HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 48, 46676-46686, November 29, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/48/46676    most recent M206444200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bellemare, D. R. Articles by Labbé, S. Search for Related Content PubMed PubMed Citation Articles by Bellemare, D. R. Articles by Labbé, S. Social Bookmarking                      What's this?

Ctr6, a Vacuolar Membrane Copper Transporter in Schizosaccharomyces pombe^*

Daniel R. Bellemare^§, Lance Shaner^¶, Kevin A. Morano^¶, Jude Beaudoin, Réjean Langlois^**, and Simon Labbé

From the Départements de  Biochimie and de  Médecine Nucléaire et Radiobiologie, Université de Sherbrooke, and ^** Sherbrooke PET Center, Université de Sherbrooke, Sherbrooke, Quebec J1H 5N4, Canada, and the ^¶ Department of Microbiology and Molecular Genetics, University of Texas Medical School, Houston, Texas 77030-1501

Received for publication, June 28, 2002, and in revised form, September 12, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Aerobic organisms possess efficient systems for the transport of copper. This involves transporters that mediate the passage of copper across biological membranes to reach essential intracellular copper-requiring enzymes. In this report, we identify a new copper transporter in Schizosaccharomyces pombe, encoded by the ctr6⁺ gene. The transcription of ctr6⁺ is induced under copper-limiting conditions. This regulation is mediated by the cis-acting promoter element CuSE (copper-signaling element) through the copper-sensing transcription factor Cuf1. An S. pombe strain bearing a disrupted ctr6 allele displays a strong reduction of copper,zinc superoxide dismutase activity. When the ctr6+ gene is overexpressed from the thiamine-inducible nmt1⁺ promoter, the cells are unable to grow on medium containing exogenous copper. Surprisingly, this copper-sensitive growth phenotype is not due to an increase of copper uptake at the cell surface. Instead, copper delivery across the plasma membrane is reduced. Consistently, this results in repressing ctr4⁺ gene expression. By using a functional ctr6⁺ epitope-tagged allele expressed under the control of its own promoter, we localize the Ctr6 protein on the membrane of vacuoles. Furthermore, we demonstrate that Ctr6 is an integral membrane protein that can trimerize. Moreover, we show that Ctr6 harbors a putative copper-binding Met-X-His-Cys-X-Met-X-Met motif in the amino terminus, which is essential for its function. Our findings suggest that under conditions in which copper is scarce, Ctr6 is required as a means to mobilize stored copper from the vacuole to the cytosol.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Acquisition of copper is crucial for aerobic life, because this element is an essential component of enzymes of primary metabolism (1, 2). Despite this vital role, too much copper in the cell can be detrimental, because in the presence of oxygen, copper can catalyze the production of cell-damaging hydroxyl radicals (3, 4). To balance the need for copper and its potentially harmful effects, living organisms have developed various specialized pathways of copper transport and distribution (5-8).

The use of bakers' yeast Saccharomyces cerevisiae as a model organism has provided fundamental information of copper homeostasis in eukaryotic cells (6, 8-10). For high affinity copper transport into S. cerevisiae cells, Cu²⁺ is reduced to Cu⁺ by the Fre1 and Fre2 cell surface reductases (11-15). Following reduction, copper ions are specifically transported across the plasma membrane by two distinct transporters, Ctr1¹ (16-18) and Ctr3 (19, 20). Ctr1 is characterized by the presence of eight copies of the consensus sequence Met-X₂-Met-X-Met in its amino-terminal extracellular domain (16, 17), whereas Ctr3 is rich in Cys residues with 11 cysteines found throughout the protein but lacks the Met-clustered motif. Although the eight Met-X₂-Met-X-Met motifs found in Ctr1 play an important role in copper uptake when cells are grown under copper starvation conditions, the last methionine (amino acid residue 127) of the Met-X₂-Met-X-Met motif 8 is essential for Ctr1 function (16). Likewise, a Met-X₃-Met motif (residues 256-260) within the second transmembrane domain of Ctr1 was also identified as essential for copper transport (16). Despite the fact that the S. cerevisiae Ctr3 protein exhibits a limited overall sequence homology to Ctr1, it has been demonstrated that Ctr3 bears a similar Met-X₃-Met motif (residues 185-189) within its second transmembrane domain (16). This enables Ctr3 to transport copper across the plasma membrane in conjunction with other critical residues such as Cys-16 within the amino-terminal portion, Cys-48 and Cys-51 within the first transmembrane domain, and Cys-199 found into the third transmembrane domain of the protein (16, 19). Once inside the cell, free copper ions are virtually undetectable (21). In fact, copper ions are transiently associated with small copper-binding proteins, denoted copper chaperones, that possess the ability to distribute copper to specific intracellular destinations (22). To date, three distinct copper chaperones Atx1 (23, 24), CCS (also termed Lys7) (25), and Cox17 (26-29) have been identified and found to deliver copper to the secretory compartment (into the Fet3 multicopper oxidase (30) via the intracellular copper transporter Ccc2 (31)), cytosolic copper,zinc-SOD1, and mitochondria (into the cytochrome c oxidase presumably with the aid of Sco1 (32-34) and Cox11 (35, 36) proteins), respectively. Consistent with their function in discrete pathways of intracellular copper distribution, mutations in any one of the copper chaperone genes gives rise only to specific defects in its respective pathway (22). In addition to the high affinity copper transporter and copper chaperones, a gene denoted CTR2 (37) has been characterized that encodes a putative copper transporter located predominantly in the vacuolar membrane (38). Although Ctr2 may mobilize intracellular copper stores, its precise mechanism of action has not been ascertained.

The early molecular mechanisms of copper acquisition in Schizosaccharomyces pombe differ from those of S. cerevisiae. Two proteins, Ctr4 and Ctr5, form a two-component copper transporting complex at the cell surface (39, 40). This association between Ctr4 and Ctr5 appears to be critical for protein maturation and secretion of the heteroprotein complex to the plasma membrane (39). Within this complex, the exact function of each protein is currently unclear. Ctr4 is a 289-amino acid protein with five repeats of the consensus sequence Met-X₂-Met-X-Met in its amino terminus, which is predicted by topological analysis to reside extracellularly (40). The carboxyl-terminal residues 111-248 of the S. pombe Ctr4 exhibit strong homology to the S. cerevisiae Ctr3 copper transporter, especially with respect to several residues within the three predicted transmembrane domains (6, 40). Ctr5 is a 173-amino acid protein that is structurally related to Ctr4. An elegant study has demonstrated that Ctr5 is an integral membrane protein, which is required for properly localizing Ctr4 to the plasma membrane in S. pombe cells (39). Once copper ions are transported by the Ctr4-Ctr5 complex into the cells, they are presumably taken by putative copper chaperones, which are yet uncharacterized at the molecular level (41). A hallmark of the ctr4⁺ and ctr5⁺ genes is the fact that they are transcriptionally regulated according to copper need (40, 42). The expression of ctr4⁺ and ctr5⁺ is activated under copper starvation conditions, whereas repression of these genes occurs under copper-replete conditions. This regulation is mediated by the cis-acting promoter element, denoted CuSE (Cu-signaling element) with the consensus sequence 5'-D(T/A)DDHGCTGD-3' (D = A, G, or T; H = A, C, or T) (42). The transcription factor responsible for regulating the copper-dependent expression of genes encoding components involved in copper transport through the CuSEs is Cuf1 (40, 42).

