. The QuikChange site-directed mutagenesis kits were from
Stratagene, Inc. The oligonucleotide primers were made at the
University of Chicago core facilities or from Integrated DNA
Technologies, Inc.
Generation of Truncated Mtf1p--
The full-length and deletion
derivatives of Mtf1p were generated in vitro using various
truncated MTF1 templates in the TNT expression system.
Different MTF1 regions were subcloned into the pGEM3 vector by PCR. For
full-length Mtf1p expression, the whole coding sequence of MTF1 was
copied from the parent plasmid by PCR using a 5' primer (MTF1-5':
AGGAATTCAGTAAGAAGGCTCTGCAACTATGTCTGTTCCAATCCCTGGT) and a 3' primer (MTF1-3':
GATTCGTCGACTCAACCAGAGTGCTCTGTTTGATACAT). The boldfaced triplets, ATG in the 5' primer and TCA (complementary to
TGA codon) in the 3' primer, represent translational start and stop
signals for MTF1 expression. The underlined sequences represent the
restriction sites (i.e. EcoRI and
SalI) used in the subsequent subcloning into the pGEM3
vector. Similarly, the 5' deletion clones of the MTF1 (i.e.
(2-30) and (2-52)) were constructed with different 5' primers
corresponding to various regions of the MTF1 coding sequence and the
above-described 3' primer (i.e. MTF1-3'). The 3' deletion
of MTF1 (i.e. (226-341), (299-341), and
(325-341)) was also generated using three different 3' primers
carrying a stop codon and the above-described 5' primer (i.e. MTF1-5'). These PCR DNA products were cloned into the
EcoRI/SalI sites of pGEM3 vector and then used
for in vitro protein expression.
The internal deletion clones (100-144) and (153-196) were each
generated by two separate PCRs followed by two subsequent clonings. For
(100-144) construction the PCR MTF1 product encoding amino
acids 1-99 of the N-terminal region of Mtf1p was subcloned first into
the EcoRI/KpnI sites of the vector pGEM3, and
then another PCR product encoding amino acids 145-341 of the
C-terminal sequence of Mtf1p was ligated in-frame into the
KpnI/HindIII sites of the same vector.
This new construct carries a 45-amino acid internal deletion
(i.e. (100-144)) of Mtf1p sequence. Similarly, for the
(153-196) clone the PCR product corresponding to amino acids 1-152
of Mtf1p was subcloned into the EcoRI/KpnI sites
of vector pGEM3 followed by in-frame ligation of a 3' insert
corresponding to amino acids 197-341 of the Mtf1p sequence into the
KpnI/HindIII sites of the vector. The other three
internal deletion mutants (i.e. (50-90), (216-260),
and (272-291)) were generated with QuikChange site-directed
mutagenesis kits from the Stratagene, Inc.
Construction of Mtf1p and Mouse DHFR Chimera--
The hybrid
constructs between the full-length Mtf1p (i.e. 341 amino
acids) and the mouse cytosolic DHFR protein (i.e. 187 amino
acids) were generated by fusion of DHFR sequence either to the N or C
termini of Mtf1p. To generate the MTF1-DHFR gene fusion the MTF1
sequence was ligated into the EcoRI/SalI sites of
pGEM3, and the DHFR sequence was placed at the 3'-end of MTF1 in-frame
by ligation into the SalI/HindIII sites of the
same vector. At the fusion site two additional residues (Val and Asp)
were introduced due to the presence of the SalI site between
the MTF1 and DHFR sequences. Similarly, the DHFR-MTF1 fusion was
constructed by insertion of DHFR sequence into the
HindIII/PstI sites of pSP73 vector, and then the
MTF1 sequence was placed at the 3'-end of DHFR by ligation into the
PstI/EcoRI sites of the same vector. This gene
fusion creates Leu and Gln residues at the PstI site between
the DHFR and MTF1.
In Vitro Expression of Mtf1p and F1
--
The
coupled in vitro transcription-translation system of RRL
(TNT kits from Promega Corp.) was used for the synthesis of
Mtf1p and F1. F1, which is translocated
into the mitochondria via a conventional pathway, was used as a
control. Two micrograms of MTF1 or F1 template DNA were
added to the 50-µl reaction mixture containing 25 µl of RRL, 2 µl
of TNT reaction buffer, 1 µl of T7 RNA polymerase, 1 µl
of amino acid mixture (1 mM) without methionine, 4 µl of
[35S]methionine, and 1 µl of ribonuclease inhibitor
RNasin (40 units/µl). The reaction was completed by incubation at
30 °C for 1 h. In these coupled reaction conditions, the MTF1
template was transcribed under the control of the T7 promoter followed
by simultaneous translation of mRNA into Mtf1p products by rabbit
ribosomes during the same incubations. The quality and amount of each
35S-labeled Mtf1p product was examined by SDS-PAGE and
fluorography before the import assay.
Isolation of Mitochondria--
Mitochondria were isolated from
S. cerevisiae strain D273-10B according to the method of
Daum et al. (27). The protein concentration was determined
by the Bio-Rad Bradford protein assay method using bovine serum albumin
as a standard.
In Vitro Import of Labeled Mtf1p into the Isolated Yeast
Mitochondria--
The 35S-labeled Mtf1p was incubated with
isolated mitochondria in 100 µl of import reaction (0.6 M
sorbitol, 10 mM MOPS, pH 7.2, 80 mM KCl, 2 mM ATP, and 2 mM NADH) at 28 °C for 30 min
unless otherwise stated (e.g. Fig. 3). However, the time
course study demonstrated that the import of Mtf1p was essentially
complete by 5-10 min. After import, one half of each sample was
directly used to assess the total mt association of Mtf1p, and the
other half was treated with 20 µg of proteinase K on ice for 30 min to remove the nonimported Mtf1p. After adding protease inhibitor PMSF
(1 mM final) mitochondria were re-isolated by
centrifugation, lysed in the sample buffer (50 mM Tris-HCl,
pH 6.0, 2% SDS, and 5% -mercaptoethanol), and then electrophoresed
on a 10-20% gradient SDS-polyacrylamide gel. Mtf1p was visualized by
fluorography and measured by densitometric scanning. In some cases, a
3-20% gradient SDS-PAGE was also used for better resolution of the
precursor and mature forms of the control protein,
F1.
Sub-mitochondrial Fractionation of Imported Proteins--
The
sub-mitochondrial fractionation was carried out as described earlier
(28). After import and proteinase K treatment, mitochondria were
re-isolated and then suspended in 100 µl of import buffer without
bovine serum albumin. The mt suspension was diluted with 7 volumes of
20 mM HEPES buffer, pH 7.4, and kept on ice for 30 min.
