Originally published In Press as doi:10.1074/jbc.M208329200 on October 1, 2002
J. Biol. Chem., Vol. 277, Issue 49, 47080-47087, December 6, 2002
Regulation of Glycoprotein Ib-IX-von Willebrand Factor
Interaction by cAMP-dependent Protein Kinase-mediated
Phosphorylation at Ser 166 of Glycoprotein Ib
*
Richard J.
Bodnar
,
Xiaodong
Xi
,
Zhenyu
Li
,
Michael C.
Berndt§, and
Xiaoping
Du
¶
From the
Department of Pharmacology, University of
Illinois, College of Medicine, Chicago, Illinois 60612 and the
§ Department of Biochemistry and Molecular Biology, Monash
University, Clayton, VIC 3168, Australia
Received for publication, August 14, 2002, and in revised form, September 26, 2002
 |
ABSTRACT |
The platelet receptor for von Willebrand factor
(VWF), glycoprotein (GP) Ib-IX, mediates initial platelet adhesion and
activation. It is known that the cytoplasmic domain of GPIb
is
phosphorylated at Ser166 by
cAMP-dependent protein kinase (PKA). To understand the
physiological role of GPIb
phosphorylation, a GPIb-IX mutant
replacing Ser166 of GPIb
with alanine (S166A) and a
deletion mutant lacking residues 166-181 of GPIb
(
165) were
constructed. These mutants, expressed in Chinese hamster ovary (CHO)
cells, showed an enhanced VWF-binding function compared with wild type
GPIb-IX. Treatment of CHO cells expressing wild type GPIb-IX with a PKA
inhibitor, PKI, reduced Ser166 phosphorylation and also
enhanced VWF binding to GPIb-IX. Furthermore, cells expressing S166A or
165 mutants showed a significantly enhanced adhesion to immobilized
VWF under flow conditions. Consistent with the studies in CHO cells,
treatment of platelets with PKI enhanced VWF binding to
platelets. In contrast, a PKA stimulator, forskolin, reduced VWF
binding and VWF-induced platelet agglutination, which was reversed by
PKI. Thus, PKA-mediated phosphorylation of GPIb
at
Ser166 negatively regulates VWF binding to GPIb-IX and is
one of the mechanisms by which PKA mediates platelet inhibition.
 |
INTRODUCTION |
Platelet adhesion and activation play critical roles in thrombosis
and hemostasis. Under high shear rate flow conditions, initial platelet
adhesion is mediated by the binding of the platelet von Willebrand
Factor (VWF)1 receptor, the
glycoprotein (GP) Ib-IX-V complex, to subendothelial-bound VWF (1, 2).
The GPIb-IX-VWF interaction also initiates an intracellular signaling
cascade leading to platelet shape change, spreading, secretion, and
aggregation (3-7).
The GPIb-IX-V complex is composed of four type I transmembrane
polypeptide chains, GPIb
, GPIb
, GPIX, and GPV (1, 8). GPIb
and
GPIb
are covalently linked through a disulfide bond to form GPIb.
GPIX is non-covalently associated with GPIb in a 1:1 ratio, and the
GPIb-IX complex is non-covalently associated with GPV in a 2:1 ratio
(1, 8). Expression of the GPV polypeptide is not required for surface
expression or the ligand-binding function of the GPIb-IX complex (9).
The extracellular domain of GPIb
contains binding sites for VWF and
-thrombin (1, 8). The cytoplasmic domain of GPIb
contains binding
sites for filamin (also called ABP-280) between residues 536 and 579 (10-12), linking the GPIb-IX complex to F-actin structures underlining
the plasma membrane. The cytoplasmic domain of GPIb
also contains a
binding site for the signaling molecule 14-3-3
located between
residues 595 and 610 (13, 14). Phosphorylation of GPIb
at
Ser609 is required for high affinity binding of 14-3-3
to GPIb
(15). 14-3-3
has been shown to be involved in
GPIb-IX-mediated activation of the integrin
IIb
3 (6). The cytoplasmic domain of
GPIb
has been found to interact with calmodulin between residues 149 and 167 (16). GPIb
has also been found to interact with 14-3-3
(17, 18) and is phosphorylated at Ser166 by PKA
(19-21).
It is known that platelet activation (including VWF-induced platelet
activation) is inhibited by compounds that increase the intracellular
concentration of cAMP such as prostaglandin E1 (PGE1) and
forskolin (6, 22, 23). Elevation of intracellular cAMP levels induces
the activation of PKA. The mechanism by which PKA inhibits platelets is
not totally understood but is known to involve phosphorylation of
multiple intracellular signaling proteins and regulation of multiple
signaling pathways. For example, cAMP has been implicated in inhibiting
Ca2+ influx (24) and phospholipase C activation (25), as
well as inhibition of G protein-coupled receptor signaling pathways (26). One of the major PKA substrates in platelets is GPIb
(19-21).
cAMP-elevating agents have been shown to induce GPIb
phosphorylation
at Ser166 (21). In a study by Fox and Berndt (27), PKA
mediated inhibition of actin polymerization during collagen-induced
platelet activation in wild type platelets but not in GPIb-IX-deficient
platelets from Bernard-Soulier syndrome patients. This suggests that
GPIb-IX and possibly PKA-mediated phosphorylation of GPIb
are
important in PKA-mediated inhibition of actin polymerization. However,
it is not clear if, and how, PKA-mediated GPIb
phosphorylation
affects GPIb-IX function.
In this study, we have examined the role of phosphorylation of GPIb
at Ser166 in regulating the receptor function of GPIb-IX.
We show that wild type GPIb-IX phosphorylated at Ser166
poorly interacts with VWF. A point mutation that changes
Ser166 of GPIb
to alanine disrupts Ser166
phosphorylation and enhances the VWF-binding function of GPIb-IX. Furthermore, activation of PKA increases GPIb
phosphorylation in
platelets and inhibits VWF binding to GPIb-IX, whereas inhibition of
PKA inhibits GPIb
phosphorylation and enhances VWF binding. Thus,
PKA-mediated phosphorylation of GPIb
at Ser166
negatively regulates the VWF-binding function of GPIb-IX.
 |
MATERIALS AND METHODS |
Reagents--
Monoclonal antibodies, SZ29 against VWF and SZ2
against GPIb
, were generous gifts from Dr. Changgeng Ruan (Suzhou
Medical College, Suzhou, China) (28, 29). cDNA clones encoding wild type GPIb
, GPIb
, and GPIX were generous gifts provided by Dr. Jose Lopez (Baylor College of Medicine, Houston, TX) (30-32). Human VWF was purified from cryoprecipitates as described previously (33).
Botrocetin was also purified as previously described (34). Ristocetin,
forskolin, and dimethyl sulfoxide (Me2SO) were
purchased from Sigma. The membrane-permeable PKA inhibitor,
myristoylated PKI, was purchased from Calbiochem (San Diego, CA).
