 |
INTRODUCTION |
Autonomous organisms normally replicate its DNA accurately, but
the fidelity of replication can be transiently decreased in response to
environmental and physiological stimuli through a number of pathways
(1). Although the Escherichia coli SOS response represents
the best-described transient mutator response (2), emerging evidence
indicates the existence of multiple inducible mutagenic pathways in
E. coli (3). One especially intriguing pathway is provoked
by increased translational errors resulting from mutations in tRNA
genes (4, 5), in genes specifying tRNA-modification enzymes (6), or
from exposure to streptomycin, an antibiotic that promotes
mistranslation (7). This pathway, dubbed translational stress-induced
mutagenesis (TSM)1 (3), does
not require the induction of lexA/recA-regulated SOS genes and is suppressed in cells defective for
RecABC/RuvABC-dependent homologous recombination (5, 7-9).
Available genetic (5, 7-9) and biochemical (10) evidence suggests that
the TSM phenotype results from error-prone DNA replication rather than
from defective DNA repair. On the basis of the effect of elimination of
individual genes encoding "non-replicative" polymerases, we
previously proposed that either DNA polymerase III or an unidentified
new DNA polymerase is responsible for error-prone replication in
TSM-induced cells.
DNA polymerase III holoenzyme (pol III HE) accounts for more than 90%
of cellular DNA synthesis (11, 12) and is also required for the major
post-replicative mismatch correction pathway (13, 14). pol III HE was
shown to effectively carry out translesion DNA synthesis past abasic
sites, mostly producing 
1-bp deletions (15), as contrasted to
translesion synthesis carried out by pol V, which mostly yields base
substitutions at abasic sites. pol III HE is a 10-subunit polymerase
((
)2
2
1
'
(
2)2)
consisting of three main components (16, 17) as follows: 1) the core polymerase (), responsible for DNA synthesis and proofreading (18, 19); 2) the processivity factor or -sliding clamp
(2) (20) that tethers the polymerase to the DNA (21);
and 3) the DnaX complex, containing ', , 
, and either or
both of two different DnaX proteins ( and ), that is responsible
for loading the -processivity clamp onto the DNA (22, 23). The
largest subassembly of pol III HE is DNA polymerase III* (pol III*)
composed of all the subunits of HE except the -subunit
(()221') (24). The HE is completed by the addition of
(2)2 to pol III* (22, 24).
In addition to pol III, four additional DNA polymerases (polymerases I,
II, IV, and V) are known in E. coli. Even though these polymerases carry out important cellular functions, genes encoding each
of these polymerases can be mutationally inactivated, implying that
considerable functional redundancy is built into the replication apparatus. DNA polymerase I (pol I; encoded by polA), known
as a "repair polymerase," normally functions to fill gaps that
arise during lagging strand replication and during excision repair. The
remaining three DNA polymerases, namely II (pol II; encoded by
polB (25, 26)), IV (pol IV; encoded by dinB
(27)), and V (pol V; encoded by umuDC (28, 29)), are induced
as a part of the SOS system. pol II has been proposed to play a role in replication-restart following DNA damage, a process that bypasses DNA
damage in both an error-free (30, 31) and error-prone manner (32, 33).
pol IV is involved in certain types of untargeted SOS mutagenesis (27,
34, 35), whereas pol V, working in conjunction with a number of other
factors including the RecA protein, is believed to be responsible for
translesion DNA synthesis (28, 29, 36). However, pol V may also be
responsible for untargeted mutations at undamaged template sites (37,
38).
The individual loss of polA, polB,
dinB, or umuDC genes does not affect the
expression of the TSM response (5, 8, 10). However, an analysis based
on cells with defects in individual genes leaves open the possibility
that two or more of these four nonessential DNA polymerases may have
nonexclusive (redundant) roles in error-prone DNA synthesis. Here we
show that a strain simultaneously defective for pol I, pol II, pol IV,
and pol V can be constructed, proving that loss of all four
non-replicative polymerases is compatible with viability. Analysis of
the TSM response in this strain confirms that the four non-replicative polymerases are not required collectively or individually for the TSM
response. To address the question directly whether pol III HE or an
unknown 6th DNA polymerase is responsible for mistranslation-induced mutagenesis, we purified pol III* from TSM-induced and uninduced cells
and analyzed its replication fidelity on both damaged and undamaged
template DNA. Our data show that purified pol III* from TSM-induced
cells shows elevated mutagenesis on undamaged DNA as well as at a
site-specific mutagenic lesion.
| |
MATERIALS AND METHODS |
Reagents, Enzymes, and Replication Proteins--
Taq
DNA polymerase was from Roche Molecular Biochemicals; restriction
endonuclease BglI, T4 DNA ligase, Vent DNA polymerase, and
T4 polynucleotide kinase were from New England Biolabs. The subunit
was purified as described by Johanson et al. (39). The
primase DnaG was purified as described by Marians (40). The E. coli single-stranded DNA-binding protein (SSB) was purified according to Minden and Marians (41).
Plasmid and Strain Construction--
Plasmid pMV22 was
constructed from plasmid pHM22 (5) as follows. The
SphI-HindIII 1604-bp fragment containing the
lacIq gene and the wild type glyV
tRNA gene under Ptrc promoter was inserted into the low copy
number plasmid pMW119 (42) cut with SphI and
HindIII. Similarly, plasmid pMV11 was constructed by
inserting the SphI-HindIII 1604-bp fragment
containing the mutant glyV tRNA gene (mutA) from
pHM11 (5) into the SphI-HindIII sites of pMW119.
To enable the subsequent transduction of the polA1 allele in
strain HSM83 (see Table I for genotypes),
the metE::Tn10 marker from strain
CAG18491 (43) was first transferred to HMS83 (44) by P1 transduction.
