HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 49, 46871-46876, December 6, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/49/46871    most recent M207083200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Young, S. H. Articles by Rozengurt, E. Search for Related Content PubMed PubMed Citation Articles by Young, S. H. Articles by Rozengurt, E. Social Bookmarking                      What's this?

Ca²⁺-stimulated Ca²⁺ Oscillations Produced by the Ca²⁺-sensing Receptor Require Negative Feedback by Protein Kinase C^*

Steven H. Young, S. Vincent Wu, and Enrique Rozengurt

From the Department of Medicine, Unit of Signal Transduction and Gastrointestinal Cancer, Division of Digestive Diseases, David Geffen School of Medicine, UCLA-CURE Digestive Diseases Research Center and Molecular Biology Institute, UCLA, Los Angeles, California 90095-1786

Received for publication, July 15, 2002, and in revised form, August 30, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

We examined the role of protein kinase C (PKC) in the mechanism and regulation of intracellular Ca²⁺ concentration ([Ca²⁺]_i) oscillations elicited by an increase in the extracellular concentration of Ca²⁺ ([Ca²⁺]_e) in human embryonic kidney 293 cells expressing the Ca²⁺-sensing receptor (CaR). Exposure to the PKC inhibitors bisindolylmaleimide I (GF I) or Ro-31-8220 converted oscillatory responses to transient, non-oscillatory responses, significantly reducing the percentage of cells that showed [Ca²⁺]_i oscillations but without decreasing the overall response to increase in [Ca²⁺]_e. Exposure to 100 nM phorbol 12,13-dibutyrate, a direct activator of PKC, eliminated [Ca²⁺]_i oscillations. Addition of phorbol 12,13-dibutyrate at lower concentrations (3 and 10 nM) did not eliminate the oscillations but greatly reduced their frequency in a dose-dependent manner. Co-expression of CaR with constitutively active mutants of PKC (either  or ₁ isoforms) also reduced [Ca²⁺]_i oscillation frequency. Expression of a mutant CaR in which the major PKC phosphorylation site is altered by substitution of alanine for threonine (T888A) eliminated oscillatory behavior, producing [Ca²⁺]_i responses almost identical to those produced by the wild type CaR exposed to PKC inhibitors. These results support a model in which phosphorylation of the CaR at the inhibitory threonine 888 by PKC provides the negative feedback needed to cause [Ca²⁺]_i oscillations mediated by this receptor.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The extracellular Ca²⁺-sensing receptor (CaR)¹ is a member of the superfamily of heptahelical G protein-coupled receptors (GPCRs) that was cloned originally from parathyroid chief cells (for review see Ref. 1). Inactivating and activating mutations of the CaR in humans (2) and genetic disruption of the CaR gene in mice (3) established that the CaR functions in the control of Ca²⁺ homeostasis. Specifically, a major physiological role of the CaR is to correct small changes in extracellular Ca²⁺ concentration ([Ca²⁺]_e) by regulating parathyroid hormone secretion (1). Subsequent studies demonstrating that the CaR is also expressed in many other tissues and cells including kidney (4), keratinocytes (5), gastrointestinal cells (6, 7), and nerve terminals suggest that the CaR could play additional, as yet less well defined, physiological roles in the regulation of secretion, gene expression, cell proliferation, and apoptosis (1).

Recent studies of CaR activation in individual living cells has shown that intracellular Ca²⁺ concentration ([Ca²⁺]_i) oscillates upon stimulation of CaR by an elevation in [Ca²⁺]_e (8, 9). It is recognized increasingly that the pattern and frequency of [Ca²⁺]_i oscillations play a key role in signal transduction, regulating Ca²⁺- and calmodulin-dependent protein kinase II (10), protein kinase C (11), mitochondrial metabolism (12), and nuclear transcriptional activity leading to differential gene expression (13-16). Consequently, the elucidation of the mechanisms underlying the generation of [Ca²⁺]_i oscillations has attracted intense interest.