Cell Lines Expressing Recombinant Proteins--
Transfection of
cDNA into CHO cells was performed according to the LipofectAMINE
Plus (Invitrogen) protocol. In short, CHO cells were plated at
5.25 × 105 cells/60 mm dish then cultured overnight
at 37 °C in 5% CO2. The DNA/LipofectAMINE mixture was
added to the CHO cells and incubated for 6 h. at 37 °C in 5%
CO2. Stably transfected cell lines were selected using
selection media containing 0.5 mg/ml G418 and further selected by cell
sorting using the anti-GPIb
monoclonal antibody, SZ2. The following
cell lines were used: cells expressing wild type GPIb-IX (1b9) (6);
GPIb-IX mutants with the cytoplasmic domain of GPIb
truncated at
residue 165, lacking amino acids 166-181 (
165); or a serine to
alanine point mutation at Ser166 in GPIb
(S166A). For
construction of the GPIb
mutants
165 and S166A, DNA fragments
were synthesized by PCR using wild type GPIb
in the pcDNA3.1(
)
vector, as the template. For the construction of the
165 GPIb
mutant, the oligonucleotide GGGTCGGTACCTTACACGCGGGCTGCG was used as the
reverse primer and CCCTACCGCGACCTGCGTTG was used as the forward primer.
These fragments were digested with NotI and KpnI
then ligated with GPIb
in pcDNA3.1(
) vector digested with the
same enzymes. For the construction of the GPIb
S166A mutant, two DNA
fragments were synthesized by PCR using the oligonucleotides CCCTACCGCGACCTGCGTTG as the forward and TCAGTGCCAGCCGGGCTG as the
reverse for the 5'-fragment and AGCCCGGCTGGCACTGAC as the forward and
TAGAAGGCACAGTCGAGG as the reverse for the 3'-fragment using wild type
GPIb
in the vector pcDNA3.1(
) as template. The two PCR
products (containing a 17-base pair overlap) were combined with the
oligonucleotides CCCTACCGCGACCTGCGTTG as the forward and
TAGAAGGCACAGTCGAGG as the reverse and amplified using the following
cycling conditions: 94 °C × 5 min, 45 °C × 1 min,
72 °C × 1 min, 94 °C × 1 min for 5 cycles followed by
55 °C × 1 min, 72 °C × 1 min, 94 °C × 1 min
for 25 cycles, and a final cycle of 55 °C × 1 min,
72 °C × 5 min. The final product was digested with
NotI and KpnI, then ligated with GPIb
in
pcDNA3.1(
) vector digested with the same enzymes. The mutant
GPIb
was sequenced in both the forward and reverse directions to
verify the nucleotide sequence.
An Antibody Against the Phosphopeptide Corresponding to the
Cytoplasmic Domain of GPIb
--
GPIb
peptides, RAAARL(pS)LTDPLV
(pS indicates phosphorylated serine) and RAAARLSLTDPLV, containing an
N-terminal cysteine were synthesized by Chiron Mimotopes
(Melbourne, Australia). The anti-phospho-GPIb
(GPIb
-P)
antibody was raised by immunizing New Zealand White rabbits with the
phosphorylated CRAAARLpSLTDPLV peptide conjugated to keyhole limpet
hemocyanin (Sigma) (35). The anti-peptide antibody was affinity
purified with the immunizing peptide conjugated to BSA and coupled on a
1:1 column of Affi-Gel 10/15 (Bio-Rad). The antibody was then absorbed
with the nonphosphorylated CRAAARLSLTDPLV peptide conjugated to BSA,
also coupled on a 1:1 column of Affi-Gel 10/15 (Bio-Rad). The
specificity of the anti-GPIb
-P antibody was verified by dot
immunoblots against the CRAAARL(pS)LTDPLV and CRAAARLSLTDPLV
peptides conjugated to albumin (1:10 w/w). Antibody reactivity was
visualized using a horseradish peroxidase-conjugated goat anti-rabbit
IgG and enhanced chemiluminescence kit (Amersham Biosciences).
Flow Cytometric Analysis of VWF Binding to GPIb-IX-expressing
Cells and Platelets--
CHO cells expressing wild type (1b9) and
mutant GPIb-IX (
165 and S166A) were grown to confluence to
synchronize cell growth. The cells were detached using 0.5 mM EDTA in PBS, pH 7.4. Seventy-five percent of the
original volume was then resuspended in Dulbecco's modified Eagle's
medium growth media and cultured for 18 h. The cells were
detached using 0.5 mM EDTA-PBS, pH 7.4, then resuspended in
Tyrode's buffer (2.5 mM Hepes, 12.1 mM
NaHCO3, 2.36 mM KCl, 0.136 M NaCl,
1 mM CaCl2, 1 mM MgCl, 0.1%
D-glucose, pH 7.4) with 1% BSA to a
concentration of 2.25 × 106 cells/ml. The cells were
incubated at 4 °C for 30 min, then ristocetin (1.25 mg/ml) and
purified VWF (35 µg/ml) were added and incubated at 22 °C for 30 min. The cells were washed once with Tyrode's buffer, further
incubated in Tyrode's buffer containing 10 µg/ml FITC-labeled SZ-29
(monoclonal antibody against VWF) in the dark at 22 °C for 30 min
and then analyzed by flow cytometry. As negative controls, cells were
incubated in the presence of VWF alone or ristocetin alone then
incubated with FITC-labeled SZ29. Nonspecific fluorescence was
identical for either treatment (data not shown). The 1b9 cells were
also preincubated with or without 50 µM PKI for 15 min or
2 µM forskolin for 5 min at 22 °C, prior to analysis for VWF binding.
The preparation of washed platelets was as described previously (36).
Briefly, blood was drawn from healthy donors with no medication within
2 weeks, and anti-coagulated with 1/7 volume of ACD (2.5% trisodium
citrate (w/v), 2.0% d-Glucose (w/v), 1.5% citric acid (w/v)).
Platelet-rich plasma (PRP) was separated by centrifuging at 300 × g for 25 min. Platelets were washed two times in CGS buffer
(0.123 M NaCl, 0.033 M D-Glucose,
0.013 M trisodium citrate, pH 6.5) and were not exposed to
cAMP-enhancing agents such as PGE1 and prostaglandin
I2 (PGI2). The washed platelets were
resuspended in modified Tyrode's buffer to a concentration of 1.0 × 107 cells/ml and treated with or without 100 µM of PKI at 37 °C for 15 min. The platelets were
further incubated with forskolin (2 µM final
concentration) or Me2SO (0.1% final concentration, vehicle control) at 22 °C for 10 min, then incubated with 1 mM
RGDS peptide (an integrin inhibitor), 5 µg/ml botrocetin, and
35 µg/ml VWF at 22 °C for 30 min. VWF binding was detected as
described above for CHO cells.