This hypotonic solution results in swelling of the organelles that
leads to specific disruption of the mt outer membrane. Under these
conditions the inter membrane space contents are released into the
medium (28), which was separated from the mitoplasts (mitochondria
without outer membrane) by centrifugation at 12,000 × g for 15 min, and saved for analysis. The inner membrane of
mitoplasts was further disrupted by sonication as follows. The
mitoplast pellet was suspended in a 100-µl sonication buffer (20 mM HEPES, pH 7.4, 100 mM NaCl) and incubated on
ice for 10 min for swelling (28). The mixture was then quickly frozen
in a dry ice/ethanol bath and then thawed by immersing in a sonication water bath. After three rounds of freeze-thaw and sonication, the
sample was centrifuged for 30 min at 150,000 × g in a
Beckman Airfuge (air pressure, 30 p.s.i.) to separate the mt
matrix contents from the membrane fraction. The supernatant was saved
as a matrix material, whereas the membrane pellet was resuspended in
100 µl of sonication buffer. These mt fractions were dialyzed
overnight against 10 mM Tris-HCl, pH 7.4, 1 mM
EDTA buffer, and then lyophilized. The dry pellets were suspended in a
sample buffer and analyzed by SDS-PAGE and fluorography.
To assess the quality of this mt sub-fractionation, the presence of
endogenous mt marker proteins Mtf1p, cytochrome
b2 (inter membrane space protein), and ADP/ATP
carrier protein (inner membrane protein) in these sub-mitochondrial
fractions was determined by SDS-PAGE followed by immunoblotting with
the protein-specific antibodies. We generated the anti-Mtf1p antibody
by immunizing rabbit with recombinant Mtf1p, whereas both anti-cyt
b2 and anti-AAC antibodies were generously
provided by Drs. Nikolaus Pfanner (Germany) and Carla M. Koehler (Switzerland).
| |
RESULTS |
In Vitro Import of Mtf1p into Isolated Yeast Mitochondria--
The
powerful in vitro assay has been used to dissect different
biochemical steps of protein import into the mitochondria. We have used
this in vitro assay system to understand more thoroughly the
import strategy of Mtf1p using isolated yeast mitochondria. Import of
another matrix-targeted mt preprotein F1-ATPase subunit (F1) was followed as a control. Mt translocation of
F1 carrying a 33-amino acid presequence, involves the
classic import pathway (29). Equal counts of the
35S-labeled F1 or Mtf1p, generated in the
RRL-coupled transcription-translation reactions, were used in the
import studies. In the absence of proteinase K treatment, both mature
and precursor forms of F1 were co-precipitated with
mitochondria (Fig. 1, lane 1).
The large F1 (designated by "P"), which
appears to be the same size as the in vitro synthesized
protein, disappeared upon proteinase K treatment (Fig. 1, lane
2). Thus, this represents the precursor F1 that was
associated with mitochondria but not imported into the mt inner
membrane/matrix. On the other hand, the short form of F1
designated by "M " was an imported product (Fig. 1,
lanes 1 and 2) whose leader sequence was removed
by an mt matrix protease. In contrast, the apparent molecular size of
Mtf1p did not change after import (Fig. 1, compare lane 4 versus lane 5). Furthermore, a higher proportion
of the protein associated with the mitochondria was found in a
proteinase-resistant compartment in the case of Mtf1p than for
F1 (Fig. 1, lane 2 versus
lane 5). As described in more detail in a later section,
these proteinase K-resistant proteins were deemed to be inside the
mitochondria, because total F1 or Mtf1p became sensitive
to proteinase K when mitochondria following import were lysed with
Triton X-100 and then treated with proteinase K (Fig. 1, lanes
3 and 6). This result indicates that, whether
normalized to total import or mt association, Mtf1p appears to be
imported at least as efficiently as does F1.
View larger version (49K):
[in this window]
[in a new window]
|
Fig. 1.
In vitro import of Mtf1p and
F1. The import assays were
carried out at 28 °C for 30 min as described under "Experimental
Procedures." After incubation, mitochondria were isolated by
centrifugation and then gently re-suspended in the import buffer. One
third of the mt suspension remained untreated for mt-association assay,
one third of the mix was treated with proteinase K to identify the
imported Mtf1p, and the remaining one-third mix was treated with 0.1%
Triton X-100 followed by proteinase K digestion. After the addition of
protease inhibitor PMSF, each mt suspension was lyophilized, suspended
in gel buffer, and run on a SDS-PAGE. The radiolabeled protein was
visualized by fluorography. The "P " and "M
" letters at the left side indicate precursor (511-amino
acid peptide) and mature (478-amino acid peptide) forms of
F1, respectively.
|
|
Mtf1p Import in the Simultaneous Absence of Membrane Potential,
ATP, and Physiological Temperature--
We have previously shown that
the import of Mtf1p occurs in the absence of either membrane potential
or ATP (26). It is possible that for Mtf1p import the membrane
potential or exogenous ATP may serve as alternate energy sources. To
investigate this further, Mtf1p import into the mitochondria was
carried out under minimal conditions, i.e. in the
simultaneous absence of ATP, membrane potential, and physiological
temperature. In the control experiments, externally added ATP or/and
NADH was not required for the import of either F1 (Fig.
2A, lanes 1-3) or
Mtf1p (Fig. 2A, lanes 8-10) and thus did not
discriminate between their import pathways. However, when both
exogenous ATP and NADH were not provided, and the electrochemical gradient across the mt inner membrane was discharged with valinomycin (K+ ionophore) or/and CCCP (H+ ionophore),
import of F1 (Fig. 2A, lanes 4-6)
but not Mtf1p (Fig. 2A, lanes 11-13) was greatly
reduced. Similarly, Mtf1p (Fig. 2A, lane 14) but
not F1 (Fig. 2A, lane 7) was
imported in the simultaneous absence of electrochemical gradient
(CCCP/valinomycin-treated mitochondria), an exogenous energy (minus
ATP) and the endogenous source of energy (apyrase-treated import mix).
A comparable level of Mtf1p import but not F1 import was
also observed under these conditions when import was performed on ice
(Fig. 2B). Because there are no other examples of protein
import into mitochondria occurring in the simultaneous absence of these
import requirements, the Mtf1p import pathway appears to be unique.
View larger version (39K):
[in this window]
[in a new window]
|
Fig. 2.
Import of Mtf1p or
F1 in the absence of general
import factors. The import assay was carried out at 28 °C
(A) or on ice (B) for 30 min in the absence of
membrane potential and ATP. Before the addition to the import mix, the
isolated mitochondria and in vitro translation products were
separately treated with apyrase (5 units) at 25 °C for 20 min to
remove endogenous ATP, whereas the membrane potential was destroyed by
pretreatment of mitochondria with 40 µM CCCP and 5 µM valinomycin to destroy the mt membrane potential.