In this study, we identify a novel gene, termed ctr6⁺, which is regulated at the transcriptional level in a copper- and Cuf1-dependent manner. A deletion of the ctr6⁺ gene (ctr6) results in a significant reduction of copper,zinc-SOD1 activity. Cells overexpressing ctr6⁺ are unable to grow on medium containing exogenous copper. Surprisingly, this copper toxicity phenotype resulting from ctr6⁺ overexpression is not due to an increase of copper uptake. Instead, the cell surface copper transport activity is reduced, and consistently the steady-state levels of the ctr4⁺ mRNA are diminished. By using a ctr6⁺-HA₄ epitope-tagged allele, which retains wild type function, we have localized Ctr6-HA₄ to the vacuolar membrane when cells are grown under conditions of low copper availability. Interestingly, we show that the amino terminus of Ctr6 harbors a Met-X-His-Cys-X-Met-X-Met sequence, which is essential for its intracellular copper transport activity. Furthermore, we demonstrate that Ctr6 is an integral membrane protein, which can assemble into a homotrimer complex. Taken together these results suggest that under copper scarcity, Ctr6 may serve to mobilize intravacuolar stores of copper in fission yeast.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Yeast Strains and Growth Conditions-- S. pombe strains used in this study were the wild type FY435 (h+ his7-366 leu1-32 ura4-18 ade6-M210) (43), the ctr6 (h+ his7-366 leu1-32 ura4-18 ade6-M210 ctr6::ura4⁺), and ctr6 ctr4 double mutant (h+ his7-366 leu1-32 ura4-18 ade6-M210 ctr6::hisG ctr4::ura4⁺) disruption strains. S. pombe cells were grown in yeast extract plus supplements (YES) or under selection in Edinburgh minimal medium₃ (EMM₃) with necessary auxotrophic requirements (44). Liquid cultures of single colony purified yeast cells were grown to mid-logarithmic phase (A_600nm of ~1.0) at 30 °C, and copper starvation or copper repletion was carried out by adding the indicated amount of BCS or CuSO₄ to the medium. After treatments for 1 h, 20-ml samples were withdrawn from the cultures for subsequent steady-state mRNA or protein analyses. When the ctr6⁺ gene was not expressed from its own promoter, two regulatable promoter systems were used for ctr6⁺ function analysis. The first one was the thiamine-repressible promoter system using the plasmid pREP3X as described previously (45, 46). The second inducible promoter system, named pctr4⁺-X, was used as described previously (47) with the plasmid pctr4⁺-X_SmaI, except that the ctr6⁺ promoter region from position 546 to position +33 was subcloned to replace the ctr4⁺ promoter for expression of Ctr6.

Analysis of ctr6⁺ Gene Expression-- For Northern blot analysis, the ctr6⁺ gene was isolated by PCR using primers that corresponded to the start and stop codons of the ORF from an S. pombe cDNA library (ATCC number 87284, deposited by S. Elledge) (kind gift of Dr. Dennis J. Thiele, University of Michigan, Ann Arbor, MI). This PCR product was purified and ³²P-labeled as described previously (48). Hybridization was carried out according to the Schleicher & Schuell protocol. The S. pombe act1⁺ probe (40) was used as an internal control. For RNase protection analyses (49), three plasmids for making antisense RNA probes were utilized. The plasmids pKSlacZ and pSKact1⁺ used were described previously (40, 50). The plasmid pSKctr6⁺ was constructed by inserting a 173-bp BamHI-EcoRI fragment of the ctr6⁺ cDNA into the same sites of pBluescript II SK. The antisense RNA hybridizes to the first 173 ribonucleotides of the ctr6⁺ transcript. To assess the ability of the CuSEs (42) to regulate the ctr6⁺ gene expression, the plasmid pSP1ctr6⁺-546lacZ containing the ctr6⁺ promoter region up to 546 from the start codon of the ctr6⁺ gene in addition to the Escherichia coli lacZ gene was created. The plasmid was constructed via three-piece ligation by simultaneously introducing the EcoRI-StuI fragment of YEp357R (51) and the BamHI-EcoRI fragment from the ctr6⁺ promoter containing 546-bp of the 5'-noncoding region and the first 11 codons of the ctr6⁺ gene into the BamHI-SmaI cut pSP1 vector (52). Furthermore, the plasmid pSKctr6⁺-546 containing nucleotides from position 546 to position +33 with respect to the start codon of the ctr6⁺ ORF was created to introduce mutations in the CuSEs (positions 210 to 201; positions 196 to 187) by site-directed mutagenesis. Precisely, the oligonucleotide 5'-²²⁶TATACCATTAGTGTACGGGGTATGAGAGTGGGTCGATGAATATATCGTTACTTGC¹⁷²-3' (letters that are underlined represent multiple point mutations in the CuSEs) was used in conjunction with pSKctr6⁺-546 and the Chameleon mutagenesis kit (Stratagene, La Jolla, CA). The DNA sequence of the mutant promoter was verified by dideoxy sequencing and then used to replace the equivalent wild type ctr6⁺ promoter in pSP1ctr6⁺-546lacZ.

Disruption of the S. pombe ctr6⁺ Gene-- A functional ura4⁺ cassette was isolated from pUR18 (53) by PCR. The primers were designed to create SmaI and BglII sites to the beginning and the end of the ura4⁺ genetic marker, respectively. After digestion at these sites, the ura4⁺ fragment was inserted to replace the ctr6⁺ ORF, leaving 710 and 438 bp each side of the ctr6⁺ locus for homologous recombination, creating pctr6::ura4⁺. The gene disruption fragment (5'-ctr6-ura4⁺-ctr6-3') was generated by restriction endonuclease digestion using unique flanking sites (BamHI and Asp718) and then transformed into the S. pombe FY435 strain by electroporation (54). The allele status of the disrupted locus was verified using Southern blotting and diagnostic PCR as described previously (55). The ctr6 ctr4 double mutant disruption strain was created as follows. The ctr6⁺ gene inactivation was conducted as described above, except that the 710-bp BamHI-BglII fragment of the 5' region of ctr6⁺ and 438-bp BamHI-KpnI fragment of the 3'-flanking fragment of ctr6⁺ were inserted to the 5' and 3' ends of hisG-ura4⁺-hisG in plasmid pDM291 (57). Once the hisG-ura4⁺-hisG cassette recycled, the ctr4⁺ locus was disrupted as described previously (40).

SOD Enzymatic Activity and Sod1⁺ mRNA Analysis-- The S. pombe isogenic strains FY435 (wild type), DBY31 (ctr6), and DBY11 (ctr6 ctr4) were grown in yeast extract plus supplements (YES) medium. Copper treatment of yeast strains was conducted as described previously (40). Once treated, cultures were divided in half and harvested by centrifugation. One-half of cells from each culture were washed and disrupted with the lysis buffer (25 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA) in the presence of protease inhibitors. Aliquots of equal concentrations of protein extracts were analyzed for assay of SOD activity by standard in-gel assay with nitro blue tetrazolium staining (40). Spectrophotometric determination of SOD activity was also performed from these protein extracts by measuring the inhibition of the reduction rate of cytochrome c by SOD, which competes for reactive oxygen species produced from the xanthine-xanthine oxidase system (56). The other half of cells of each culture was stored at 80 °C until total RNA was extracted as described previously (50). For analysis of sod1⁺ gene expression by Northern blot, a 545-bp genomic DNA fragment from S. pombe FY435 was isolated by PCR using primers that corresponded to the start and stop codons of the sod1⁺ gene. The PCR product purification, ³²P-labeling, and hybridization were performed as described above.

⁶⁴Cu Uptake Measurements-- S. pombe cells were grown to mid-logarithmic phase prior to uptake experiments. At A_600nm of ~1.0, cells were harvested and washed twice with citrate buffer (50 mM sodium citrate, pH 6.5, 5% glucose) as described previously (17). Radioactive copper (250 µCi/µg of ⁶⁴Cu in the form of ⁶⁴CuCl₂ in 0.1 M HCl) was produced at the ⁶⁴Cu production facility at the Sherbrooke PET Center. ⁶⁴CuCl₂ was added to 2 ml of cells to a final concentration of 2 µM, and cultures were incubated for 10 min either at 30 or 0 °C. Uptake of ⁶⁴Cu was terminated by adding ice-cold EDTA (10 mM in PBS). Samples were collected by suction through nitrocellulose membrane filters (0.45 µm) loaded onto a 1225 Sampling Manifold (Millipore, Bedford, MA). After filtration, the cells were washed with 25 ml of ice-cold PBS, pH 7.4, air-dried, and then counted using a -counter (Canberra-Packard Cobra II). Counts obtained at 0 °C were subtracted from the values at 30 °C to give net uptake values. Furthermore, the values were normalized to culture density as described previously (39).

Ctr6 Epitope Tagging-- The plasmid pSKctr6⁺-StuI-BspEI carries a 15-bp StuI-BspEI linker inserted in-frame within the ctr6⁺ gene at position +208 relative to the first nucleotide of the initiator codon. The linker was introduced by the overlap extension method as described by Ho et al. (58). The insertion generated 5 extra amino acids after the arginine residue at position 70 (Arg⁷⁰-Pro-Asp-Tyr-Thr-Ser) within a predicted hydrophilic loop that is located immediately after the first transmembrane domain of Ctr6. We used the restriction sites StuI and BspEI created within ctr6⁺ to swap the linker region with four copies of the Haemophilus influenzae HA epitope (59). To generate the four copies of the HA epitope, a short DNA region of pCTR3-C-HA₃/315 (20) harboring three copies of the HA tag was isolated by PCR using primers that contained StuI and BspEI restriction sites. The fragment was digested and cloned into pSKctr6⁺-StuI-BspEI vector. This plasmid was digested with StuI, and a fourth copy of the HA epitope was subcloned into the StuI site. The ctr6⁺-HA₄ fusion allele was verified by sequencing, and the HA₄ epitope-tagged Ctr6 protein was judged to be fully functional because of its ability to mobilize intracellular copper stores. To create the ctr6-M1 allele, the primers CTR6MUT1-A (5'-CGGAATTCATGAATCACGGCGGTAATTCTACGGCGCGAGCCTGTTCAATGAAGATG-3') and CTR6TAA (5'-CGCGGATCCGTTAATGGCATAATCCTACAGTTTGAACAG-3') were made corresponding to the beginning and the end of the ctr6⁺ gene with mutations (underlined) in the sequence that generated the Met-9Ala, His-11Ala substitutions at the amino-terminal region of Ctr6. For the ctr6-M2 and ctr6-M3 alleles, a similar approach was used, except that the substitutions C12A, M14A, M16A, M9A, H11A, C12A, M14A, and M16A were created, respectively, as specified in Fig. 8.

Protein Extraction and Immunoblotting-- For Ctr6-HA₄ detection, ~5 A₆₀₀ units of ctr6 mutant strain harboring the indicated expression plasmid were spheroplasted as described by Pasion and Forsburg (60), except that the cell wall was digested with 0.8 mg of Zymolyase 20T (Seikagaku, Tokyo, Japan) and 80 units of Glusulase (PerkinElmer Life Sciences) per ml of Spheroplasting buffer (50 mM Tris-HCl, pH 7.4, 1 M sorbitol, 1 mM dithiothreitol, 1 mM 2-mercaptoethanol). Spheroplasts were resuspended in 0.6 ml of HEGN₁₀₀ buffer (20 mM HEPES, pH 7.9, 1 mM EDTA, 10% glycerol, 100 mM NaCl) supplemented with 1 mM phenylmethylsulfonyl fluoride, 8 µg/ml aprotinin, 4 µg/ml pepstatin, and 2 µg/ml leupeptin (Sigma). Spheroplasts were lysed by three rounds of freezing in a nitrogen liquid bath and rapid thawing at 30 °C. Lysates were centrifuged at 100,000 × g for 30 min at 4 °C. The pellet fraction was resuspended in 0.6 ml of buffer A (1 mM EDTA, 1% Triton X-100, 150 mM NaCl, 1 mM dithiothreitol, and the above-mentioned protease inhibitors in PBS, pH 7.4) and incubated on ice for 30 min. Solubilized Ctr6-HA₄ was enriched by immunoprecipitation using 2 µg of monoclonal antibodies against HA (F-7) (Santa Cruz Biotechnology, Santa Cruz, CA) bound to the protein A-Sepharose CL-4B (Amersham Biosciences). After incubation at 4 °C on a rotating wheel for 2 h, immunoprecipitated complexes were washed three times with buffer B containing 1 mM EDTA and 0.5% Triton X-100 in PBS (pH 7.4) and three times with PBS (pH 7.4). Once washed, the attached complexes were resuspended in 4× SDS loading buffer containing 4.0 M urea and then dissociated from the beads by heating them to 85 °C. Samples were analyzed by immunoblotting with anti-HA (F-7), horseradish peroxidase-conjugated secondary antibodies (Amersham Biosciences) and developed with enhanced chemiluminescent detection reagents. For protein expression analysis of Ctr4-FLAG₂, GST-Ptc4, and PCNA, the following antisera were used for immunodetection: monoclonal anti-FLAG antibody M2 (Sigma); polyclonal anti-GST antibody Z-5 (Santa Cruz Biotechnology, Santa Cruz, CA); and monoclonal anti-PCNA antibody PC10 (Sigma).

Fractionation and EGS Cross-linking-- Cells were spheroplasted and lysed as described above. Membrane fractions were isolated by centrifugation at 100,000 × g. The supernatant that contained soluble proteins were precipitated in 10% trichloroacetic acid and washed with acetone before separation on SDS-PAGE. Membrane fractions (pellets) were untreated or treated with 0.2 M Na₂CO₃ (pH 11) or 1% Triton X-100 for 30 min on ice and re-fractionated at 100,000 × g for 2 h as described previously (39). The Ctr4-FLAG₂ fusion protein (39) and PCNA (61) were used as control. For in vitro cross-linking experiments, Triton X-100-treated fractions were incubated with increasing concentrations of EGS (Pierce) as described previously (19). The cross-linked complexes were immunoprecipitated as described above and analyzed by SDS-PAGE under denaturing conditions and immunoblotting but employing, this time, a polyclonal goat anti-HA (Y-11) to counterblot the immunoprecipitated material.