Cell Adhesion under Flow--
Purified human VWF was diluted to
a final concentration of 50 µg/ml with 0.1 mM
NaHCO3, pH 8.3, and coated onto glass cover slides (22 × 40
1, Fisher) overnight in a humid environment at 4 °C. The
cover slides were washed with PBS to remove unbound VWF, blocked with
5% BSA in PBS at room temperature for 2 h, and installed in a
parallel flow chamber (Model RC-30, Warner Instruments Inc., Hamden,
CT) with a silicon rubber gasket. The chamber has a depth of 0.075 mm,
a width of 3 mm, and a length of 35 mm. The cells suspended in modified
Tyrode's buffer containing 5% bovine serum albumin (5 × 106 cells/ml) were perfused by a syringe pump (Harvard
Apparatus Inc., Holliston, MA) into the flow chamber at various shear
rates for 2 min. Transient adhesion (rolling) of cells on the
VWF-coated surface was recorded on video tapes. Shear rate was
calculated as described by Slack and Turitto (37). Transient adherent
cells were counted in 10 randomly selected fields of 0.18 mm2 at randomly selected time points during the perfusion period.
Platelet Agglutination--
Whole blood was anti-colaguated with
0.38% sodium citrate, then centrifuged at 350 × g for
25 min and PRP obtained as previously described (38). The PRP was
preincubated with RGDS (1 mM) and PKI (100 µM) for 10 min at 22 °C or forskolin (2 µM) at 22 °C for 5 min. VWF-dependent
platelet agglutination was induced by the addition of ristocetin (1.25 mg/ml) to the PRP. Platelet agglutination was measured using a
turbidometric platelet aggregometer at 37 °C with a stirring speed
of 1000 rpm.
Immunoprecipitation and Immunodepletion of Phosphorylated
GPIb
--
The preparation of washed platelets was as described
above (36), and were not exposed to cAMP-enhancing agents such as
PGE1 and PGI2. Washed platelets were
resuspended in Tyrode's buffer containing 0.1% BSA to a concentration
of 1 × 109 cells/ml and incubated at 37 °C for 30 min. CHO cells expressing wild type Ib-IX (1b9 cells) were detached
with 0.5 mM EDTA-PBS, pH 7.4, then resuspended in Tyrode's
buffer containing 0.1% BSA to a concentration of 5.0 × 107 cells/ml. The cells were solubilized with an equal
volume of solubilization buffer (0.1 M Tris, 0.01 M EGTA, 0.15 M NaCl, 2% Triton X-100, pH 7.4)
containing 0.2 mM E64 (calpain inhibitor, Roche Molecular
Biochemicals), 2 mM phenylmethylsulfonylfluoride (Sigma),
and 0.08 units/ml Aprotinin (Sigma) and incubated on ice for 10 min.
The lysate was centrifuged at 100,000 × g for 30 min
at 4 °C. The supernatant (100 µl) was incubated with rabbit IgG or
purified anti-GPIb
-P antibody (5 µg) at 4 °C for 30 min then
further incubated for 30 min after the addition of 25 µl (50% v/v)
of Protein A-conjugated Sepharose beads (Amersham Biosciences). The
beads were separated from the supernatant by centrifugation. To
quantitate the unphosphorylated GPIb
in the platelet lysate, the
phosphorylated GPIb
was depleted by repeated immunoprecipitation with anti-GPIb
-P antibody. The immunoprecipitates were combined then
washed three times with wash buffer (0.1 M Tris, pH 7.4, 0.15 M NaCl, 10 mM EGTA, 1% Triton X-100).
Both the platelet lysates depleted of phosphorylated GPIb
and
immunoprecipitates were diluted to an identical final volume with SDS
sample buffer containing 5%
-mercaptoethanol and Western blotted
with anti-GPIb
antibody, SZ2, to detect the GPIb-IX containing
unphosphorylated GPIb
. The results were visualized with enhanced
chemiluminescence (Amersham Biosciences).
 |
RESULTS |
Phosphorylation-deficient Mutants of GPIb
--
To investigate
the roles of phosphorylation of GPIb
in regulating the functions of
GPIb-IX, a conserved point mutation was made in GPIb
that replaces
Ser166 with alanine (Fig. 1).
A truncation mutation was also made that deleted the C-terminal 16 residues of GPIb
including Ser166. This deletion
includes the reported 14-3-3 binding site in GPIb
(Fig. 1). Each of
these mutants was co-transfected with GPIb
and GPIX cDNAs into
CHO cells, and stable cell lines expressing these GPIb-IX mutants were
established.

View larger version (16K):
[in this window]
[in a new window]
|
Fig. 1.
Phosphorylation-deficient mutants of
GPIb . The schematic
illustrates the mutations made in the cytoplasmic domain of GPIb .
The mutant 165 is a truncation mutant lacking the C-terminal amino
acids 166-181 (including Ser166 and the reported 14-3-3 binding site). The S166A mutant is a conservative mutation changing
Ser166 to alanine, eliminating phosphorylation at this
site.
|
|
An Anti-GPIb
Antibody Specifically Recognizes Phosphorylated
Ser166--
To determine whether the above mentioned
mutations abolished Ser166 phosphorylation in GPIb-IX, and
to investigate the phosphorylation of Ser166 in regulating
GPIb-IX function, an anti-peptide antibody was developed using a
synthetic peptide corresponding to the RAAARL(pS)LTDPLV sequence of the
cytoplasmic domain of GPIb
with Ser166 phosphorylated.
This antibody (anti-GPIb
-P) reacted specifically with the
phosphorylated peptide RAAARL(pS)LTDPLV but did not react with the
corresponding non-phosphorylated peptide RAAARLSLTDPLV (Fig.
2A), indicating the
anti-GPIb
-P antibody recognizes the GPIb
cytoplasmic domain
sequence only when Ser166 is phosphorylated. To examine
whether anti-GPIb
-P specifically recognizes phosphorylated GPIb
in platelets, platelets were solubilized and immunoblotted with
anti-GPIb
-P. Anti-GPIb
-P antibody specifically reacted with a
protein of molecular mass, 24 kDa, corresponding to GPIb
(Fig. 2B), which is also immunoblotted by a previously characterized antibody specific for the C-terminal domain of GPIb
(anti-Ib
C) (14). Furthermore, preincubation of platelets with a
specific PKA inhibitor, PKI, dramatically inhibited the reactivity of
anti-GPIb
-P with GPIb
. In contrast, treatment of platelets with
the PKA activator, forskolin, enhanced the binding of anti-GPIb
-P to
GPIb
(Fig. 2B). These results demonstrate that
anti-GPIb
-P specifically recognizes GPIb
only when
Ser166 is phosphorylated. To determine whether GPIb
expressed in CHO cells was phosphorylated, and whether the above
described mutants of GPIb-IX are phosphorylation-deficient, the lysates
from wild type and mutant GPIb-IX-expressing cells were immunoblotted
with anti-GPIb
-P. Fig 2C shows that anti-GPIb
-P
reacted with the wild type GPIb
expressed in 1b9 cells but failed to
react with GPIb
from the S166A or
165 mutant cells. Thus, wild
type GPIb
expressed in CHO cells is phosphorylated at
Ser166, but the S166A and the
165 mutants are
phosphorylation-deficient at Ser166. These data also
further demonstrate that anti-GPIb
-P antibody is specific for
phosphorylated Ser166.

