Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M207482200 on September 11, 2002

J. Biol. Chem., Vol. 277, Issue 48, 46216-46225, November 29, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/48/46216    most recent
M207482200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ullán, R. V.
Right arrow Articles by Martín, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ullán, R. V.
Right arrow Articles by Martín, J. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Novel Epimerization System in Fungal Secondary Metabolism Involved in the Conversion of Isopenicillin N into Penicillin N in Acremonium chrysogenum*

Ricardo V. UllánDagger §, Javier CasqueiroDagger §, Oscar BañuelosDagger , Francisco J. Fernández§, Santiago GutiérrezDagger §, and Juan F. MartínDagger §||

From the Dagger  Area de Microbiología, Facultad de Ciencias Biológicas y Ambientales, Universidad de León, 24071 León, Spain and § Instituto de Biotecnología de León (INBIOTEC), Parque Científico de León, Avda del Real 1, 24006 León, Spain

Received for publication, July 25, 2002, and in revised form, September 11, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The epimerization step that converts isopenicillin N into penicillin N during cephalosporin biosynthesis has remained uncharacterized despite its industrial relevance. A transcriptional analysis of a 9-kb region located downstream of the pcbC gene revealed the presence of two transcripts that correspond to the genes named cefD1 and cefD2 encoding proteins with high similarity to long chain acyl-CoA synthetases and acyl-CoA racemases from Mus musculus, Homo sapiens, and Rattus norvegicus. Both genes are expressed in opposite orientations from a bidirectional promoter region. Targeted inactivation of cefD1 and cefD2 was achieved by the two-marker gene replacement procedure. Disrupted strains lacked isopenicillin N epimerase activity, were blocked in cephalosporin C production, and accumulated isopenicillin N. Complementation in trans of the disrupted nonproducer mutant with both genes restored epimerase activity and cephalosporin biosynthesis. However, when cefD1 or cefD2 were introduced separately into the double-disrupted mutant, no epimerase activity was detected, indicating that the concerted action of both proteins encoded by cefD1 and cefD2 is required for epimerization of isopenicillin N into penicillin N. This epimerization system occurs in eukaryotic cells and is entirely different from the known epimerization systems involved in the biosynthesis of bacterial beta -lactam antibiotics.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The molecular genetics of cephalosporin biosynthesis is an excellent model for secondary metabolism, since considerable information on the enzymology (reviewed in Refs. 1 and 2), molecular genetics, and gene expression mechanisms (3-5) has accumulated in the last few years. The biosynthesis of cephalosporins by Acremonium chrysogenum and cephamycins by Amycolatopsis (Nocardia) lactamdurans and Streptomyces clavuligerus (reviewed in Refs. 6 and 7) begins with the formation of the tripeptide delta -(L-alpha -aminoadipyl)-L-cysteinyl-D-valine (ACV)1 by the ACV synthetase (8), followed by cyclicization of ACV to isopenicillin N (IPN). IPN is later converted into penicillin N by an epimerase activity that has remained uncharacterized so far in A. chrysogenum. After the epimerization step, penicillin N is transformed by a deacetoxycephalosporin C synthase (expandase) into deacetoxycephalosporin C, and finally, deacetoxycephalosporin C is converted into deacetylcephalosporin C (DAC) and cephalosporin C by DAC synthase (hydroxylase) and DAC acetyltransferase, respectively (Fig. 1).


View larger version (15K):
[in this window]
[in a new window]
  		Fig. 1.   Biosynthetic pathway of cephalosporin C in A. chrysogenum. The step(s) catalyzed by the isopenicillin N epimerase is indicated by a question mark.

The genes pcbAB (9) and pcbC (10) encoding ACV synthetase and IPN synthase are linked together in chromosome VII in the so-called "early cephalosporin gene cluster" (11). The genes cefEF, encoding the bifunctional expandase-hydroxylase (12), and cefG, encoding the DAC acetyltransferase (13, 14), are linked together in the so-called "late cephalosporin cluster" in chromosome I (11).

The isopenicillin N epimerization step still remains unclear. Demain and co-workers (15, 16) reported that isopenicillin N was converted into penicillin N by extracts of A. chrysogenum, although the epimerizing enzyme was extremely labile (17, 18), preventing purification of the protein. However, the isopenicillin N epimerase has been purified from S. clavuligerus (19, 20) and A. lactamdurans (21), and the cefD gene encoding this protein was cloned from both microorganisms (22, 23). Repeated attempts to clone the homologous cefD gene of A. chrysogenum using as probe the bacterial cefD gene or oligonucleotides based on bacterial epimerase conserved amino acid regions with the A. chrysogenum preferred codon usage were unsuccessful.2 These results suggested that the fungal IPN epimerization system was different from the bacterial one.

In this article, we describe that two genes contain genetic information required for the epimerization step converting isopenicillin N into penicillin N in A. chrysogenum. The corresponding gene products act in a two-protein system described for the first time in antibiotic biosynthesis. The two genes (named cefD1 and cefD2) are completely different from the cefD gene of A. lactamdurans and S. clavuligerus.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Microbial Strains, Media, and Culture Conditions-- A. chrysogenum C10 (ATCC 48278), a strain producing high levels of cephalosporin C, was used for the genetic studies. Escherichia coli ESS2231, a beta -lactam supersensitive strain, was used for routine cephalosporin bioassays. Escherichia coli DH5alpha and E. coli WK6 were used for plasmid purification (double-stranded or single-stranded DNA, respectively). All A. chrysogenum strains were first grown in seed medium (24) for 48 h. Ten ml of seed culture was used to inoculate 100 ml of defined production medium (MDFA) (24) in 500-ml triple-baffled flasks. The cultures were incubated at 25 °C in a rotary shaker at 250 rpm. The levels of cephalosporin antibiotics were determined by bioassay using E. coli ESS2231 as the test strain in plates with penicillinase from Bacillus cereus UL1 as described previously (13).

Plasmids Containing the cefD1 and/or cefD2 Genes-- Several constructions named pCD4.5, pCD1, pCD2, and pCD1+2 were obtained from plasmid pJL43 (9).

pD4.5 was obtained from pJL43 by inserting a 6.8-kb SalI fragment bearing the cefD1, cefD2, and bidirectional promoter region (see Fig. 5). SalI and BglII restriction sites were introduced by in vitro mutagenesis in the cefD1 and cefD2 genes, respectively. Finally, the hygromycin resistance (hph) cassette, subcloned from pAN7-1 (25), was inserted in the BglII site to inactivate the cefD2 gene.

PCD1+2 was obtained by inserting a 5.8-kb BamHI-EcoRV fragment bearing the cefD1 and cefD2 genes into the BamHI-EcoRI site of pC43 (26).

pCD1 bearing the cefD1 gene was constructed by partial digestion of pCD1+2 with SacI and religation.

pCD2 contains a 3.5-kb BamHI-SalI fragment bearing the cefD2 gene inserted into the BamHI-EcoRI site of pC43.

Transformation of A. chrysogenum-- Transformation of A. chrysogenum protoplasts was performed as described previously (27).

DNA Sequencing and Intron Analysis-- DNA fragments were subcloned into pBluescript SK+, and a nested set of fragments was generated with the Erase-a-base procedure (Promega) by digestion with exonuclease III (28). The fragments were sequenced by the dideoxynucleotide chain termination method (29). To elucidate the presence of putative introns in the DNA sequence of the cefD2 gene, the DNA region containing the expected intron splicing sites was amplified by RT-PCR (Invitrogen) using RNA of A. chrysogenum 48-h cultures as template with the primers 4A (TATCCGGCAAGCTTGGTCGTAGAG) and 4B (CTTGCGTGAGGGGCGGATGC). The amplified region was sequenced to confirm the presence of the intron. The nucleotide sequence is deposited in the GenBankTM/EBI Data Bank under the accession number AJ507632.

Site-directed Mutagenesis-- In vitro mutagenesis was performed with the QuikChange site-directed mutagenesis kit (Stratagene) by following the manufacturer's instructions. Oligonucleotides A1 (5'-CCGCTGCCTACCGTCGACGCCAAGC-3') and A2 (5'-GCTTGGCGTCGACGGTAGGCAGCGG-3') were used in the formation of a SalI site in the cefD1 gene.

Similarly, a BglII site in the cefD2 gene was obtained with the oligonucleotides B1 (5'-GGCGCCATAGATCTGCCAAGAGCATGC-3') and B2 (5'-GCATGCTCTTGGCAGATCTATGGCGCC-3').

Southern and Northern Blotting and DNA Hybridizations-- Genomic DNA of A. chrysogenum was isolated as described previously (27). Three µg of genomic DNA from A. chrysogenum C10 or its transformants were digested with EcoRI and the fragments were resolved in a 0.7% agarose gel. The gel was blotted onto Hybond-N membranes (Amersham Biosciences) and hybridized with different probes (see "Results") labeled with [32P]dCTP (30).

RNA Isolation and Northern Analysis-- Total A. chrysogenum RNA was isolated with the RNeasy Kit (Qiagen). Total RNA was resolved by agarose-formaldehyde gel electrophoresis and blotted onto Hybond-N membranes (Amersham Biosciences) as described by Sambrook et al. (30).

Hybridization probes were labeled with [alpha -32P]dCTP by nick translation and purified by filtration through Wizard minicolumns (Promega). Hybridizations were carried out as described by Sambrook et al. (30). The intensity of the hybridization bands was determined by using a phosphor imager scanner (Instant Imager; Packard).

HPLC Determination of Cephalosporin C-- Cephalosporin C analysis was performed in a Beckman System Gold HPLC equipped with a µBondapack C18 column as described previously (31, 32).

HPLC Resolution of Isopenicillin N and Penicillin N-- HPLC identification of isopenicillin N and penicillin N was performed as described by Neuss et al. (33). Isopenicillin N and penicillin N (500 µg/ml) were derivatized with 2,3,4,6-tetra-O-acetyl-beta -D-glucopyranosyl isotiocyanate (GITC) (2 mg/ml in acetonitrile) for 2 h at pH 8.5 (adjusted with sodium bicarbonate). The HPLC separation was performed in a Beckman System Gold HPLC equipped with a µBondpack C18 column with a mobile phase of methanol/acetonitrile/acetic acid/water (36:7:2:55) with a flow of 1.2 ml/min.

IPN Epimerase Assay-- The IPN epimerase assay was performed as described by Lübbe et al. (34). IPN epimerase activity was determined by measuring the in vitro conversion of isopenicillin into penicillin N. The results were quantified by a coupled reaction by determining the conversion of IPN into cephalosporin C (CPC). Cell-free extracts were prepared from A. chrysogenum cultures grown for 72 h. The enzymatic activity was expressed in units/mg of protein. One unit is the activity forming 1 ng of CPC/min in the coupled assay. The specific activity is given as units/mg of protein. Total protein concentration in the cell extract was measured by the Bradford assay.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Transcript Map of the Region Located Downstream of the pcbC Gene-- Since the genes encoding all other proteins involved in CPC biosynthesis are clustered in two separate loci, we hypothesized that the gene encoding the protein(s) involved in the conversion of isopenicillin N into penicillin N might be located in one of the two cephalosporin gene clusters. Recently, we have reported that a gene, cefT, located in the early cephalosporin cluster downstream from pcbAB, encoding a multidrug efflux pump protein causes a significant increase of cephalosporin C production (35). To search for genes located on the other side of the early cluster downstream from the pcbC gene, a transcript map of this region was made using RNA extracted from mycelia of A. chrysogenum grown for 48 h in MDFA medium, since at this time the expression of other CPC biosynthetic genes is known to be high in this cephalosporin-overproducing strain (36). Five probes, P1, P2, P3, P4, and P5 (Fig. 2A), covering 9 kb downstream of the pcbC gene were used. Results showed (Fig. 2B) the presence of three transcript signals. Probe P1 gave rise to a 1.15-kb hybridization band, coinciding with the known size of the transcript of the pcbC gene (26). Probes P2 and P3 highlighted a hybridizing RNA of 1.2 kb, and probes P4 and P5 gave a hybridizing transcript of 2.0 kb (Fig. 2B), indicating the presence in this region of two open reading frames named ORF1 and ORF2.


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 2.   Transcriptional analysis of the DNA region downstream of the pcbC gene. A, genomic map of the region located downstream of the pcbC gene. P1-P5 are the probes used in the transcriptional analysis (see "Results"). B, hybridization signals obtained with probes P1 (transcript I, 1.15 kb), P2 and P3 (transcript II, 1.2 kb), and P4 and P5 (transcript III, 2.0 kb). The three transcripts are indicated by wavy lines below the DNA fragment.

ORF1 and ORF2 Encode Proteins with High Similarity to Acyl-CoA Synthetases and Acyl-CoA Racemases, Respectively-- A 5.8-kb BamHI-EcoRV fragment containing ORF1 and ORF2 was cloned in the pBluescript KS+ and sequenced on both strands. Sequence analysis revealed the presence of two open reading frames. ORF1 has 2193 nucleotides, and it is interrupted by the presence of five introns. This gene was also cloned from a previously constructed cDNA library (37), and the sequence confirmed the presence of the five introns. ORF1 encoded a protein of 642 amino acids with a deduced molecular mass of 71 kDa. The encoded protein showed similarity to long chain acyl-CoA synthetases (Fig. 3), particularly those from Homo sapiens (26.3% identical amino acids), Rattus norvegicus (25.5% identity), and Mus musculus (25.5% identity) (38). The ORF1-encoded protein has all the characteristic motifs of the acyl-CoA ligases involved in the activation (usually through an adenylation step) of the carboxyl group of fatty acids or amino acids (39).


View larger version (96K):
[in this window]
[in a new window]
  		Fig. 3.   Amino acid sequence of the CefD1 protein. Alignment of the deduced amino acid sequences of the protein encoded by the cefD1 gene of A. chrysogenum and the long chain acyl-CoA synthetases of H. sapiens (vlacs), R. norvegicus (vlacs), and M. musculus (vlacs). Only the identical amino acids are shaded. The consensus motifs A-H of acetyl-CoA ligases with functionally conserved amino acids are overlined.

ORF2 consists of 1146 nucleotides, and it is interrupted by the presence of one intron. RT-PCR studies using RNA from 48-h cultures of A. chrysogenum C10 confirmed the presence of the intron. A DNA band of the expected size (92 bp), assuming the splicing of the intron, was obtained by RT-PCR. The nucleotide sequence of the amplified DNA band showed that the intron had been removed at the splicing sites corresponding to nucleotides 64-157 numbered from the ATG translation initiation codon. ORF2 encoded a protein of 383 amino acids with a deduced molecular mass of 41.4 kDa. The encoded protein showed (Fig. 4) similarity to alpha -methyl-acyl-CoA racemases, particularly those from H. sapiens (42.1% identical amino acid) M. musculus (39.4% identity) and R. norvegicus (39.3%) (40, 41).


View larger version (58K):
[in this window]
[in a new window]
  		Fig. 4.   Amino acid sequence of the CefD2 protein. Alignment of the deduced amino acid sequences of the protein encoded by the cefD2 gene of A. chrysogenum, with the acyl-CoA racemases of H. sapiens (rm), M. musculus (mcar1), and R. norvegicus (p-EP1). Identical amino acids are shaded.

Targeted Inactivation of ORF1 and ORF2 Results in Mutants Blocked in Cephalosporin Production-- To study the role of the proteins encoded by ORF1 and ORF2 in cephalosporin C biosynthesis, targeted inactivation of both genes was performed with the double marker technique (42) developed for targeted inactivation in A. chrysogenum (43).

To perform targeted inactivation of these genes, plasmid pD4.5 was constructed (Fig. 5A); this plasmid carries an incomplete ORF2 (obtained by insertion of the hygromycin resistance cassette) and ORF1 inactivated by a frameshift mutation introduced in vitro. Plasmid pD4.5 contains also the bleomycin resistance marker (Fig. 5).


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 5.   Disruption of cefD1 and cefD2 by a double crossing over and molecular analysis of the transformants. A, disruption by gene replacement with the pD4.5 plasmid. The cefD1 gene in pD4.5 was previously inactivated by an in vitro frameshift mutation at the SalI site (boxed S) located at the 5' region of the gene. The inactive mutant genes are indicated by dashed arrows. The SalI fragments modified by the recombination events are indicated by solid bars. S, SalI; B, BamHI. B, Southern blot hybridization of SalI-digested genomic DNA from several transformants with a labeled probe internal to the bidirectional promoter of cefD1 and cefD2 genes. Lane 1, TD125; lane 2, TD132; lane 3, TD167; lane 4, TD188; lane 5, TD189; lane 6, TD115; lane 7, TD197; lane 8, TD203; lane 9, TD112; lane 10, TD234; lane 11, A. chrysogenum C10. The sizes of the hybridization bands are indicated on the right.

Plasmid pD4.5 was transformed into A. chrysogenum C10, and transformants were selected by the resistance to hygromycin B. The transformants were screened for those clones showing a hygR phleS phenotype, indicating that double recombination had occurred. Thirty-three transformants of the 250 clones tested showed the hygR phleS phenotype. All of these 33 transformants were tested for cephalosporin production by the agar plug method. Nine transformants showed a drastic reduction in the cephalosporin production, and seven additional transformants showed no cephalosporin production at all as compared with A. chrysogenum C10, suggesting that targeted inactivation had occurred in the mutants.

To confirm that targeted inactivation took place at the right position, the seven nonproducing transformants and two others with drastic reduction in cephalosporin production were analyzed by Southern blot. A. chrysogenum C10 and one transformant (Fig. 5B, lane 8) with no reduction in cephalosporin production were used as controls. The DNA of all strains was digested with SalI and hybridized with a probe internal to the bidirectional promoter region located between ORF1 and ORF2 (Fig. 5A). Results showed that the A. chrysogenum C10 (Fig. 5B, lane 11) hybridized with a genomic DNA band of 6.8 kb; however, in transformants with no cephalosporin production (Fig. 5B, lanes 3-7, 9, and 10), the 6.8-kb hybridization band was converted into a band of 3.8 kb, as expected, by a canonical double recombination (Fig. 5A). In transformants with a drastic reduction in cephalosporin production (Fig. 5B, lanes 1 and 2) the 6.8 kb is converted into a 5.0-kb hybridization signal, suggesting that a noncanonical recombination process had occurred at the ORF1-ORF2 locus. By contrast, in the transformant with no reduction in cephalosporin production (Fig. 5B, lane 8), two hybridization bands of 3.8 and 6.8 kb were present, suggesting an ectopical integration of the pD4.5 plasmid. To study in more detail the effect of targeted inactivation of the ORF1 and ORF2, three transformants named TD167, TD189, and TD234 (lanes 3, 5, and 10 in Fig. 5B) were selected.

The Disrupted Transformants TD167, TD189, and TD234 Lacked Isopenicillin Epimerase Activity-- To study whether proteins encoded by ORF1 and ORF2 were involved in the conversion of isopenicillin N into penicillin N, the epimerase activity was measured in cell extracts of three disrupted transformants (TD167, TD189, and TD234) and the parental strain A. chrysogenum C10. Results showed that the epimerase activity was absent in the ORF1-ORF2-disrupted strains, both at 72 and 96 h, whereas the A. chrysogenum C10 strained a high level of IPN epimerase activity (92 units/mg of protein) at 72 h.

These results clearly indicated that the proteins encoded by the ORF1 and ORF2 are involved in the epimerization step in cephalosporin C biosynthesis. Thus, the corresponding genes have been named cefD1 and cefD2 according to standard beta -lactam gene nomenclature, since the designation cefD is used to describe the bacterial epimerase gene (44).

The TD167, TD189, and TD234 Disrupted Strains Accumulate Isopenicillin N-- If cefD1 and cefD2 encode the IPN epimerase, the TD167, TD189, and TD234 mutants should accumulate isopenicillin N. Results showed (Fig. 6A) that no cephalosporins were detected by bioassay in any of the disrupted strains, whereas in the same culture conditions high cephalosporin production was observed in either A. chrysogenum C10 or in the nondisrupted transformant. Analysis by HPLC of the culture broth supernatant (Fig. 6B) showed that the disrupted strains formed no traces of cephalosporin C, whereas in A. chrysogenum C10 cephalosporin C is produced.


View larger version (18K):
[in this window]
[in a new window]
  		Fig. 6.   Cephalosporin production and HPLC analysis of A. chrysogenum C10 and the disrupted mutant TD189. A, time course of cephalosporin production by A. chrysogenum C10 () and the disrupted mutant TD189 (open circle ). Fermentations were carried out in triplicate, and the experiments were repeated twice. Samples were taken every 24 h to measure cephalosporins. B, HPLC analysis of the cephalosporin C in 96-h cultures of A. chrysogenum C10 (dotted line) and mutant TD189 (solid line). Note the absence of the CPC peak (retention time 26 min) in the disrupted mutant. Results were identical for the two other disrupted mutants, TD167 and TD234.

The culture filtrates from the three disrupted strains, TD167, TD189, and TD234, and the parental A. chrysogenum C10 were treated with GITC (see "Experimental Procedures"), and the derivatized compounds were resolved by HPLC. Results showed that in A. chrysogenum C10 culture broth the peaks corresponding to both isopenicillin N and penicillin N were present (Fig. 7). However, in the three disrupted strains, the peak corresponding to penicillin N is absent, and at the same time there is an accumulation of isopenicillin N, confirming the previous evidence indicating that disrupted strains are blocked in isopenicillin N epimerase.


View larger version (27K):
[in this window]
[in a new window]
  		Fig. 7.   HPLC resolution of isopenicillin N and penicillin N and accumulation of isopenicillin N in the disrupted strain TD189. A, resolution of penicillin N and isopenicillin N after GITC derivatization in the culture broths of A. chrysogenum C10. GITC-isopenicillin N and GITC-penicillin eluted with retention times of 15 and 17 min, respectively. B, HPLC analysis of culture broths of the disrupted strain TD189. Note the absence of penicillin N. C, coelution of an external isopenicillin N standard with the isopenicillin N accumulated by strain TD189. D, resolution of an external penicillin N standard and the isopenicillin N accumulated by strain TD189. E, comparative levels of isopenicillin N and penicillin N in A. chrysogenum C10 and in the disrupted strain TD189. Note that there is clear accumulation of isopenicillin N in strain TD189. Results were identical for the two other disrupted mutants.

Complementation of Both cefD1 and cefD2 Mutations Is Required for Restoration of Epimerase Activity-- To elucidate whether both the acyl-CoA synthetase and the acyl-racemase encoded by cefD1 and cefD2 or just one of them were involved in the conversion of isopenicillin N into penicillin N, a series of complemented strains lacking one or both of these genes was created.

For this purpose, plasmids pCD1, pCD2, and pCD1+2 bearing the cefD1, cefD2, or both genes, respectively, were constructed (Fig. 8). These three plasmids were transformed separately in the TD189 deletion mutant, and transformants were selected by resistance to phleomycin. Five transformants (TCD1) obtained with the pCD1 plasmids were selected, and their genomic DNA digested with SacI was hybridized with a 1-kb fragment of the cefD1-cefD2 bidirectional promoter region (Fig. 5) as probe. Results showed (Fig. 8A) that all five transformants gave hybridization with a DNA band of 4.5 kb in addition to the endogenous 6.6-kb hybridization band (corresponding to the disrupted gene in the host TD189 strain), indicating that the insert of the plasmid pCD1 was intact.


View larger version (12K):
[in this window]
[in a new window]
  		Fig. 8.   Southern analysis showing the complementation in trans of the disrupted TD189 mutant with pCD1 and pCD2. A, plasmid pCD1 containing the cefD1 gene. Southern blot hybridization of SacI-digested genomic DNA from five transformants, untransformed A. chrysogenum C10, and mutant TD189, using as probe the 1-kb HindIII-EcoRV internal to the bidirectional promoter of cefD1 and cefD2. Lane 1, TCD1-8; lane 2, TCD1-10; lane 3, TCD1-15; lane 4, TCD1-16; lane 5, TCD1-21; lane 6, TD189 (disrupted mutant); lane 7, A. chrysogenum C10. The sizes of the hybridization bands are indicated on the right. B, plasmid pCD2 containing the cefD2 gene. Southern blot hybridization of ClaI + SpeI-digested genomic DNA from five transformants, untransformed A. chrysogenum C10, and mutant TD189 with the same probe internal to the bidirectional promoter of cefD1 and cefD2 genes. Lane 1, TCD2-28; lane 2, TCD2-32; lane 3, TCD2-38; lane 4, TCD2-49; lane 5, TCD2-90; lane 6, TD189 (disrupted mutant); lane 7, A. chrysogenum C10. The sizes of the hybridization bands are indicated on the right. C, plasmid pCD1+2 containing the cefD1 and cefD2 genes. Southern blot hybridization is shown of ClaI-SpeI-digested genomic DNA from three transformants, untransformed A. chrysogenum C10, and mutant TD189, with the same labeled probe internal to the bidirectional promoter. Lane 1, TCD1+2-24; lane 2, TCD1+2-115; lane 3, TCD1+2-119; lane 4, TD189; lane 5, A. chrysogenum C10. The sizes of the hybridization bands are indicated on the right. The 24-kb hybridization band corresponded to the endogenous band in the gene-disrupted clone TD189.

Similarly, five transformants (TCD2) obtained with the pCD2 plasmid were selected, and their DNA was digested with a mixture of SpeI and ClaI and hybridized with the same probe (1 kb of the promoter region) as above. Results showed (Fig. 8B) a hybridization band of 5 kb in several transformants, indicating that the insert of plasmid pCD2 is intact. The large 24-kb hybridization band corresponded to the endogenous hybridizing band in the cefD1-cefD2 disrupted clone (TD189; lane 5), whereas the wild type A. chrysogenum gave a 20-kb hybridization band.

Finally, the DNA of three transformants (TCD1+2) obtained with the pCD1+2 plasmid was digested with a mixture of SpeI and ClaI and hybridized with the same 1-kb probe as above. Results showed (Fig. 8C) that the probe hybridized with a band of 7.3 kb, indicating that the insert of the plasmid pCD1+2 was integrated in an intact form. The 24-kb hybridization band corresponded to the endogenous hybridizing band in the cefD1-cefD2-disrupted clone (TD189).

To study which of the two ORFs were responsible for the epimerization step, the IPN epimerase activity was measured in three representative transformants TCD1, TCD2, and TCD1+2. Results showed (Table I) that only in A. chrysogenum TCD1+2 transformants (where cefD1 and cefD2 are present) was the epimerase activity restored. In transformants TCD1 and TCD2, where just one of the genes was functional, no epimerase activity was detected. These results indicate that both cefD1 and cefD2 proteins are indeed involved in the epimerization of isopenicillin N into penicillin N. 

                              
View this table:
[in this window]
[in a new window]
 
Table I
Isopenicillin N epimerase activity in transformants TCD1+2, TCD1, and TCD2 derived from TD189 by complementation with cefD1+2, cefD1 and cefD2 genes, respectively

Cephalosporin Production in TCD1, TCD2, and TCD1+2 Transformants-- Cephalosporin C fermentations with three of the TCD1, TCD2, and TCD1+2 transformants were performed. Results showed (Fig. 9A) that in transformants TCD1+2, the cephalosporin production was restored to levels similar to those of A. chrysogenum C10. In TCD1 transformants (Fig. 9B), a very small amount of cephalosporins production was detected (~1% of cephalosporin produced in A. chrysogenum C10), whereas in TCD2 transformants (Fig. 9B), no cephalosporin was produced at all. HPLC analysis (Fig. 9C) confirmed that TCD1+2 transformants produced authentic cephalosporin C as in A. chrysogenum C10.


View larger version (32K):
[in this window]
[in a new window]
  		Fig. 9.   Specific cephalosporin production and HPLC analysis of untransformed A. chrysogenum C10 and mutants complemented in trans: TCD1, TCD2, and TCD1+2. A, left panel, specific cephalosporins production of the untransformed A. chrysogenum C10 and TCD1-8, TCD1-10, and TCD1-15. Right panel, HPLC analysis of CPC in A. chrysogenum C10 and in TCD1-8; the same result was obtained with the other transformants. Note that a minimal amount of CPC (retention time 26 min) is detected in TCD1 transformants (B). Left panel, specific cephalosporins production of untransformed A. chrysogenum C10 and TCD2-28, TCD2-49, and TCD2-90. Right panel, HPLC analysis of CPC in A. chrysogenum C10 and in TCD2-49; the same result was obtained with the other transformants. Note that there is no complementation of CPC production by cefD2. C, left panel, specific cephalosporin production of the untransformed A. chrysogenum C10 and TCD1+2-24, TCD1+2-115, and TCD1+2-119. Right panel, HPLC analysis of CPC in A. chrysogenum C10 and in TCD1+2-115; the same result was obtained with the other transformants. CPC production is restored when TD189 is complemented by pCD1+2.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

D-Amino acids are very frequent components of nonribosomal peptides (45, 46) and their derivatives (e.g. beta -lactams). Very little is known about the mechanism of amino acid epimerization that give rise to the D-configuration. In many cases, epimerization is performed by an epimerization domain integrated into the large modular peptide synthetases (8, 47), whereas in other cases, the D-amino acids are formed by separate epimerases (e.g. the D-alanine component of cyclosporin and HC toxin) (48).

In this work, we report that the epimerization step converting isopenicillin N into penicillin N in A. chrysogenum is catalyzed by a two-protein system never described before in the biosynthesis of antibiotics or other secondary metabolites. These proteins are encoded by two genes expressed in opposite orientation from a bidirectional promoter region: cefD1, which shows high similarity to long chain acyl-CoA synthetases (39), and cefD2, showing high similarity to acyl-CoA racemases (49, 50).

A mechanism of action of the A. chrysogenum two-component IPN epimerase system can be proposed on the basis of homology of the CefD1 and CefD2 proteins with known eucaryotic epimerases. Such epimerization systems that require previous activation of the substrate as CoA-derivatives have been reported to be involved in the racemization of phytanic acid and in the inversion of ibuprofen in humans. Phytanic acid occurs naturally as a mixture of the (3R)- and the (3S)-diastereoisomers and is converted after alpha -oxidation into pristanic acid (51). The oxidases and dehydrogenases responsible for further beta -oxidation of phytanic acid act only on (2S)-2-methylacyl-CoAs (53, 54), and a racemization step is required for complete degradation. In summary, alpha -methyl-branched fatty acids are racemized as CoA thioesters by a specific alpha -methylacyl-CoA racemase similar to the protein encoded by cefD2 (49, 50).

Another example is the epimerization of the 2-arylpropionic acids (e.g. ibuprofen), an important group of nonsteroidal anti-inflammatory drugs. A unique feature regarding 2-arylpropionic acid metabolism is the stereoselective conversion of the R-enantiomer to its S-diastereomer but not vice versa (55). The pathway for this metabolic event begins with the activation of the 2-arylpropionic acids as an acyl-CoA by an acyl-CoA synthetase (that resembles the protein encoded by cefD1) that is later racemized by a 2-arylpropionyl-CoA epimerase, and finally the S-diastereoisomer is released by a thioesterase (56, 57). The 2-arylpropionyl-CoA epimerase has been purified from rat liver (57), showing that it is similar to alpha -methylacyl-CoA racemases (54).

As shown in this work, the protein encoded by the cefD2 has high similarity to alpha -methylacyl-racemases and 2-arylpropionyl-CoA epimerases, suggesting that after activation of isopenicillin N to isopenicillinyl-CoA by an isopenicillin-adenylate-mediated mechanism, epimerization to penicillinyl-CoA occurs by a similar mechanism (Fig. 10).


View larger version (30K):
[in this window]
[in a new window]
  		Fig. 10.   Proposed model for the conversion of L-alpha -aminoadipyl side chain of isopenicillin N into the D-alpha -aminoadipyl side chain of penicillin N by the fungal two-protein system (acyl-CoA-synthetase and acyl-CoA-epimerase). For comparison, the direct epimerization by the bacterial isopenicillin N epimerase is shown.

Our results show that the product of both genes cefD1 and cefD2 are necessary for full epimerase activity and for cephalosporin biosynthesis, which supports the proposed activation and epimerization model. Finally, the required hydrolysis of the CoA thioesters has been reported to occur in a nonstereoselective manner by different thioesterases (56).

The Streptomyces clavuligerus and Amycolatopsis lactamdurans isopenicillin N epimerases appear to work by an entirely different mechanism, since they are single proteins with a molecular weight of 59,000 (for the A. lactamdurans) or 63,000 (for the S. clavuligerus enzyme) that catalyze a pyridoxal phosphate-dependent removal of the amino group at C-2 of the alpha -aminoadipyl chain, followed by reintroduction in the D-configuration (19, 21).

    ACKNOWLEDGEMENTS

We thank R. Bovenberg (Dutch State Mines, Delft, The Netherlands) and C. Schofield (Oxford University) for providing pure isopenicillin N and penicillin N.

    FOOTNOTES

* This work was supported by grants from Biochimie GmbH (the Novartis group, Austria), Comisión Interministerial de Ciencia y Tecnología, Spain (Ministry of Education and Science, Madrid) Grant BIO97-0289-C02-01, and Agencia de Desarrollo Económico de Castilla y León Grant 08-2/99/LE/0001.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AJ507632.

Recipient of a fellowship of the Diputación de León (Spain).

|| To whom correspondence should be addressed. Tel.: 34-987-291505; Fax: 34-987-291506; E-mail: degjmm@unileon.es.

Published, JBC Papers in Press, September 11, 2002, DOI 10.1074/jbc.M207482200

2 S. Gutiérrez and J. F. Martín, unpublished results.

    ABBREVIATIONS

The abbreviations used are: ACV, delta -(L-alpha -aminoadipyl)-L-cysteinyl-D-valine; IPN, isopenicillin N; DAC, deacetylcephalosporin C; HPLC, high pressure liquid chromatograph; GITC, 2,3,4,6-tetra-O-acetyl-beta -D-glucopyranosyl isotiocyanate.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Demain, A. L. (1983) in Antibiotics Containing the beta -Lactam Structure (Demain, A. L. , and Solomon, N. A., eds) , pp. 189-228, Springer-Verlag New York Inc., New York
2. Martín, J. F., and Liras, P. (1989) Adv. Biochem. Eng. Biotechnol. 39, 153-187[Medline] [Order article via Infotrieve]
3. Aharanowitz, Y., Cohen, G., and Martín, J. F. (1992) Annu. Rev. Microbiol. 46, 461-495[CrossRef][Medline] [Order article via Infotrieve]
4. Martín, J. F., Gutiérrez, S., and Demain, A. L. (1997) in Fungal Biotechnology (Anke, T., ed) , pp. 91-127, Chapman and Hall, Weinheim, Germany
5. Martín, J. F. (2000) J. Bacteriol. 182, 2355-2362[Free Full Text]
6. Liras, P. (1999) Antonie Leeuwenhoek 75, 109-124
7. Martín, J. F. (1998) Appl. Microbiol. Biotechnol. 50, 1-15[CrossRef][Medline] [Order article via Infotrieve]
8. Martín, J. F. (2000) J. Antibiot. (Tokyo) 53, 1008-1021[Medline] [Order article via Infotrieve]
9. Gutiérrez, S., Díez, B., Álvarez, E., and Martín, J. F. (1991) J. Bacteriol. 173, 2354-2365[Abstract/Free Full Text]
10. Samson, S. M., Belagaje, R., Blankenship, D. T., Chapman, J. L., Perry, D., Skatrud, P. L., van Frank, R. M., Abraham, E. P., Baldwin, J. E., Queener, S. W., and Ingolia, T. D. (1985) Nature 318, 191-194[CrossRef][Medline] [Order article via Infotrieve]
11. Gutiérrez, S., Fierro, F., Casqueiro, J., and Martín, J. F. (1999) Antonie Leeuwenhoek 75, 81-94
12. Samson, S. M., Chapman, J. L., Belagaje, R., Queener, S. W., and Ingolia, T. D. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 5705-5709[Abstract/Free Full Text]
13. Gutiérrez, S., Velasco, J., Fernández, F. J., and Martín, J. F. (1992) J. Bacteriol. 174, 3056-3064[Abstract/Free Full Text]
14. Velasco, J., Gutiérrez, S., Campoy, S., and Martín, J. F. (1999) Biochem. J. 337, 379-385
15. Konomi, T., Herchen, S., Baldwin, J. E., Yoshida, M., Hunt, N., and Demain, A. L. (1979) Biochem. J. 184, 427-430[Medline] [Order article via Infotrieve]
16. Sawada, Y., Baldwin, J. E., Singh, P. D., Solomon, N. A., and Demain, A. L. (1980) Antimicrob. Agents Chemother. 27, 380-387
17. Baldwin, J. E., Keeping, J. W., Singh, P. D., and Vallejo, C. A. (1981) Biochem. J. 194, 649-651[Medline] [Order article via Infotrieve]
18. Jayatilake, G. S., Huddleston, J. A., and Abraham, E. P. (1981) Biochem. J. 194, 645-647[Medline] [Order article via Infotrieve]
19. Jensen, S. E., Westlake, D. W. S., and Wolfe, S. (1983) Can. J. Microbiol. 29, 1526-1531[Medline] [Order article via Infotrieve]
20. Usui, S., and Yu, C. A. (1989) Biochim. Biophys. Acta. 999, 78-85[CrossRef][Medline] [Order article via Infotrieve]
21. Láiz, L., Liras, P., Castro, J. M., and Martín, J. F. (1990) J. Gen. Microbiol. 136, 663-671
22. Kovacevick, S., Tobin, M. B., and Miller, J. R. (1990) J. Bacteriol. 172, 3952-3958[Abstract/Free Full Text]
23. Coque, J. J. R., Liras, P., and Martín, J. F. (1993) Mol. Gen. Genet. 236, 453-458[CrossRef][Medline] [Order article via Infotrieve]
24. Shen, Y. Q., Wolfe, S., and Demain, A. L. (1986) Bio/Technology 4, 61-64
25. Punt, P. J., Dingemanse, M. A., Kuyvenhoven, A., Soede, R. D., Pouwles, P. H., and van den Hondel, C. C. A. A. (1990) Gene (Amst.) 93, 101-109[CrossRef][Medline] [Order article via Infotrieve]
26. Gutiérrez, S., Marcos, A. T., Casqueiro, J., Kosalková, K., Fernández, F. J., Velasco, J., and Martín, J. F. (1999) Microbiology 145, 317-324[Abstract/Free Full Text]
27. Gutiérrez, S., Díez, B., Alvarez, E., Barredo, J. L., and Martín, J. F. (1991) Mol. Gen. Genet. 225, 56-64[Medline] [Order article via Infotrieve]
28. Henikoff, S. (1984) Gene (Amst.) 28, 351-359[CrossRef][Medline] [Order article via Infotrieve]
29. Sanger, F., Nicken, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467[Abstract/Free Full Text]
30. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
31. Gutiérrez, S., Velasco, J., Marcos, A. T., Fernández, F. J., Fierro, F., Díez, B., Barredo, J. L., and Martín, J. F. (1997) Appl. Microbiol. Biotechnol. 48, 606-614[CrossRef][Medline] [Order article via Infotrieve]
32. Kosalková, K., Marcos, A. T., and Martín, J. F. (2001) J. Ind. Microbiol. Biotechnol. 27, 252-258[CrossRef][Medline] [Order article via Infotrieve]
33. Neuss, N., Berry, D. M., Kupka, J., Demain, A. L., Queener, S. W., Duckworth, D. C., and Huckstep, L. L. (1982) J. Antibiot. 35, 580-584[Medline] [Order article via Infotrieve]
34. Lübbe, C., Wolfe, S., and Demain, A. L. (1986) Appl. Microbiol. Biotechnol. 23, 367-368
35. Ullán, R. V., Liu, G., Casqueiro, J., Gutiérrez, S., Bañuelos, O., and Martín, J. F. (2002) Mol. Gen. Genet. 267, 673-683
36. Velasco, J., Gutiérrez, S., Fernández, F. J., Marcos, A. T., Arenós, C., and Martín, J. F. (1994) J. Bacteriol. 176, 985-991[Abstract/Free Full Text]
37. Velasco, J., Gutiérrez, S., Casqueiro, J., Fierro, F., Campoy, S., and Martín, J. F. (2001) Appl. Microbiol. Biotechnol. 57, 300-356
38. Uchiyama, A., Aoyama, T., Kamijo, K., Uchida, Y., Kondo, N., Orii, T., and Hashimoto, T. (1996) J. Biol. Chem. 271, 30360-30365[Abstract/Free Full Text]
39. Turgay, K., Krause, M., and Marahiel, M. A. (1992) Mol. Microbiol. 6, 529-546[Medline] [Order article via Infotrieve]
40. Reichel, C., Brugger, R., Bang, H., Geisslinger, G., and Brune, K. (1997) Mol. Phamacol. 51, 76-582
41. Schmitz, W., Helander, H. M., Hiltunen, J. K., and Conzelmann, E. (1997) Biochem. J. 326, 883-889
42. Mansour, S. L., Thomas, K. R., and Capecchi, M. R. (1988) Nature 336, 348-352[CrossRef][Medline] [Order article via Infotrieve]
43. Liu, G., Casqueiro, J., Bañuelos, O., Cardoza, R. E., Gutiérrez, S., and Martín, J. F. (2001) J. Bacteriol. 183, 1765-1772[Abstract/Free Full Text]
44. Martín, J. F., Ingolia, T. D., and Queener, S. W. (1990) in Molecular Industrial Mycology (Leong, S. A. , and Berka, R., eds) , pp. 149-195, Marcel Dekker, New York
45. Kleinkauf, H., and von Döhren, H. (1996) Eur. J. Biochem. 236, 335-351[Medline] [Order article via Infotrieve]
46. Martín, J. F., Gutiérrez, S., and Aparicio, J. F. (2000) in Encyclopedia of Microbiology (Lederberg, J., ed) , pp. 213-237, Academic Press, Inc., San Diego, CA
47. Stachelhaus, T., and Marahiel, M. A. (1995) FEMS Microbiol. Lett. 125, 3-14[CrossRef][Medline] [Order article via Infotrieve]
48. Cheng, Y.-Q., and Walton, J. D. (2000) J. Biol. Chem. 275, 4906-4911[Abstract/Free Full Text]
49. Schmitz, W., Fingerhut, R., and Conzelmann, E. (1994) Eur. J. Biochem. 222, 313-323[Medline] [Order article via Infotrieve]
50. Schmitz, W., Albers, C., Fingerhut, R., and Conzelmann, E. (1995) Eur. J. Biochem. 231, 815-822[Medline] [Order article via Infotrieve]
51. Ackman, R. G., and Hansen, R. P. (1967) Lipids 2, 357-362[CrossRef][Medline] [Order article via Infotrieve]
52. Fingerhut, R., Schmitz, W., and Conzelmann, E. (1993) J. Inherited Metab. Dis. 16, 591-594[CrossRef][Medline] [Order article via Infotrieve]
53. van Veldhoven, P. P., Croes, K., Asselberghs, S., Herdewijn, P., and Mannaerts, G. P. (1996) FEBS Lett. 388, 80-84[CrossRef][Medline] [Order article via Infotrieve]
54. Schmitz, W., and Conzelmann, E. (1997) Eur. J. Biochem. 244, 434-440[Medline] [Order article via Infotrieve]
55. Caldwell, J., Hutt, A. J., and Fournel-Gigleux, S. (1988) Biochem. Pharmcacol. 37, 105-114
56. Knihinicki, R. D., Day, R. O., and Williams, K. M. (1991) Biochem. Pharmacol. 42, 1905-1911[CrossRef][Medline] [Order article via Infotrieve]
57. Shieh, W. R., and Chen, C. S. (1993) J. Biol. Chem. 268, 3487-3493[Abstract/Free Full Text]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
W. L. Kelly and C. A. Townsend
Mutational Analysis and Characterization of Nocardicin C-9' Epimerase
J. Biol. Chem., September 10, 2004; 279(37): 38220 - 38227.
[Abstract] [Full Text] [PDF]

Home page
 Eukaryot CellHome page
E. K. Schmitt, A. Bunse, D. Janus, B. Hoff, E. Friedlin, H. Kurnsteiner, and U. Kuck
Winged Helix Transcription Factor CPCR1 Is Involved in Regulation of {beta}-Lactam Biosynthesis in the Fungus Acremonium chrysogenum
Eukaryot. Cell, February 1, 2004; 3(1): 121 - 134.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/48/46216    most recent
M207482200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ullán, R. V.
Right arrow Articles by Martín, J. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ullán, R. V.
Right arrow Articles by Martín, J. F.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement