HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 49, 47080-47087, December 6, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/49/47080    most recent M208329200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bodnar, R. J. Articles by Du, X. Search for Related Content PubMed PubMed Citation Articles by Bodnar, R. J. Articles by Du, X. Social Bookmarking                      What's this?

Regulation of Glycoprotein Ib-IX-von Willebrand Factor Interaction by cAMP-dependent Protein Kinase-mediated Phosphorylation at Ser ¹⁶⁶ of Glycoprotein Ib^*

Richard J. Bodnar, Xiaodong Xi, Zhenyu Li, Michael C. Berndt^§, and Xiaoping Du^¶

From the  Department of Pharmacology, University of Illinois, College of Medicine, Chicago, Illinois 60612 and the ^§ Department of Biochemistry and Molecular Biology, Monash University, Clayton, VIC 3168, Australia

Received for publication, August 14, 2002, and in revised form, September 26, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

The platelet receptor for von Willebrand factor (VWF), glycoprotein (GP) Ib-IX, mediates initial platelet adhesion and activation. It is known that the cytoplasmic domain of GPIb is phosphorylated at Ser¹⁶⁶ by cAMP-dependent protein kinase (PKA). To understand the physiological role of GPIb phosphorylation, a GPIb-IX mutant replacing Ser¹⁶⁶ of GPIb with alanine (S166A) and a deletion mutant lacking residues 166-181 of GPIb (165) were constructed. These mutants, expressed in Chinese hamster ovary (CHO) cells, showed an enhanced VWF-binding function compared with wild type GPIb-IX. Treatment of CHO cells expressing wild type GPIb-IX with a PKA inhibitor, PKI, reduced Ser¹⁶⁶ phosphorylation and also enhanced VWF binding to GPIb-IX. Furthermore, cells expressing S166A or 165 mutants showed a significantly enhanced adhesion to immobilized VWF under flow conditions. Consistent with the studies in CHO cells, treatment of platelets with PKI enhanced VWF binding to platelets. In contrast, a PKA stimulator, forskolin, reduced VWF binding and VWF-induced platelet agglutination, which was reversed by PKI. Thus, PKA-mediated phosphorylation of GPIb at Ser¹⁶⁶ negatively regulates VWF binding to GPIb-IX and is one of the mechanisms by which PKA mediates platelet inhibition.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Platelet adhesion and activation play critical roles in thrombosis and hemostasis. Under high shear rate flow conditions, initial platelet adhesion is mediated by the binding of the platelet von Willebrand Factor (VWF)¹ receptor, the glycoprotein (GP) Ib-IX-V complex, to subendothelial-bound VWF (1, 2). The GPIb-IX-VWF interaction also initiates an intracellular signaling cascade leading to platelet shape change, spreading, secretion, and aggregation (3-7).

The GPIb-IX-V complex is composed of four type I transmembrane polypeptide chains, GPIb, GPIb, GPIX, and GPV (1, 8). GPIb and GPIb are covalently linked through a disulfide bond to form GPIb. GPIX is non-covalently associated with GPIb in a 1:1 ratio, and the GPIb-IX complex is non-covalently associated with GPV in a 2:1 ratio (1, 8). Expression of the GPV polypeptide is not required for surface expression or the ligand-binding function of the GPIb-IX complex (9). The extracellular domain of GPIb contains binding sites for VWF and -thrombin (1, 8). The cytoplasmic domain of GPIb contains binding sites for filamin (also called ABP-280) between residues 536 and 579 (10-12), linking the GPIb-IX complex to F-actin structures underlining the plasma membrane. The cytoplasmic domain of GPIb also contains a binding site for the signaling molecule 14-3-3 located between residues 595 and 610 (13, 14). Phosphorylation of GPIb at Ser⁶⁰⁹ is required for high affinity binding of 14-3-3 to GPIb (15). 14-3-3 has been shown to be involved in GPIb-IX-mediated activation of the integrin _IIb3 (6). The cytoplasmic domain of GPIb has been found to interact with calmodulin between residues 149 and 167 (16). GPIb has also been found to interact with 14-3-3 (17, 18) and is phosphorylated at Ser¹⁶⁶ by PKA (19-21).

It is known that platelet activation (including VWF-induced platelet activation) is inhibited by compounds that increase the intracellular concentration of cAMP such as prostaglandin E1 (PGE₁) and forskolin (6, 22, 23). Elevation of intracellular cAMP levels induces the activation of PKA. The mechanism by which PKA inhibits platelets is not totally understood but is known to involve phosphorylation of multiple intracellular signaling proteins and regulation of multiple signaling pathways. For example, cAMP has been implicated in inhibiting Ca²⁺ influx (24) and phospholipase C activation (25), as well as inhibition of G protein-coupled receptor signaling pathways (26). One of the major PKA substrates in platelets is GPIb (19-21). cAMP-elevating agents have been shown to induce GPIb phosphorylation at Ser¹⁶⁶ (21). In a study by Fox and Berndt (27), PKA mediated inhibition of actin polymerization during collagen-induced platelet activation in wild type platelets but not in GPIb-IX-deficient platelets from Bernard-Soulier syndrome patients. This suggests that GPIb-IX and possibly PKA-mediated phosphorylation of GPIb are important in PKA-mediated inhibition of actin polymerization. However, it is not clear if, and how, PKA-mediated GPIb phosphorylation affects GPIb-IX function.

In this study, we have examined the role of phosphorylation of GPIb at Ser¹⁶⁶ in regulating the receptor function of GPIb-IX. We show that wild type GPIb-IX phosphorylated at Ser¹⁶⁶ poorly interacts with VWF. A point mutation that changes Ser¹⁶⁶ of GPIb to alanine disrupts Ser¹⁶⁶ phosphorylation and enhances the VWF-binding function of GPIb-IX. Furthermore, activation of PKA increases GPIb phosphorylation in platelets and inhibits VWF binding to GPIb-IX, whereas inhibition of PKA inhibits GPIb phosphorylation and enhances VWF binding. Thus, PKA-mediated phosphorylation of GPIb at Ser¹⁶⁶ negatively regulates the VWF-binding function of GPIb-IX.

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Reagents-- Monoclonal antibodies, SZ29 against VWF and SZ2 against GPIb, were generous gifts from Dr. Changgeng Ruan (Suzhou Medical College, Suzhou, China) (28, 29). cDNA clones encoding wild type GPIb, GPIb, and GPIX were generous gifts provided by Dr. Jose Lopez (Baylor College of Medicine, Houston, TX) (30-32). Human VWF was purified from cryoprecipitates as described previously (33). Botrocetin was also purified as previously described (34). Ristocetin, forskolin, and dimethyl sulfoxide (Me₂SO) were purchased from Sigma. The membrane-permeable PKA inhibitor, myristoylated PKI, was purchased from Calbiochem (San Diego, CA).

Cell Lines Expressing Recombinant Proteins-- Transfection of cDNA into CHO cells was performed according to the LipofectAMINE Plus (Invitrogen) protocol. In short, CHO cells were plated at 5.25 × 10⁵ cells/60 mm dish then cultured overnight at 37 °C in 5% CO₂. The DNA/LipofectAMINE mixture was added to the CHO cells and incubated for 6 h. at 37 °C in 5% CO₂. Stably transfected cell lines were selected using selection media containing 0.5 mg/ml G418 and further selected by cell sorting using the anti-GPIb monoclonal antibody, SZ2. The following cell lines were used: cells expressing wild type GPIb-IX (1b9) (6); GPIb-IX mutants with the cytoplasmic domain of GPIb truncated at residue 165, lacking amino acids 166-181 (165); or a serine to alanine point mutation at Ser¹⁶⁶ in GPIb (S166A). For construction of the GPIb mutants 165 and S166A, DNA fragments were synthesized by PCR using wild type GPIb in the pcDNA3.1() vector, as the template. For the construction of the 165 GPIb mutant, the oligonucleotide GGGTCGGTACCTTACACGCGGGCTGCG was used as the reverse primer and CCCTACCGCGACCTGCGTTG was used as the forward primer. These fragments were digested with NotI and KpnI then ligated with GPIb in pcDNA3.1() vector digested with the same enzymes. For the construction of the GPIb S166A mutant, two DNA fragments were synthesized by PCR using the oligonucleotides CCCTACCGCGACCTGCGTTG as the forward and TCAGTGCCAGCCGGGCTG as the reverse for the 5'-fragment and AGCCCGGCTGGCACTGAC as the forward and TAGAAGGCACAGTCGAGG as the reverse for the 3'-fragment using wild type GPIb in the vector pcDNA3.1() as template. The two PCR products (containing a 17-base pair overlap) were combined with the oligonucleotides CCCTACCGCGACCTGCGTTG as the forward and TAGAAGGCACAGTCGAGG as the reverse and amplified using the following cycling conditions: 94 °C × 5 min, 45 °C × 1 min, 72 °C × 1 min, 94 °C × 1 min for 5 cycles followed by 55 °C × 1 min, 72 °C × 1 min, 94 °C × 1 min for 25 cycles, and a final cycle of 55 °C × 1 min, 72 °C × 5 min. The final product was digested with NotI and KpnI, then ligated with GPIb in pcDNA3.1() vector digested with the same enzymes. The mutant GPIb was sequenced in both the forward and reverse directions to verify the nucleotide sequence.

An Antibody Against the Phosphopeptide Corresponding to the Cytoplasmic Domain of GPIb-- GPIb peptides, RAAARL(pS)LTDPLV (pS indicates phosphorylated serine) and RAAARLSLTDPLV, containing an N-terminal cysteine were synthesized by Chiron Mimotopes (Melbourne, Australia). The anti-phospho-GPIb (GPIb-P) antibody was raised by immunizing New Zealand White rabbits with the phosphorylated CRAAARLpSLTDPLV peptide conjugated to keyhole limpet hemocyanin (Sigma) (35). The anti-peptide antibody was affinity purified with the immunizing peptide conjugated to BSA and coupled on a 1:1 column of Affi-Gel 10/15 (Bio-Rad). The antibody was then absorbed with the nonphosphorylated CRAAARLSLTDPLV peptide conjugated to BSA, also coupled on a 1:1 column of Affi-Gel 10/15 (Bio-Rad). The specificity of the anti-GPIb-P antibody was verified by dot immunoblots against the CRAAARL(pS)LTDPLV and CRAAARLSLTDPLV peptides conjugated to albumin (1:10 w/w). Antibody reactivity was visualized using a horseradish peroxidase-conjugated goat anti-rabbit IgG and enhanced chemiluminescence kit (Amersham Biosciences).

Flow Cytometric Analysis of VWF Binding to GPIb-IX-expressing Cells and Platelets-- CHO cells expressing wild type (1b9) and mutant GPIb-IX (165 and S166A) were grown to confluence to synchronize cell growth. The cells were detached using 0.5 mM EDTA in PBS, pH 7.4. Seventy-five percent of the original volume was then resuspended in Dulbecco's modified Eagle's medium growth media and cultured for 18 h. The cells were detached using 0.5 mM EDTA-PBS, pH 7.4, then resuspended in Tyrode's buffer (2.5 mM Hepes, 12.1 mM NaHCO₃, 2.36 mM KCl, 0.136 M NaCl, 1 mM CaCl₂, 1 mM MgCl, 0.1% D-glucose, pH 7.4) with 1% BSA to a concentration of 2.25 × 10⁶ cells/ml. The cells were incubated at 4 °C for 30 min, then ristocetin (1.25 mg/ml) and purified VWF (35 µg/ml) were added and incubated at 22 °C for 30 min. The cells were washed once with Tyrode's buffer, further incubated in Tyrode's buffer containing 10 µg/ml FITC-labeled SZ-29 (monoclonal antibody against VWF) in the dark at 22 °C for 30 min and then analyzed by flow cytometry. As negative controls, cells were incubated in the presence of VWF alone or ristocetin alone then incubated with FITC-labeled SZ29. Nonspecific fluorescence was identical for either treatment (data not shown). The 1b9 cells were also preincubated with or without 50 µM PKI for 15 min or 2 µM forskolin for 5 min at 22 °C, prior to analysis for VWF binding.

The preparation of washed platelets was as described previously (36). Briefly, blood was drawn from healthy donors with no medication within 2 weeks, and anti-coagulated with 1/7 volume of ACD (2.5% trisodium citrate (w/v), 2.0% d-Glucose (w/v), 1.5% citric acid (w/v)). Platelet-rich plasma (PRP) was separated by centrifuging at 300 × g for 25 min. Platelets were washed two times in CGS buffer (0.123 M NaCl, 0.033 M D-Glucose, 0.013 M trisodium citrate, pH 6.5) and were not exposed to cAMP-enhancing agents such as PGE₁ and prostaglandin I₂ (PGI₂). The washed platelets were resuspended in modified Tyrode's buffer to a concentration of 1.0 × 10⁷ cells/ml and treated with or without 100 µM of PKI at 37 °C for 15 min. The platelets were further incubated with forskolin (2 µM final concentration) or Me₂SO (0.1% final concentration, vehicle control) at 22 °C for 10 min, then incubated with 1 mM RGDS peptide (an integrin inhibitor), 5 µg/ml botrocetin, and 35 µg/ml VWF at 22 °C for 30 min. VWF binding was detected as described above for CHO cells.

Cell Adhesion under Flow-- Purified human VWF was diluted to a final concentration of 50 µg/ml with 0.1 mM NaHCO₃, pH 8.3, and coated onto glass cover slides (22 × 401, Fisher) overnight in a humid environment at 4 °C. The cover slides were washed with PBS to remove unbound VWF, blocked with 5% BSA in PBS at room temperature for 2 h, and installed in a parallel flow chamber (Model RC-30, Warner Instruments Inc., Hamden, CT) with a silicon rubber gasket. The chamber has a depth of 0.075 mm, a width of 3 mm, and a length of 35 mm. The cells suspended in modified Tyrode's buffer containing 5% bovine serum albumin (5 × 10⁶ cells/ml) were perfused by a syringe pump (Harvard Apparatus Inc., Holliston, MA) into the flow chamber at various shear rates for 2 min. Transient adhesion (rolling) of cells on the VWF-coated surface was recorded on video tapes. Shear rate was calculated as described by Slack and Turitto (37). Transient adherent cells were counted in 10 randomly selected fields of 0.18 mm² at randomly selected time points during the perfusion period.

Platelet Agglutination-- Whole blood was anti-colaguated with 0.38% sodium citrate, then centrifuged at 350 × g for 25 min and PRP obtained as previously described (38). The PRP was preincubated with RGDS (1 mM) and PKI (100 µM) for 10 min at 22 °C or forskolin (2 µM) at 22 °C for 5 min. VWF-dependent platelet agglutination was induced by the addition of ristocetin (1.25 mg/ml) to the PRP. Platelet agglutination was measured using a turbidometric platelet aggregometer at 37 °C with a stirring speed of 1000 rpm.

Immunoprecipitation and Immunodepletion of Phosphorylated GPIb-- The preparation of washed platelets was as described above (36), and were not exposed to cAMP-enhancing agents such as PGE₁ and PGI₂. Washed platelets were resuspended in Tyrode's buffer containing 0.1% BSA to a concentration of 1 × 10⁹ cells/ml and incubated at 37 °C for 30 min. CHO cells expressing wild type Ib-IX (1b9 cells) were detached with 0.5 mM EDTA-PBS, pH 7.4, then resuspended in Tyrode's buffer containing 0.1% BSA to a concentration of 5.0 × 10⁷ cells/ml. The cells were solubilized with an equal volume of solubilization buffer (0.1 M Tris, 0.01 M EGTA, 0.15 M NaCl, 2% Triton X-100, pH 7.4) containing 0.2 mM E64 (calpain inhibitor, Roche Molecular Biochemicals), 2 mM phenylmethylsulfonylfluoride (Sigma), and 0.08 units/ml Aprotinin (Sigma) and incubated on ice for 10 min. The lysate was centrifuged at 100,000 × g for 30 min at 4 °C. The supernatant (100 µl) was incubated with rabbit IgG or purified anti-GPIb-P antibody (5 µg) at 4 °C for 30 min then further incubated for 30 min after the addition of 25 µl (50% v/v) of Protein A-conjugated Sepharose beads (Amersham Biosciences). The beads were separated from the supernatant by centrifugation. To quantitate the unphosphorylated GPIb in the platelet lysate, the phosphorylated GPIb was depleted by repeated immunoprecipitation with anti-GPIb-P antibody. The immunoprecipitates were combined then washed three times with wash buffer (0.1 M Tris, pH 7.4, 0.15 M NaCl, 10 mM EGTA, 1% Triton X-100). Both the platelet lysates depleted of phosphorylated GPIb and immunoprecipitates were diluted to an identical final volume with SDS sample buffer containing 5% -mercaptoethanol and Western blotted with anti-GPIb antibody, SZ2, to detect the GPIb-IX containing unphosphorylated GPIb. The results were visualized with enhanced chemiluminescence (Amersham Biosciences).

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Phosphorylation-deficient Mutants of GPIb-- To investigate the roles of phosphorylation of GPIb in regulating the functions of GPIb-IX, a conserved point mutation was made in GPIb that replaces Ser¹⁶⁶ with alanine (Fig. 1). A truncation mutation was also made that deleted the C-terminal 16 residues of GPIb including Ser¹⁶⁶. This deletion includes the reported 14-3-3 binding site in GPIb (Fig. 1). Each of these mutants was co-transfected with GPIb and GPIX cDNAs into CHO cells, and stable cell lines expressing these GPIb-IX mutants were established.

View larger version (16K): [in this window] [in a new window]   Fig. 1.   Phosphorylation-deficient mutants of GPIb. The schematic illustrates the mutations made in the cytoplasmic domain of GPIb. The mutant 165 is a truncation mutant lacking the C-terminal amino acids 166-181 (including Ser166 and the reported 14-3-3 binding site). The S166A mutant is a conservative mutation changing Ser166 to alanine, eliminating phosphorylation at this site.

An Anti-GPIb Antibody Specifically Recognizes Phosphorylated Ser¹⁶⁶-- To determine whether the above mentioned mutations abolished Ser¹⁶⁶ phosphorylation in GPIb-IX, and to investigate the phosphorylation of Ser¹⁶⁶ in regulating GPIb-IX function, an anti-peptide antibody was developed using a synthetic peptide corresponding to the RAAARL(pS)LTDPLV sequence of the cytoplasmic domain of GPIb with Ser¹⁶⁶ phosphorylated. This antibody (anti-GPIb-P) reacted specifically with the phosphorylated peptide RAAARL(pS)LTDPLV but did not react with the corresponding non-phosphorylated peptide RAAARLSLTDPLV (Fig. 2A), indicating the anti-GPIb-P antibody recognizes the GPIb cytoplasmic domain sequence only when Ser¹⁶⁶ is phosphorylated. To examine whether anti-GPIb-P specifically recognizes phosphorylated GPIb in platelets, platelets were solubilized and immunoblotted with anti-GPIb-P. Anti-GPIb-P antibody specifically reacted with a protein of molecular mass, 24 kDa, corresponding to GPIb (Fig. 2B), which is also immunoblotted by a previously characterized antibody specific for the C-terminal domain of GPIb (anti-IbC) (14). Furthermore, preincubation of platelets with a specific PKA inhibitor, PKI, dramatically inhibited the reactivity of anti-GPIb-P with GPIb. In contrast, treatment of platelets with the PKA activator, forskolin, enhanced the binding of anti-GPIb-P to GPIb (Fig. 2B). These results demonstrate that anti-GPIb-P specifically recognizes GPIb only when Ser¹⁶⁶ is phosphorylated. To determine whether GPIb expressed in CHO cells was phosphorylated, and whether the above described mutants of GPIb-IX are phosphorylation-deficient, the lysates from wild type and mutant GPIb-IX-expressing cells were immunoblotted with anti-GPIb-P. Fig 2C shows that anti-GPIb-P reacted with the wild type GPIb expressed in 1b9 cells but failed to react with GPIb from the S166A or 165 mutant cells. Thus, wild type GPIb expressed in CHO cells is phosphorylated at Ser¹⁶⁶, but the S166A and the 165 mutants are phosphorylation-deficient at Ser¹⁶⁶. These data also further demonstrate that anti-GPIb-P antibody is specific for phosphorylated Ser¹⁶⁶.