After a 30-min import reaction, the in vitro imported
proteins were detected by proteinase K digestion of intact mitochondria
followed by SDS-PAGE and fluorography.
|
|
We have also confirmed an earlier observation (26) that Mtf1p import
can occur with trypsin-treated mitochondria but that was not the case
for F1, which requires a protease-sensitive mt receptor
(data not shown). This suggests that mt association or import of Mtf1p
does not involve a specific interaction with the receptor implicated in
mt import. An alternative model is that Mtf1p gains access to the mt
matrix by a quite different pathway employing an mt surface receptor
that is protease-resistant. Negatively charged phospholipid of mt
membrane could be such a recognition molecule for the positively
charged internal sequence of Mtf1p (see below) as has been proposed for
translocation of yeast mt apocytochrome c (30, 31) and
Drosophila antennapedia transcription factor (32). To
explore whether the mt membrane phospholipids rather than a
proteinaceous receptor is involved in the mt translocation of Mtf1p,
the in vitro import reaction was carried out with
mitochondria pretreated with one or more phospholipases
(i.e. bovine pancreatic phospholipase A2,
Clostridium phospholipase C, Streptomyces
phospholipase D, and/or human placenta sphingomyelinase) at 37 °C
for 2 h. None of these phospholipase treatments of mitochondria
influenced the uptake of Mtf1p (data not shown).
Mtf1p Import Is Completed within 5 min--
As we described above,
the mt import of Mtf1p occurs without the general import factors. It is
possible that the efficiency of Mtf1p import may be reduced under these
conditions. For example, Mtf1p import might be slower when import is
performed at low temperature or/and in the absence of import factors
than that under the standard conditions. To explore this possibility we
compared the time course for Mtf1p import at 28 °C, on ice
(3 °C), or on ice without membrane potential and ATP (Fig.
3). Import was carried out for different time periods as above. Because Mtf1p import is not inhibited at low
temperature or under import-poisoning conditions, and proteinase K
requires several minutes for complete digestion of Mtf1p, a 0-min
import control was also performed. In the 0-min control, Mtf1p,
proteinase K, and mitochondria were added simultaneously and incubated
on ice for 30 min. The 0-min value was subtracted from the other import
measures and then plotted against import time (Fig. 3). It appears
that 5-min import of Mtf1p is essentially completed under any of these
conditions. Between zero time and 5 min there appears to be a linear
increase of Mtf1p import. This suggests that the membrane potential,
ATP, or the import temperature did not influence the import capacity of
Mtf1p.
View larger version (10K):
[in this window]
[in a new window]
|
Fig. 3.
Time course for Mtf1p import. Import was
performed at 28 °C (  ), on ice (3 °C) ( ),
or on ice with mitochondria pre-treated with CCCP/valinomycin/apyrase
( ). Mtf1p was incubated with mitochondria for variable times
under these specific conditions followed by proteinase K digestion on
ice for 30 min. After re-isolation of mitochondria, Mtf1p was detected
by SDS-PAGE and fluorography. For a zero time control, Mtf1p,
proteinase K, and mitochondria were added simultaneously to the import
mix. To calculate time-dependent Mtf1p import, the zero
time import value was subtracted from the other import measures, which
were then plotted against the incubation time.
|
|
Is Mtf1p Resistant to Proteinase K?--
One possibility for this
unusual import behavior of Mtf1p could be due to high resistance of
Mtf1p to protease K degradation. To pursue this issue a series of
proteinase K concentrations in the range of 0.1 to 1.0 mg/ml was
utilized for the digestion of pre-import or imported Mtf1p (Fig.
4). The in vitro translation Mtf1p products were incubated with these concentrations of proteinase K
on ice for 30 min. Under these conditions Mtf1p was completely digested
by each of these concentrations of proteinase K (Fig. 4, top
panel). On the other hand, when Mtf1p was incubated with isolated
mitochondria, the imported Mtf1p became resistant to proteinase K
digestion using proteinase concentrations that effectively digest
pre-import Mtf1p (middle panel). However, the incubated Mtf1p became sensitive to proteinase K when mitochondria were lysed
with Triton X-100 after the import reaction (bottom panel), as anticipated.
View larger version (32K):
[in this window]
[in a new window]
|
Fig. 4.
Digestion of Mtf1p with different
concentrations of proteinase K. The proteinase K digestion was
carried out on ice for 30 min. The upper panel exhibits
proteinase K digestion of Mtf1p without mitochondria. The middle
panel represents proteinase K digestion of Mtf1p after incubation
with mitochondria, and the bottom panel exhibits proteinase
K digestion of Mtf1p following import and lysis of mitochondria with
0.1% Triton X-100. The latter two experiments were performed as
described in the legend to Fig. 1. These results are identical whether
or not mitochondria were re-isolated prior to proteinase K digestion
and Triton X-100 treatment for the results illustrated here.
|
|
Sub-mitochondrial Location of Endogenous Mtf1p and of Mtf1p
Imported in Vitro--
To identify the intra-mitochondrial site of the
imported proteins, we have performed sub-mitochondrial fractionation by
selective opening of the mt outer and inner membranes by hypotonic
swelling, and freeze-thaw and sonication, respectively (28). The
specificity and authenticity of this sub-fractionation procedure was
determined by monitoring the distribution of endogenous mt protein
markers (i.e. cyt b2 for the inter
membrane space, AAC for the inner membrane, and Mtf1p for the matrix)
in the mt sub-fractions as well as in the whole mitochondria by
immunoblotting with specific antibodies (Fig.
5A). Cyt b2 was
detected in the whole mitochondria (Mt) and in the inter membrane space
(IMS) (Fig. 5A, lanes 1 and 2) but not
in the inner membrane (IM) or matrix (MTX) fraction (Fig. 5A, lanes 3 and 4). The inner membrane
protein AAC was detected in the mitochondria and in the inner membrane
(Fig. 5A, lanes 1 and 3) but not in
the inter membrane space or matrix fraction (Fig. 5A,
lanes 2 and 4). The endogenous Mlfip was detected
in the whole mitochondria, matrix and inner membrane fractions (Fig. 5A, lanes 1, 3, 4).
View larger version (40K):
[in this window]
[in a new window]
|
Fig. 5.
Sub-mitochondrial localization of Mtf1p or
F1 following import.