View larger version (50K):
[in this window]
[in a new window]
|
Fig. 2.
Specific binding of
anti-GPIb -P to phosphorylated
Ser166 peptide corresponding to the C-terminal sequence of
GPIb . A, the synthetic
phosphopeptide, CRAAARLpSLTDPLV, or equivalent nonphosphorylated
peptide, CRAAARLSLTDPLV, were conjugated to BSA and dot blotted onto
nitrocellulose. As a control, BSA was also applied to the
nitrocellulose membrane. Purified anti-GPIb -P antibody was incubated
with the nitrocellulose for 2 h at 22 °C. After further
incubation with horseradish peroxidase-conjugated goat anti-rabbit IgG,
bound antibody was detected using enhanced chemiluminescence. Note that
the anti-GPIb -P antibody specifically recognized the phosphorylated
peptide but not the nonphosphorylated peptide nor BSA. B,
washed resting platelets were incubated with Me2SO (0.05%,
Control), membrane-permeable PKI (100 µM), or
forskolin (2 µM) for 1 h at 37 °C then
solubilized as described under "Materials and Methods." The lysates
were immunoblotted using the anti-GPIb -P antibody (left
panel) or the anti-Ib C antiserum (14) (right
panel) directed against the nonphosphorylated GPIb C-terminal
sequence. C, CHO cells expressing wild type GPIb-IX (1b9),
the GPIb C-terminal domain deletion mutant 165, and the
Ser166 to Ala point mutant (S166A) were resuspended in
modified Tyrode's buffer and then solubilized as described under
"Materials and Methods." The lysate was immunoblotted with the
anti-GPIb -P antibody.
|
|
VWF Binding to GPIb-IX Is Regulated through GPIb
Phosphorylation--
To examine whether phosphorylation at
Ser166 of GPIb
plays a role in regulating the
VWF-binding function of GPIb-IX, cells expressing wild type GPIb-IX
(1b9) and the S166A mutant were incubated with increasing
concentrations of soluble human VWF in the presence of ristocetin, a
modulator that induces VWF binding to GPIb-IX. The S166A mutant
demonstrated significantly increased VWF binding compared with 1b9
cells (Fig. 3A). This
increased VWF binding to the S166A mutant was not caused by differences
in GPIb-IX expression level, as the expression levels of the two cell
lines were comparable (Fig. 3B). Furthermore, the VWF
binding data shown in Fig. 3A was corrected relative to the
ratio of the expression levels between the two cell lines. Thus, the
mutant S166A showed an increased VWF-binding function. We also examined
VWF binding to cells expressing the
165 mutant (
165). The
165
mutant, lacking the C-terminal cytoplasmic residues 166-181 of
GPIb
, also showed an increase in ristocetin-induced VWF binding in a
manner that is similar to the S166A mutant (Fig.
4). Thus, disruption of
Ser166 phosphorylation in GPIb
or deletion of the
phosphorylation site of GPIb
enhanced the VWF-binding function of
GPIb-IX.

View larger version (29K):
[in this window]
[in a new window]
|
Fig. 3.
VWF binding to the S166A mutant of
GPIb-IX. A, CHO cells expressing wild type GPIb-IX
(1b9) or the GPIb mutant S166A (Ser to Ala mutation) were incubated
in the presence of 1.25 mg/ml ristocetin and an increasing
concentration of purified human VWF at 22 °C for 30 min. Bound VWF
was detected using a FITC-labeled anti-VWF monoclonal antibody (SZ29)
and analyzed by flow cytometry as described under "Materials and
Methods." The fluorescence intensity (geomean) of VWF binding was
corrected for the ratio of the GPIb-IX expression levels between the
two cell lines as determined in B. Shown in the figure are
data from three separate experiments (mean ± S.D.). B,
the surface expression levels of GPIb-IX on CHO cells expressing wild
type GPIb-IX (1b9) and the S166A mutant were analyzed by flow cytometry
after incubation with 20 µg/ml of the anti-GPIb monoclonal
antibody SZ2 followed by FITC-labeled goat anti-mouse IgG
antibody.
|
|

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 4.
VWF-binding to 165
mutant of GPIb-IX. CHO cells expressing wild type GPIb-IX (1b9)
and mutant 165 (lacking residues 166-181) were incubated with 35 µg/ml of human VWF in the presence of 1.25 mg/ml ristocetin or with
ristocetin alone. VWF binding was detected with the FITC-labeled
anti-VWF monoclonal antibody, SZ29, and analyzed by flow cytometry. The
cells were also analyzed for surface expression of GPIb-IX using an
anti-GPIb (SZ2) monoclonal antibody followed by a FITC-labeled goat
anti-mouse antibody and analyzed by flow cytometry. The fluorescence
intensity (geomean) of VWF binding was corrected for the ratio of the
GPIb-IX expression levels between the two cell lines (1b9/ 165 = 1/1.37). Shown in the figure are the results from 3 separate
experiments (mean ± S.D.).
|
|
In platelets, GPIb
is phosphorylated by PKA (20, 21). To determine
whether PKA in CHO cells is also responsible for phosphorylation of
GPIb
and the negative regulation of VWF-binding function, we
examined the effects of a specific PKA inhibitor, PKI, on GPIb
phosphorylation and on VWF-binding function of GPIb-IX in CHO cells
expressing wild type GPIb-IX (1b9). Fig.
5A shows that the phosphorylation level of wild type GPIb
is reduced by PKI treatment. Coincident with the reduced GPIb
phosphorylation, VWF binding to 1b9
cells was enhanced by PKI treatment (Fig. 5B), in a manner similar to the increased VWF binding in the S116A mutant lacking the
PKA-phosphorylation site of GPIb
(Fig. 5C). The
increased VWF binding to the S166A mutant, however, was not inhibited
by the PKA activator forskolin (Fig. 5C). Taken together,
these data indicate that VWF-binding function of GPIb-IX is negatively
regulated by PKA-mediated phosphorylation of GPIb
in this CHO cell
model.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 5.