The transductants were selected on LB agar containing 30 µg/ml
tetracycline (Sigma). One isolate, named AM132, was characterized by
its inability to grow in minimal medium without methionine. E. coli strains AM134 and AM135 were constructed by co-transducing
the polA1 allele along with the marker
metE::Tn10 from strain AM132 into
strains CC105 and CC105mutA, respectively. Strains AM134 and
AM135 were characterized for the presence of polA1 allele by
testing their sensitivity to 0.04% methyl methanesulfonate in LB
plates and to UV irradiation at 7 J/m2 as described
previously (45). The E. coli strain AM130 was created by P1
transduction of the
(umuDC)595::Cmr allele
from strain RW82 to strain AM107 (CC105 polB (10)). The
presence of the (umuDC)595 allele was
confirmed by UV sensitivity at 30 J/m2. The E. coli strain AM146 was constructed by transferring the dinB::Kanr allele from strain
YG7207 to strain AM130 by P1 transduction. The presence of the
dinB::Kanr allele in AM146 was
confirmed by PCR amplification (forward primer 5'-CGCTGTATCAATACTTTGGTCA; reverse primer
5'-AGGCGAATAAGTTTTGTTTTGA) followed by analysis of restriction
digestion patterns of the PCR products. The E. coli strain
AM147 was made by co-transducing the polA1 allele along with
the marker metE::Tn10 from strain AM132
to AM146 by P1 transduction. Strain AM147 was characterized by
sensitivity to 0.04% methyl methanesulfonate and to UV irradiation at
7 J/m2.
The F' factors contained in strains CC104 and CC107 (two strains
related to CC105, the parental strain for AM147) contain a second copy
of the dinB gene (46, 47). To show that AM147 does not have
a second (wild type) copy of dinB, we carried out a
PCR-based analysis as summarized in Fig.
1. This analysis shows that an
"external" primer set (F1/R1 in Fig. 1) yields a single band corresponding to a disrupted version of dinB in AM147
cells (lane 2) and that two "internal" primer sets
(F2/R2 and F3/R3) do not yield a band (lanes 4 and
6), indicating the loss of sequences corresponding to
dinB. To verify that we could have detected a second copy of
dinB, we repeated the analysis with AM155 (CC104 dinB::Kanr), a strain harboring an
F' factor that was previously shown to have a second, episomal copy of
dinB. Our analysis shows that the F1/R1 primer set yields
two bands (lane 8), one corresponding to a disrupted allele
(1862 bp) and the other corresponding to the wild type allele (1603 bp). As expected, internal primer sets F2/R2 and F3/R3 amplify the
second copy of dinB in AM155 cells. Thus, these data confirm
that AM147 does not have an undisrupted dinB allele.
View larger version (46K):
[in this window]
[in a new window]
|
Fig. 1.
PCR-based analysis of dinB
alleles in E. coli strains AM147 (a
CC105 derivative) and AM155 (a CC104 derivative). At the
top is a diagrammatic representation of wild type
dinB and flanking sequences (sequence numbers are from the
GenBankTM sequence AE000131). The sequence replaced by the
KanR cassette (shaded arrow) in AM147 and AM155
and the positions of three sets of PCR primers (F1/R1,
F2/R2, and F3/R3) are also shown. At the
center are ethidium bromide-stained agarose electrophoretic
gels showing PCR products from CC105 (lanes 1, 3,
and 5), AM147 (lanes 2, 4, and
6), CC104 (lanes 7, 9, and
11), and AM155 (lanes 8, 10, and 12).
(For lanes 1-6, C = CC105 and
A = AM147; for lanes 7-12,
C = CC104 and A = AM155). Sizes of the
PCR products for each of the four strains using each of the 3 sets of
primers are shown at the bottom. The presence of a single
band corresponding to a disrupted dinB allele in AM147
(lane 2) using the external primer set (F1/R1),
and the absence of amplification products using the two internal primer
sets (F2/R2 and F3/R3; lanes 4 and
6) indicates the absence of a wild type dinB
allele in AM147. AM155 serves as a positive control demonstrating that
an undisrupted allele can be detected using the F1/R1 (lane
8, lower band), F2/R2 (lane 10), or F3/R3 (lane
12) primer sets.
|
|
Papillation Assay--
Papillation assays were performed with
slight modifications of the procedures described by Miller (48).
Cultures were spread on minimal A medium containing 0.2% glucose, 500 µg/ml phenyl--D-galactopyranoside (a non-inducing
lactose analog that serves as a carbon source after exhaustion of
glucose; Sigma), 40 µg/ml of the -galactosidase indicator
5-bromo-4-chloro-3-indolyl--D-galactopyranoside (X-gal; Gold Biotechnologies), and 1 mM
isopropyl--D-thiogalactopyranoside (IPTG; Sigma). Plates
were incubated at 37 °C for 4-5 days at which time blue papillae
(lacZ+ revertants) are distinctly visible
against the white background of lacZ
cells.
Construction of Site-specific C Lesion-bearing ssDNA
Constructs--
M13 single-stranded DNA (ssDNA) molecules bearing an
C residue were constructed following the procedures described
elsewhere (49-51) and summarized below. M13mp7L2 ssDNA was linearized
by cutting with the restriction endonuclease EcoRI that cuts
a hairpin DNA structure within the polycloning site of the vector. The
linearized DNA was annealed to a 57-nt "scaffold" and a
5'-phosphorylated 17-nt insert containing a single site-specific C
lesion. Annealing of the 57-mer draws the two ends of the linear M13
ssDNA together to form a non-covalently closed circular DNA with a
17-nt "gap" complementary to the lesion-containing 17-mer. The
annealed DNA is subjected to DNA ligation to generate a covalently
closed ssDNA circle containing the lesion-bearing 17-nt insert. After
the ligation step, the scaffold is removed by heat denaturation in the
presence of a 10-fold molar excess of an "anti-scaffold" 57-mer
(i.e. a 57-mer with a sequence complementary to that of the
scaffold). The constructed circular ssDNA was purified by using a
QIAquick gel extraction kit column (Qiagen).
To prime in vitro DNA synthesis, a 60-mer was annealed to
the ssDNA
(5'-TAACCAATAGGAACGCCATCAAAAATAATTCGCGTCTGGCCTTCCTGTAGCCAGCTTTCA-3'; complementary to the M13 sequence from 6628 to 6687; Fig.
4A) as follows. One pmol of the ssDNA construct (with or
without an C lesion) was mixed with 1.5 pmol of a 60-mer in 50 mM Tris-Cl (pH 7.8), 10 mM MgCl2,
and 20 mM dithiothreitol (DTT), heated at 85 °C for 5 min, and allowed to cool over 2 h to 30 °C. The terms
C-ssDNA and C-ssDNA, respectively, refer to the primed ssDNA
bearing a site-specific C lesion or normal cytosine (as a control).