Most models proposed to explain the mechanism by which [Ca²⁺]_i oscillations are generated in response to GPCR activation are based broadly on negative feedback effects of PKC on the production of Ins(1,4,5)P₃ or on the regulatory properties of [Ca²⁺]_i on the Ins(1,4,5)P₃ receptor (17-19). For example, classic (, ₁, ₂, and ) and/or novel (, , , and ) isoforms of PKC, which are stimulated by [Ca²⁺]_i and diacylglycerol or by diacylglycerol, respectively (20, 21), can attenuate phosphoinositide signaling either by phosphorylation and uncoupling of the receptor from Gq (22, 23) or by phosphorylation of the ₃ isoform of phospholipase C, which prevents its activation by Gq (24). In addition, PKC can also reduce [Ca²⁺]_i by accelerating the rate of Ca²⁺ extrusion from the cell (25). Our recent experiments, using the PKC inhibitor Ro-31-8220, suggested that negative feedback by PKC could also play a role in the generation of [Ca²⁺]_e-evoked [Ca²⁺]_i oscillations via the CaR (9). Specifically, in the presence of this inhibitor, most cells expressing CaR responded to an increase in [Ca²⁺]_e by a transient increase in [Ca²⁺]_i rather than by [Ca²⁺]_i oscillations (9). In contrast, Breitwieser et al. (8) concluded that the activity of a variety of protein kinases, including PKC, does not influence the pattern of [Ca²⁺]_i oscillations induced by activation of the CaR by [Ca²⁺]_e. Thus, the mechanism(s) underlying [Ca²⁺]_e-evoked [Ca²⁺]_i oscillations through the CaR is not understood, and the role of protein kinases, especially of PKC, in this process remains controversial.

The studies presented here were designed to elucidate whether PKCs play a role in the generation of [Ca²⁺]_i oscillations induced by activation of the CaR. Our results produced several lines of evidence indicating that PKCs negatively regulate the frequency of [Ca²⁺]_i oscillations induced by activation of the CaR by increases in [Ca²⁺]_e. In particular, we demonstrate, for the first time, that expression of a mutant CaR in which the major PKC phosphorylation site (Thr-888) is altered by substitution of alanine for threonine completely eliminates [Ca²⁺]_e-evoked [Ca²⁺]_i oscillations. We conclude that [Ca²⁺]_i oscillations induced by activation of the CaR in response to an increase in [Ca²⁺]_e result from negative feedback involving PKC-mediated phosphorylation of the CaR at Thr-888.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cell Culture-- HEK 293 cells were maintained in culture as described previously (26). For experimentation, cells were re-plated onto clean 15-mm diameter number 1 glass coverslips (Warner Instrument Corp., Hamden, CT) resting on the bottom of 35-mm plastic culture dishes 1 day before transfection. Approximately 8.5 × 10⁴ cells were plated per 35-mm dish. Culture medium was high glucose Dulbecco's modified Eagle's medium (D5796; Sigma) supplemented with 10% fetal bovine serum, penicillin (10 units/ml), streptomycin (10 µg/ml), and amphotericin B (25 ng/ml). Cells were maintained in a humidified incubator under 10% CO₂ and 90% air at 37 °C.

Transient Transfection-- A total of 1.7 µg of plasmid DNA (human CaR cDNA cloned in the pCR3.1 expression vector was kindly provided by Dr. Allen Spiegel, NIDDK, National Institutes of Health, Bethesda, MD) was used to transfect cells in each 35-mm culture dish. DNA was diluted and mixed with Lipofectin (Invitrogen) according to manufacturer's guidelines. The resulting solution (volume, 1 ml) was added to the cells, and after 4-6 h, cells were supplemented with 10% fetal bovine serum. Cells were studied 2 or 3 days after transfection. To identify transfected cells expressing the CaR, co-transfections were performed with vector encoding CaR and expression vector pDsRed1-N1 (Invitrogen), which produces a red fluorescent protein. In all co-transfections, total DNA was maintained at 1.7 µg.

Construction of CaR Mutant-- CaR_T888A mutant was constructed by QuikChange^TM mutagenesis (Stratagene) using cloned human CaR cDNA plasmid as a template and a pair of complementary primers (sense, 5'CAAGGTGGCTGCCCGTGCCGCGCTGCGCCGCAGCA; antisense, 5'TGCTGCGGCGCAGCGCGGCACGGGCAGCCACCTTG) in which endogenous restriction site SrfI was eliminated, and a single point mutation, ACG  GCG, was introduced. Mutation was confirmed by SrfI digestion and DNA sequencing.

Solutions-- Physiological saline consisted of Hanks' balanced salt solution (HBSS; Invitrogen) without phenol red supplemented with calcium and 20 mM HEPES buffer. Final concentrations (in mM) were as follows: 138 NaCl, 4 NaHCO₃, 0.3 Na₂HPO₄, 5 KCl, 0.3 KH₂PO₄, 1.5 CaCl₂, 0.5 MgCl₂, 0.4 MgSO₄, 5.6 D-glucose, 20 HEPES, pH 7.4.

Measurement of [Ca²⁺]_i-- Cells on coverslips were loaded with the fluorescent calcium indicator Fura-2 by incubation in saline containing 5 µM Fura-2/AM (Molecular Probes, Eugene, OR) for 45-60 min at 37 °C. Coverslips were then mounted in an experimental chamber (RC-25F; Warner Instrument Corp.) that was perfused at 1.5 ml/min. The perfusion solution was heated using an inline heater (TC-344B; Warner Instrument Corp.), which maintained bath temperature at 37 °C. The chamber in turn was placed on the stage of an inverted microscope (Zeiss TV 100; Carl Zeiss, Inc., Thornwood, NY) to which was attached a digital imaging system (Attofluor; Atto Instruments, Rockville, MD) with electronically controlled excitation filter positions and associated software (RatioVision). Ratios of images (340 nm excitation/380 nm excitation, emission filter 520 nm) were obtained at 1.5-s intervals. A region of interest covering 15 × 15 µm was defined over each cell, and the average ratio intensity over the region was converted to [Ca²⁺]_i using a calibration curve constructed with a series of calibrated buffered calcium solutions (calcium calibration buffer kit #2; Molecular Probes). For each cell, [Ca²⁺]_i values and their times of acquisition were stored on computer disk. All experiments were performed at 37 °C.

Materials-- GF I (bisindolylmaleimide I), GF V (bisindolylmaleimide V), and PDBu (phorbol-12,13-dibutyrate) were purchased from Calbiochem. Plasmids encoding constitutively active mutant PKC isoforms _mut and _1mut were kindly provided by Dr. Peter Parker, Imperial Cancer Research Institute, London, United Kingdom.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The PKC Inhibitors Ro-31-8220 and GF I Reduce [Ca²⁺]_i Oscillations without Reducing Overall [Ca²⁺]_i Response-- To examine the effect of [Ca²⁺]_e on CaR-mediated changes in [Ca²⁺]_i in single cells, HEK 293 cells transiently transfected with the human CaR cDNA were loaded with the fluorescent Ca²⁺ indicator Fura-2 and incubated in the presence of 1.5 mM [Ca²⁺]_e. Intracellular Ca²⁺ imaging revealed that most transfected cells exhibited a stable [Ca²⁺]_i. In agreement with our recent results (9), a small increase in [Ca²⁺]_e from 1.5 to 3.0 mM elicited sustained [Ca²⁺]_i oscillations (Fig. 1a). The fraction of responsive cells was 72%, and that fraction displaying [Ca²⁺]_i oscillations was 57% (n = 28; see Fig. 1d). Untransfected HEK 293 cells or cells transfected with vector did not exhibit [Ca²⁺]_i oscillations in response to an identical increase in [Ca²⁺]_e (results not shown).

View larger version (22K): [in this window] [in a new window]   Fig. 1.   [Ca2+]e-induced [Ca2+]i oscillations are inhibited by treatment with either Ro-31-8220 or GF I, without inhibition of overall [Ca2+]i responsiveness. a, control cell. HEK 293 cells were transfected with a plasmid encoding the CaR, as described under "Experimental Procedures." An increase in [Ca2+]e from a resting concentration of 1.5 to 3.0 mM triggered oscillations in [Ca2+]i. The increase of [Ca2+]e to 3.0 mM from a resting concentration of 1.5 mM is marked by a horizontal line below the [Ca2+]i trace. b, pretreatment with Ro-31-8220 (1.25 µM, 1 h) inhibits the oscillatory behavior induced by an increase in [Ca2+]e, but after an initial transient produces a sustained increase in [Ca2+]i. Individual traces from four separate cells are superimposed. c, pretreatment with GF I (3.5 µM, 1 h) inhibits the oscillatory behavior but produces a sustained increase in [Ca2+]i. Individual traces from four separate cells are superimposed. d, summary of GF I results. Treatment with GF I (3.5 µM, 1 h) reduced the percentage of cells that show oscillatory behavior (open bars) but did not reduce overall responsiveness (percentage of cells showing oscillatory or sustained response) to [Ca2+]e (closed bars). Treatment with the inactive analog GF V or with GF I under conditions expected to produce inefficient loading (1 µM, 4 min., 22 °C) does not influence the response to [Ca2+]e.

To determine whether PKC activity is required for the generation of [Ca²⁺]_i oscillations, HEK 293 cells transfected with CaR were pretreated for 1 h with the selective PKC inhibitors Ro-31-8220 (27) or GF I (28, 29). An increase in [Ca²⁺]_e in cells exposed to Ro-31-8220 at 1.25 µM induced a marked increase in [Ca²⁺]_i, but the change in [Ca²⁺]_i no longer had a strong oscillatory component; the majority of the responses consisted of an initial [Ca²⁺]_i transient followed by a sustained plateau. Individual traces from four separate cells are presented in Fig. 1b. Pretreatment with GF I (3.5 µM) also inhibited the oscillatory behavior induced by an increase in [Ca²⁺]_e and also resulted in a sustained increase in [Ca²⁺]_i after the increase in [Ca²⁺]_e. Individual traces from four separate cells are illustrated in Fig. 1c. As summarized in Fig. 1d, the fraction of GF I-treated cells that exhibited [Ca²⁺]_i oscillations dropped to only 16% (p < 0.05 compared with control; n = 14) whereas the percentage of responsive cells treated with GF I was 78%. Thus, the PKC inhibitor blunted the oscillatory behavior without reducing overall responsiveness. In contrast, exposure of HEK 293 cells transfected with CaR to 3.5 µM GF V (an inactive analog of GF I) for 1 h did not have any significant inhibitory effect on the fraction of cells that displayed [Ca²⁺]_e-evoked [Ca²⁺]_i oscillations (p > 0.05; n = 35).

A previous study (8) has reported that treatment with GF I did not produce any effect on the pattern of [Ca²⁺]_i oscillations mediated by the CaR in HEK 293 cells. In the study of Breitwieser et al. (8), the cells were treated with 1 µM GF I for 4 min at 22 °C. When we used GF I at identical experimental conditions (i.e. 1 µM at 22 °C for 4 min), we also observed that such an exposure to this agent did not inhibit [Ca²⁺]_i oscillations in response to an increase in [Ca²⁺]_e in HEK 293 cells expressing the CaR. In this case we found that the fraction of cells showing [Ca²⁺]_i oscillations was 53%, and the percentage of responsive cells was 69%, similar to control values (Fig. 1d). It is likely that under these conditions exposure to GF I did not change [Ca²⁺]_i oscillations, because it did not accumulate in the cell at a sufficient concentration.

The Frequency of [Ca²⁺]_i Oscillations Induced by [Ca²⁺]_e Stimulation of the CaR Is Modulated by PDBu, an Activator of PKC-- Previous studies using cell populations showed that phorbol ester-induced activation of PKC abrogates [Ca²⁺]_e-evoked stimulation of phospholipase C and the associated increases in [Ca²⁺]_i, suggesting that PKC may modulate the coupling of the CaR to intracellular signaling systems directly (30). Accordingly, we found that addition of 100 nM PBD to HEK 293 cells expressing CaR stops [Ca²⁺]_e-induced [Ca²⁺]_i oscillations within a few cycles (Fig. 2a).

View larger version (17K): [in this window] [in a new window]   Fig. 2.   Treatment with PDBu, a PKC activator, reduces [Ca2+]i oscillation frequency induced by an increase in [Ca2+]e in HEK 293 cells transfected with the CaR. a, addition of 100 nM PDBu (marked by the line above the [Ca2+]i trace) after the start of [Ca2+]e-induced [Ca2+]i oscillations results in the cessation of oscillatory behavior. b, pretreatment with 3 nM PDBu for 5 min before the increase in [Ca2+]e results in oscillations of diminished frequency. c, pretreatment with 10 nM PDBu for 5 min caused a further decrease in the frequency of the [Ca2+]i oscillations. d, summary of the effect of increasing concentrations of PDBu on [Ca2+]i oscillation frequency. The average [Ca2+]i oscillation frequency decreased as a function of PDBu concentration (5-min exposure). Error bars represent S.E.

If negative feedback by PKC is required for the production of [Ca²⁺]_e-induced [Ca²⁺]_i oscillations, we would expect that exposure to lower concentrations of PDBu (e.g. 3 and 10 nM) should modulate oscillation frequency. As shown in Fig. 2b, pretreatment of the cells with 3 nM PDBu for 5 min reduced average oscillation frequency. Increasing the concentration of PDBu to 10 nM further reduced [Ca²⁺]_i oscillation frequency in response to an elevation of [Ca²⁺]_e (Fig. 2c). The results are summarized in Fig. 2d. The average [Ca²⁺]_i oscillation frequency dropped by about 50% after 5 min of exposure to 3 nM PDBu (control, 2.7 ± 0.14/min (±S.E.), n = 28; 3 nM PDBu, 1.39 ± 0.16/min (±S.E.), n = 21; p < 0.0001). An increase in PDBu concentration to 10 nM caused a further reduction in oscillation frequency (0.74 ± 1.6/min (±S.E.), n = 12; p < 0.02 compared with 3 nM PDBu). These results suggest that PDBu-induced PKC activation reinforces a negative feedback component that markedly reduces the frequency of [Ca²⁺]_e-induced [Ca²⁺]_i oscillations mediated by the CaR in single cells.

The Frequency of [Ca²⁺]_i Oscillations Induced by [Ca²⁺]_e Stimulation of the CaR Is Modulated by Expression of Constitutively Active Mutant Isoforms of PKC-- Having established that pharmacological inhibition or activation of PKCs strikingly influences the frequency of [Ca²⁺]_e-induced [Ca²⁺]_i oscillations in HEK 293 cells expressing the CaR, our next step was to examine whether overexpression of PKC isoforms also down-regulates the frequency of [Ca²⁺]_e-induced [Ca²⁺]_i oscillations mediated by the CaR. The PKCs comprise a family of at least 10 distinct isoforms, which can be classified into three distinct subgroups on the basis of structural and regulatory differences (31-33). Classic PKCs (, , and ) respond to intracellular rises in diacylglycerol and [Ca²⁺]_i whereas novel PKCs (, , , and ) respond to diacylglycerol but not to changes in [Ca²⁺]_i. Receptor stimuli that induce [Ca²⁺]_i oscillations promote a parallel repetitive translocation of classic PKCs to the plasma membrane in a variety of model systems (11, 23, 34). In contrast, novel PKCs translocate to the plasma membrane with kinetics that are not synchronized with [Ca²⁺]_i oscillations (35). These considerations prompted us to examine the effect of co-transfection of the CaR with either a classic or a novel isoform of the PKC family.

Cultures of HEK 293 cells were co-transfected with plasmids encoding the CaR and either vector, constitutively active isoforms of PKC (₁ and ), or protein kinase D, a kinase that is activated downstream of PKC (36-39). Fig. 3a shows a typical tracing of [Ca²⁺]_i oscillations in a control HEK 293 cell transfected with the CaR after [Ca²⁺]_e was raised from 1.5 to 3.0 mM. As shown in Fig. 3b, when HEK 293 cells were co-transfected with plasmids encoding for the CaR and constitutively active PKC isoform ₁ (PKC_1mut), the oscillation frequency was reduced markedly. The results are summarized in Fig. 3c. Average oscillation frequencies of cells transfected with an empty vector or cells transfected with a plasmid encoding protein kinase D were not significantly different (p > 0.5, n = 17 cells; p > 0.3, n = 30 cells) from control cells transfected with only the plasmid encoding CaR. In contrast, cells transfected with the active mutants of PKC isoforms  (PKC_mut) or ₁ (PKC_1mut) show reduced average oscillation frequencies compared with control cells (, p = 0.03, n = 26 cells; ₁, p = 0.001, n = 32 cells). These results suggest that an increase in the cellular concentration of PKC reinforces a negative feedback loop that regulates the frequency of [Ca²⁺]_e-induced [Ca²⁺]_i oscillations in HEK 293 cells expressing the CaR.

View larger version (19K): [in this window] [in a new window]   Fig. 3.   Co-transfection of HEK cells with plasmids coding for constitutively active (mutant) PKC isoforms  or 1 reduces oscillation frequency. a, control cell. HEK 293 cells were transfected with a plasmid encoding the CaR, as described under "Experimental Procedures." The increase of [Ca2+]e to 3.0 mM from a resting concentration of 1.5 mM is marked by a horizontal line below the [Ca2+]i trace. The increase in [Ca2+]e triggered striking oscillations in [Ca2+]i. b, cell transfected with active 1 form (PKC1mut) showed reduced [Ca2+]i oscillation frequency after [Ca2+]e was raised from 1.5 to 3.0 mM. c, summary of oscillation frequencies. Cells that were co-transfected with plasmids encoding for either active PKC  (PKCmut) or active PKC 1 form (PKC1mut) exhibited a decrease in average [Ca2+]i oscillation frequency. Co-transfection of cells with plasmid coding for protein kinase D (PKD) produced [Ca2+]i oscillations whose frequency did not differ from cells that were transfected with empty vector or from untransfected cells (control). p values are compared with control, and error bars represent S.E.

Mutation of Threonine 888, the Predominant PKC Phosphorylation Site of the CaR, Prevents [Ca²⁺]_i Oscillations-- In a previous study using cell populations, Bai et al. (30) have shown that PKC-mediated phosphorylation of threonine 888 of the CaR inhibits [Ca²⁺]_e-induced increase in [Ca²⁺]_i, indicating that this amino acid is the major site for the inhibitory influence of PKC on the CaR. However, the effect of this mutation on the oscillatory signaling properties of the CaR in individual living cells has not been investigated.

If CaR-mediated [Ca²⁺]_i oscillations are generated physiologically by the periodic phosphorylation of this inhibitory site by PKC, mutation of Thr-888 to a non-phosphorylatable amino acid should significantly reduce or even eliminate [Ca²⁺]_i oscillations mediated by this receptor. To test this hypothesis, we expressed a CaR in which the threonine at position 888 of the CaR was mutated to alanine (T888A). As shown in Fig. 4b, HEK 293 cells expressing CaR_T888A did not show [Ca²⁺]_i oscillations after CaR activation by increases in [Ca²⁺]_e. The [Ca²⁺]_i response consisted of a rapid rise in [Ca²⁺]_i followed by a sustained phase of elevated [Ca²⁺]_i. In all, of 129 responding cells analyzed from five independent preparations that responded to an increase in [Ca²⁺]_e to 3.0 mM, all 129 cells showed this behavior, i.e. none exhibited [Ca²⁺]_i oscillations (Fig. 4c).

View larger version (18K): [in this window] [in a new window]   Fig. 4.   [Ca2+]e-induced [Ca2+]i oscillations are blocked when HEK 293 cells express a mutant CaR in which the threonine at position 888, the major PKC phosphorylation site, is replaced by alanine (T888A). a, in cells expressing wild-type (wt) CaR, an increase in [Ca2+]e from 1.5 to 3.0 mM triggered [Ca2+]i oscillations. The increase in [Ca2+]e to 3.0 mM is marked by a horizontal line below the [Ca2+]i trace. b, cells expressing the CaRT888A mutant respond to an increase in [Ca2+]e from 1.5 to 3.0 mM with a sustained increase in [Ca2+]i but without [Ca2+]i oscillations in any of the cells analyzed. Individual traces from three separate cells are superimposed. c, summary of experiments with CaRT888A (total number of cells = 136). In cells expressing the CaRT888A mutant, no oscillatory responses were observed (open bars). The percentage of responding cells transfected with either wild type CaR or CaRT888A is indicated by the closed bars. d, pretreatment of CaRT888A-expressing cells with 100 nM PDBu (5 min) does not prevent the response to 3.0 mM [Ca2+]i. Individual traces from three separate cells are superimposed.

In addition, prior exposure to PDBu (100 nM for 5 min) does not prevent the response to 3.0 mM [Ca²⁺]_e in CaR_T888A-expressing cells (Fig. 4d). We verified that the non-oscillatory [Ca²⁺]_i response induced by an increase in [Ca²⁺]_e to 3.0 mM in cells expressing this CaR_T888A mutant in HEK 293 cells did not prevent [Ca²⁺]_i oscillations induced by 10 µM carbachol (data not shown), which acts via an endogenous muscarinic GPCR expressed by these cells (40).

We have reported recently that stimulation of HEK 293 cells expressing the CaR with amino acids (L-phenylalanine or L-tryptophan) induced [Ca²⁺]_i oscillations of a different pattern from [Ca²⁺]_i oscillations induced by increases in [Ca²⁺]_e (9). The patterns differed in the following ways: 1) The amino acid-induced [Ca²⁺]_i transients repetitively returned to baseline levels. 2) The amino acid-induced oscillation frequencies (~1/min) were lower than those induced by [Ca²⁺]_e (~4/min). 3) Amino acid-induced and [Ca²⁺]_e-induced oscillations differed in their sensitivity to pharmacological agents that influence [Ca²⁺]_i (9). The results illustrated in Fig. 5a confirm that stimulation of HEK 293 cells expressing the wild type CaR with 5 mM L-phenylalanine induced [Ca²⁺]_i oscillations of a different pattern from [Ca²⁺]_i oscillations induced by an increase in [Ca²⁺]_e (from 1.5 to 3 mM). These results raised the interesting possibility that amino acids and [Ca²⁺]_e produce [Ca²⁺]_i oscillations via the CaR through a different mechanism(s). In view of these considerations and the results illustrated in Fig. 4 with CaR_T888A, we examined [Ca²⁺]_i oscillations triggered by addition of 5 mM L-phenylalanine to cultures of HEK 293 cells expressing either CaR or CaR_T888A. As shown in Fig. 5b, [Ca²⁺]_i oscillations induced by addition of 5 mM L-phenylalanine persisted in the same cells expressing CaR_T888A in which [Ca²⁺]_e-induced [Ca²⁺]_i oscillations were eliminated, although the average oscillation frequency of the L-phenylalanine-induced [Ca²⁺]_i oscillations was reduced (1.0 ± 0.06 min¹; n = 23 cells) compared with wild-type CaR (1.3 ± 0.1 min¹; n = 14 cells). These results provide further support for the notion that amino acids and [Ca²⁺]_e produce [Ca²⁺]_i oscillations through the CaR via different mechanisms.

View larger version (27K): [in this window] [in a new window]   Fig. 5.   Effect of L-phenylalanine on [Ca2+]i oscillations in HEK 293 cells expressing either wild type CaR or a mutant CaR in which the threonine at position 888, the major PKC phosphorylation site, is replaced by alanine (T888A). a, in HEK 293 cells expressing wild-type (wt) CaR, addition of 5 mM L-phenylalanine to the medium triggered transient [Ca2+]i oscillations. After a brief washout of the L-phenylalanine, an increase in [Ca2+]e from 1.5 to 3.0 mM also triggered [Ca2+]i oscillations. The increase in L-phenylalanine or [Ca2+]e is marked by a horizontal line below the [Ca2+]i trace. b, HEK 293 cells expressing the CaRT888A mutant continue to respond to 5 mM L-phenylalanine with [Ca2+]i oscillations but at a lower frequency than that induced in cells expressing the wild-type CaR. After a brief washout of the L-phenylalanine, cells responded to an increase in [Ca2+]e with a sustained increase in [Ca2+]i but without [Ca2+]i oscillations (as shown in Fig. 4).

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Most models proposed to explain the mechanism by which [Ca²⁺]_i oscillations are generated in response to GPCR activation are based broadly on negative feedback effects of PKC on the production of Ins(1,4,5)P₃ or on the regulatory properties of [Ca²⁺]_i on the Ins(1,4,5)P₃ receptor (17-19). However, definitive evidence identifying the mechanism(s) involved is available in very few instances. For example, even the role of PKC in the generation of glutamate-induced [Ca²⁺]_i oscillations mediated by the metabotropic glutamate receptor 5, one of the most studied systems, appears controversial (22, 23, 34). In the present study, we examined the hypothesis that PKC activation provides a negative feedback link that is critical for generating the [Ca²⁺]_i oscillatory behavior produced by [Ca²⁺]_e activation of the CaR.

Our results produced several lines of evidence indicating that PKCs negatively regulate the frequency of [Ca²⁺]_i oscillations induced by activation of the CaR by increases in [Ca²⁺]_e. 1) Exposure to the PKC inhibitors GF I or Ro-31-8220 converted oscillatory responses to transient, non-oscillatory responses, significantly reducing the percentage of cells that showed [Ca²⁺]_i oscillations but without decreasing the overall response to [Ca²⁺]_e. 2) Exposure to PDBu, a direct activator of PKC, greatly reduced the frequency of [Ca²⁺]_i oscillations in a dose-dependent manner. 3) Co-expression of CaR with constitutively active mutants of PKC (either  or ₁ isoforms) reduced [Ca²⁺]_i oscillation frequency. These results indicate that [Ca²⁺]_i oscillations generated in response to [Ca²⁺]_e-elicited CaR activation are based on negative feedback effects of PKC.

PKC can exert negative feedback on phosphoinositide signaling either by phosphorylation and uncoupling of the receptor from Gq (22, 23) or by phosphorylation of the ₃ isoform of phospholipase C, which prevents its activation by Gq (24). In addition, PKC can also reduce [Ca²⁺]_i by accelerating the rate of Ca²⁺ extrusion from the cell (25). A salient feature of the results presented here is that a single amino acid substitution in the CaR was sufficient to drastically reduce the ability of this GPCR to generate [Ca²⁺]_i oscillations. Specifically, mutation of the major PKC phosphorylation site, threonine 888, to alanine eliminated [Ca²⁺]_i oscillations induced by activation of the CaR by increases in [Ca²⁺]_e, producing [Ca²⁺]_i responses almost identical to those produced by the wild-type CaR in cells exposed to inhibitors of PKC. These results support a model in which periodic phosphorylation of the CaR at the inhibitory threonine 888 by PKC provides the negative feedback needed to cause [Ca²⁺]_e-induced [Ca²⁺]_i oscillations.

The CaR is an allosteric protein that responds to two different agonists, Ca²⁺ and aromatic amino acids (41), with the production of [Ca²⁺]_i oscillations (8, 9). The differing patterns of [Ca²⁺]_i oscillations induced by L-phenylalanine and [Ca²⁺]_e suggest that these stimuli induce [Ca²⁺]_i oscillations through different mechanisms. This idea is given further credence by our results showing that cells expressing the mutant receptor CaR_T888A continue to respond to the addition of L-phenylalanine with [Ca²⁺]_i oscillations (although at reduced frequency), whereas at the same time they do not produce [Ca²⁺]_i oscillations in response to increases in [Ca²⁺]_e. This suggests that unlike [Ca²⁺]_e-induced [Ca²⁺]_i oscillations, L-phenylalanine-induced oscillations are not controlled by PKC providing negative feedback though the major phosphorylation site at threonine 888 on the CaR. Further experimentation will be necessary to determine the mechanism(s) by which L-phenylalanine induces [Ca²⁺]_i oscillations through the CaR.

Oscillatory changes in [Ca²⁺]_i in response to receptor stimulation is a fundamental mechanism of cell signaling in both non-excitable and excitable cells that can protect cells from the cytotoxic effects of prolonged increases in [Ca²⁺]_i. It is increasingly recognized that the pattern and frequency of [Ca²⁺]_i oscillations encodes for differential regulation of biological responses including selective gene expression (13-16). For example, low frequency [Ca²⁺]_i oscillations activate the transcription factor NF-B whereas higher frequencies lead to stimulation of the transcription factor NF-AT (14). Our results demonstrating that the CaR-mediated [Ca²⁺]_i oscillations in response to an increase in [Ca²⁺]_e are negatively regulated by PKC are of potential physiological importance. Because many cells in the organism that express CaR are exposed to numerous hormones, neurotransmitters, and growth factors that promote PKC activation, it is plausible that the pattern of [Ca²⁺]_i oscillations triggered by activation of the CaR in response to an increase in [Ca²⁺]_e could be finely tuned by PKC activity, which in turn is determined by other signals reaching the cell.

	ACKNOWLEDGEMENTS

We thank J. Sinnett-Smith, C. Hurd, and R. Waldron for helpful discussions.

	FOOTNOTES

^* This work was supported by National Institute of Health Grants DK 17294, DK 55003, DK 56930, and NCI P50 CA90388.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Ronald S. Hirshberg Professor of Pancreatic Cancer Research. To whom correspondence should be addressed: Rm. 11-124, Warren Hall, Dept. of Medicine, David Geffen School of Medicine, UCLA, 900 Veteran Ave., Los Angeles, CA 90095-1786. Tel.: 310-794-6610; Fax: 310-267-2399; E-mail: erozengurt@mednet.ucla.edu.

Published, JBC Papers in Press, September 27, 2002, DOI 10.1074/jbc.M207083200

	ABBREVIATIONS

The abbreviations used are: CaR, Ca²⁺-sensing receptor; GPCR, G protein-coupled receptor; PKC, protein kinase C; Ins(1, 4,5)P₃, inositol 1,4,5-trisphosphate; HEK, human embryonic kidney; PDBu, phorbol 12,13-dibutyrate.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. L. Davies, A. Ozawa, W. D. McCormick, M. M. Dvorak, and D. T. Ward Protein Kinase C-mediated Phosphorylation of the Calcium-sensing Receptor Is Stimulated by Receptor Activation and Attenuated by Calyculin-sensitive Phosphatase Activity J. Biol. Chem., May 18, 2007; 282(20): 15048 - 15056. [Abstract] [Full Text] [PDF]

				O. Rey, S. H. Young, R. Papazyan, M. S. Shapiro, and E. Rozengurt Requirement of the TRPC1 Cation Channel in the Generation of Transient Ca2+ Oscillations by the Calcium-sensing Receptor J. Biol. Chem., December 15, 2006; 281(50): 38730 - 38737. [Abstract] [Full Text] [PDF]

				A. D. Conigrave and E. M. Brown Taste Receptors in the Gastrointestinal Tract II. L-Amino acid sensing by calcium-sensing receptors: implications for GI physiology. Am J Physiol Gastrointest Liver Physiol, November 1, 2006; 291(5): G753 - G761. [Abstract] [Full Text] [PDF]

				S. L. Davies, C. E. Gibbons, T. Vizard, and D. T. Ward Ca2+-sensing receptor induces Rho kinase-mediated actin stress fiber assembly and altered cell morphology, but not in response to aromatic amino acids Am J Physiol Cell Physiol, June 1, 2006; 290(6): C1543 - C1551. [Abstract] [Full Text] [PDF]

				P. J. Atkinson, K. W. Young, S. J. Ennion, J. N. C. Kew, S. R. Nahorski, and R. A. J. Challiss Altered Expression of Gq/11{alpha} Protein Shapes mGlu1 and mGlu5 Receptor-Mediated Single Cell Inositol 1,4,5-Trisphosphate and Ca2+ Signaling Mol. Pharmacol., January 1, 2006; 69(1): 174 - 184. [Abstract] [Full Text] [PDF]

				O. Rey, S. H. Young, J. Yuan, L. Slice, and E. Rozengurt Amino Acid-stimulated Ca2+ Oscillations Produced by the Ca2+-sensing Receptor Are Mediated by a Phospholipase C/Inositol 1,4,5-Trisphosphate-independent Pathway That Requires G12, Rho, Filamin-A, and the Actin Cytoskeleton J. Biol. Chem., June 17, 2005; 280(24): 22875 - 22882. [Abstract] [Full Text] [PDF]

				M. Zhang and G. E. Breitwieser High Affinity Interaction with Filamin A Protects against Calcium-sensing Receptor Degradation J. Biol. Chem., March 25, 2005; 280(12): 11140 - 11146. [Abstract] [Full Text] [PDF]

				A. M. Sakwe, L. Rask, and E. Gylfe Protein Kinase C Modulates Agonist-sensitive Release of Ca2+ from Internal Stores in HEK293 Cells Overexpressing the Calcium Sensing Receptor J. Biol. Chem., February 11, 2005; 280(6): 4436 - 4441. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/49/46871    most recent M207083200v1