Inhibition of PKA enhances VWF binding to
GPIb-IX in CHO cells. A, 1b9 cells were resuspended in
Tyrode's buffer then incubated with 50 µM PKI or 2 µM forskolin or 0.1% Me2SO
(Control), solubilized, and then immunoblotted with the
anti-GPIb -P antibody to detect GPIb phosphorylation at
Ser166 or with the anti-Ib C antibody to detect total
GPIb . The relative quantity of phosphorylated GPIb in 1b9 cells
was determined by scanning the protein bands and analyzing band density
using NIH Image (mean ± S.D., n = 3). The results
are expressed as percent change from the control. B, 1b9
cells were preincubated without or with 50 µM PKI for 15 min at 22 °C then allowed to bind VWF (35 µg/ml) in the presence
of ristocetin (1.25 mg/ml). As a negative control, cells were incubated
with ristocetin alone in the absence of VWF. VWF binding was detected
using the anti-VWF antibody SZ29 by flow cytometry as described under
"Materials and Methods." Note that PKI treatment enhanced VWF
binding. C, S166A cells were pre-incubated with 2 µM forskolin or 0.2% Me2SO (vehicle) for 5 min at 22 °C then allowed to incubate with ristocetin in the absence
(Control) or presence of VWF. Binding of VWF was detected by
flow cytometry as described in B.
|
|
Effects of Ser166-deficient Mutations on Cell Adhesion
to VWF under Flow--
GPIb-IX binding to VWF mediates transient
adhesion (or rolling) of platelets on subendothelial-bound VWF under
flow conditions. We therefore examined whether the
165 and S166A
mutants of GPIb-IX also affect GPIb-IX-dependent cell
adhesion to VWF under flow conditions. As controls, we also examined
adhesion of these cell lines to BSA-coated surfaces. No cells from the
mutant GPIb-IX-expressing cell lines or from the wild type GPIb-IX cell
line adhered to BSA-coated surface at shear rates above 1080 s
1. As reported previously, wild type GPIb-IX-expressing
cells adhered poorly on a VWF-coated surface. At a shear rate of 1080 s
1 or higher, no 1b9 cells were seen to roll on the
VWF-coated surface (Fig. 6). In contrast,
both the S166A and
165 mutant cells showed transient adhesion on the
VWF-coated surface (Fig. 6). Interestingly, the truncation mutant
165 showed a greater increase in adhesion compared with the S166A
mutant at 1080 s
1 shear rate. Although the reason for
this difference remains to be investigated, it may be relevant that the
165 mutant not only lacks the phosphorylation site at
Ser166 but also lacks the entire C-terminal domain
containing the reported 14-3-3 binding site in GPIb
. Thus,
phosphorylation at Ser166 of GPIb
negatively regulates
cell adhesion and rolling on immobilized VWF under flow conditions, and
in addition to Ser166 phosphorylation, the C-terminal
domain of GPIb
containing the previously reported 14-3-3 binding
site may also be important in negatively regulating GPIb-IX
function.

View larger version (14K):
[in this window]
[in a new window]
|
Fig. 6.
Effects of GPIb mutations on
GPIb-IX-dependent transient cell adhesion to VWF under flow
conditions. Wild type GPIb-IX-expressing cells (1b9) and GPIb
mutant cells, S166A and 165, were perfused into a VWF-coated
parallel plate flow chamber at the indicated shear rates as described
under "Materials and Methods." Transient adhesion (rolling)
of these cells was recorded using a videotape recorder. The number of
rolling cells was counted in randomly selected fields of 0.18 mm2. Each field was evaluated for 10 s. The results
shown are the mean ± S.D. of cell counts/mm2
(n = 10). Statistical analysis revealed that the
difference between 1b9 cells and the two mutant cell lines are
significant (p < 0.01 in both cases). These cell lines
were also perfused into BSA-coated parallel plate flow chamber.
Transient adherent cells on BSA-coated surface are zero for all of
three cell lines.
|
|
Negative Regulation of VWF Binding to GPIb-IX by PKA-mediated
Phosphorylation in Human Platelets--
We showed above that the
VWF-binding function of GPIb-IX is negatively regulated by
PKA-dependent GPIb-IX phosphorylation at Ser166
in CHO cells. To verify whether PKA also negatively regulates the
VWF-binding function of GPIb-IX in platelets, platelets were preincubated with PKI or forskolin and then allowed to bind soluble VWF
in the presence of botrocetin. The integrin inhibitor, RGDS, was added
to all reactions to exclude any role of integrin
IIb
3 in VWF binding. Treatment of
platelets with PKI significantly increased VWF binding to platelets
compared with control untreated platelets (Fig.
7A). This increase was not due
to the activation of the integrin
IIb
3
because the platelets were preincubated with the integrin inhibitor,
RGDS. On the other hand, incubation with forskolin induced a decrease
in VWF binding (Fig. 7A). When the platelets were
preincubated with PKI and then incubated with forskolin, PKI was able
to reverse the inhibitory effects of forskolin (Fig. 7B).
Furthermore, to examine if PKA negatively regulates GPIb-IX-mediated
agglutination, PRP was preincubated with PKI in the presence or absence
of forskolin. Platelet agglutination was induced by the addition of
ristocetin in the presence of the integrin inhibitor, RGDS. Incubation
of PRP with forskolin induced a decrease in GPIb-IX-mediated
agglutination (Fig. 7C). When PRP was preincubated with PKI
prior to addition of forskolin, the inhibitory effects of forskolin on
ristocetin-induced platelet agglutination was reversed (Fig.
7C), indicating that PKA negatively regulates
GPIb-IX-dependent platelet agglutination. In parallel with
their effects on VWF binding, PKI induced a significant decrease in the
phosphorylation of GPIb
at Ser166, and forskolin induced
a significant increase in GPIb
phosphorylation (Fig. 7D).
These data are consistent with PKA-induced phosphorylation of GPIb
negatively regulating GPIb-IX-VWF interaction.

View larger version (51K):
[in this window]
[in a new window]
|
Fig. 7.
PKA-mediated phosphorylation of
GPIb negatively regulates VWF binding to
GPIb-IX in platelets. A, washed resting platelets (1.0 × 109 cells/ml) in modified Tyrode's buffer were
preincubated without or with 100 µM PKI (PKI + VWF) for 15 min, 2 µM forskolin
(forskolin + VWF), or 0.1% Me2SO
(VWF) for 10 min at 22 °C and then incubated with VWF (35 µg/ml) in the presence of botrocetin (5 µg/ml). VWF binding was
analyzed as described under "Materials and Methods." B,
washed resting platelets in modified Tyrode's buffer were treated
without (forskolin + VWF) or with 100 µM PKI (PKI + forskolin + VWF) for 15 min at 22 °C and then incubated with 2 µM of forskolin for 10 min at 22 °C. The cells were
then incubated with or without VWF (botrocetin) in the
presence of botrocetin, stained with FITC-labeled SZ29, and analyzed
using flow cytometry. C, PRP was first treated with the
integrin inhibitor RGDS. The RGDS-treated PRP was then preincubated
without or with 100 µM PKI for 10 min and then incubated
with 2 µM forskolin or 0.05% Me2SO for 5 min
at 22 °C. Ristocetin (1.25 mg/ml) was then added to induce
GPIb-IX-mediated agglutination, which was recorded using a platelet
turbidometric aggregometer at 37 °C. D, washed resting
platelets in Tyrode's buffer (1.0 × 109 cells/ml)
were treated with 100 µM PKI or 2 µM
forskolin for 1 h at 37 °C. Platelets were solubilized as
described under "Materials and Methods." The platelet lysate was
immunoblotted using the anti-GPIb -P antibody to detect
phosphorylated GPIb , or using the anti-GPIb antibody to monitor
the level of total GPIb . Levels of phosphorylated GPIb in
platelets were quantitated by scanning the protein bands and analyzing
band density using NIH Image (mean ± S.D., n = 4). The results are shown as percent changes from the control. Slight
loading errors between different samples were corrected using the ratio
of the total amount of GPIb between samples.