Buffers Used for Polymerase Purification--
Buffers contain
the following: "Tris-back extraction" buffer (TBEB): 50 mM Tris-Cl (pH 7.5), 100 mM NaCl, 1 mM EDTA, 20% glycerol, and 5 mM DTT; "0.20
TBEB" is TBEB containing 0.2 g/ml of ammonium sulfate; "0.17
TBEB" is TBEB containing 0.17 g/ml of ammonium sulfate (52). Buffer A
is 50 mM Tris-Cl (pH 7.5), 0.5 mM EDTA, 20%
glycerol, and 5 mM DTT. Buffer B is buffer A supplemented with 5 mM MgCl2, 0.2 mM EDTA and
0.4 mM ATP.
Purification of pol III*--
pol III* was purified following
the procedures described previously (23), as summarized below. Cells
were grown in 300 liters of LB medium supplemented with ampicillin (50 µg/ml) and IPTG (1 mM) as appropriate, and cells were
harvested by centrifugation at 4 °C in a Sharples centrifuge. The
cell pellet was resuspended in an equal volume of 50 mM
Tris-Cl (pH 7.5), 10% sucrose solution, quick-frozen in liquid
nitrogen, and stored at 80 °C.
The cell suspension (2 kg) was thawed on ice, and the
A595 was adjusted to 200 with 50 mM Tris-Cl (pH 7.5), 10% sucrose solution. One-ninth
volume of lysis buffer (1.5 M NaCl, 0.2 M EDTA,
0.2 M spermidine, and 50 mM DTT) was added, and
the pH was adjusted to 8.5 by adding solid Tris base. Lysozyme (10 mg/ml in water) was added to 0.2 mg/ml, and the contents were incubated
for 30 min on ice, followed by 10 min in a 37 °C water bath. The
lysed cells were distributed into 250-ml Sorvall GSA bottles, kept on ice for 5 min, and centrifuged for 60 min at 13,000 rpm in a Sorvall SLA-1500 rotor. The supernatant (fraction 1a) was collected by gentle
decantation. To precipitate nucleic acid, polymin P (1% v/v; Amersham
Biosciences) was added slowly, with gentle stirring, to fraction 1a to
a final concentration of 0.06%. Stirring was continued for an
additional 30 min at 4 °C. The suspension was centrifuged at 13,000 rpm for 30 min at 4 °C in a Sorvall SLA-1500 rotor to collect the
supernatant (fraction 1b).
Ammonium sulfate (0.25 g/ml) was added to fraction 1b over a 10-min
interval while stirring. The contents were stirred for an additional 30 min at 4 °C, transferred into Sorvall GSA bottles, and centrifuged
at 27,000 × g in a Sorvall SLA-1500 rotor for 45 min
at 4 °C. The precipitate was resuspended in 0.2 TBEB (1/10th of the
fraction 1a volume), and the insoluble fraction was collected by
centrifugation as above. This procedure was repeated with 0.17 TBEB
(1/40th of the fraction 1a volume), and the final recovered insoluble
fraction was dissolved in a small volume of TBEB (fraction II).
Fraction II was quick-frozen in liquid nitrogen and stored at
80 °C.
Fraction II was thawed and dialyzed overnight against 4 liters of
buffer A + 40 mM NaCl at 4 °C. The dialysate was
clarified by centrifugation for 20 min at 48,200 × g
at 4 °C. The clarified solution was diluted with buffer A to the
conductivity of buffer A + 50 mM NaCl. The diluted fraction
II was applied to a heparin-agarose (Sigma) column (1 ml of resin per
10 mg of protein) equilibrated with buffer A + 50 mM NaCl.
The column was washed with 2 column volumes of the equilibration
buffer, and the activity was eluted with a 10-column volume of NaCl
gradient (50-400 mM) in buffer A. Fractions were pooled,
and ammonium sulfate was added to 0.26 g/ml. The suspension was stirred
for 2 h at 4 °C and centrifuged at 37,000 rpm for 60 min at
4 °C in a Sorvall A841 rotor. The precipitate was resuspended in a
small volume (300 µl) of buffer B (fraction III).
Fraction III was clarified by centrifugation for 5 min at 13,000 rpm in
a microcentrifuge. The clarified fraction III was gel-filtered through
a fast protein liquid chromatography Superose 6 column (HR 10/30;
Amersham Biosciences) equilibrated with buffer B at a flow rate of 0.1 ml/min. Peak fractions were pooled, and glycerol was added to achieve a
final concentration of 38% (fraction IV) and stored in aliquots at
80 °C.
pol III* Assay--
The assay mix (25 µl) containing 50 mM HEPES-KOH (pH 8.0), 50 mM potassium
glutamate, 10 mM magnesium acetate, 10 mM DTT, 10 µg/ml rifampicin, 100 µg/ml bovine serum albumin (BSA), 24 µg/ml SSB, 3.2 µg/ml M13 Gori ssDNA, 100 µM each of CTP, GTP, and UTP, 80 µM each of
dGTP, dCTP, dATP, and [3H]dTTP (200-400 cpm/pmol), and 1 mM ATP was pre-warmed for 5 min at 30 °C. Twenty ng of
DnaG was added, and the contents were incubated for 5 min at 30 °C.
Thirty ng of the subunit were added, and the reactions were started
by the addition of pol III*. If necessary, the proteins were diluted
with 50 mM Tris-Cl (pH 7.5), 150 mM NaCl, 5 mM EDTA, 10 mM DTT, 500 µg/ml BSA, and 20%
glycerol. After incubation for 5 min at 30 °C, the reaction was
stopped by chilling and addition of 2 drops of 0.2 M sodium
pyrophosphate, 2 drops of calf thymus DNA (1 mg/ml; Sigma), and 4 ml of
5% trichloroacetic acid. Acid-insoluble radioactivity was then
measured. One unit of activity is the amount catalyzing the
incorporation of 1 nmol of deoxyribonucleotide in 30 min at
30 °C.
Replication of DNA-primed M13 ssDNA by Purified
Proteins--
Replication of M13 ssDNA primed with an annealed 60-mer
by purified proteins was carried out following the procedures of Geider and Kornberg (53) and of Livneh (54) as follows. The standard reaction
mixture (25 µl) included 20 mM Tris-Cl (pH 7.5), 4%
glycerol, 0.1 mM EDTA, 8 mM MgCl2,
8 mM DTT, 50 mM potassium glutamate, 80 µg/ml
BSA, 10 µg/ml rifampicin, 1 mM ATP, 80 µM
each of the dNTPs, 20 fmol 60-mer primed C-ssDNA or C-ssDNA, 32 µg/ml of SSB, 20 ng of subunit, and 4 units of pol III*.
Reactions were allowed to proceed for 20 min at 37 °C and were
stopped by adding EDTA to 5 mM, Tris-Cl (pH 8.0) to 10 mM, and SDS to 0.5% (w/v), followed by heating at 65 °C
for 10 min. Proteinase K was added to a final concentration of 50 µg/ml, and the mixture was incubated at 55 °C for 30 min. Then the
reaction mix was subjected to phenol extraction, followed by standard
ethanol precipitation. The precipitated DNA was dissolved in a minimum
volume of H2O, and an aliquot was checked by
electrophoresis on an agarose gel (0.8%). Ethidium bromide staining
revealed that about half of the input ssDNA (with or without C) was
converted to replicative form II (RF II) DNA on the basis of
electrophoretic mobility.
Analysis of in Vitro Mutation Fixation at C--
Replication
reactions were carried out as described above, and the newly
synthesized minus strand was selectively amplified by ligation-mediated
PCR (LM-PCR) following the procedures described in detail by Al Mamun
et al. (10, 55). The resulting gel-purified 309-bp DNA
fragment was subjected to multiplex sequencing reactions as described
by Al Mamun et al. (10) and summarized below. Eight ng (0.04 pmol) of the 309-bp PCR product, 0.06 ng (0.1 pmol) of a
5'-32P-labeled 19-nt long primer (50), 20 µM
dGTP, 20 µM dCTP, 200 µM ddATP, and 1 unit
of Taq DNA polymerase (Roche Molecular Biochemicals) in 15 µl of reaction buffer provided by the vendor was subjected to linear
amplification as follows: cycle 1: 94 °C/2 min, 52 °C/20 s, 65 °C/5 s; cycles 2-19: 94 °C/20 s; 52 °C/20 s, 65 °C/5
s; cycle 20: 94 °C/20 s, 52 °C/20 s, and 65 °C/40 s. The
elongation products were electrophoresed on 16% polyacrylamide, 8 M urea gels, and the autoradiograms were analyzed by
densitometry as described previously (49).
Construction of Gapped M13mRS65 DNA--
Gapped DNA was prepared
following the procedures described elsewhere (56, 57) with some
modifications. Double-stranded form I (RF-I) DNA of phage M13mRS65 was
isolated using a Qiagen plasmid mini kit following the procedures
described by the vendor. The DNA was digested with the restriction
endonucleases MluI and SphI, which cut at
positions 60 and +379 of the lacI gene, respectively, producing two fragments of size 439 and 8040 bp. The 8040-bp fragment was purified from 0.8% TAE (40 mM Tris acetate, 1 mM EDTA (pH 8))-agarose gels using the QIAquick gel
extraction kit (Qiagen) by procedures described by the vendor. The
purified 8040-bp fragment (1850 fmol) was mixed with M13mRS65 ssDNA
(1250 fmol) in the presence of 25 mM Tris-Cl (pH 7.5), 10 mM MgCl2, and 10 mM DTT,
heat-denatured at 90 °C for 2 min, cooled in an ice bath, incubated
at 70 °C for 5 min, and allowed to slow-cool to room temperature
over several hours by switching off the water bath.
Gap-filling DNA Synthesis and Mutation Frequency
Determination--
Gap-filling DNA synthesis was performed following
the procedures as described previously (56, 57). The 25-µl reaction mixture contained 30 mM HEPES-KOH (pH 7.6), 10 mM MgCl2, 8 mM DTT, 100 µg/ml
BSA, 200 µM of each dNTP, 1 mM ATP, 20 nM subunit, 50 fmol of gapped DNA, and 5-15 units of
DNA polymerase III* (pol III*). Where indicated, replication products
were radiolabeled by including 7 µCi of [-32P]dATP
(10 mCi/ml; 6000 Ci/mmol; Amersham Biosciences). The reaction mix was
incubated at 37 °C for 10 min and quenched by adding EDTA to 15 mM. To assess gap-filling, 10 µl of each reaction were
mixed with 2.5 µl of SDS/dye mix (20 mM Tris-Cl (pH 7.5),
5 mM EDTA, 5% SDS, 0.5% bromphenol blue, 25% glycerol)
and subjected to electrophoresis in a 0.8% agarose gel in TAE buffer
containing 0.5 µg/ml ethidium bromide at constant voltage (70 V) for
16 h. Bands were visualized by illumination with UV light and
photographed. The gel was dried and exposed to Kodak XRP film to
produce autoradiograms.
To analyze mutagenesis, replicated DNA contained in the 25-µl
reaction mix (described above) was extracted with phenol-chloroform, precipitated with ethanol, and resuspended in 12 µl of
H2O. An aliquot was checked by electrophoresis to confirm
the completeness of gap-filling. 1-2-µl aliquots were used to
transfect competent MC1061 cells by electroporation as described by Al
Mamun et al. (55). Immediately following electroporation, 1 ml of cold SOC medium (0.5% yeast extract, 2% tryptone, 10 mM NaCl, 2.5 mM KCl, 10 mM
MgCl2, 10 mM MgSO4, and 20 mM glucose) was added. An appropriate volume (50-100 µl)
of the transfection mix, together with 3 ml of soft agar containing 2.5 mg of X-gal (Sigma) and 0.3 ml of indicator culture (E. coli NR9099), were mixed and the contents plated on minimal agar.
The plates were incubated at 37 °C for 24 h, and the
lacI mutants were scored as light and dark blue plaques. The
mutation frequency was determined by dividing the number of mutant
plaques by the total number of plaques.