View larger version (50K): [in this window] [in a new window]   Fig. 2.   Specific binding of anti-GPIb-P to phosphorylated Ser166 peptide corresponding to the C-terminal sequence of GPIb. A, the synthetic phosphopeptide, CRAAARLpSLTDPLV, or equivalent nonphosphorylated peptide, CRAAARLSLTDPLV, were conjugated to BSA and dot blotted onto nitrocellulose. As a control, BSA was also applied to the nitrocellulose membrane. Purified anti-GPIb-P antibody was incubated with the nitrocellulose for 2 h at 22 °C. After further incubation with horseradish peroxidase-conjugated goat anti-rabbit IgG, bound antibody was detected using enhanced chemiluminescence. Note that the anti-GPIb-P antibody specifically recognized the phosphorylated peptide but not the nonphosphorylated peptide nor BSA. B, washed resting platelets were incubated with Me2SO (0.05%, Control), membrane-permeable PKI (100 µM), or forskolin (2 µM) for 1 h at 37 °C then solubilized as described under "Materials and Methods." The lysates were immunoblotted using the anti-GPIb-P antibody (left panel) or the anti-IbC antiserum (14) (right panel) directed against the nonphosphorylated GPIb C-terminal sequence. C, CHO cells expressing wild type GPIb-IX (1b9), the GPIb C-terminal domain deletion mutant 165, and the Ser166 to Ala point mutant (S166A) were resuspended in modified Tyrode's buffer and then solubilized as described under "Materials and Methods." The lysate was immunoblotted with the anti-GPIb-P antibody.

VWF Binding to GPIb-IX Is Regulated through GPIb Phosphorylation-- To examine whether phosphorylation at Ser¹⁶⁶ of GPIb plays a role in regulating the VWF-binding function of GPIb-IX, cells expressing wild type GPIb-IX (1b9) and the S166A mutant were incubated with increasing concentrations of soluble human VWF in the presence of ristocetin, a modulator that induces VWF binding to GPIb-IX. The S166A mutant demonstrated significantly increased VWF binding compared with 1b9 cells (Fig. 3A). This increased VWF binding to the S166A mutant was not caused by differences in GPIb-IX expression level, as the expression levels of the two cell lines were comparable (Fig. 3B). Furthermore, the VWF binding data shown in Fig. 3A was corrected relative to the ratio of the expression levels between the two cell lines. Thus, the mutant S166A showed an increased VWF-binding function. We also examined VWF binding to cells expressing the 165 mutant (165). The 165 mutant, lacking the C-terminal cytoplasmic residues 166-181 of GPIb, also showed an increase in ristocetin-induced VWF binding in a manner that is similar to the S166A mutant (Fig. 4). Thus, disruption of Ser¹⁶⁶ phosphorylation in GPIb or deletion of the phosphorylation site of GPIb enhanced the VWF-binding function of GPIb-IX.

View larger version (29K): [in this window] [in a new window]   Fig. 3.   VWF binding to the S166A mutant of GPIb-IX. A, CHO cells expressing wild type GPIb-IX (1b9) or the GPIb mutant S166A (Ser to Ala mutation) were incubated in the presence of 1.25 mg/ml ristocetin and an increasing concentration of purified human VWF at 22 °C for 30 min. Bound VWF was detected using a FITC-labeled anti-VWF monoclonal antibody (SZ29) and analyzed by flow cytometry as described under "Materials and Methods." The fluorescence intensity (geomean) of VWF binding was corrected for the ratio of the GPIb-IX expression levels between the two cell lines as determined in B. Shown in the figure are data from three separate experiments (mean ± S.D.). B, the surface expression levels of GPIb-IX on CHO cells expressing wild type GPIb-IX (1b9) and the S166A mutant were analyzed by flow cytometry after incubation with 20 µg/ml of the anti-GPIb monoclonal antibody SZ2 followed by FITC-labeled goat anti-mouse IgG antibody.

View larger version (18K): [in this window] [in a new window]   Fig. 4.   VWF-binding to 165 mutant of GPIb-IX. CHO cells expressing wild type GPIb-IX (1b9) and mutant 165 (lacking residues 166-181) were incubated with 35 µg/ml of human VWF in the presence of 1.25 mg/ml ristocetin or with ristocetin alone. VWF binding was detected with the FITC-labeled anti-VWF monoclonal antibody, SZ29, and analyzed by flow cytometry. The cells were also analyzed for surface expression of GPIb-IX using an anti-GPIb (SZ2) monoclonal antibody followed by a FITC-labeled goat anti-mouse antibody and analyzed by flow cytometry. The fluorescence intensity (geomean) of VWF binding was corrected for the ratio of the GPIb-IX expression levels between the two cell lines (1b9/165 = 1/1.37). Shown in the figure are the results from 3 separate experiments (mean ± S.D.).

In platelets, GPIb is phosphorylated by PKA (20, 21). To determine whether PKA in CHO cells is also responsible for phosphorylation of GPIb and the negative regulation of VWF-binding function, we examined the effects of a specific PKA inhibitor, PKI, on GPIb phosphorylation and on VWF-binding function of GPIb-IX in CHO cells expressing wild type GPIb-IX (1b9). Fig. 5A shows that the phosphorylation level of wild type GPIb is reduced by PKI treatment. Coincident with the reduced GPIb phosphorylation, VWF binding to 1b9 cells was enhanced by PKI treatment (Fig. 5B), in a manner similar to the increased VWF binding in the S116A mutant lacking the PKA-phosphorylation site of GPIb (Fig. 5C). The increased VWF binding to the S166A mutant, however, was not inhibited by the PKA activator forskolin (Fig. 5C). Taken together, these data indicate that VWF-binding function of GPIb-IX is negatively regulated by PKA-mediated phosphorylation of GPIb in this CHO cell model.

View larger version (23K): [in this window] [in a new window]   Fig. 5.   Inhibition of PKA enhances VWF binding to GPIb-IX in CHO cells. A, 1b9 cells were resuspended in Tyrode's buffer then incubated with 50 µM PKI or 2 µM forskolin or 0.1% Me2SO (Control), solubilized, and then immunoblotted with the anti-GPIb-P antibody to detect GPIb phosphorylation at Ser166 or with the anti-IbC antibody to detect total GPIb. The relative quantity of phosphorylated GPIb in 1b9 cells was determined by scanning the protein bands and analyzing band density using NIH Image (mean ± S.D., n = 3). The results are expressed as percent change from the control. B, 1b9 cells were preincubated without or with 50 µM PKI for 15 min at 22 °C then allowed to bind VWF (35 µg/ml) in the presence of ristocetin (1.25 mg/ml). As a negative control, cells were incubated with ristocetin alone in the absence of VWF. VWF binding was detected using the anti-VWF antibody SZ29 by flow cytometry as described under "Materials and Methods." Note that PKI treatment enhanced VWF binding. C, S166A cells were pre-incubated with 2 µM forskolin or 0.2% Me2SO (vehicle) for 5 min at 22 °C then allowed to incubate with ristocetin in the absence (Control) or presence of VWF. Binding of VWF was detected by flow cytometry as described in B.

Effects of Ser¹⁶⁶-deficient Mutations on Cell Adhesion to VWF under Flow-- GPIb-IX binding to VWF mediates transient adhesion (or rolling) of platelets on subendothelial-bound VWF under flow conditions. We therefore examined whether the 165 and S166A mutants of GPIb-IX also affect GPIb-IX-dependent cell adhesion to VWF under flow conditions. As controls, we also examined adhesion of these cell lines to BSA-coated surfaces. No cells from the mutant GPIb-IX-expressing cell lines or from the wild type GPIb-IX cell line adhered to BSA-coated surface at shear rates above 1080 s¹. As reported previously, wild type GPIb-IX-expressing cells adhered poorly on a VWF-coated surface. At a shear rate of 1080 s¹ or higher, no 1b9 cells were seen to roll on the VWF-coated surface (Fig. 6). In contrast, both the S166A and 165 mutant cells showed transient adhesion on the VWF-coated surface (Fig. 6). Interestingly, the truncation mutant 165 showed a greater increase in adhesion compared with the S166A mutant at 1080 s¹ shear rate. Although the reason for this difference remains to be investigated, it may be relevant that the 165 mutant not only lacks the phosphorylation site at Ser¹⁶⁶ but also lacks the entire C-terminal domain containing the reported 14-3-3 binding site in GPIb. Thus, phosphorylation at Ser¹⁶⁶ of GPIb negatively regulates cell adhesion and rolling on immobilized VWF under flow conditions, and in addition to Ser¹⁶⁶ phosphorylation, the C-terminal domain of GPIb containing the previously reported 14-3-3 binding site may also be important in negatively regulating GPIb-IX function.

View larger version (14K): [in this window] [in a new window]   Fig. 6.   Effects of GPIb mutations on GPIb-IX-dependent transient cell adhesion to VWF under flow conditions. Wild type GPIb-IX-expressing cells (1b9) and GPIb mutant cells, S166A and 165, were perfused into a VWF-coated parallel plate flow chamber at the indicated shear rates as described under "Materials and Methods." Transient adhesion (rolling) of these cells was recorded using a videotape recorder. The number of rolling cells was counted in randomly selected fields of 0.18 mm2. Each field was evaluated for 10 s. The results shown are the mean ± S.D. of cell counts/mm2 (n = 10). Statistical analysis revealed that the difference between 1b9 cells and the two mutant cell lines are significant (p < 0.01 in both cases). These cell lines were also perfused into BSA-coated parallel plate flow chamber. Transient adherent cells on BSA-coated surface are zero for all of three cell lines.

Negative Regulation of VWF Binding to GPIb-IX by PKA-mediated Phosphorylation in Human Platelets-- We showed above that the VWF-binding function of GPIb-IX is negatively regulated by PKA-dependent GPIb-IX phosphorylation at Ser¹⁶⁶ in CHO cells. To verify whether PKA also negatively regulates the VWF-binding function of GPIb-IX in platelets, platelets were preincubated with PKI or forskolin and then allowed to bind soluble VWF in the presence of botrocetin. The integrin inhibitor, RGDS, was added to all reactions to exclude any role of integrin _IIb3 in VWF binding. Treatment of platelets with PKI significantly increased VWF binding to platelets compared with control untreated platelets (Fig. 7A). This increase was not due to the activation of the integrin _IIb3 because the platelets were preincubated with the integrin inhibitor, RGDS. On the other hand, incubation with forskolin induced a decrease in VWF binding (Fig. 7A). When the platelets were preincubated with PKI and then incubated with forskolin, PKI was able to reverse the inhibitory effects of forskolin (Fig. 7B). Furthermore, to examine if PKA negatively regulates GPIb-IX-mediated agglutination, PRP was preincubated with PKI in the presence or absence of forskolin. Platelet agglutination was induced by the addition of ristocetin in the presence of the integrin inhibitor, RGDS. Incubation of PRP with forskolin induced a decrease in GPIb-IX-mediated agglutination (Fig. 7C). When PRP was preincubated with PKI prior to addition of forskolin, the inhibitory effects of forskolin on ristocetin-induced platelet agglutination was reversed (Fig. 7C), indicating that PKA negatively regulates GPIb-IX-dependent platelet agglutination. In parallel with their effects on VWF binding, PKI induced a significant decrease in the phosphorylation of GPIb at Ser¹⁶⁶, and forskolin induced a significant increase in GPIb phosphorylation (Fig. 7D). These data are consistent with PKA-induced phosphorylation of GPIb negatively regulating GPIb-IX-VWF interaction.

View larger version (51K): [in this window] [in a new window]   Fig. 7.   PKA-mediated phosphorylation of GPIb negatively regulates VWF binding to GPIb-IX in platelets. A, washed resting platelets (1.0 × 109 cells/ml) in modified Tyrode's buffer were preincubated without or with 100 µM PKI (PKI + VWF) for 15 min, 2 µM forskolin (forskolin + VWF), or 0.1% Me2SO (VWF) for 10 min at 22 °C and then incubated with VWF (35 µg/ml) in the presence of botrocetin (5 µg/ml). VWF binding was analyzed as described under "Materials and Methods." B, washed resting platelets in modified Tyrode's buffer were treated without (forskolin + VWF) or with 100 µM PKI (PKI + forskolin + VWF) for 15 min at 22 °C and then incubated with 2 µM of forskolin for 10 min at 22 °C. The cells were then incubated with or without VWF (botrocetin) in the presence of botrocetin, stained with FITC-labeled SZ29, and analyzed using flow cytometry. C, PRP was first treated with the integrin inhibitor RGDS. The RGDS-treated PRP was then preincubated without or with 100 µM PKI for 10 min and then incubated with 2 µM forskolin or 0.05% Me2SO for 5 min at 22 °C. Ristocetin (1.25 mg/ml) was then added to induce GPIb-IX-mediated agglutination, which was recorded using a platelet turbidometric aggregometer at 37 °C. D, washed resting platelets in Tyrode's buffer (1.0 × 109 cells/ml) were treated with 100 µM PKI or 2 µM forskolin for 1 h at 37 °C. Platelets were solubilized as described under "Materials and Methods." The platelet lysate was immunoblotted using the anti-GPIb-P antibody to detect phosphorylated GPIb, or using the anti-GPIb antibody to monitor the level of total GPIb. Levels of phosphorylated GPIb in platelets were quantitated by scanning the protein bands and analyzing band density using NIH Image (mean ± S.D., n = 4). The results are shown as percent changes from the control. Slight loading errors between different samples were corrected using the ratio of the total amount of GPIb between samples.

Stoichiometry of GPIb Phosphorylation in CHO Cells and in Platelets-- We showed previously (38) and also here (Figs. 3 and 6) that wild type GPIb-IX expressed in CHO cells poorly bound VWF and poorly adhered to a VWF-coated surface under both static and flow conditions. In contrast, resting platelets bind VWF in the presence of ristocetin (Fig. 7) and adhere to VWF under high shear rate flow conditions (39). The regulatory mechanism causing this difference in the receptor function of GPIb-IX between CHO cells and platelets has never been satisfactorily explained. As we show here, the VWF-binding function of GPIb-IX is negatively regulated by PKA-mediated phosphorylation of GPIb at Ser¹⁶⁶ and enhanced in Ser¹⁶⁶ phosphorylation-deficient mutants expressed in CHO cells. We hypothesized that one of the mechanisms for the difference between CHO cells and platelets may result from a difference in the levels of Ser¹⁶⁶ phosphorylation. To investigate this possibility, we examined the stoichiometry of GPIb phosphorylation in resting platelets and in CHO cells. As shown in Fig. 7D, treatment of washed platelets with forskolin, a PKA activator, increased the reactivity of anti-GPIb-P by about 100% in immunoblots, suggesting that a significant proportion (~50%) of GPIb in resting platelets is dephosphorylated at Ser¹⁶⁶ (Fig. 7), a result consistent with previously published data (27). In contrast, forskolin failed to significantly enhance the reactivity of anti-GPIb-P with GPIb-IX expressed in CHO cells (Fig. 5), indicating that GPIb phosphorylation is near maximal levels. To further compare the Ser¹⁶⁶ phosphorylation between platelets and 1b9 cells, platelets or 1b9 cells were solubilized, and GPIb-IX in the cell lysate was immunoprecipitated repeatedly with anti-GPIb-P to deplete phosphorylated GPIb. The phosphorylated GPIb-IX complex immunoprecipitated with anti-GPIb-P and the depleted cell lysates were then analyzed by SDS-PAGE and immunoblotted with a monoclonal antibody against the extracellular domain of GPIb, SZ-2. In CHO cells, following repeated immuno-depletion with anti-GPIb-P, no GPIb was detected in the cell lysates, suggesting that almost all GPIb-IX molecules expressed in CHO cells are in the Ser¹⁶⁶-phosphorylated form (Fig. 8B). In contrast, ~35% of the GPIb remained in the platelet lysate following anti-GPIb-P depletion (Fig. 8A). These results demonstrate that there are two populations of GPIb in platelets, a Ser¹⁶⁶-phosphorylated form and a Ser¹⁶⁶-dephosphorylated form, and that all GPIb-IX molecules expressed in CHO cells are phosphorylated at Ser¹⁶⁶ of GPIb. This explains why GPIb-IX in platelets shows higher VWF binding and adhesion function than GPIb-IX expressed in CHO cells, and suggests that dynamic regulation of phosphorylation levels of GPIb in platelets may be a mechanism to regulate platelet adhesion to VWF.

View larger version (72K): [in this window] [in a new window]   Fig. 8.   The stoichiometry of GPIb phosphorylation in resting platelets and 1b9 cells. Platelets (A) and 1b9 cells (B) were solubilized as described under "Materials and Methods," GPIb phosphorylated at Ser166 in the lysates was immunoprecipated repeatedly using anti-GPIb-P (GPIb-P) or rabbit IgG antibody to depletion. The immunoprecipitated, phosphorylated GPIb-IX proteins (P) and the lysates (S) were immunoblotted with the anti-GPIb monoclonal antibody SZ2 to detect GPIb-IX level. Note that GPIb-IX in 1b9 cells was almost totally depleted by the anti-GPIb-P antibody, whereas GPIb-IX in the platelets was only partially immunoprecipitated by anti-GPIb-P.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

It has been shown previously (19-21) that the cytoplasmic domain of GPIb is phosphorylated at Ser¹⁶⁶. It is not clear, however, how, and if, phosphorylation at Ser¹⁶⁶ affects GPIb-IX function. In this study, we conclude that GPIb-IX with GPIb phosphorylated at Ser¹⁶⁶ is in a resting form and poorly interacts with VWF and that dephosphorylation at Ser¹⁶⁶ up-regulates the VWF-binding function of GPIb-IX. These conclusions are supported by the finding that GPIb-IX expressed in CHO cells is nearly 100% phosphorylated at Ser¹⁶⁶ and poorly binds to VWF and that the conserved point mutation changing Ser¹⁶⁶ to alanine to abolish Ser¹⁶⁶ phosphorylation significantly enhances the VWF-binding function of GPIb-IX. Furthermore, we show that the PKA activator, forskolin, increases GPIb phosphorylation in platelets but reduces VWF binding. In contrast, the PKA inhibitor, PKI, inhibited GPIb phosphorylation in both CHO cells and platelets and enhanced ristocetin-induced VWF binding. Thus, our data indicate that PKA-mediated phosphorylation of GPIb at Ser¹⁶⁶ negatively regulates VWF binding to GPIb-IX. This provides a novel intracellular signaling mechanism for regulation of the VWF-binding function of GPIb-IX and for PKA-mediated platelet inhibition.

Our finding that VWF-binding function of GPIb-IX is negatively regulated by PKA-dependent phosphorylation of Ser¹⁶⁶ of GPIb is physiologically and pathologically relevant. It is currently believed that GPIb-IX in normal circulating platelets does not bind to soluble VWF. At the site of vascular injury, VWF binding to GPIb-IX occurs when GPIb-IX is exposed to subendothelial-bound VWF. Interaction of VWF with the subendothelium is thought to induce a conformational change in VWF and thus allow its interaction with GPIb-IX. In vitro, this change in VWF is mimicked by surface immobilization of VWF or by the VWF modulators, ristocetin or botrocetin. However, recent studies show that in thrombotic microangioapathy (TMA) including thrombotic thrombocytopenic purpura (TTP), unusually large VWF multimers in the circulation interact with circulating platelets to cause microthrombosis and thrombocytopenia (40, 41). These unusually large VWF multimers are caused by a deficiency in the VWF-cleaving metalloprotease, ADAMTS13. Thus, unusually large VWF multimers appear to be able to interact with circulating platelets in these patients. Interestingly, although ADAMTS13 is deficient or decreased in many classic TTP patients, it is normal in patients with bone marrow transplant-associated TTP and several other types of thrombotic microangioapathy (40, 42), suggesting that additional mechanisms may be responsible for the increased interaction of large VWF multimers with platelets in these patients. Also, as ADAMTS13 protease levels fluctuate under different physiological and pathological conditions (41), and as hemostatically active large VWF multimers are present in normal individuals, it appears that a regulatory mechanism that controls the interaction between circulating large VWF multimers and platelets would be necessary to prevent the TTP-like thrombotic and hemostatic disorders in normal circulation. In this respect, although it has been thought that the ligand-binding function of GPIb-IX is not regulated in platelets, we have recently found that intracellular changes in GPIb-IX such as cytoskeletal association may affect the VWF-binding functions of GPIb-IX (38). In this study, we show that the VWF-binding function of GPIb-IX is regulated in addition by the PKA-mediated phosphorylation of GPIb at Ser¹⁶⁶, indicating that VWF binding to GPIb-IX is not only controlled by VWF conformation but is also regulated by the cAMP-mediated intracellular signal. This dual regulation of ligand-receptor interaction may reflect the requirement to tightly control the VWF-binding function of GPIb-IX to prevent TTP-like disorders in the normal circulation.

It is not clear how phosphorylation of GPIb regulates the ligand-binding function of GPIb-IX. There are several possible mechanisms. First, Ser¹⁶⁶ is a key residue in a 14-3-3 binding motif, and phosphorylation at Ser¹⁶⁶ has been reported to up-regulate 14-3-3 binding to the 14-3-3 binding sequence in GPIb (17, 18). Interestingly, a truncation mutation of GPIb that lacked the C-terminal 16 residues including the 14-3-3 binding site showed similarly enhanced VWF binding and showed an enhanced transient cell adhesion compared with wild type GPIb-IX-expressing cells (Figs. 4 and 6). This suggests that this region of GPIb is important in the negative regulation of GPIb-IX-dependent cell adhesion to the immobilized VWF. It is therefore possible that the interaction of 14-3-3 with the cytoplasmic domain of GPIb may be important in negatively regulating GPIb-IX interaction with VWF, and thus up-regulation of 14-3-3 interaction by Ser¹⁶⁶ phosphorylation would also negatively regulate VWF-binding function. Secondly, it is possible that phosphorylation at Ser¹⁶⁶ directly or indirectly induces a conformational change in the extracellular ligand-binding domain of GPIb. This possibility is consistent with a recent report that an anti-GPIb monoclonal antibody causes inhibition of the ligand-binding function of GPIb-IX (43). Thirdly, as we showed previously that association between GPIb-IX and the membrane skeleton regulates ligand-binding function (38), it is also possible that phosphorylation of GPIb induces reorganization of the GPIb-IX-associated membrane skeleton, which in turn regulates the VWF-binding function of GPIb-IX. Consistent with this hypothesis, it has been shown previously by Fox and Berndt (27) that phosphorylation of GPIb is associated with inhibition of actin polymerization during platelet activation, which may involve the reorganization of GPIb-IX-associated membrane skeletal structure.

The CHO cell model has been extensively used to study the structure and function of GPIb-IX. However, as we showed previously (38) and here, GPIb-IX-expressing CHO cells adhere poorly to human VWF under flow conditions. Our data is consistent with the findings of Cunningham et al. (12) and Cranmer et al. (44) who also showed that CHO cells expressing wild type GPIb-IX adhered poorly to human VWF-coated surfaces under static conditions (in the absence of botrocetin) and rolled poorly on human VWF under high shear rate flow conditions (44). However, a more recent paper by Williamson et al. (45) reported an apparent contradiction between their data and ours as it showed significant adhesion of wild type GPIb-IX-expressing CHO cells to bovine VWF. However, there are two major differences between Williamson's and our studies (and the results of Crammer et al. using human VWF (44)). Williamson et al. (45) examined the interaction of GPIb-IX-expressing cells with bovine VWF, which is similar to the result of Cranmer et al. using bovine VWF (44). In contrast, we (38) and Cranmer et al. (44) showed that wild type GPIb-IX-expressing cells adhere poorly to immobilized human VWF under high shear rate (and static) conditions. It is known that bovine VWF is different from human VWF in that it can bind to human platelet GPIb-IX without requiring any VWF modulation (such as immobilization or ristocetin) (46, 47). This suggests that binding of bovine VWF to human platelets may not be regulated by the physiological regulatory mechanisms relevant to the interaction of human platelets with human VWF (2). There is also a major difference in our flow adhesion assays and those of Williamson et al. (45). In the assay of Williamson et al. (45), GPIb-IX-expressing CHO cells were allowed to interact with the VWF-coated surface under static conditions or at a very low flow rate for 5 min to initiate cell adhesion. The shear rate was then increased, thus in reality reflecting the shear resistance of statically adherent cells. In our assay system, cells flow across the VWF-coated surface at constant high shear rates, which mimics the platelet adhesion process in blood vessels. Under these flow conditions, CHO cells expressing wild type GPIb-IX adhere poorly to VWF. We show that phoshorylation of GPIb at Ser¹⁶⁶ is associated with inhibition of VWF-binding function of GPIb-IX. We also show that almost all wild type GPIb-IX molecules expressed in CHO cells are phosphorylated at Ser¹⁶⁶. These data suggest that PKA-dependent phosphorylation at Ser¹⁶⁶ of GPIb may contribute to the poor VWF-binding function of GPIb-IX in CHO cells. In contrast to CHO cells, phosphorylation of Ser¹⁶⁶ in human platelets is dynamically regulated (Figs. 7 and 8) (27), and a significant percentage (30-50%) of GPIb-IX molecules in platelets is dephosphorylated at Ser¹⁶⁶. Correlated with the presence of dephosphorylated forms of GPIb-IX, ristocetin-induced VWF binding to GPIb-IX is significantly higher in platelets. VWF-binding function of GPIb-IX is also retained in fixed platelets, suggesting that at least a portion of GPIb-IX molecules expressed on platelet surface are in an active state. We show that inhibition of PKA significantly further enhances VWF binding to platelets (Fig. 7), which is associated with dephosphorylation of GPIb. Thus, we speculate that one of the possible mechanisms by which agonists enhance platelet adhesion is to inhibit PKA and thus change the balance between phosphorylated and unphosphorylated forms of GPIb-IX in platelets.

	FOOTNOTES

^* This work was supported by Grant HL62350 from NHLBI, National Institutes of Health.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ A part of this work was done during the tenure of the Established Investigatorship of the American Heart Association.

To whom correspondence should be addressed: Dept. of Pharmacology, University of Illinois at Chicago, 835 S. Wolcott Ave., Chicago, IL 60612. Tel.: 312-355-0237; Fax: 312-996-1225; E-mail: xdu@uic.edu.

Published, JBC Papers in Press, October 1, 2002, DOI 10.1074/jbc.M208329200

	ABBREVIATIONS

The abbreviations used are: VWF, von Willebrand factor; GP, glycoprotein; PKA, cAMP-dependent protein kinase; PKI, PKA inhibitor; CHO, Chinese hamster ovary; PGE₁, prostaglandin E1; pS, phosphorylated serine; BSA, bovine serum albumin; PBS, phosphate-buffered saline; FITC, fluorescein isothiocyanate; PRP, platelet-rich plasma; TTP, thrombotic thrombocytopenic purpura; PGI₂, prostaglandin I₂.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				F.-T. Mu, R. K. Andrews, J. F. Arthur, A. D. Munday, S. L. Cranmer, S. P. Jackson, F. C. Stomski, A. F. Lopez, and M. C. Berndt A functional 14-3-3{zeta}-independent association of PI3-kinase with glycoprotein Ib{alpha}, the major ligand-binding subunit of the platelet glycoprotein Ib-IX-V complex Blood, May 1, 2008; 111(9): 4580 - 4587. [Abstract] [Full Text] [PDF]

				H. Yin, A. Stojanovic, N. Hay, and X. Du The role of Akt in the signaling pathway of the glycoprotein Ib-IX induced platelet activation Blood, January 15, 2008; 111(2): 658 - 665. [Abstract] [Full Text] [PDF]

				E. E. Gardiner, D. Karunakaran, J. F. Arthur, F.-T. Mu, M. S. Powell, R. I. Baker, P. M. Hogarth, M. L. Kahn, R. K. Andrews, and M. C. Berndt Dual ITAM-mediated proteolytic pathways for irreversible inactivation of platelet receptors: de-ITAM-izing Fc{gamma}RIIa Blood, January 1, 2008; 111(1): 165 - 174. [Abstract] [Full Text] [PDF]

				S.-Z. Luo, X. Mo, V. Afshar-Kharghan, S. Srinivasan, J. A. Lopez, and R. Li Glycoprotein Ib{alpha} forms disulfide bonds with 2 glycoprotein Ib{beta} subunits in the resting platelet Blood, January 15, 2007; 109(2): 603 - 609. [Abstract] [Full Text] [PDF]

				X. Mo, N. Lu, A. Padilla, J. A. Lopez, and R. Li The Transmembrane Domain of Glycoprotein Ibbeta Is Critical to Efficient Expression of Glycoprotein Ib-IX Complex in the Plasma Membrane J. Biol. Chem., August 11, 2006; 281(32): 23050 - 23059. [Abstract] [Full Text] [PDF]

				K. Dai, R. Bodnar, M. C. Berndt, and X. Du A critical role for 14-3-3{zeta} protein in regulating the VWF binding function of platelet glycoprotein Ib-IX and its therapeutic implications Blood, September 15, 2005; 106(6): 1975 - 1981. [Abstract] [Full Text] [PDF]

				A. Kasirer-Friede, M. R. Cozzi, M. Mazzucato, L. De Marco, Z. M. Ruggeri, and S. J. Shattil Signaling through GP Ib-IX-V activates {alpha}IIb{beta}3 independently of other receptors Blood, May 1, 2004; 103(9): 3403 - 3411. [Abstract] [Full Text] [PDF]

				D. S. Sim, G. Merrill-Skoloff, B. C. Furie, B. Furie, and R. Flaumenhaft Initial accumulation of platelets during arterial thrombus formation in vivo is inhibited by elevation of basal cAMP levels Blood, March 15, 2004; 103(6): 2127 - 2134. [Abstract] [Full Text] [PDF]

				J. M. Woodcock, J. Murphy, F. C. Stomski, M. C. Berndt, and A. F. Lopez The Dimeric Versus Monomeric Status of 14-3-3{zeta} Is Controlled by Phosphorylation of Ser58 at the Dimer Interface J. Biol. Chem., September 19, 2003; 278(38): 36323 - 36327. [Abstract] [Full Text] [PDF]

				C. Perrault, P. Mangin, M. Santer, M.-J. Baas, S. Moog, S. L. Cranmer, I. Pikovski, D. Williamson, S. P. Jackson, J.-P. Cazenave, et al. Role of the intracellular domains of GPIb in controlling the adhesive properties of the platelet GPIb/V/IX complex Blood, May 1, 2003; 101(9): 3477 - 3484. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/49/47080    most recent M208329200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Bodnar, R. J. Articles by Du, X. Search for Related Content PubMed PubMed Citation Articles by Bodnar, R. J. Articles by Du, X. Social Bookmarking                      What's this?