|
|
Stoichiometry of GPIb
Phosphorylation in CHO Cells and in
Platelets--
We showed previously (38) and also here (Figs. 3 and 6)
that wild type GPIb-IX expressed in CHO cells poorly bound VWF and poorly adhered to a VWF-coated surface under both static and flow conditions. In contrast, resting platelets bind VWF in the presence of
ristocetin (Fig. 7) and adhere to VWF under high shear rate flow
conditions (39). The regulatory mechanism causing this difference in
the receptor function of GPIb-IX between CHO cells and platelets has
never been satisfactorily explained. As we show here, the VWF-binding
function of GPIb-IX is negatively regulated by PKA-mediated
phosphorylation of GPIb
at Ser166 and enhanced in
Ser166 phosphorylation-deficient mutants expressed in CHO
cells. We hypothesized that one of the mechanisms for the difference
between CHO cells and platelets may result from a difference in the
levels of Ser166 phosphorylation. To investigate this
possibility, we examined the stoichiometry of GPIb
phosphorylation
in resting platelets and in CHO cells. As shown in Fig. 7D,
treatment of washed platelets with forskolin, a PKA activator,
increased the reactivity of anti-GPIb
-P by about 100% in
immunoblots, suggesting that a significant proportion (~50%) of
GPIb
in resting platelets is dephosphorylated at Ser166
(Fig. 7), a result consistent with previously published data (27). In
contrast, forskolin failed to significantly enhance the reactivity of
anti-GPIb
-P with GPIb-IX expressed in CHO cells (Fig. 5), indicating
that GPIb
phosphorylation is near maximal levels. To further compare
the Ser166 phosphorylation between platelets and 1b9 cells,
platelets or 1b9 cells were solubilized, and GPIb-IX in the cell lysate
was immunoprecipitated repeatedly with anti-GPIb
-P to deplete
phosphorylated GPIb
. The phosphorylated GPIb-IX complex
immunoprecipitated with anti-GPIb
-P and the depleted cell lysates
were then analyzed by SDS-PAGE and immunoblotted with a monoclonal
antibody against the extracellular domain of GPIb, SZ-2. In CHO cells,
following repeated immuno-depletion with anti-GPIb
-P, no GPIb was
detected in the cell lysates, suggesting that almost all GPIb-IX
molecules expressed in CHO cells are in the
Ser166-phosphorylated form (Fig.
8B). In contrast, ~35% of
the GPIb remained in the platelet lysate following anti-GPIb
-P
depletion (Fig. 8A). These results demonstrate that there
are two populations of GPIb
in platelets, a
Ser166-phosphorylated form and a
Ser166-dephosphorylated form, and that all GPIb-IX
molecules expressed in CHO cells are phosphorylated at
Ser166 of GPIb
. This explains why GPIb-IX in platelets
shows higher VWF binding and adhesion function than GPIb-IX expressed
in CHO cells, and suggests that dynamic regulation of phosphorylation levels of GPIb
in platelets may be a mechanism to regulate platelet adhesion to VWF.

View larger version (72K):
[in this window]
[in a new window]
|
Fig. 8.
The stoichiometry of GPIb
phosphorylation in resting platelets and 1b9 cells.
Platelets (A) and 1b9 cells (B) were solubilized
as described under "Materials and Methods," GPIb phosphorylated
at Ser166 in the lysates was immunoprecipated repeatedly
using anti-GPIb -P (GPIb -P) or rabbit IgG antibody to depletion.
The immunoprecipitated, phosphorylated GPIb-IX proteins (P)
and the lysates (S) were immunoblotted with the anti-GPIb
monoclonal antibody SZ2 to detect GPIb-IX level. Note that GPIb-IX in
1b9 cells was almost totally depleted by the anti-GPIb -P antibody,
whereas GPIb-IX in the platelets was only partially immunoprecipitated
by anti-GPIb -P.
|
|
 |
DISCUSSION |
It has been shown previously (19-21) that the cytoplasmic domain
of GPIb
is phosphorylated at Ser166. It is not clear,
however, how, and if, phosphorylation at Ser166 affects
GPIb-IX function. In this study, we conclude that GPIb-IX with GPIb
phosphorylated at Ser166 is in a resting form and poorly
interacts with VWF and that dephosphorylation at Ser166
up-regulates the VWF-binding function of GPIb-IX. These conclusions are
supported by the finding that GPIb-IX expressed in CHO cells is nearly
100% phosphorylated at Ser166 and poorly binds to VWF and
that the conserved point mutation changing Ser166 to
alanine to abolish Ser166 phosphorylation significantly
enhances the VWF-binding function of GPIb-IX. Furthermore, we show that
the PKA activator, forskolin, increases GPIb
phosphorylation in
platelets but reduces VWF binding. In contrast, the PKA inhibitor, PKI,
inhibited GPIb
phosphorylation in both CHO cells and platelets and
enhanced ristocetin-induced VWF binding. Thus, our data indicate that
PKA-mediated phosphorylation of GPIb
at Ser166
negatively regulates VWF binding to GPIb-IX. This provides a novel
intracellular signaling mechanism for regulation of the VWF-binding
function of GPIb-IX and for PKA-mediated platelet inhibition.
Our finding that VWF-binding function of GPIb-IX is negatively
regulated by PKA-dependent phosphorylation of
Ser166 of GPIb
is physiologically and pathologically
relevant. It is currently believed that GPIb-IX in normal circulating
platelets does not bind to soluble VWF. At the site of vascular injury, VWF binding to GPIb-IX occurs when GPIb-IX is exposed to
subendothelial-bound VWF. Interaction of VWF with the subendothelium is
thought to induce a conformational change in VWF and thus allow its
interaction with GPIb-IX. In vitro, this change in VWF is
mimicked by surface immobilization of VWF or by the VWF modulators,
ristocetin or botrocetin. However, recent studies show that in
thrombotic microangioapathy (TMA) including thrombotic thrombocytopenic
purpura (TTP), unusually large VWF multimers in the circulation
interact with circulating platelets to cause microthrombosis and
thrombocytopenia (40, 41). These unusually large VWF multimers are
caused by a deficiency in the VWF-cleaving metalloprotease, ADAMTS13.
Thus, unusually large VWF multimers appear to be able to interact with
circulating platelets in these patients. Interestingly, although
ADAMTS13 is deficient or decreased in many classic TTP patients, it is normal in patients with bone marrow transplant-associated TTP and
several other types of thrombotic microangioapathy (40, 42), suggesting
that additional mechanisms may be responsible for the increased
interaction of large VWF multimers with platelets in these patients.