Determination of Percent Translesion DNA
Synthesis--
Translesion DNA synthesis was determined following the
procedure as described by Pham et al. (36), as summarized
below. The reaction mix (10 µl) contained 20 mM Tris-Cl
(pH 7.5), 5 mM DTT, 8 mM MgCl2, 0.1 mM EDTA, 25 mM potassium glutamate, 4%
glycerol, 40 µg/ml BSA, 1 mM ATP, 500 µM
dNTPs, 100 nM SSB (as tetramer), 40 nM (as
dimer), 50 nM primer/template (see below), and 0.5 to 1 unit of pol III*. The reaction mix was incubated at 37 °C for 10 min
and terminated by adding an equal volume of 20 mM EDTA in
95% formamide. The reaction products were heat-denatured and separated
on a 12% denaturing polyacrylamide gel, and band intensities were
measured by PhosphorImaging using ImageQuant software (Amersham Biosciences). Percent translesion synthesis values were calculated as
the number of primers extended to the lesion plus the number of primers
extended past the lesion, divided by the total number of primers.
The sequence of the template (120-mer) and primer (30-mer) were
5'-GATAACAATTTCACACAGGAAACAGCTATGACCATGATTCAGTGATGTCCCGTTCGCCCATAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACT-3', 5'-AGTCACGACGTTGTAAAACGACGGCCAGTG-3', respectively. In the
control template, normal cytosine (C) replaced C. To prepare the
template-primer, 200 nM of 120-mer was mixed with 200 nM of 5'-32P-end-labeled 30-mer in the presence
of 25 mM Tris-Cl (pH 7.5), 10 mM
MgCl2, and 10 mM DTT, heat-denatured at
90 °C for 3 min, cooled in an ice bath, incubated at 70 °C for 5 min, and then allowed to slow-cool to room temperature by switching the
water bath off.
| |
RESULTS |
The TSM Phenotype Is Expressed in an E. coli mutA Strain
Simultaneously Deficient for pol I, pol II, pol IV, and pol
V--
Increased mistranslation results in the expression of an
error-prone DNA polymerase that is demonstrable in cell-free extracts. This activity is detected as increased in vitro mutation
fixation at a site-specific mutagenic lesion
(3,N4-ethenocytosine; C) borne on phage M13
ssDNA (10). In this system, primed ssDNA bearing an C residue
(C-ssDNA) is replicated with cell-free extracts from mutA
cells, and the newly synthesized complementary (minus) strand is
selectively amplified using ligation-mediated PCR (LM-PCR). The
amplified products are subjected to multiplex sequencing to
characterize mutagenesis at the C lesion. Interestingly, the
error-prone polymerase activity is undetectable in cell-free extracts
prepared from recA mutA cells (10), consistent with the
observations that expression of the TSM phenotype requires a functional
recA gene (5, 8).
We have shown previously, through a series of in vivo
experiments, that the TSM response does not require the individual
function of pol I, pol II, pol IV, or pol V (5, 8, 10). This
observation, together with the crude extract results considered above,
argued that the TSM phenotype is mediated by pol III. However, the
available data did not exclude the possibility of a redundant function
for the "non-essential" DNA polymerases such that one of the
remaining three were able to compensate for the loss of any one
polymerase. To address this possibility, we constructed a strain
(AM147) that is defective for all four nonessential DNA polymerases
(pol I, pol II, pol IV, and pol V), and we asked if the TSM phenotype, detected as increased lacZ 
lacZ+ papillation (58), is still displayed in
such a strain in response to the expression of the mutA tRNA
gene. When E. coli AM147 is transformed with pMV11, a
plasmid bearing mutA, a strong mutator phenotype (increased
papillation) is observed in the presence of IPTG, a condition in which
the mutA allele is expressed (Fig. 2). The intensity of the papillation is
comparable with that in strain CC105/pMV11, the positive control with
wild type polA, polB, dinB, and
umuDC alleles. Increased papillation is not observed for
strains CC105/pMV22 (plasmid-borne wild type glyV) and
AM147/pMV22 (plasmid-borne wild type glyV) in the presence
of IPTG. These observations rule out a requirement for the individual
or collective function of polA, polB,
dinB, and umuDC for the expression of the TSM
phenotype. It may be noted that a second copy of dinB has
been found on the F' factor of some E. coli strains (46, 47). We have tested for a second dinB allele in AM147 by PCR amplification using both an external primer set and two internal primer
sets, and we confirmed that the strain did not have a second dinB allele (see "Materials and Methods"; Fig. 1).
View larger version (43K):
[in this window]
[in a new window]
|
Fig. 2.
Colony papillation assay for mutator
activity. Cells were streaked on papillation agar medium
containing IPTG (see "Materials and Methods") and were incubated
for 5 days at 37 °C to allow the development of papillae. The plate
shows that strains bearing the pMV11 (mutA) plasmid (from
left, 2nd, 4th, and 5th
streaks) show dramatically increased papillation, in contrast to
the background level papillation observed for strains carrying pMV22
(glyV+ control; 1st and 3rd
streaks).
|
|
Purification and Characterization of pol III* from Mutator and
Control Strains--
To address the question whether DNA polymerase
III is error-prone in TSM-induced E. coli cells, we purified
pol III* from two pairs of strains. The first pair consisted of strains
AM134 (polA; non-mutator control) and AM135 (polA
mutA; mutator); the second set consisted of strains AM147/pMV22
(polA polB dinB umuDC; non-mutator control) and AM147/pMV11
(polA polB dinB umuDC mutA; mutator). Purification was
carried out as described under "Materials and Methods." Table
II summarizes some characteristics of the four purified enzymes and shows that all four enzymes had similar specific polymerase activities by the M13Gori polymerization
assay (59).
Fig. 3 shows that the polymerization
activity, based on an assay in which a 60-mer primer annealed to M13
ssDNA is elongated, is somewhat higher for pol III* from non-mutator
strains as compared with that from mutator strains. Because
polymerization activity for the four polymerase preparations is
essentially similar using the DnaG-primed M13Gori ssDNA
assay (Table II), it is not clear why the 60-mer primer elongation
assay shows a slight reduction in polymerization by pol III* from
mutator strains as compared with those from non-mutator strains.
View larger version (14K):
[in this window]
[in a new window]
|
Fig. 3.
Characterization of pol III polymerization
activity using primed undamaged M13 ssDNA (see Fig.