A, Mtf1p or F1 was imported into the
mitochondria for 30 min and then treated with proteinase K. Mitochondria were re-isolated by centrifugation and then
sub-fractionated as described under "Experimental Procedures." The
presence of radiolabeled Mtf1p or F1 in these mt
fractions was examined by SDS-PAGE and fluorography. The symbols used:
P, precursor F1; M, matured
F1; Mt, the intact mitochondria;
IMS, inter membrane space; IM, inner membrane;
MTX, matrix; PK, proteinase K. B,
detection of endogenous mt marker proteins cyt
b2 (inter membrane space protein), AAC (inner
membrane integrated protein), and Mtf1p (matrix protein) in the mt
fractions by immunodecorating with rabbit antibodies raised against
these proteins. C, sub-mitochondrial distribution of Mtf1p
and F1 under the minimal import conditions. After import
and proteinase K digestion, mitochondria were re-isolated and then
fractionated into matrix (MTX) and membrane (IM).
The labeled protein was detected by SDS-PAGE and fluorography.
|
|
Using the same fractionation procedure the sub-mitochondrial location
of the in vitro imported Mtf1p was determined. As before, precursor and mature forms of F1 were seen to be
associated with incubated mitochondria (Fig. 5B, top
panel, lane 1), and the majority of the mature form but
not the precursor was proteinase K-resistant (Fig. 5B,
top panel, lane 2) indicating its translocation
to the mitochondria. Most of the mt-associated Mtf1p was proteinase
K-resistant (Fig. 5B, bottom panel, lanes
1 and 2) indicating its efficient import. After import,
when the mt outer membrane was disrupted by osmotic shock, neither
Mtf1p nor F1 was released in the solution (Fig.
5B, lane 3). This suggests that these proteinase
K-resistant proteins were present within the mitoplasts rather than in
the inter membrane space (IMS). The mitoplasts were further separated into matrix (MTX) and inner membrane (IM) by disruption of the inner
membrane as described under "Experimental Procedures". Mtf1p and
F1 both were recovered in the matrix and inner membrane
fractions, although in different proportions (Fig. 5B,
lanes 4 and 5). The majority of the imported
F1 was found with the inner membrane fraction, whereas
the Mtf1p was equally distributed between the inner membrane fraction
and the matrix. A similar distribution of both proteins was also
observed when mitoplasts were pretreated with proteinase K before
sonication. This suggests that a fraction of imported Mtf1p or
F1 was associated with the matrix side of the mt inner
membrane. Because F1 is a subunit of the
hetero-oligomeric ATPase complex of the mt inner membrane, we did not
anticipate F1 in the matrix fraction. It is possible
that F1 might be displaced into the MTX upon disruption
of the mt inner membrane in the presence of salt. The distribution of
Mtf1p among sub-mitochondrial fractions was similar when import was
carried out in the absence of ATP and membrane potential (see below).
This unexpected distribution of Mtf1p between the soluble matrix and
the inner membrane could be due to its existence as a free form in the
matrix and as a transcription complex with the mt DNA template, which
is associated with the mt inner membrane (33). Importantly, the
endogenous Mtf1p, like the in vitro imported protein, was
present in the matrix as well as in the inner membrane fraction in
about the same relative proportions in both cases.
Was Mtf1p properly translocated into the mitochondria after import
under the most restrictive import conditions? Mtf1p and mitochondria
were incubated on ice in the absence of both ATP and membrane
potential. After proteinase K treatment, mitochondria were re-isolated
and separated into total membrane and soluble matrix fractions. Mtf1p
in these sub-mitochondrial fractions were identified by SDS-PAGE and
fluorography. Again, a vast majority of Mtf1p was detected in the
matrix fraction, which is consistent with our previous results. This
indicates that Mtf1p was properly translocated into the matrix
compartment of mitochondria under the most limiting import conditions
(Fig. 5C).
In Vitro Expression and Import of Different Deleted Mtf1p
Products--
To ascertain which portions of the Mtf1p sequence are
required for import, various N-terminal (i.e. (2-30),
(2-52)), C-terminal (i.e. (325-341), (299-341),
and (226-341)), and internal (i.e. (50-90),
(100-144), (153-196), (216-260), and (272-291)) deletion constructs of Mtf1p were generated (Fig.
6) as described under "Experimental
Procedures." In each of the N-terminal truncations the initiator
methionine was preserved. The C-terminal truncated (299-341)
derivative was very similar to the earlier Mtf1p fragment generated
from the BglII-digested MTF1 template (26). The internal deletions included a region of predominant positive charge
(i.e. (153-196)), the regions of predominant negative
charge (i.e. (100-144) and (216-260)), and two
neutral areas (i.e. (50-90) and (272-291)). Each of
the MTF1 clones produced one predominant Mtf1p product of the predicted
size after incubation with the coupled transcription-translation RRL
system. The ability of the mitochondria to import each of the Mtf1p
products was examined. Most Mtf1p products exhibited a similar level of
mt association (i.e. ~15-20% of the input protein) (Fig.
6, B and C, top panels). However,
proteinase K digestion revealed that the import capacity of these Mtf1p
products varied significantly depending on the sequence they carried.
The full-length and the C-terminal truncated Mtf1p products
(i.e. (226-341), (299-341), and (325-341))
retained import capacity (Fig. 6B, bottom panel).
Maximum import was observed with the full-length protein, whereas the
C-terminal truncated Mtf1p products exhibited weaker import capacity.
The mutant (325-341) lacking the last 16 amino acid residues,
exhibited the greatest import capacity of the C-terminal truncated
mutants. On the other hand, the N-terminal deletion derivatives of
Mtf1p (i.e. (2-30) or (2-52)), whose association
with mitochondria was comparable to the wild type level, did not have
any import activity. This result suggests that the N-terminal sequence
of Mtf1p is important for its mt translocation. To determine whether
one or more of the other sequences had an impact on Mtf1p import, we
also studied a group of internal sequences. In these deletions we
focused on regions of Mtf1p that were predominantly negatively charged
(i.e. (100-144) and (216-260)), positively charged
(i.e. (153-196)), or neutral (i.e.
(50-90) and (272-291)) (Fig. 6A). With most of these
internal deletions there was a drastic reduction of Mtf1p import (Fig.
6C, bottom panel). The import of (50-90) or
(100-144) was profoundly reduced, whereas the (216-260)
derivative was least affected (Fig. 6C). These results
indicate that at least the first 150 amino acids are required for
targeting to the mitochondria.
View larger version (27K):
[in this window]
[in a new window]
|
Fig. 6.
A, schematic presentation of the
predominant negatively and positively charged regions in Mtf1p.
B and C, mt association and import of Mtf1p
carrying N-terminal, C-terminal, and internal deletions,
respectively.
|
|
Does Mtf1p Adsorbed onto the mt Membrane Become Proteinase
K-resistant?--
All Mtf1p constructs described above associate with
the isolated mitochondria. However, only some of these
membrane-associated Mtf1p products exhibited proteinase K resistance.
For example, most N-terminal deletion mutants of Mtf1p were
susceptible to proteinase K digestion despite their normal
association/adsorption on mitochondria. This argues that the membrane
association/adsorption of Mtf1p is not the major factor for its
sensitivity or resistance to proteinase K digestion. To address this
issue further, we have selected the import-competent full-length Mtf1p,
the import-incompetent (2-30)Mtf1p, as well as the control protein
F1. The (2-30), which is import defective, was also
used as a negative control. After import and with or without proteinase
K treatment, the presence of Mtf1p in the mt membrane and matrix
fractions was determined by sub-mitochondrial fractionation. Without
proteinase K treatment, Mtf1p was detected in both membrane and matrix
fractions, but predominantly in the membrane portion (Fig.
7, lane 2 versus
lane 1). However, the proteinase K treatment of mitochondria
following import reduced the amount of Mtf1p on the mt membrane
fraction (Fig. 7, lane 4) so that the residual amount in
this fraction was similar to the amount in the matrix fraction (Fig. 7,
lanes 1 or 3). This suggests that the
membrane-associated Mtf1p could be classified into two distinct
populations: proteinase K-sensitive and proteinase K-resistant. The
protease-sensitive Mtf1p might be on the cytoplasmic surface of the mt
outer membrane and be readily accessible to the external proteinase K
for degradation. Conversely, the protease-resistant Mtf1p is in an
inaccessible site of intact mitochondria, probably on the inner face of
the inner membrane. As anticipated, Mtf1p levels in the matrix fraction remained the same whether mitochondria were pre-treated with proteinase K or not (Fig. 7, lane 1 versus lane
3). On the other hand, in the absence of proteinase K treatment,
the (2-30) mutant was recovered mainly in the membrane fraction
(Fig. 7, lane 6) corroborating our earlier observation that
this mutant does associate with the mt membrane. However, the
membrane-associated (2-30) mutant on intact mitochondria was fully
susceptible to the external proteinase K (Fig. 7, lanes 7 and 8) indicating that it cannot be translocated into the mt
matrix or even the inner surface of the inner membrane. In another
control experiment, F1 was recovered in both matrix and
membrane fractions (Fig. 7, lanes 9 and 10).
Together, this finding clearly indicates that Mtf1p binds to the mt
outer membrane (protease-sensitive complex), proceeds through the mt
double membrane (protease-resistant?), and then reaches the mt matrix
(fully protease-resistant).
View larger version (11K):
[in this window]
[in a new window]
|
Fig. 7.
Sub-mitochondrial fractionation of Mtf1p
following import incubation with mitochondria. After import
reaction at 28 °C for 30 min, one half of the import mix was treated
with proteinase K, whereas the other half remained untreated.
Mitochondria were re-isolated by centrifugation and fractionated
into matrix (MTX) and membrane (MM) as described
earlier. Mtf1p or F1 in these mt fractions was detected
by SDS-PAGE and fluorography.
|
|
Import of Urea-denatured Mtf1p--
The mutational analysis
described above suggests that Mtf1p might use an import-competent
secondary structure rather than a short N-terminal presequence. If this
is the case, unfolding of the putative Mtf1p structure should inhibit
Mtf1p import. To pursue this issue the in vitro synthesized
protein was precipitated with ammonium sulfate and then resuspended
either in the 10 mM Tris-HCl buffer, pH 7.5, or in 8 M urea. This urea-denatured protein was diluted in the
import mix yielding a final concentration of 80 mM urea.
The addition of 80 mM urea during the foregoing import reaction of native Mtf1p or F1 exhibited no apparent
effect on their import (Fig.
8A). The presence of 80 mM urea in the assay mix did not interfere with the import
of the ammonium sulfate-precipitated proteins resuspended in a Tris
buffer (Fig. 8B, first and third panels from the top, lanes 1-5). It is
worth noting that the presence of 0.2 M urea in the import
reaction of some other mt proteins previously studied had no
discernable effect on their import (34, 35). Interestingly, when Mtf1p
was denatured with 8 M urea before addition to the import
reaction, its import capacity was drastically reduced (Fig.
8B, second panel from top, lanes
1-5), whereas its mt association appeared to be significantly
enhanced (data not shown). However, between 15 and 30 min some import
of urea-denatured Mtf1p appears to occur (Fig. 8B,
second panel from top, lanes 3-5)
probably due to renaturation of Mtf1p to its import-competent conformation during import incubation. On the other hand, urea denaturation did not interfere with the mt import of F1
(Fig. 8B, compare the third and fourth
panels).
View larger version (28K):
[in this window]
[in a new window]
|
Fig. 8.
Import of urea-denatured Mtf1p or
F1. A, lanes
1 and 2 represent import of the in vitro
translated native protein at 28 °C for 30 min in the absence or
presence of 80 M urea added during import reaction.
B, the in vitro translated Mtf1p or
F1 product was precipitated with ammonium sulfate (66%
saturation). After centrifugation, protein pellet was suspended in 10 mM Tris-HCl buffer, pH 7.5, containing no urea or 8 M urea. Import was carried out at 28 °C for different
time periods. In the first and third panels from
the top, lanes 1-5 represent import of ammonium
sulfate-precipitated proteins suspended in Tris buffer, and 80 mM urea (final concentration) was added in an import
reaction. In the second and fourth panels from
the top, lanes 1-5 represent import of ammonium
sulfate-precipitated protein suspended in 8 M urea. These
suspended proteins were diluted so that the final urea concentration
was 80 mM. C, graphical presentations of mt
import of native Mtf1p (), urea-denatured Mtf1p (),
urea-denatured Mtf1p plus RRL ( -), or renatured Mtf1p
(). 10 µl of RRL was directly added to the 100-µl import
mix of urea-denatured Mtf1p as a potential source of import factor in
the lysate. In the last case, the urea-denatured Mtf1p was diluted
100-fold (i.e. 80 mM urea, final) in the import
reaction, incubated for 30 min at room temperature (i.e.
25 °C) to allow renaturation, and then mitochondria were added to
monitor import.
|
|
The cell-free RRL translation system carries Hsp70 and Hsp90
chaperone-like import factors (36, 37). There is also a report that the
cytoplasmic Hsp70 chaperone binds mt precursor protein during
translation in a cell-free extract (38) or by incubation with the
purified precursor (39). Therefore, there is a possibility that the
import inhibition of Mtf1p with 8 M urea pretreatment could
be a secondary effect e.g. inactivation of an RRL chaperone protein. To examine this, import of urea-denatured Mtf1p was performed in the presence of RRL (10 µl/100 µl of reaction), which was added directly to the import mixture without exposing to 8 M
urea. The presence of RRL in the import reaction did not make any
difference in the import capacity of urea-denatured Mtf1p (Fig.