Also, as ADAMTS13 protease levels fluctuate under different
physiological and pathological conditions (41), and as hemostatically
active large VWF multimers are present in normal individuals, it
appears that a regulatory mechanism that controls the interaction
between circulating large VWF multimers and platelets would be
necessary to prevent the TTP-like thrombotic and hemostatic disorders
in normal circulation. In this respect, although it has been thought
that the ligand-binding function of GPIb-IX is not regulated in
platelets, we have recently found that intracellular changes in GPIb-IX
such as cytoskeletal association may affect the VWF-binding functions
of GPIb-IX (38). In this study, we show that the VWF-binding function
of GPIb-IX is regulated in addition by the PKA-mediated phosphorylation
of GPIb
at Ser166, indicating that VWF binding to
GPIb-IX is not only controlled by VWF conformation but is also
regulated by the cAMP-mediated intracellular signal. This dual
regulation of ligand-receptor interaction may reflect the requirement
to tightly control the VWF-binding function of GPIb-IX to prevent
TTP-like disorders in the normal circulation.
It is not clear how phosphorylation of GPIb
regulates the
ligand-binding function of GPIb-IX. There are several possible mechanisms. First, Ser166 is a key residue in a 14-3-3 binding motif, and phosphorylation at Ser166 has been
reported to up-regulate 14-3-3 binding to the 14-3-3 binding sequence
in GPIb
(17, 18). Interestingly, a truncation mutation of GPIb
that lacked the C-terminal 16 residues including the 14-3-3 binding
site showed similarly enhanced VWF binding and showed an enhanced
transient cell adhesion compared with wild type GPIb-IX-expressing
cells (Figs. 4 and 6). This suggests that this region of GPIb
is
important in the negative regulation of GPIb-IX-dependent
cell adhesion to the immobilized VWF. It is therefore possible that the
interaction of 14-3-3 with the cytoplasmic domain of GPIb
may be
important in negatively regulating GPIb-IX interaction with VWF, and
thus up-regulation of 14-3-3 interaction by Ser166
phosphorylation would also negatively regulate VWF-binding function. Secondly, it is possible that phosphorylation at Ser166
directly or indirectly induces a conformational change in the extracellular ligand-binding domain of GPIb
. This possibility is
consistent with a recent report that an anti-GPIb
monoclonal antibody causes inhibition of the ligand-binding function of GPIb-IX (43). Thirdly, as we showed previously that association between GPIb-IX
and the membrane skeleton regulates ligand-binding function (38), it is
also possible that phosphorylation of GPIb
induces reorganization of
the GPIb-IX-associated membrane skeleton, which in turn regulates the
VWF-binding function of GPIb-IX. Consistent with this hypothesis, it
has been shown previously by Fox and Berndt (27) that phosphorylation
of GPIb
is associated with inhibition of actin polymerization during
platelet activation, which may involve the reorganization of
GPIb-IX-associated membrane skeletal structure.
The CHO cell model has been extensively used to study the structure and
function of GPIb-IX. However, as we showed previously (38) and here,
GPIb-IX-expressing CHO cells adhere poorly to human VWF under flow
conditions. Our data is consistent with the findings of Cunningham
et al. (12) and Cranmer et al. (44) who also
showed that CHO cells expressing wild type GPIb-IX adhered poorly to
human VWF-coated surfaces under static conditions (in the absence of
botrocetin) and rolled poorly on human VWF under high shear rate flow
conditions (44). However, a more recent paper by Williamson et
al. (45) reported an apparent contradiction between their data and
ours as it showed significant adhesion of wild type GPIb-IX-expressing
CHO cells to bovine VWF. However, there are two major differences
between Williamson's and our studies (and the results of Crammer
et al. using human VWF (44)). Williamson et al.
(45) examined the interaction of GPIb-IX-expressing cells with bovine
VWF, which is similar to the result of Cranmer et al. using
bovine VWF (44). In contrast, we (38) and Cranmer et
al. (44) showed that wild type GPIb-IX-expressing cells adhere poorly to immobilized human VWF under high shear rate (and static) conditions. It is known that bovine VWF is different from human VWF in
that it can bind to human platelet GPIb-IX without requiring any VWF
modulation (such as immobilization or ristocetin) (46, 47). This
suggests that binding of bovine VWF to human platelets may not be
regulated by the physiological regulatory mechanisms relevant to the
interaction of human platelets with human VWF (2). There is also a
major difference in our flow adhesion assays and those of Williamson
et al. (45). In the assay of Williamson et al.
(45), GPIb-IX-expressing CHO cells were allowed to interact with the
VWF-coated surface under static conditions or at a very low flow rate
for 5 min to initiate cell adhesion. The shear rate was then increased,
thus in reality reflecting the shear resistance of statically adherent
cells. In our assay system, cells flow across the VWF-coated surface at
constant high shear rates, which mimics the platelet adhesion process
in blood vessels. Under these flow conditions, CHO cells expressing
wild type GPIb-IX adhere poorly to VWF. We show that phoshorylation of
GPIb
at Ser166 is associated with inhibition of
VWF-binding function of GPIb-IX. We also show that almost all wild type
GPIb-IX molecules expressed in CHO cells are phosphorylated at
Ser166. These data suggest that PKA-dependent
phosphorylation at Ser166 of GPIb
may contribute to the
poor VWF-binding function of GPIb-IX in CHO cells. In contrast to CHO
cells, phosphorylation of Ser166 in human platelets is
dynamically regulated (Figs. 7 and 8) (27), and a significant
percentage (30-50%) of GPIb-IX molecules in platelets is
dephosphorylated at Ser166. Correlated with the presence of
dephosphorylated forms of GPIb-IX, ristocetin-induced VWF binding to
GPIb-IX is significantly higher in platelets. VWF-binding function of
GPIb-IX is also retained in fixed platelets, suggesting that at least a
portion of GPIb-IX molecules expressed on platelet surface are in an
active state. We show that inhibition of PKA significantly further
enhances VWF binding to platelets (Fig. 7), which is associated with
dephosphorylation of GPIb
. Thus, we speculate that one of the
possible mechanisms by which agonists enhance platelet adhesion is to
inhibit PKA and thus change the balance between phosphorylated and
unphosphorylated forms of GPIb-IX in platelets.
 |
FOOTNOTES |
*
This work was supported by Grant HL62350 from NHLBI,
National Institutes of Health.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
A part of this work was done during the tenure of the
Established Investigatorship of the American Heart Association.
To whom correspondence should be addressed: Dept. of
Pharmacology, University of Illinois at Chicago, 835 S. Wolcott Ave., Chicago, IL 60612. Tel.: 312-355-0237; Fax: 312-996-1225; E-mail: xdu@uic.edu.
Published, JBC Papers in Press, October 1, 2002, DOI 10.1074/jbc.M208329200
 |
ABBREVIATIONS |
The abbreviations used are:
VWF, von Willebrand
factor;
GP, glycoprotein;
PKA, cAMP-dependent
protein kinase;
PKI, PKA inhibitor;
CHO, Chinese hamster ovary;
PGE1, prostaglandin E1;
pS, phosphorylated serine;
BSA, bovine serum albumin;
PBS, phosphate-buffered saline;
FITC, fluorescein
isothiocyanate;
PRP, platelet-rich plasma;
TTP, thrombotic
thrombocytopenic purpura;
PGI2, prostaglandin
I2.
 |
REFERENCES |
| 1.
|
Ruggeri, Z. M.