Indirect Immunofluorescence Microscopy-- For localization of Ctr6-HA₄, ctr6 mutant cells were transformed with the plasmid pctr6⁺-HA₄, which expresses from its own promoter a functional HA₄ epitope-tagged Ctr6 protein. Transformed cells were grown to early log phase. After no treatment or incubation in the presence of either CuSO₄ (100 µM) or BCS (100 µM) for 9 h as described previously (47), the cells were fixed by adding formaldehyde (methanol-free) (Polysciences, Warrington, PA) to 3.7%. Fixed cells were harvested and washed with 0.1 M potassium phosphate, pH 6.5, containing 1.2 M sorbitol. Cells were spheroplasted as the above-described procedure and adsorbed to polylysine-coated multiwell slides. After a 30-min block with TBS (10 mM Tris-HCl, pH 7.4, 150 mM NaCl, 1% bovine serum albumin), cells were incubated with anti-HA antibody (F-7) and anti-GST antibody (Z-5) diluted 1:200 in TBS. After a 2-h reaction, cells were washed with TBS and incubated for 1 h with the appropriate secondary antibodies as follows: goat anti-mouse Alexa-Red conjugate or goat anti-rabbit Alexa-Green conjugate (Molecular Probes, Eugene, OR) both diluted 1:500 in TBS. After cells were washed, mounting solution containing 4,6-diamino-2-phenylindole (DAPI) was added to each well. The cells were observed with an Olympus BX60 epifluorescent microscope (Olympus America, Melville, NY). To localize GST-Ptc4, S. pombe cells were co-transformed with pctr6⁺-HA₄ and pDS473aGST-ptc4⁺. To generate this latter plasmid, the ptc4⁺ gene was isolated by PCR from S. pombe FY435 genomic DNA using primers that corresponded to the start and stop regions of the ptc4⁺ ORF (62). The PCR product obtained was digested with BamHI and SmaI and cloned into the corresponding sites of pDS473a vector (63).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Ctr6 Is a Putative Member of the Ctr Transporter Family-- Protein data base searches from the S. pombe Genome Project (64) revealed an ORF (SPBC23G7.16) encoding a putative copper transporter related to the Ctr transporter family (1). This was supported by the following observations. First, the amino terminus of this putative transporter harbors a Met-X-His-Cys-X-Met motif (residues 9-14) that contains only one difference, which is a cysteine (fourth position) instead of a methionine residue to be identical to the Met-X₂-Met-X-Met motifs identified in the Ctr transporter family as potential copper ion-binding motifs (1). Second, like the Ctr4 (40) and Ctr5 (39) proteins that form a two-component copper transporting complex at the cell surface of S. pombe, the SPBC23G7.16-encoded protein contains three transmembrane regions according to TOP-PRED II analysis (65). Third, the overall sequence homology with the S. pombe Ctr4 (32% identity in 140-amino acid overlap) and Ctr5 (27% identity in 138-amino acid overlap) proteins was noteworthy, especially within the putative transmembrane spanning domains. Thus, we termed the locus encoding this novel and uncharacterized polypeptide, ctr6⁺ (Fig. 1). Among the known Ctr family members from yeast and mammals, Ctr6 displays the highest sequence identity with the S. cerevisiae Ctr2 protein (37), exhibiting 37% identity in 126-amino acid overlap. Although the Ctr2 protein from bakers' yeast has been localized in the vacuolar membrane and may participate in the mobilization of intracellular pools of copper ions (38), its precise function in copper homeostasis has not yet been ascertained. Taken together, these observations suggest that ctr6⁺ encodes a new member of the Ctr transporter family, and for that reason the gene was isolated for further analysis.

View larger version (21K): [in this window] [in a new window]   Fig. 1.   The protein sequence of Ctr6 and its predicted hydrophobicity profile. A, shown is the Ctr6 amino acid sequence depicted by its single-letter code. The asterisks depict a putative copper-binding region, which harbors a Met-X-His-Cys-X-Met-X-Met motif. The boxes represent the three putative transmembrane spanning domains (TM1-3). The up arrows indicate the positions where introns were inserted in S. pombe ctr6+. The triangle shows the location of the HA tag (four copies) inserted in-frame into Ctr6. Accessibility of lysine residues (indicated with a line below) for in vitro cross-linking with EGS. B, the hydrophobicity plot of Ctr6.

Copper-specific Transcriptional Repression of the ctr6⁺ Gene-- Based on these structural features of Ctr6, we ascertained whether the ctr6⁺ gene was transcriptionally regulated by copper availability via the Cuf1 copper-sensing transcription factor. As shown in Fig. 2A, the S. pombe ctr6⁺ mRNA expression in a wild type strain was repressed (~6-fold) when cells were exposed to 100 µM CuSO₄ and derepressed (~3-fold) as compared with the basal levels when cells were grown in the presence of the copper chelator BCS. Furthermore, using isogenic strains harboring a wild type cuf1⁺ gene and an insertionally inactivated cuf1 allele, we found that the copper-dependent regulation of ctr6⁺ mRNA required the copper sensor Cuf1 (Fig. 2B). Indeed, in the absence of Cuf1, although a low level of ctr6⁺ mRNA was still observed, its expression was clearly unregulated by cellular copper status. Interestingly, within the ctr6⁺ promoter region up to 546 from the start codon of the ctr6⁺ ORF, two copies of a repeated sequence, 5'-D(T/A)DDHGCTGD-3' (D = A, G or T; H = A, C, or T), termed CuSE (42), were found at positions 210 to 201 and 196 to 187. It is important to note that Cuf1 factor directly interacts with CuSEs to mediate transcriptional copper regulation of the ctr4⁺ and ctr5⁺ genes, which encode high affinity copper transport proteins in fission yeast. To ascertain if the CuSEs play a role in ctr6⁺ regulation by copper, we fused 546-bp of the 5'-noncoding region and the first 11 codons of ctr6⁺ in-frame with the E. coli lacZ gene. ctr6⁺-lacZ expression from the reporter plasmid was down-regulated in the presence of copper (~7-fold) and up-regulated in the presence of BCS (~3-fold) (Fig. 3). When we inserted multiple point mutations that mimic changes known to abolish binding of Cuf1 to CuSEs in both elements within the ctr6⁺ promoter, a low and constitutive basal level of expression was observed (Fig. 3). In fact, there was a complete lack of either down- or up-regulation of the ctr6⁺-lacZ fusion. Taken together, these data show that ctr6⁺ is regulated at the transcriptional level through CuSEs in a copper- and Cuf1-dependent manner.

View larger version (22K): [in this window] [in a new window]   Fig. 2.   ctr6+ gene expression is regulated by cellular copper status through Cuf1. Total RNA from control (), CuSO4 (100 µM) (A) or BCS (B) (100 µM) cultures was isolated. Shown is an RNA blot of ctr6+, ctr4+, and act1+ mRNA steady-state levels. B, ctr6+ mRNA in wild type strain (cuf1+) are down-regulated in the presence of 1 and 100 µM CuSO4, respectively, and up-regulated under copper starvation conditions (100 µM BCS). In the isogenic cuf1 strain, the constitutive steady-state levels of ctr6+ mRNA are unaffected by either exogenous CuSO4 (1 and 100 µM) or BCS (100 µM). The ctr6+ and act1+ mRNA steady-state levels are indicated with arrows.

View larger version (24K): [in this window] [in a new window]   Fig. 3.   The CuSEs confer copper responsiveness to the ctr6+ promoter. A, RNase protection analysis of repression by copper (1 and 100 µM) versus low () or copper-starved conditions by BCS (100 µM). Wild type (WT) promoter fragment and mutant of the CuSE element found in the ctr6+ promoter were analyzed using a ctr6+-lacZ reporter gene. The lacZ and act1+ mRNA levels are shown with arrows. B, schematic representation of the ctr6+-lacZ reporter gene within which lie two copies of the wild type 5'-D(T/A)DDHGCTGD-3' sequence (gray boxes), termed CuSE (42), whereas the filled boxes represent the mutant CuSEs (5'-DGDDHATGAD-3'). The nucleotide number refers to the position relative to the A of the initiator codon of the ctr6+ ORF. C, quantitation of lacZ levels after treatments shown in A. The values are the means of three replicates ± S.D.