8C). It is possible that the putative RRL chaperone acts on
the nascent protein during translation but has little impact on a
pre-synthesized protein. On the other hand, urea-denatured Mtf1p, which
exhibited some import activity (~10%) after 10- to 15-min incubation
(Fig. 8B), might undergo partial renaturation due to
dilution of urea concentration in the import reaction. To explore this
possibility the urea-denatured protein was preincubated in the import
reaction without mitochondria for 30 min at 25 °C, and then
mitochondria were added and incubated at 28 °C to allow Mtf1p import
to occur. Interestingly, the overall import capacity of the denatured
or renatured Mtf1p was similar except that the maximum import of the
renatured Mtf1p was observed within 5 min compared with 15-20 min for
the urea-denatured Mtf1p (Fig. 8C). It appears that only a
small fraction of denatured Mtf1p can regain import competent conformation following a renaturation incubation.
Limited Proteolysis of the Native and Urea-denatured Mtf1p--
To
investigate the conformational changes of Mtf1p upon urea denaturation,
a limited trypsin proteolysis was performed. The native or 8 M urea-denatured Mtf1p was incubated with different concentrations of trypsin (0.1 µg/ml to 1.0 mg/ml, final) at 25 °C
for 30 min, and the degree of protein degradation was determined from
the band intensity of the full-length protein on a SDS-PAGE gel (Fig.
9). Because an equal amount of protein
was used in each incubation, the decrease in the intensity of the
full-length protein truly reflects degradation of this protein. The
extent of hydrolysis of Mtf1p varies between native and denatured
protein, such that denatured Mtf1p was degraded to a greater extent
than that of the native protein (Fig. 9). For example, following
incubation with 100 µg/ml trypsin, only 10% of the denatured protein
remained intact, whereas >50% of the native protein was detected
under similar conditions (Fig. 9A). Also the denatured Mtf1p
had undergone degradation even with lower concentrations of trypsin
(1-10 µg/ml) suggesting that the denatured protein was more
susceptible to proteolysis than the native protein. This was even more
obvious in the time course of degradation using 100 µg/ml trypsin for various digestion times (Fig. 9B).
View larger version (47K):
[in this window]
[in a new window]
|
Fig. 9.
Trypsin digestion of the native, 8 M urea-denatured and renatured Mtf1p. Mtf1p was
denatured with 8 M urea as described in Fig. 7. For
renaturation the urea-treated Mtf1p was diluted 100-fold in 10 mM Tris-HCl, pH 8.0, buffer, and incubated at room
temperature for 30 min. Mtf1p digestion with trypsin was carried out in
10 mM Tris-HCl, pH 8.0, containing 80 mM urea.
A, each of these Mtf1p products was digested with various
concentrations of trypsin at 25 °C for 30 min. After incubation,
trypsin was inactivated by adding 5-fold excess soybean trypsin
inhibitor and 1 mM PMSF. The digested products were
lyophilized, dissolved in sample buffer, and run on SDS-PAGE (3-20%
polyacrylamide gel). The protein bands were visualized by
phosphorimaging. B, time course for Mtf1p digestion with 100 µg/ml trypsin at 25 °C.
|
|
In Vitro Import of DHFR-Mtf1p Fusion Protein--
A chimera of the
cytosolic protein dihydrofolate reductase (DHFR) and an mt presequence
has been frequently used for functional analysis of mt targeting
sequences. To determine whether Mtf1p is capable of targeting a
heterologous protein into mitochondria, mouse cytoplasmic protein DHFR
was fused to the C terminus or N terminus of Mtf1p (Fig.
10A). These fusion proteins
were expressed in the RRL system. The MTF1-DHFR (DHFR fused
to the C terminus of MTF1) clone produced two products: a 66-kDa major
and a 43-kDa minor polypeptide. The 66-kDa polypeptide corresponds to
the expected size of full-length Mtf1p-DHFR fusion protein, whereas the
43-kDa polypeptide was most probably Mtf1p alone. On the other hand, the DHFR-MTF1 (DHFR fused to the N terminus of MTF1)
construct generated mainly the 66-kDa full-length DHFR-Mtf1p fusion
protein.
View larger version (42K):
[in this window]
[in a new window]
|
Fig. 10.
Mt import of Mtf1p/DHFR chimeras.
A, schematic presentation of chimeric proteins.
B, the top and bottom panels represent
the mt association ( PK, without proteinase K treatment)
and import (+PK, proteinase K treatment) of Mtf1p or its
fusion products, respectively.
|
|
Under the in vitro import conditions the mt association of
these products (i.e. without proteinase K treatment) seems
to be similar (Fig. 10B, upper panel), whereas
their import capacity (i.e. proteinase K-resistant) differed
significantly (Fig. 10B, lower panel). The
full-length Mtf1p was efficiently imported into mitochondria as
anticipated. On the other hand, following proteinase K treatment the
full-length Mtf1p-DHFR fusion protein disappeared with the enhanced
appearance of Mtf1p (Fig. 10B, compare upper and
lower panels, lane 2). The simplest interpretation of this result is that the Mtf1p portion of the fusion protein was translocated into the mitochondria while its C-terminal DHFR half got stacked outside of mitochondria and became susceptible to proteinase K digestion. Conversely, most of the DHFR-Mtf1p fusion protein was imported into mitochondria as an intact protein while a small fraction
of this fusion protein exhibited import of Mtf1p without its fusion
partner DHFR (Fig. 10B, lower panel, lane 3).
This result suggests that Mtf1p can translocate a heterologous protein
into a protease-resistant compartment only when the protein is attached to the N-terminal end of Mtf1p. We have also found that the DHFR-Mtf1p fusion protein, like Mtf1p itself, is imported into mitochondria without an mt receptor protein, mt membrane potential, or ATP (data not
shown). However, unlike Mtf1p the translocation of DHFR-Mtf1p was
sensitive to the import temperature with import being significantly reduced at low temperature.
In Vivo Import of Mtf1p Is Not Influenced by the mt Genetic
Background--
Because the in vitro mt translocation of
Mtf1p occurs without a membrane potential and ATP, we have measured the
steady-state level of Mtf1p accumulation inside the mitochondria of
living cells in which mt ATP synthesis and membrane potential are
expected to be substantially reduced due to defective mt DNA. The mt
accumulation of imported proteins using the conventional import pathway
could be differently influenced by these genetic (and physiological) variations. Furthermore, mt import and accumulation of Mtf1p, which is
a component of mt transcription complex, could also be influenced by
its interacting molecules such as mt DNA or the mt core RNA polymerase
subunit. To explore these possibilities, we have assessed Mtf1p levels
in mitochondria with different genetic backgrounds (Fig.