4A). The reaction mix (25 µl) included 20 mM Tris-Cl (pH 7.5), 4% glycerol, 0.1 mM EDTA,
8 mM MgCl2, 8 mM DTT, 50 mM potassium glutamate, 80 µg/ml BSA, 10 µg/ml
rifampicin, 1 mM ATP, 80 µM each of the
dNTPs, [-32P]dATP (3000-4000 cpm/pmol), 20 fmol of
primed M13 ssDNA, 20 ng of subunit, and pol III* (0.5-16 units for
the experiments depicted in A; 4 units for those in
B). After incubation at 37 °C for 10 min (A)
or for the indicated time (B), the reaction was stopped by
chilling, and the addition of 2 drops of 0.2 M sodium
pyrophosphate, 2 drops of calf thymus DNA (1 mg/ml), and 4 ml of 5%
trichloroacetic acid. The resulting mixture was passed through a glass
fiber filter (Enzo), and acid-insoluble radioactivity was measured
following the procedure described by Wickner and Kornberg (68).
|
|
Mutation Fixation at an C Lesion by Purified pol III*--
We
have shown previously (5) that mutation fixation at an C residue
borne on transfected M13 ssDNA is significantly increased in
mutA cells. Subsequently we showed that in vitro
translesion DNA synthesis across a site-specific C residue by crude
extracts prepared from mutA cells is error-prone (10). To
determine whether translesion synthesis across C by purified pol
III* from mutA strains is also error-prone, we used a
modification of the previously described in vitro
replication-in vitro mutation detection system (10, 55). In
the modified assay system for purified pol III, we created a primed
template (C-ssDNA) consisting of M13 ssDNA bearing a site-specific
lesion to which a 60-mer primer is annealed so that the 3'-OH terminus
is situated 388 nt upstream of the lesion site. The primer is elongated
by the DNA polymerase, followed by selective amplification of the newly
synthesized complementary strand by LM-PCR and subsequent multiplex
sequencing analysis as outlined in Fig.
4. In the multiplex sequence analysis
strategy, the specificity of base insertion opposite the lesion is
determined by elongation of a labeled sequencing primer in the presence
dGTP, dCTP, and ddATP. Correct insertion of a guanine opposite C
yields a 23-mer limit elongation product, whereas insertion of a T
(i.e. a C A transversion) or an A (C T transition)
opposite C yields, respectively, 21- and 22-nt-long products.
Densitometric analysis of the relative signal intensity of each band is
used to calculate the frequency of each type of mutation as described
previously.
View larger version (38K):
[in this window]
[in a new window]
|
Fig. 4.
Characterization of in vitro
mutagenesis at an C residue by purified pol III preparations.
A, schematic representation of M13mp7L2 genome showing the
position of the C lesion (or C in control constructs; position
X at nucleotide 6240), the BglI restriction
endonuclease site (at nucleotide 6402), and the 60-mer primer-annealing
site (nt 6628-6687). DNA synthesis on the primed template was carried
out as described under "Materials and Methods," and a 319-nt
sequence of the newly synthesized strand was selectively amplified by
ligation-mediated PCR as described in detail elsewhere (10) and
summarized briefly under "Materials and Methods." B,
summary of multiplex sequence analysis procedures for a 319-bp
double-stranded DNA fragment derived by selective amplification of the
newly synthesized strand as above. A 5'-32P-labeled
19-nt-long primer (50) was mixed with the 309-bp DNA fragment and
subjected to 20 cycles of (linear) elongation by Taq DNA
polymerase (Taq pol) in the presence of dGTP, dCTP, and
ddATP as described under "Materials and Methods." Under the
described conditions, primer elongation on wild type (WT)
and mutant templates results in dead-end products of characteristic
lengths: 23-mer for wild type, 22-mer for C T mutation, and 21-mer
for C A mutation. The elongation products were fractionated by high
resolution gel electrophoresis and quantitated by computing
densitometry. C, composite autoradiogram showing in
vitro mutation fixation at C lesions (lanes 5-8)
and, as controls, at normal cytosine (lanes 1-4). In
vitro synthesized complementary (minus) strand was selectively
amplified by LM-PCR followed by PCR, and the double-stranded DNA
products were subjected to multiplex sequence analysis as outlined in
B above. The resulting labeled elongation products were
fractionated on 8% polyacrylamide, 8 M urea gels followed
by autoradiography. Lanes 1-4, C-ssDNA (control,
C) replicated with 4 units of pol III* from the
indicated strains. Lanes 5-8, C-ssDNA replicated with 4 units of pol III* from the indicated strains. We have previously
demonstrated, by reconstruction experiments, that the in
vitro mutation analysis system described here measures mutation
frequency and specificity with reasonable accuracy (10).
|
|
Fig. 4C shows that when a control template-primer in which
normal cytosine replaces C (C-ssDNA) is replicated by pol III* from
non-mutator strains (lanes 1 and 3) or from
mutator strains (lanes 2 and 4), as expected,
almost all of the signal is contained in the 23-nt band
(i.e. no detectable 22- and 21-nt bands are observed).
Lane 5 shows that C-ssDNA, when replicated by pol III*
from non-mutator strain AM134, displays detectable mutagenesis. Replication of C-ssDNA by pol III* from mutator strain AM135 (lane 6) results in detectably increased mutagenesis, as
indicated by the increased intensity of the bands corresponding to C
A (21 nt) and C T (22 nt) events. Table
III provides a quantitative summary of
the results obtained from at least three independent replication for
each of the pol III*, followed by mutation analysis. Translesion
synthesis by pol III* from AM134 results in 17% mutagenesis, whereas
translesion synthesis by the polymerase from AM135 results in 34%
mutagenesis (Table III). A similar pattern of mutation is observed when
C-ssDNA is replicated with pol III* from non-mutator strain
AM147/pMV22 (Fig. 4C, lane 7) or from the mutator
strain AM147/pMV11 (lane 8) (9.8 versus 26%;
Table III). In vivo mutagenesis at an C lesion ranges
from 4 to 13% for wild type strains and 40 to 60% in mutA
cells (5, 8, 10). The lower fold elevation in mutagenesis by pol III*
from mutator strains versus non-mutator strains (2-3-fold;
Table III) is considered under "Discussion."
To address the question whether the elevation of mutagenesis at C
lesion is mediated by elevated translesion DNA synthesis by pol III
from mutator strains, we used a template-primer consisting of a
120-nt-long oligonucleotide bearing a site-specific C lesion (or
normal C in controls) at nucleotide position 51 annealed to a
5'-end-labeled 30-mer primer whose 3'-OH terminus is 14 nt downstream of the lesion site (Fig. 5). The primer
was elongated by pol III following the procedures described under
"Materials and Methods," and the products were analyzed by high
resolution gel electrophoresis. Fig. 5 shows that all of the tested pol
III preparations were capable of significant levels of translesion DNA
synthesis across C. Table IV presents
a quantitative analysis, based on densitometric analyses of the type of
data represented by Fig. 5, and confirms that there are no significant
differences in translesion DNA synthesis by pol III preparations from
control and mutator strains. Therefore, elevated mutagenesis at C
lesion by pol III from mutator strains appears to result from increased
errors rather than from increased translesion DNA synthesis.
View larger version (35K):
[in this window]
[in a new window]
|
Fig. 5.
Translesion DNA synthesis across an
C residue by purified pol III*. The DNA
template-primer used, schematically shown at right,
consisted of a 120-nt-long oligonucleotide template bearing an C (or
C for control experiments) at position 51, annealed with a
5'-32P-end-labeled primer (30 nt) 14 nt downstream of the
lesion. DNA synthesis by pol III* was carried out as described under
"Materials and Methods," and the elongation products were analyzed
on a 12% denaturing polyacrylamide gel. Locations of the full-length
product, the site of the lesion, as well as the unelongated primer are
marked on the left of the autoradiograph. Lane 1,
unelongated primer; lane 2, elongation on a control template
(normal cytosine at position 51) by pol III* from AM134; lanes
3-6, elongation on an C template by pol III* from AM134
(lane 3), AM135 (lane 4), AM147/pMV22 (lane
5), and AM147/pMV11 (lane 6).
|
|
Fidelity of pol III* from Mutator and Control Strains during in
Vitro Gap-filling DNA Synthesis on Undamaged Templates--
M13mRS65
phage is a derivative of M13 phage harboring, in addition to the
lacZ gene, the entire adjacent lacI gene
(M13lacI+Z+) (60, 61).
Because phage M13mRS65 carries the lacZ gene, it is
capable of -complementation on a lacZM15 host such as E. coli NR9099. However, because it also carries the
lacI gene encoding the lac repressor,
-complementation depends on the state of the lacI gene.
On plates containing X-gal, M13mRS65 (lacI+)
will produce colorless plaques, whereas lacI mutants
generated by DNA synthesis errors will produce blue plaques. Thus, this phage provides a forward mutational target where blue mutants can be
readily observed against a background of colorless plaques. Fig.
6A outlines an in
vitro assay system based on this phage. The assay consists of
creating a 439-nt-long gap in the lacI region (60 to +379)
following the procedures described under "Materials and Methods."
The lacI gap is filled by DNA synthesis catalyzed by pol
III* from non-mutator and mutator strains, and the resulting products
are transfected into an appropriate host for analysis of mutagenesis
that occurred during in vitro DNA synthesis.
View larger version (43K):
[in this window]
[in a new window]
|
Fig. 6.
A, pol III replication fidelity assay
based on gap-filling in M13 double-stranded RF DNA. The 439-nt-long gap
is located in the 5'-region of the lacI gene (60 to +379
of the lacI gene) and covers the promoter region and the
first 379 bp of the lacI gene. Gap-filling proceeds from the
+379 position (right) to the 60 position
(left). Gapped DNA was replicated with pol III*, and the
replicated products were analyzed as described under "Materials and
Methods." Ethidium bromide-stained agarose gel (B) and an
autoradiogram of the same gel (C), showing replicated
products, are shown. Lane 1, uncopied M13mRS65 gapped DNA;
lane 2, replicated DNA with pol III* from strain AM134;
lane 3, replicated DNA with pol III* from strain AM135;
lane 4, replicated DNA with pol III* from strain
AM147/pMV22; lane 5, replicated DNA with pol III* from
strain AM147/pMV11; and lane 6, RF II DNA marker (nicked
double-stranded M13mRS65 DNA).
|
|
Fig. 6B (ethidium bromide fluorescence) and Fig.
6C (autoradiography) show that the mobility of the gapped
DNA changes to that of replicative form II (RF-II) DNA after a 10-min
gap-filling reaction by pol III. Table V
summarizes mutation frequencies obtained by transfection of the
replication products into competent E. coli MC1061 cells,
and shows that the mutation frequency for pol III from the non-mutator
strain AM134 is 34.7 × 104, whereas it is 83.4 × 104 for AM135, a 2.4-fold elevation. Similar results
were obtained for pol III from strains AM147/pMV22 (non-mutator) and
AM147/pMV11 (mutator; Table V). Thus pol III* from mutator strains is
error-prone against undamaged DNA also. Table V also shows that
mutation frequencies for uncopied DNA, and for gap-filled (non-mutator polymerases) are, respectively, 12 × 104, and
35-42 × 104, values that are ~2-fold higher than
those reported by Pham et al. (62) for uncopied DNA (6 × 104) and for DNA replicated with wild type pol III
(15 × 104). It is possible that the higher
background rates in our experiments are due to differences in the
preparation of the template M13mRS65 gapped DNA. However, the
3-3.5-fold elevation in mutation frequency gap-filled DNA when
compared with uncopied DNA in our experiments (Table V) is similar to
the 2.5-fold elevation (at 200 µM dNTPs concentration)
reported by Pham et al. (62). Finally, the 2.4-fold elevation in lacI mutagenesis observed for pol III from
mutator strains in comparison to non-mutator strains (Table V) is
similar to the 3-fold elevation in a lacZ forward
mutagenesis assay based on replication of M13 ssDNA by crude extracts
from mutA and wild type cells (10). Thus, pol III* from the
mutator strains tested here is error-prone against undamaged DNA.
View this table:
[in this window]
[in a new window]
|
Table V
Fidelity of in vitro gap-filling pol-III*
M13mRS65 gapped DNA was constructed as described ("Materials and
Methods" and Fig. 6), and in vitro gap-filling synthesis
by purified pol-III* preparations was carried out as described under
"Materials and Methods." Approximately 20 ng of the replicated
(RFII) DNA was transfected into electrocompetent MC1061 cells, and the
transfected cells were plated on X-gal indicator plates as described
under "Materials and Methods." Under the plating conditions,
wild-type phage forms colorless plaques, whereas lacI mutant
phage forms blue or light blue plaques.
|
|
| |
DISCUSSION |
The present study was undertaken to investigate the mechanisms
underlying the mutator phenotype observed in cells in which mistranslation levels have been increased either due to mutations in
genes for tRNAs or tRNA-modifying enzymes or as a result of exposure to
mistranslation-promoting agents such as streptomycin. Although mutator
phenotypes can result from defects in repair, replication, or
recombination, accumulating evidence suggests that
mistranslation-mediated mutagenesis is mediated by error-prone DNA
replication. In particular, our previous work (10) showed that a
transiently expressed novel DNA polymerase or an induced alteration of
a constitutively expressed DNA polymerase might be responsible for the
TSM phenotype.
How exactly mistranslation activates error-prone replication is not
understood. Two available hypotheses have focused on a modification of
E. coli DNA polymerase III. Slupska et al. (4) have proposed that the phenotype results from direct mistranslation of
the subunit protein of pol III to create a small fraction of
dominant-negative proteins. Because Asp Gly mistranslation by a
missense suppressor tRNA is inefficient (1-2% (63)), a key prediction
of this hypothesis is that the mutator phenotype is transient, being
expressed in a small fraction (1-2%) of mutA cells at any
one time. However, transfection of M13 ssDNA bearing a site-specific
C residue results in a 5-20-fold elevation in mutagenesis, a result
that suggests that a majority of mutA cells must
constitutively express a mutator phenotype (5). To allow for a
constitutive expression of the phenotype, the alternative hypothesis
suggested that mistranslation triggered an "upstream" event
activating a pathway that ultimately led to the constitutive expression
of an error-prone replication activity (5). The molecular signal that
turns on error-prone replication is presumed to be increased protein
turnover due to an accumulation of misfolded proteins generated by
mistranslation. Alternatively, mistranslation may result in the
production of very small amounts of "gain-of-function" mutant
proteins that activate a signal cascade leading to the production of an
error-prone polymerase.
The work reported here shows that efficient induction of the TSM
response occurs in cells simultaneously defective for pol I, pol II,
pol IV, and pol V (Fig. 2). The construction of a viable, multiply
deficient strain (AM147 polA polB dinB umuDC) suggests that
all essential replication functions in E. coli can indeed be
carried out by the remaining polymerase, namely pol III.
To address the question whether a modified form of pol III can account
for the mutator phenotype, we purified pol III* from two pairs of
TSM-induced and uninduced cells (Fig. 3 and Table II) and analyzed the
replication fidelity of the purified enzymes on both damaged (C;
Fig. 4 and Table III) and undamaged DNA templates (Fig. 6 and Table V).
Our results show that mutagenesis is elevated over 2-fold on both
damaged and undamaged DNA when they are replicated by pol III from
mutator strains as compared with control strains (Tables III and
V).
The enhanced mutagenesis by pol III* from TSM-induced cells is
characterized by an increase in C A and C T mutations, with C
A mutations predominating over C T mutations (Table III). This
mutational specificity is in complete agreement with our in
vivo studies (5, 8) as well as our previous in vitro studies with crude extracts (10). The data here show that pol III is
capable of extensive DNA synthesis across an C lesion (~35%
translesion synthesis; Fig. 5 and Table IV). Thus, our results suggest
that both base insertion opposite an C residue as well as extension
past the site can be carried out by pol III in E. coli cells
and that "lesion-bypass polymerases" such as pol II, pol IV, and
pol V (32) are not required for some noninstructive mutagenic DNA
lesions. This finding resolves a number of early and previously
puzzling observations on the mutagenic properties of C, including
its noninstructive template characteristics (64), as well as its
ability to induce mutations in SOS-deficient cells (65). Indeed, the
unusual mutagenic properties of C were instrumental in uncovering
UVM, an SOS-independent DNA damage-inducible pathway in E. coli (3, 49, 50, 66).
Because essentially identical results are obtained with two
different pol III* preparations from two different mutA
strains (one of which was defective for all four of the remaining DNA polymerases thus ruling out any polymerase cross-contamination), these
results are consistent with the conclusion that pol III* from
mutA cells is error-prone. Nevertheless, the apparent
magnitude of the mutator effect at C residues differs from that
observed in vivo as well as previous in vitro
replication studies based on crude extracts. Thus, mutagenesis is
elevated 2-fold at C by pol III* from TSM-induced cells over
controls, as compared with the 5-20-fold effect observed in
vivo (5, 8) and in vitro with crude cell extracts (10).
This magnitude of difference between in vivo and in
vitro results appears to be an inherent, as yet unexplained,
property of highly purified pol III preparations. It is instructive to
compare these results with the in vivo and in
vitro magnitude of differences for wild type dnaQ and
mutD5 pol III holoenzyme preparations (62). The
dnaQ defect in mutD5 cells reduces the editing
activity of to <2% of the wild type level and leads to a
10,000-fold elevation in mutagenesis. A part of the mutator effect is
attributable to saturation of the mismatch repair pathway; however,
even in cells overexpressing mutL (the limiting component of
mismatch repair system), there is only a 6-20-fold reduction in the
magnitude of mutator effect, so that residual mutagenesis is still
about 2 to 3 orders of magnitude above that in wild type cells (67).
Despite such a huge in vivo difference, the error frequency
differences between the wild type and mutD5 holoenzymes (in
the same experimental system as the one we have used) ranges from 2.2- to 4.5-fold at dNTP concentrations of 50-1000 mM (we use
200 mM dNTPs) (62). In comparison to mutD5, mutA is a weaker mutator that elevates mutagenesis by about
5-20-fold depending on the assay (3, 7, 58), the most accurate
determination being a 17-fold increase in mutation rate in
streptomycin-induced rpsL1408 cells at a specific
lacZ site (7). The above considerations suggest that the
observed elevation in error levels mutA pol III is
significant. These results, in conjunction with the demonstration that
the mutA phenotype is expressed in cells defective for
polA, polB, dinB, and umuDC
(Fig. 2), suggest that the error-prone polymerase mediating TSM is a
modified version of pol III. How exactly pol III is modified in
TSM-induced cells is unknown. Among the possibilities are incorporation
of one or more mistranslated subunits into the holoenzyme, chemical
modification (such as phosphorylation or acetylation), and acquisition
of a cofactor that can affect fidelity.
,
TOP
ABSTRACT
INTRODUCTION
C lesion by purified
pol-III*