Effects of Deletion and Overexpression of ctr6⁺ on Cell Growth and Regulation of Cell Surface Copper Transporter-- To understand the role of Ctr6, we inactivated the ctr6⁺ locus by deletion and replacement with the S. pombe ura4⁺ gene. Whereas the ctr6 mutant cells exhibited no obvious defect to use respiratory carbon sources (e.g. glycerol) or to grow on medium containing an iron chelator (e.g. BPS, ferrozine) (data not shown), the copper,zinc-SOD1 activity in ctr6 cells was strongly diminished as compared with wild type cells (Fig. 4, A and B). As observed for Ctr6, deletion of the ctr4⁺ gene (ctr4) dramatically lowered copper,zinc-SOD1 activity, whereas the ctr6 ctr4 double disruptant was devoid of measurable activity (Fig. 4, A and B). In all cases, loss of endogenous SOD1 activity was repaired to ~40-85% that of the wild type starting strain by the addition of exogenous copper (Fig. 4, A and B). Importantly, under low basal copper conditions (Fig. 4, C and D, untreated ()), the sod1⁺ transcript levels remained virtually unchanged and clearly visible in all isogenic strains used, whereas under the same conditions, inactivation of the ctr6⁺ and ctr4⁺ genes resulted in an ~6- and ~19-fold reduction in SOD activity, respectively (Fig. 4B). These data clearly suggest a physiological and post-translational function for Ctr6 and Ctr4 in copper delivery to copper,zinc-SOD1. Although in S. pombe the sod1⁺ mRNA expression was found to increase ~2-fold with the addition of exogenous CuSO₄ to the growth medium, the effect of the disruptions (ctr6, ctr4, and ctr6 ctr4) should be mainly considered under low copper conditions, because copper transport proteins become critical for cell function only under these conditions. Furthermore, the fact that the reduction in SOD activity in ctr6, ctr4, and ctr6 ctr4 strains is largely reversed by addition of exogenous copper clearly implicates Ctr6 and Ctr4 in copper metabolism.

View larger version (27K): [in this window] [in a new window]   Fig. 4.   ctr6 cells exhibit low levels of SOD activity. A, an S. pombe strain bearing a disrupted ctr6 allele displayed a strong reduction of copper,zinc-SOD1 activity, as demonstrated by a representative in-gel activity assay. As observed for Ctr6, deletion of the ctr4+ gene (ctr4) dramatically lowered copper,zinc-SOD1 activity, whereas the ctr6 ctr4 double disruptant was devoid of measurable activity. In all cases, loss of endogenous SOD1 activity was repaired nearly to that found in the wild type parental strain by the addition of exogenous CuSO4 (100 µM). B, SOD activity determined from isogenic wild type, ctr6, ctr4, or ctr6 ctr4 double mutant strains by using a cytochrome c/xanthine oxidase method. The values of SOD activities are the means of three replicates ± S.D. C, shown is a representative RNA blot assay of sod1+ and act1+ (as control) mRNA steady-state levels. Total RNA was prepared from aliquots of the same cell cultures used for assay of SOD activity. D, values are the averages of triplicate determinations ± S.D.

Interestingly, when the ctr6+ gene was overexpressed from the thiamine-inducible nmt1⁺ promoter, the cells were hypersensitive to copper and unable to grow on medium containing 100 µM CuSO₄ (Fig. 5A). Furthermore, this phenotype appeared to be highly copper-specific because among 10 different metal ions, CuSO₄, AgNO₃, HgCl₂, CdCl₂, FeCl₃, NH4Fe(SO)₄, CoCl₂, Pb(C2H₃O₂), MnCl₂, and ZnCl₂, tested at many concentrations, only copper and silver, a metal that is electronically similar to the reduced form of Cu²⁺, gave rise to that growth defect (Fig. 5A and data not shown). To ascertain whether this copper toxicity phenotype resulting from ctr6⁺ overexpression was due to an increase of copper uptake, we measured ⁶⁴Cu transport. Surprisingly, as shown in Fig. 5B, activation of the ctr6⁺ gene resulted in an ~60-70% reduction in the high affinity ⁶⁴Cu transport. Consistently, in the ctr6 strain overexpressing the wild type ctr6⁺ gene, the steady-state levels of the ctr4⁺ mRNA were strongly diminished (~12-fold) as compared with the levels observed in the same strain (ctr6) harboring either the plasmid alone or a mutated ctr6 allele (Fig. 5C). This diminution of the ctr4⁺ steady-state mRNA levels was particularly striking under copper-limiting conditions (Fig. 5C, medium under copper-limiting conditions due to the presence of the copper chelator BCS, Fig. 5B). These data may suggest a copper re-distribution within the cell, perhaps because of a release of copper from intracellular organelle(s). To confirm that the copper toxicity phenotype was linked with the overexpression of ctr6+, a mutant version of the gene was created. Precisely, site-directed mutagenesis was used to convert the methionine (Met-9) and histidine (His-11) codons to that encoding alanine. Although the Ctr6-M1 mutant localized properly (Fig. 8), the copper toxicity phenotype was lost, indicating that the phenotype was specifically associated with the presence of the wild type Ctr6 protein when overproduced.

View larger version (29K): [in this window] [in a new window]   Fig. 5.   Effects of ctr6+ overexpression on cell growth and regulation of the ctr4+ transporter gene expression. A, ctr6 cells, transformed with plasmids pREP3X (plasmid alone), pctr6+, pctr6-M1, pctr6+-HA4, or pctr6-M1-HA4, were spotted in the absence () or presence of CuSO4 (100 µM) or AgNO3 (100 nM). B, cultures grown under copper deprivation conditions were incubated with 2 µM radioactive copper for 10 min. Absorption of 64CuCl2 was carried out at 30 °C, and the values were corrected with respect to culture density and temperature (i.e. uptake at 30 °C subtracted by uptake at 0 °C). Results are the mean of triplicate samples. WT, wild type strain FY435 (ctr6+) was used as control. p, plasmid alone. C, RNase protection assay from aliquots of cultures grown to mid-logarithmic phase for copper uptake measurements. Cells were incubated in the absence () or presence of CuSO4 (1 and 100 µM), or BCS (100 µM). After total RNA extraction, the ctr4+ steady-state mRNA levels were analyzed. Results illustrated are representative of three independent experiments.