(1991)
in
Progress in Hemostasis and Thrombosis
(Coller, B. S., ed), Vol. 10
, pp. 35-68, W. B. Saunders Company, Philadelphia
|
| 2.
|
Andrews, R. K.,
Shen, Y.,
Gardiner, E. E.,
Dong, J. F.,
Lopez, J. A.,
and Berndt, M. C.
(1999)
Thromb. Haemostasis
82,
357-364[Medline]
[Order article via Infotrieve]
|
| 3.
|
De Marco, L.,
Girolami, A.,
Russell, S.,
and Ruggeri, Z. M.
(1985)
J. Clin. Invest.
75,
1198-1203[Medline]
[Order article via Infotrieve]
|
| 4.
|
Kroll, M. H.,
Harris, T. S.,
Moake, J. L.,
Handin, R. I.,
and Schafer, A. I.
(1991)
J. Clin. Invest.
88,
1568-1573[Medline]
[Order article via Infotrieve]
|
| 5.
|
Savage, B.,
Almus-Jacobs, F.,
and Ruggeri, Z. M.
(1998)
Cell
94,
657-666[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Gu, M., Xi, X.,
Englund, G. D.,
Berndt, M. C.,
and Du, X.
(1999)
J. Cell Biol.
147,
1085-1096[Abstract/Free Full Text]
|
| 7.
|
Li, Z., Xi, X.,
and Du, X.
(2001)
J. Biol. Chem.
276,
42226-42232[Abstract/Free Full Text]
|
| 8.
|
Lopez, J. A.
(1994)
Blood Coagul. Fibrinolysis
5,
97-119[Medline]
[Order article via Infotrieve]
|
| 9.
|
Lopez, J. A.,
Leung, B.,
Reynolds, C. C., Li, C. Q.,
and Fox, J. E.
(1992)
J. Biol. Chem.
267,
12851-12859[Abstract/Free Full Text]
|
| 10.
|
Andrews, R. K.,
and Fox, J. E.
(1991)
J. Biol. Chem.
266,
7144-7147[Abstract/Free Full Text]
|
| 11.
|
Andrews, R. K.,
and Fox, J. E.
(1992)
J. Biol. Chem.
267,
18605-18611[Abstract/Free Full Text]
|
| 12.
|
Cunningham, J. G.,
Meyer, S. C.,
and Fox, J. E.
(1996)
J. Biol. Chem.
271,
11581-11587[Abstract/Free Full Text]
|
| 13.
|
Du, X.,
Harris, S. J.,
Tetaz, T. J.,
Ginsberg, M. H.,
and Berndt, M. C.
(1994)
J. Biol. Chem.
269,
18287-18290[Abstract/Free Full Text]
|
| 14.
|
Du, X.,
Fox, J. E.,
and Pei, S.
(1996)
J. Biol. Chem.
271,
7362-7367[Abstract/Free Full Text]
|
| 15.
|
Bodnar, R. J., Gu, M., Li, Z.,
Englund, G. D.,
and Du, X.
(1999)
J. Biol. Chem.
274,
33474-33479[Abstract/Free Full Text]
|
| 16.
|
Andrews, R. K.,
Munday, A. D.,
Mitchell, C. A.,
and Berndt, M. C.
(2001)
Blood
98,
681-687[Abstract/Free Full Text]
|
| 17.
|
Andrews, R. K.,
Harris, S. J.,
McNally, T.,
and Berndt, M. C.
(1998)
Biochemistry
37,
638-647[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Calverley, D. C.,
Kavanagh, T. J.,
and Roth, G. J.
(1998)
Blood
91,
1295-1303[Abstract/Free Full Text]
|
| 19.
|
Wyler, B.,
Bienz, D.,
Clemetson, K. J.,
and Luscher, E. F.
(1986)
Biochem. J.
234,
373-379[Medline]
[Order article via Infotrieve]
|
| 20.
|
Fox, J. E.,
Reynolds, C. C.,
and Johnson, M. M.
(1987)
J. Biol. Chem.
262,
12627-12631[Abstract/Free Full Text]
|
| 21.
|
Wardell, M. R.,
Reynolds, C. C.,
Berndt, M. C.,
Wallace, R. W.,
and Fox, J. E.
(1989)
J. Biol. Chem.
264,
15656-15661[Abstract/Free Full Text]
|
| 22.
|
Salzman, E. W.
(1972)
New England J. Med.
286,
358-363
|
| 23.
|
Coller, B. S.
(1981)
Blood
57,
846-855[Free Full Text]
|
| 24.
|
Hettasch, J. M.,
and Le Breton, G. C.
(1987)
Biochim. Biophys. Acta
931,
49-58[Medline]
[Order article via Infotrieve]
|
| 25.
|
Ryningen, A.,
Olav Jensen, B.,
and Holmsen, H.
(1998)
Biochim. Biophys. Acta
1394,
235-248[Medline]
[Order article via Infotrieve]
|
| 26.
|
Manganello, J. M.,
Djellas, Y.,
Borg, C.,
Antonakis, K.,
and Le Breton, G. C.
(1999)
J. Biol. Chem.
274,
28003-28010[Abstract/Free Full Text]
|
| 27.
|
Fox, J. E.,
and Berndt, M. C.
(1989)
J. Biol. Chem.
264,
9520-9526[Abstract/Free Full Text]
|
| 28.
|
Ruan, C. G., Du, X. P., Xi, X. D.,
Castaldi, P. A.,
and Berndt, M. C.
(1987)
Blood
69,
570-577[Abstract/Free Full Text]
|
| 29.
|
Ruan, C. G., Xi, X. D.,
and Gu, J. M.
(1986)
Zhonghua Nei ke Za Zhi
25,
547-550[Medline]
[Order article via Infotrieve], 576
|
| 30.
|
Lopez, J. A.,
Chung, D. W.,
Fujikawa, K.,
Hagen, F. S.,
Papayannopoulou, T.,
and Roth, G. J.
(1987)
Proc. Natl. Acad. Sci. U. S. A.
84,
5615-5619[Abstract/Free Full Text]
|
| 31.
|
Lopez, J. A.,
Chung, D. W.,
Fujikawa, K.,
Hagen, F. S.,
Davie, E. W.,
and Roth, G. J.
(1988)
Proc. Natl. Acad. Sci. U. S. A.
85,
2135-2139[Abstract/Free Full Text]
|
| 32.
|
Hickey, M. J.,
Williams, S. A.,
and Roth, G. J.
(1989)
Proc. Natl. Acad. Sci. U. S. A.
86,
6773-6777[Abstract/Free Full Text]
|
| 33.
|
Booth, W. J.,
Furby, F. H.,
Berndt, M. C.,
and Castaldi, P. A.
(1984)
Biochem. Biophys. Res. Commun.
118,
495-501[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Andrews, R. K.,
Booth, W. J.,
Gorman, J. J.,
Castaldi, P. A.,
and Berndt, M. C.
(1989)
Biochemistry
28,
8317-8326[CrossRef][Medline]
|