11). Mitochondria were isolated from
the wild type yeast, (RPO41) strain lacking core subunit,
o strain bearing no mt DNA, and the RF1023 strain
lacking Mtf1p (a negative control). These yeast mutants neither respire
(i.e. have impaired membrane potential) nor generate ATP by
oxidative phosphorylation. The isolated mitochondria were lysed,
electrophoresed on SDS-PAGE, and then subjected to Western blotting
with anti-Mtf1p antibody. The 43-kDa Mtf1p was absent in the RF1023
strain carrying the chromosomal mtf1:LEU2 gene, while
mitochondria from all other strains had comparable levels of Mtf1p
(Fig. 11A). This suggests that the in vivo import
and stability of Mtf1p are not influenced by mt ATP synthesis, mt
respiration, or its interacting mt matrix molecules like mt DNA, or mt
core RNA polymerase. We have also assessed the relative levels of Mtf1p
and an mt small subunit r-protein in the wild type,
respiratory-defective petites (P2 and 01P2) (40) as well as
0 yeast strains. Interestingly, the steady-state level
of mt r-protein was strongly influenced by the mt genotype, whereas the
Mtf1p levels remained almost the same (Fig. 11B).
View larger version (8K):
[in this window]
[in a new window]
|
Fig. 11.
Western blotting of mt proteins isolated
from different yeast strains measured with anti-Mtf1p antibody.
A, mitochondria were isolated from the wild type and mutant
yeast lacking Mtf1p (i.e. MTF1), the mt RNA polymerase
(i.e. RPO41) or mt DNA (i.e.
0), and lysed in the sample buffer. Equal amounts of mt
protein were electrophoresed on a SDS-PAGE, transferred onto an
Immobilon-P nitrocellulose membrane, and then immunodecorated with
rabbit polyclonal anti-Mtf1p antibody. B, the steady-state
levels of Mtf1p and Mna6p (an mt r-protein) in different mt background,
which was determined by Western blotting with anti-Mtf1p and anti-Mna6p
antibodies, respectively. The petites P2 and O1P2 carry
nonfunctional mt genome, whereas the 0 strain
lacks the whole mt DNA.
|
|
| |
DISCUSSION |
We have reported here the conditions under which Mtf1p is imported
and localized within isolated yeast mitochondria. Taken together from
the results presented here and those from our earlier experiments, it
appears that the translocation of Mtf1p into the mt matrix is carried
out without a cleavable N-terminal presequence, a proteinaceous surface
receptor, an mt membrane potential or ATP hydrolysis. This unusual
import of Mtf1p is also observed when import is performed on ice
(i.e. 3 °C). To our knowledge, this is the only known
case of protein import into the mt matrix that does not involve any of
the previously described requisites of the classic import pathway.
Mtf1p is also capable of carrying a heterologous protein into the
mitochondria by the same pathway. The sub-mitochondrial fractions
demonstrated that the in vitro imported protein is
translocated to the same sites as the endogenous protein. This suggests
that Mtf1p under the in vitro conditions probably follows an
import pathway similar to that for the endogenous protein of living
cells. This is consistent with observations of intact yeast of various
mt petite genotypes. The mt accumulation of Mtf1p is unimpaired in
yeasts that have functionally deficient mitochondria (petites) or that
lack mt DNA (0). This is not the case for an mt matrix
protein (mt r-protein Mna6p) that appears to follow the canonical
pathway into the mitochondria. Although Mtf1p is regarded as a matrix
protein, we find a significant portion of the protein associated with
the mt inner membrane. We do not know the physiological significance of
this distribution.
We favor an import model for Mtf1p that relies on a favorable
import-competent conformation for several reasons. First, compared with
other mt proteins hitherto studied, Mtf1p carries quite an extended
targeting sequence. Indeed almost all of the protein sequence seems to
be required for optimal import. Second, in contrast to
F1 (and other proteins using the canonical pathway),
Mtf1p import is dramatically reduced by urea denaturation. The
unfolding induced by urea denaturation is thought, if anything, to
facilitate the import of conventionally imported proteins (12, 34, 35). Urea-induced Mtf1p unfolding appears to disrupt the postulated import-competent conformation. The folding of Mtf1p into this conformation probably takes place during translation in the rabbit reticulocyte lysate, where ATP is available. The apparent energy independence of Mtf1p import could relate to the notion that the energy
is expended during the synthesis and folding of the protein into an
energy-dependent import-competent conformation. This could be facilitated by the charge segregation in the linear sequence of the
protein, a segregation that could facilitate charge-charge interaction
in the folding of the protein. The productive folding of this protein
probably relies on the chaperones present in the reticulocyte lysate.
We have evidence that the import of protein synthesized in the wheat
germ extract depends upon different sequence domains, perhaps because
of the differences in the chaperones of the wheat germ
extract.2 Third, the newly
translated and import-competent Mtf1p is more resistant to tryptic
hydrolysis than is the urea-denatured protein. This argues that the two
forms of the protein differ conformationally.
There are several other mt proteins that enter the mitochondria
independent of one or more features that characterize the usual protein
import pathway, but none of them is as fully independent of the
features upon which mt import depends, as is the case for Mtf1p. Among
these proteins, the translocation of subunit Va of cytochrome
c oxidase into the mt inner membrane exhibits features that
are apparently related to those implied for Mtf1p. Like Mtf1p, the mt
import of subunit Va does not require a surface receptor and is
insensitive to the temperature of import, and it requires a very low
level of ATP (41), although it is dependent on the mt membrane
potential. The mt inner membrane protein ADP/ATP carrier (AAC) does not
have a cleavable presequence and is translocated into the mt inner
membrane independent of ATP hydrolysis and mt-Hsp60 but requires a
membrane potential across the inner membrane (42). The mt import of
murine CLK-1 protein is guided by its leader sequence but does not need
the membrane potential (43). A receptor or/and temperature-independent
cellular protein translocation pathway has also been noticed with other
non-mt proteins. The human HIV TAT protein or a recombinant chimera
carrying the 11-residue (YGRKKRRQRRR) highly positively charged
transduction domain of TAT protein, moves into the cell in an
energy-independent fashion and without any receptor or transporter
involvement (44). The Drosophila antennapedia homeoprotein
is also internalized into cells in the absence of a specific receptor
and even at a low temperature (i.e. 10 °C) (45).
Interestingly, yeast mt Mtf1p, HIV TAT, and Drosophila
homeoprotein are all transcription factors.
The other thoroughly studied exception to the classic mt import pathway
is apocytochrome c, which is a 108-amino acid soluble protein of the mt inter membrane space. Apocytochrome c
import shares some import features with Mtf1p, although apocytochrome c, unlike Mtf1p, does not cross the inner mt membrane. This
apoprotein is synthesized without a cleavable N-terminal presequence,
but the initiating methionine is missing from the mature form. The mt
translocation of apocytochrome c does not require a
receptor, ATP hydrolysis, or an electrochemical potential across the
inner membrane of mitochondria (30). Mt targeting of apocytochrome c is mediated through two functionally independent
structural domains located at the N and C termini of the protein,
respectively (31). Apocytochrome c probably makes initial
contacts with the outer membrane surface via an electrostatic
association with the phospholipid headgroups (30, 31). This membrane
association allows further interaction of this apoprotein with a
protease-resistant inter membrane component(s). The apoprotein is then
translocated across the outer membrane by diffusion, a reaction that
appears to be reversible. Once in the inter membrane space,
apocytochrome c interacts with cytochrome c heme
lyase (CCHL) on the outer face of the inner membrane, which traps
apocytochrome c in the inter membrane space of mitochondria
(30, 31). In the final step apocytochrome c is fixed in the
inter membrane space by covalent attachment of heme, a reaction
catalyzed by CCHL.
What is the structure of Mtf1p that allows for its robust import? The
amino acid sequence analysis of several dozens of the cleavable leader
peptides of mt precursor proteins of yeast, Neurospora, and
mammals reveals that these presequences usually contain several basic
and hydroxylated residues but no acidic amino acids (7). These
targeting sequences are also predicted to form an amphipathic positively charged -helix in the membrane-like environments (46, 47), which seems to be required for preprotein recognition by the mt
surface receptors (6-10) as well as for preprotein transport across
the inner membrane (47, 48). A surplus of positively charged residues
in the presequence also greatly facilitates preprotein transport across
the inner membrane (i.e. transfer of a precursor protein
from the TOM complex to the TIM complex is facilitated by stepwise
interactions of the positively charged presequence with the negative
charged regions on these two complexes) (47, 48). In contrast, Mtf1p
carries neither a cleavable presequence (25) nor does its N-terminal
sequence exhibit the usual presequence characteristics (i.e.
the first 50-amino acid sequence of Mtf1p is not rich in basic and
hydroxylated residues and has little capacity to form a positively
charged amphipathic -helix). This suggests that Mtf1p probably
carries a nonconventional mt-targeting signal. To ascertain whether an
internal region having some of the characteristics of the targeting
sequence may exist, we inspected the sequence of Mtf1p for charge
segregation. Between residues 100 to 260 in the middle of the protein
there is a 44-amino acid region that contains 10 acidic and 2 basic
amino acids, followed by a region between residues 157 and 197 that
contains 10 basic but no acidic residues, and a third region between
residues 207 and 260 that contains 14 acidic and 3 basic residues.
Thus, it appears that an internal positively charged region of Mtf1p is surrounded by more negatively charged flanking sequences (Fig. 6A). We have also noticed a small patch of negatively
charged sequence at the very end of Mtf1p. Because the charged amino
acid residues are important for sub-cellular translocation of mt
precursor proteins (6-10) as well as the human HIV TAT protein (44) we have explored by deletion analysis what role these charged or other
noncharged regions may play in Mtf1p translocation. The deletion of
N-terminal sequences of various lengths and of several internal
sequences revealed that the first 50-amino acid N-terminal sequence of
Mtf1p is essential but not sufficient for its mt targeting, because the
internal sequences from residues 50-144 are also required. This
strongly suggests that an extended sequence from 2 to 144 at least is
absolutely required for Mtf1p import. Mtf1p import is also influenced
by other sequences between 144 and 341 residues. It is not clear
whether this is representative of several separated subdomains in
this region of the protein that are required for its translocation.
Like Mtf1p, mt protein import without a canonical cleavable presequence
has also been noticed with other mt proteins (e.g. AAC (42),
apocytochrome c (31), Tom22 (49), Bcl-2 (50), CCHL (51), and
BCS1 (52)). On the contrary, the signal sequence of some mt proteins is
encoded by an N-terminal segment that is not removed on import
(e.g. 70-kDa mt outer membrane protein (53), inter membrane
space protein adenylate kinase (54), mt matrix proteins 3-oxoacyl-CoA
thiolase (55) and GTP-AMP phosphotransferase (56)). Yet another class
of mt or chloroplast proteins carries a cleavable presequence that is
not necessary for organelle targeting (e.g. subunit 6 of
yeast mt cytochrome bc1 complex (57), mammalian mt phosphate carrier (58), or outer envelope receptor protein Toc86p of
chloroplast (59)).
The recent protein data base from the yeast genome sequencing project
reveals that almost one-third of nuclear-coded mt proteins indeed lack
cleavable N-terminal presequences. According to the size of cleavable
presequences yeast mt proteins can be categorized into three different
classes. Class 1 consists of major mt proteins with a sizable
presequence, which is often cleaved following import. This class
includes the mt core RNA polymerase. Class II proteins do not have a
cleavable presequence; however, their initiating methionine residue is
missing from the mature form. Mtf1p belongs to this class. Proteins
belonging to class III remain intact even after their import
into mitochondria (i.e. the N-terminal sequences of the
preprotein and mature protein are identical) (i.e. Tom6p, r-protein MrpL24, Met-tRNA synthetase). The reported mt-targeting signals range from nonhelical to random secondary structure or mostly
polar sequences (46, 60-62). This finding suggests that all mt
proteins are not imported in precisely the fashion characterized for
the bulk of the proteins hitherto studied. There are at least three
different import routes that seem to operate for mt targeting of
different nuclear-encoded mt proteins (63). Preproteins carrying N-terminal signals use the outer membrane Tom20p and the general import
pore (GIP) complexes. Preproteins with internal signals such as inner
membrane carriers use the outer membrane Tom70p, the GIP complex, and a
special Tim pathway, involving small Tims of the inter membrane space
and Tim22p-Tim54p of the inner membrane (63). The third one is a quite
short import pathway for the small Tim proteins themselves. For the
translocation of these Tim proteins into the inter membrane space, the
trypsin-accessible surface domains of mt import receptors, including
Tom20, Tom22, and Tom70, are dispensable (64). However, the
trypsin-resistant Tom5 that generally functions as a linker between
§ and
TOP
ABSTRACT
INTRODUCTION