Subcellular Location of Ctr6-- To begin to ascertain the mechanism by which Ctr6 functions in copper mobilization in S. pombe, we conducted experiments to determine the Ctr6 subcellular location. Ctr6 was tagged by inserting four tandem repeats of the HA epitope within a predicted hydrophilic loop region located between the first and second transmembrane domains of the protein. A ctr6 mutant strain transformed with a plasmid harboring the ctr6⁺-HA₄ gene gave rise to the above-mentioned phenotypes (Fig. 5) as observed for the wild type ctr6⁺ gene, indicating that the Ctr6-HA₄ protein is functional. This strain was grown without treatment or was incubated in the presence of either CuSO₄ (100 µM) or BCS (100 µM). Protein extracts were prepared, and the Ctr6-HA₄ fusion protein was enriched by immunoprecipitation using equal amounts of protein extract with anti-HA F-7 antibody. Immunoprecipitates were resolved by SDS-PAGE and analyzed by immunoblotting. As shown in Fig. 6A, a polypeptide species of ~22 kDa was detected, in keeping with the expected size of Ctr6-HA₄ fusion protein (21.4 kDa) as predicted by its primary DNA sequence. Consistent with the regulation of ctr6⁺ mRNA steady-state levels, the Ctr6-HA₄ protein levels were dramatically reduced in cells grown in the presence of 100 µM CuSO₄ (Fig. 6A).

View larger version (29K): [in this window] [in a new window]   Fig. 6.   Copper-dependent regulation of Ctr6, which is an integral membrane protein. A, ctr6 cells, transformed with plasmids pctr6+-HA4 or pctr6-M1-HA4, were grown to mid-log phase and incubated in the absence () or presence of CuSO4 (100 µM) or BCS (100 µM) for 9 h at 30 °C. Triton X-100-solubilized extracts were prepared from lysed spheroplasts and used for immunoprecipitation. The immunoprecipitates were loaded and separated on 9% SDS-PAGE and then analyzed by immunoblotting. The positions of the Ctr6-HA4 and PCNA proteins are indicated with arrows. B, ctr6 cells were transformed with pctr6+-HA4 and grown in a similar manner to that described in A but with only the addition of BCS (100 µM). Equivalent amounts of total lysate (Total) and supernatant (S) or pellet (P) fractions were loaded. Pellet fraction obtained from cell lysates was either untreated or incubated in the presence of 0.1 M Na2CO3 at pH 11, or adjust to 1% Triton X-100, and centrifuged at 100,000 × g for 30 min before analysis by immunoblotting. The positions of the Ctr6-HA4, Ctr4-FLAG2, and PCNA proteins are indicated with arrows.

The primary sequence of Ctr6 predicted that this protein was integrated into a cellular membrane. To investigate this, ctr6⁺-HA₄ and ctr4⁺-FLAG₂ (39) fusion genes were co-transformed and expressed in a ctr6 ctr4 double mutant disruption strain. Whole cell extracts, prepared from cells grown under conditions of low copper availability, were subjected to ultracentrifugation at 100,000 × g to collect membranes. The supernatant that contains soluble and detached peripheral membrane proteins was precipitated, washed with acetone, resuspended, and left untreated before analysis by Western blotting. The pellet fractions were resuspended and left untreated, or were adjusted to 0.2 M Na₂CO₃ or 1% Triton X-100, and then re-fractionated at 100,000 × g. As shown in Fig. 6B, in the absence of treatment, or in the presence of Na₂CO₃, which dissociates peripheral but not integral membrane proteins from the membrane, Ctr6-HA₄ and Ctr4-FLAG₂ proteins were not detected into the supernatant fractions but only in the pellet fractions. Conversely, the PCNA protein, which is soluble, was only found into the supernatant fraction. In the presence of Triton X-100, a nonionic detergent that solubilizes membranes, both Ctr6-HA₄ and Ctr4-FLAG₂ proteins were detected in the pellet and supernatant fractions, implying that Ctr6-HA₄ is an integral membrane protein as shown previously for Ctr4-FLAG₂ (39) and reproduced here as a control.

To determine the cellular location of Ctr6-HA₄, indirect immunofluorescence microscopy was carried out using anti-HA antibody. When S. pombe ctr6 cells expressing the Ctr6-HA₄ fusion protein were grown under copper starvation conditions, Ctr6-HA₄ fluorescence appeared to localize in vacuole membranes (Fig. 7A). These organelles around which Ctr6-HA₄ was detected appear as indentations by Nomarski optics (Fig. 7A, DIC). Conveniently, when ctr6⁺-HA₄ was induced by copper removal, the number and size of the vacuoles decreased and became bigger, respectively, as a consequence of nutrient limitation (data not shown) (62), facilitating the Ctr6-HA₄ localization. Importantly, the fluorescence was absent when ctr6 mutant cells expressing the Ctr6-HA₄ fusion protein were grown under copper-replete conditions (100 µM CuSO₄) (Fig. 7A). Furthermore, no fluorescence was observed in cells expressing the untagged ctr6⁺ allele (data not shown). To further confirm the Ctr6-HA₄ localization, cells were co-transformed with plasmids expressing both the Ctr6-HA₄ and GST-Ptc4 fusion proteins. The use of GST-Ptc4 fusion protein, which is known to localize in the vacuolar membrane (62), served as a positive control. As shown in Fig. 7B, double immunofluorescence labeling carried out with anti-HA and anti-GST antibodies revealed that Ctr6-HA₄ and GST-Ptc4 proteins were both visualized at the vacuolar membrane. Taken together, the copper-mediated repression of Ctr6-HA₄ protein levels, the integral membrane nature of Ctr6-HA₄, and the vacuolar membrane staining are suggestive of a mechanism whereby Ctr6 provides copper ions from the vacuole to cytosolic copper-requiring enzyme(s) when cells are grown under copper starvation conditions.

View larger version (34K): [in this window] [in a new window]   Fig. 7.   Ctr6 localizes to the vacuolar membrane. A, ctr6 deletion strain expressing Ctr6-HA4 was grown to early logarithmic phase in Edinburgh minimal medium and incubated in the absence () or presence of BCS (100 µM) or CuSO4 (100 µM). Cells were fixed, permeabilized, and labeled with anti-HA monoclonal antibody (Ab). DAPI staining visualized DNA and Nomarski microscopy was used to determine cell morphology. The indentations seen by Nomarski (DIC) represent the vacuoles. B, the vacuolar S. pombe Ptc4 (fused to GST without loss of function) (62) was expressed and viewed as a control.

Identification of Amino-terminal Residues Necessary for Ctr6 Function-- To gain insight into the mechanisms by which Ctr6 transport copper ions, we carried out a functional dissection of a potential metal-binding motif, Met-X-His-Cys-X-Met-X-Met (residues 9-16), within the amino-terminal region of Ctr6. Although a cysteine was found (fourth position) instead of a methionine to be identical to the Met-X₂-Met-X-Met motif identified in the Ctr transporter family as potential copper-binding motif, the chemical nature of cysteine with an external SH group may replace the methionine to coordinate copper. Recently, an elegant study (16) has demonstrated that a conserved methionine located 20 amino acid residues from the beginning of the first transmembrane domain in S. cerevisiae Ctr1 protein is essential for copper transport. Analogous to the situation described for Ctr1, the last methionine of the putative Met motif of Ctr6 was found 18 amino acid residues from the first transmembrane domain. Because of these observations, site-directed mutagenesis was used to convert codons encoding residues, which have the potential to bind copper, to codons encoding alanine (Fig. 8A). To assess the effects of these mutations on Ctr6 function, plasmids expressing the mutant proteins shown in Fig. 8A were transformed into an S. pombe ctr6 strain. As controls, subcellular localization was performed to ensure that the mutant proteins were produced and properly localized (Fig. 8B). For each mutant, we measured ⁶⁴Cu uptake. As shown in Fig. 8C, all three Ctr6 mutant proteins failed to diminish high affinity ⁶⁴Cu transport as compared with the reduction observed in the same strain (ctr6) expressing wild type Ctr6. Furthermore, despite the fact that these mutant alleles were overexpressed in the ctr6 strain, the steady-state levels of ctr4⁺ mRNA were still robustly induced under copper deprivation conditions as opposed to the ctr4⁺ mRNA levels detected in the ctr6 mutant strain overexpressing the wild type ctr6⁺ allele (Fig. 8D). These results suggest that the methionine (Met-9, Met-14, and Met-16), histidine (His-11), and cysteine (Cys-12) residues, which compose the copper-binding motif, Met-X-His-Cys-X-Met-X-Met (residues 9-16), within the amino-terminal region of Ctr6 are involved in the process of copper transport mediated by Ctr6. However, whether these residues equivalently contribute in copper transport must await a comprehensive dissection of the copper-binding motif.

View larger version (22K): [in this window] [in a new window]   Fig. 8.   The amino-terminal Met-X-His-Cys-X-Met-X-Met motif is necessary for the copper transport activity of Ctr6. A, schematic representation of the Ctr6 protein tagged with four copies of the HA epitope. The primary sequence of the Met-X-His-Cys-X-Met-X-Met motif is shown below, and the putative copper-binding ligands are underlined. TM1-3, putative transmembrane domains. The amino acid numbers refer to the position relative to the first amino acid of the protein. The sequence of the mutations (M1, M2, and M3) in the Met-X-His-Cys-X-Met-X-Met motif are shown corresponding to the residues in the wild type Ctr6. B, representative cells from M1, M2, and M3 mutants of Ctr6. Cells from cultures grown in the presence of BCS (100 µM) were fixed, probed for the HA epitope, and viewed by epifluorescence. DAPI staining was used to determine the location of the nucleus. Shown are matched images of anti-HA-GAM-Alexa Red fluorescence and DAPI merged images. C, ctr6 cells expressing the wild type ctr6+-HA4 gene display a distinct 64Cu uptake rate to that observed with cells expressing ctr6-M1-HA4, ctr6-M2-HA4, and ctr6-M3-HA4 alleles. Cells were incubated with 2 µM 64Cu in citrate buffer (pH 6.5) (17) for 10 min. Copper uptake was quantitated and normalized to culture density and temperature-dependent transport. Error bars represent the S.D. for three independent experiments. D, ctr6 strain, transformed with pctr6+-HA4, pctr6-M1-HA4, pctr6-M2-HA4, and pctr6-M3-HA4, was grown under low copper conditions. Cultures were untreated or treated with CuSO4 (100 µM) or BCS (100 µM) for 1 h. Total RNA was prepared from culture aliquots. ctr4+ and act1+ mRNAs (arrows) were detected using RNase protection assays. Results shown are representative of three independent experiments.

Ctr6 Assembles into an Oligomeric Complex-- On the basis of hydropathy profiling, the majority of membrane transport proteins are thought to contain 6 ± 3 and up to 12 ± 2 transmembrane domains (1, 19, 67). Because three, four, or six transmembrane domains are probably insufficient to form a translocation path, these transport proteins may form oligomeric complexes (67). To examine the possibility that Ctr6 adopts an oligomeric conformation, the Ctr6-HA₄ fusion protein was expressed in a ctr6 deletion strain under copper starvation conditions. Triton X-100-solubilized membrane protein fractions prepared from these cells were incubated with increasing concentrations of EGS. This cross-linker reacts predominantly with the -amine group of lysine residues, which are predicted to be accessible for such reaction in Ctr6.² Once cross-linked, the tagged Ctr6 molecules were immunoprecipitated with anti-HA F7 antibody, and immunoprecipitates were resolved by SDS-PAGE and then revealed by immunoblotting, but employing this time a polyclonal goat anti-HA (Y-11) to counterblot the immunoprecipitated material. In the absence of EGS, we noted that Ctr6-HA₄ migrates as an ~22-kDa monomeric protein (Fig. 9), which is consistent with its predicted molecular mass of 21.4 kDa. As the EGS concentration was increased, the monomeric form of Ctr6-HA₄ protein disappeared, with concomitant appearance of homodimeric (~44 kDa) and homotrimeric (~66 kDa) forms of Ctr6-HA₄. Although only a very low level of Ctr6-HA₄ homodimer was detectable, the Ctr6-HA₄ homotrimer was clearly visible (Fig. 9). Taken together, these results strongly suggest that the Ctr6-HA₄ protein forms a homotrimer as part of a copper transporter unit in the vacuolar membrane in fission yeast.

View larger version (11K): [in this window] [in a new window]   Fig. 9.   Ctr6 multimerizes. Representative EGS cross-linking experiment of Triton X-100-solubilized cell lysates prepared from ctr6 cells expressing Ctr6-HA4. After incubations with 0, 0.5, 1.0, 2.5, 3.0, and 5.0 mM EGS for 30 min at room temperature, the cross-linked complexes were immunoprecipitated, separated on 9% SDS-PAGE, and detected by immunoblotting. Monomeric (~22-kDa, 1 oval), dimeric (~44-kDa, 2 ovals), and trimeric (~66-kDa, 3 ovals) forms of Ctr6 were detected. M, reference marker.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Because of their property to promptly gain and lose electrons, copper ions are redox-active co-factors that serve as catalytic centers of numerous proteins involved in a variety of essential enzymatic processes (2, 68). Despite this crucial role, copper ions, when present in excess, can have detrimental effects due to their proclivity to engage in redox reactions or by competing with other metal ions for enzyme-active sites (4, 69). Thus, distinct pathways have evolved for the signaling, transport, trafficking, and sequestration of copper ions within cells to keep the delicate balance between essential and toxic levels (70).

In this study, we identified a novel S. pombe copper-responsive gene, termed ctr6⁺, which encodes a vacuolar membrane transporter. Like the ctr4+ and ctr5+ genes encoding the high affinity copper heteromeric transport complex at the cell surface in S. pombe (39), ctr6+ is activated at the transcriptional level in response to copper limitation by the Cuf1 nutritional copper-sensing transcription factor through the CuSE recognition sequence. Based on this observation that ctr6⁺ is transcriptionally regulated by copper in the same direction as the genes encoding components of the high affinity copper uptake machinery suggests a function for Ctr6 in copper utilization as opposed to copper detoxification. Given the fact that genetic studies have implicated the vacuole as playing a role for copper storage (38, 71, 72), and assuming that vacuolar copper is present in a usable form, we envision Ctr6 as an intracellular transporter to mobilize stores of copper from the organelle, thereby representing a specialized pathway by which copper could be distributed within cells (Fig. 10). The proposed model is supported by the fact that a deletion of the ctr6⁺ gene (ctr6) results in a significant reduction of copper,zinc-SOD1 activity, suggesting a role for S. pombe Ctr6 in delivering copper to cytosolic copper-dependent enzyme(s) under conditions of copper scarcity. Furthermore, when Ctr6 was overexpressed from the thiamine-inducible nmt1⁺ promoter, the cells exhibited a copper-sensitive growth phenotype, which was not attributable to an increase of copper uptake. Consistently, in response to the action of Ctr6, there was loss of Cuf1-dependent activation of the cell surface copper transporter ctr4⁺ gene expression, which represents an additional argument indicating the increased of copper cellular levels within the cell.

View larger version (75K): [in this window] [in a new window]   Fig. 10.   Effect of Ctr6 activity on copper transport. Ctr6 assembles as homotrimer in the vacuolar membrane to mobilize stored copper out of the organelle. Because of the activity of Ctr6 that put extra copper into the cytoplasm/nucleus, Cuf1 copper-sensing transcription factor is inactivated by the intracellular pool of labile copper, preventing futile expression of the ctr4+and ctr5+ cell surface transport genes.

Because some membrane proteins that function in the secretory pathway (e.g. endoplasmic reticulum/Golgi apparatus) or at the plasma membrane may be mis-localized to the vacuole when overexpressed (73), for subcellular localization of Ctr6, we used a functional epitope-tagged ctr6⁺ allele that was expressed under the control of its own promoter. This latter system ensured low levels of ctr6⁺ gene expression. Moreover, localization of Ctr6 to the vacuolar membrane was also observed using the disruption strain (ctr6) in which a ctr6⁺-HA₄ allele was re-integrated.² To examine further the localization of Ctr6, we compared the labeling pattern of Ctr6-HA₄ to the GST-Ptc4 fusion protein known to function in the vacuolar membrane (62). Indirect immunofluorescence microscopy demonstrated that Ctr6 localizes on the membrane of vacuoles in a manner identical to that observed for GST-Ptc4. Interestingly, similar subcellular localization has been reported recently (38) for the S. cerevisiae Ctr2 protein. Analogous to the situation for Ctr2, Ctr6 was visualized surrounding the vacuole with points of concentration of the protein around the organelle. This observation further supports a possible common role for these two proteins in the mobilization and transmission of intracellular pools of copper to metalloenzymes.

Complementary to immunofluorescence localization, subcellular fractionation experiments demonstrate that Ctr6 is an integral membrane protein that is undetectable in soluble fractions, unless cell extracts were supplemented with Triton X-100, a detergent that solubilizes membrane structures (19). As demonstrated for the S. cerevisiae Ctr3 (19) and human Ctr1 (74), EGS cross-linking experiments revealed that Ctr6 can assemble as a trimer. Importantly, the homo-multimeric state of Ctr6 may be required to form a functional translocation path, which contains, in general, 6 ± 3 and up to 12 ± 2 transmembrane domains within transport proteins (67). Nine transmembrane domains from three Ctr6 molecules could be sufficient to form a pore by which copper can be translocated from the vacuole into the cytoplasm. The oligomeric state may also play a role in other functions of Ctr6, including its stabilization into the membrane structure, or interaction with the cytosolic domain of delivering copper proteins.

Based on computer algorithm analysis, the amino-terminal 33 amino acids of Ctr6 are predicted to be inside the vacuole. Within this region of Ctr6 lies a putative copper coordination motif, Met-X-His-Cys-X-Met-X-Met (residues 9-16), that may function in copper capture within the vacuole. This is supported by the observation that mutations in which the methionine (Met-9) and histidine (His-11) or cysteine (Cys-12) and methionines (Met-14 and Met-16), or all five of these residues, were substituted to alanine altered copper transport activity of Ctr6. The methionine and histidine residues at positions 9 and 11, respectively, when mutated (mutant M1), gave rise to a stronger alteration with respect to Ctr6 activity compared with the mutant M2 in which the cysteine and methionine residues at position 12, 14, and 16 were mutated. However, whether one residue contributes more than another one in copper transport must await a fine mapping dissection of each amino acid that could play a role in the handling of copper. Similarly to the situation for the S. cerevisiae Ctr1 and Ctr3, and human Ctr1 (16), Ctr6 contains in its second transmembrane domain a conserved Met-X₃-Met motif (residues 111-115). Although we have not ascertained its function, this Met-X₃-Met motif may play a critical function in copper translocation across the vacuolar membrane.

In the presence of excess iron or copper ions, the vacuole has been proposed to play an important role to detoxify the cell, preventing their accumulation in the cytosol to toxic levels. Once inside the vacuole, perhaps, these metal ions could be bound under a bio-unavailable form as Fe³⁺/Cu²⁺ to polyphosphates or other molecules. Conversely, when grown under copper starvation conditions, Ctr6 would mobilize stored copper from the vacuole to replenish the cytosol according to copper need. The similarity in the potency of silver in fostering the copper-sensitive growth phenotype because of the expression of ctr6⁺ and the electronic similarity of Ag⁺ to Cu⁺, but not Cu²⁺, suggest that the intracellular copper transporter Ctr6 may pump Cu⁺ rather than Cu²⁺. This would suggest a role for a vacuolar membrane metalloreductase. So far, analysis of genomic DNA sequences from the S. pombe Genome project has revealed two open reading frames (SPBC1683.09C, denoted frp1+, and SPBC947.05C) related to Cu²⁺/Fe³⁺ ion reductases found in S. cerevisiae. Although the frp1+-encoded reductase can reduce Fe³⁺ to Fe²⁺ at the cell surface of fission yeast, its role in the metabolism of other metal ions (e.g. copper) is unknown. Regarding the second ORF, SPBC947.05C, its potential role in Fe³⁺/Cu²⁺ reductase activity is still uncharacterized. Finally, given the extended amino acid sequence homology between Ctr6 and all Ctr family members, especially within the regions that encompass the transmembrane domains, it will be interesting to determine what motif of the intracellular copper transporter Ctr6 is required for sorting the molecule to the vacuolar membrane, whereas the other members of the family, except for the S. cerevisiae Ctr2, are sorted to the plasma membrane.

	ACKNOWLEDGEMENTS

We gratefully acknowledge Drs. Stefan Zeisler and Johan E. van Lier for ongoing development and support of the ⁶⁴Cu production facility at the Sherbrooke PET Center. We are grateful to Dennis J. Thiele for the pSP1ctr4⁺-FLAG₂ plasmid. We greatly appreciate advice from Maria Marjorette O. Peña about the EGS cross-linking approach. We are thankful to an anonymous reviewer for very helpful comments on the manuscript. We also thank Serge Rodrigue and Julie Laliberté for excellent technical assistance. Infrastructure equipment essential for performing this investigation was obtained through the Canada Foundation for Innovation Grant NOF-3754 (to S. L.).

	FOOTNOTES

^* This work was supported in part by Canadian Institutes of Health Research Grant MOP-36450 (to S. L.) and by American Cancer Society Grant MBC-103134 (to K. A. M.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ Supported in part by the Fondation Dr. Georges Phénix and the Natural Sciences and Engineering Research Council of Canada.

New Investigator Scholar from the Canadian Institutes of Health Research. To whom correspondence should be addressed: Dépt. de Biochimie, Faculté de Médecine, Université de Sherbrooke, 3001 12e Ave. Nord, Sherbrooke, Quebec J1H 5N4, Canada. Tel.: 819-820-6868 (ext. 15460); Fax: 819-564-5340; E-mail: Simon.Labbe@USherbrooke.ca.

Published, JBC Papers in Press, September 18, 2002, DOI 10.1074/jbc.M206444200

² D. R. Bellemare, L. Shaner, K. A. Morano, and S. Labbé, unpublished data.

	ABBREVIATIONS

The abbreviations used are: Ctr, copper transporter; BCS, bathocuproinedisulfonic acid; Cuf1, copper factor 1; CuSE, copper-signaling element; DIC, differential interference contrast; EGS, ethylene glycolbis(succinimidylsuccinate); ORF, open reading frame; PBS, phosphate-buffered saline; SOD, superoxide dismutase; HA, hemagglutinin; PCNA, proliferating cell nuclear antigen; DAPI, 4,6-diamino-2-phenylindole.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES