Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M202341200 on September 26, 2002

J. Biol. Chem., Vol. 277, Issue 49, 47385-47392, December 6, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/49/47385    most recent
M202341200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mohrmann, L.
Right arrow Articles by Verrijzer, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mohrmann, L.
Right arrow Articles by Verrijzer, C. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Characterization of the Extended Myb-like DNA-binding Domain of Trithorax Group Protein Zeste*

Lisette Mohrmann, Arnoud J. Kal, and C. Peter VerrijzerDagger

From the Department of Molecular and Cell Biology, Center for Biomedical Genetics, Leiden University Medical Center, P.O. Box 9503, 2300 RA Leiden, The Netherlands

Received for publication, March 11, 2002, and in revised form, September 26, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Zeste is a Drosophila sequence-specific DNA-binding protein that performs a variety of functions during chromatin-directed gene regulation. Its DNA-binding domain (DBD) was previously identified, but no similarities to established DNA-binding structures are known. Here we present sequence comparisons suggesting that the Zeste-DBD is a novel variant of the tri-helical Myb-DBD. Using band shift assays, we mapped the Zeste-DBD to 76 residues, corresponding to a single Myb repeat of only 50 residues. All residues involved in formation of the hydrophobic core of the Myb domain are conserved in Zeste, suggesting it forms an extended Myb domain. Mutagenesis studies determined (T/C/g)GAGTG(A/G/c) as the consensus Zeste recognition sequence. Reconstituted transcription experiments established that deviations from this optimal consensus compromise transcriptional activation by Zeste. In addition, flanking DNA is critical because Zeste-DBD binding requires a DNA sequence of minimally 16 base pairs, which is much longer than the consensus site. The DNA flanking the consensus is contacted by Zeste through sequence-independent backbone contacts. Interestingly, hydroxyl radical footprinting revealed that the Zeste-DNA backbone contacts all map to one face of the DNA. We compare the DNA-binding properties of Zeste with those of classical tri-helical DBDs harboring a helix-turn-helix motif and suggest a model for Zeste-DNA recognition.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Recognition of specific DNA sequences is the most fundamental mechanism by which transcriptional regulators are able to function in a gene-specific manner. The Drosophila Zeste protein is a sequence-specific DNA-binding transcription factor that belongs to the trithorax group (trxG)1 of regulators. The trxG comprises diverse activators that act together with the polycomb group (PcG) of repressors to maintain the correct expression of key developmental genes including the homeotic genes (1-6). Zeste is a transcriptional activator of homeotic genes, including Ultrabithorax (Ubx), as well as other genes such as white and decapentaplegic (dpp) (7-10). Consistent with a role in the regulation of multiple genes, Zeste is found associated with over 60 sites on polytene chromosomes of the larval salivary gland (11, 12). Zeste recognition elements are found in the promoter areas of its target genes as well as in some polycomb response elements that mediate the maintenance of either gene activity or silencing by trxG and PcG proteins. So far, only three members of the trxG/PcG proteins have been shown to posses sequence-specific DNA-binding activity. In addition to Zeste, this group comprises GAGA, a zinc-finger trxG protein, and the PcG protein Pleiohomeotic, which contains a Krüppel-like zinc-finger DBD (5, 6, 13). These factors are attractive candidate tethering factors that may direct non-DNA binding trxG/PcG proteins to polycomb response elements and promoters of homeotic genes.

A combination of genetic and biochemical studies has suggested that Zeste activates gene expression by alleviation of chromatin-mediated repression. Zeste loss-of-function mutations are enhancers of position effect variegation, indicating a role in counteracting heterochromatin-mediated silencing (14). Biochemical experiments revealed that Zeste recruits the SWI/SNF-related Drosophila Brahma complex to mediate transcriptional activation on a chromatin template (15). In addition, Zeste shows positive as well as negative genetic interactions with a number of PcG genes (16, 17). More recently, Zeste was identified as a component of a large Pc-containing complex, PRC1 (18). Thus, Zeste may perform dual functions and act as a tethering factor for trxG activators as well as PcG repressors. Moreover, Zeste is involved in chromosome pairing-dependent gene control phenomena. Firstly, Zeste bound to an enhancer on one chromosome is able to activate an allelic promoter on a homologously paired chromosome. This process is referred to as transvection and has been described for loci such as Ubx, dpp, and yellow (19-22). Secondly, particular neomorphic Zeste mutations result in pairing-dependent repression of transcription (23). Taken together, these studies show that Zeste is a multifunctional regulator of chromatin-directed gene regulation.

A unique feature of Zeste is that it binds cooperatively to multiple Zeste elements as a higher-order homo-oligomer (24, 25). Zeste oligomerization is the result of coiled-coil interactions mediated by carboxyl-terminal leucine zipper motifs (Fig. 2A). Interestingly, a Zeste oligomer cannot bind efficiently to a single Zeste site; rather, DNA binding requires at least 4 or more recognition elements. Indeed, natural Zeste-responsive elements such as the Ubx promoter (8) or the Ubx polycomb response elements2 typically contain multiple Zeste-binding elements. Although the Zeste-DBD (Fig. 2) was identified over a decade ago (24, 26, 27), no similarities with well characterized DNA-binding motifs have been identified so far.

Many DNA-binding proteins can be classified into distinct groups that use a common structural motif for DNA recognition. The first DNA recognition motif discovered, and one of the best characterized, is the helix-turn-helix (HTH) structure (28). The HTH motif is part of the DBDs of a wide range of distinct gene regulatory proteins found in organisms ranging from bacteria and archaea to man. The second of the two helices that form the HTH motif inserts into the major groove of the DNA where it makes base-specific as well as backbone contacts. Consequently, this helix is referred to as the recognition helix. There is substantial variation in the DNA-binding protein structures harboring an HTH and in the way the recognition helix inserts into the major groove. One of the most common examples of an eukaryotic HTH DBD is the homeodomain. Within the ~60-amino acid homeodomain, the HTH motif is part of a stable tri-helical protein fold with helix 2 and 3 forming the HTH motif. A unique feature of homeodomain-DNA interactions is that, in addition to the insertion of helix 3 into the major groove, DNA contacts are made by a short unstructured amino-terminal arm, which reaches into the minor groove (29).

A distinct class of tri-helical DBDs containing an HTH motif is formed by the Myb domain (30). As indicated by its name, Myb repeats were first recognized in the transcriptional regulator c-Myb, which is involved in the control of cell proliferation and differentiation (31). The Myb DNA-binding domain comprises three imperfect tandem repeats (R1, R2, and R3), each forming a tri-helical protein fold in which an HTH motif is formed by helix 2 and 3 (32, 33). Together, R2 and R3 are sufficient for recognition of specific DNA sequences, whereas R1 enhances the stability of the Myb-DNA complex (34, 35). The three helices in each repeat are maintained by a hydrophobic core that includes three strictly conserved tryptophan residues (Fig. 1) (36, 37). The turn between the second and third helices in each repeat is one amino acid longer than in the classical HTH motif. Another related domain is found in the yeast regulator Rap1p (repressor activator protein 1), which contains a DBD with properties that are somewhat in between those of a homeodomain and a Myb domain. Rap1p is a bifunctional regulator, which can either activate or repress transcription; its binding sites are found in the promoters of a large number of genes as well as at telomeric DNA (38). The Rap1p DBD contains two very similar subdomains that each bind the sequence GGTGT arranged in a tandem orientation. The structure of each of these is very similar to that of the Myb domain, but, like homeodomains, the Rap1p subdomains contain an amino-terminal arm that contacts the minor groove (39). Another protein sequence motif that shows similarity to the Myb domain is the SANT domain, which was first recognized in several proteins involved in transcriptional control including SWI3, ADA2, N-CoR, and TFIIIB (40). Although no DNA-binding activity has been reported for the SANT domain, it has been suggested, based on sequence similarities, that the Myb and SANT domains are folded into a related conformation. Finally, the DBD of the vertebrate telomere repeat-binding factor TRF1 comprises a single Myb domain that suffices for sequence-specific DNA binding (41). Helix 3 of the TRF1 DBD makes base-specific contacts in the major groove, whereas its amino-terminal arm binds within the minor groove (42). Hence, the Myb domain and homeodomain are related tri-helical structural arrangements harboring an HTH motif that binds DNA in a related but distinct fashion.


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 1.   Sequence alignment of Zeste DNA-binding domain with members of the Myb and SANT families. Amino acids are given in single-letter code, and conserved residues are color coded (hydrophobic, blue; acidic, orange; basic, red; polar, green; and glycine/proline, yellow). The conserved amino acids involved in the hydrophobic core are indicated. The three consensus residues (tryptophans, tyrosines, and phenylalanines) are indicated by hashes and the other amino acids by asterisks. The SANT domain alignments were taken from Aasland et al. (40). The open rectangles indicate the positions of the alpha  helices. The positions of the alpha  helices within Zeste are predicted by the PredictProtein program of the Swiss Institute of Bioinformatics. The organization of the alpha  helices within the other polypeptides were derived from the following published three-dimensional structures: hRap1 (50), scRap1 (39), hTRF1 (51), and mmMyb (32).

In this study, we have analyzed the structural and functional properties of the Zeste-DBD. Although previous studies failed to uncover a relationship between the Zeste-DBD and known DNA recognizing structures, our results indicate that the Zeste-DBD is related both to the Myb- and to the homeodomain. We found that a 76-amino acid domain of Zeste, corresponding to a single Myb repeat, mediates sequence-specific DNA binding. Interestingly, the Zeste-DBD is significantly larger than the 60-amino acid homeodomain or the ~50-amino acid Myb domain. However, the strict conservation of key structural residues and structure predictions suggested that the Zeste-DBD might form an extended tri-helical DBD related to the Myb domain and the homeodomain. Using a combination of band shift assays, DNase I, and hydroxyl radical footprinting, we characterized the DNA-binding properties of the Zeste-DBD. The optimal Zeste recognition sequence was identified, and functional assays revealed that changes in DNA-protein interactions affect transcriptional activation by Zeste. In addition to base-specific contacts, sequence-independent backbone contacts were shown to be critical for efficient Zeste binding. Interestingly, hydroxyl radical footprinting revealed that the Zeste-DNA backbone contacts covering about 13 base pairs all map to one face of the DNA. Our results indicated that the Zeste-DBD is related to the Myb domain but that there are significant differences in the way these domains interact with DNA.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Expression and Purification of Recombinant Proteins-- To investigate whether the DBD of Zeste based on the homology to Myb/SANT domains (between amino acid 42 and 143) were still able to bind DNA, six different expression constructs were created (indicated in Fig. 2A). DNA fragments encoding the different DBDs were generated using a PCR-based strategy. Primers were designed to generate a BamHI restriction site directly in front of the indicated amino-terminal Zeste amino acid and a stopcodon and EcoRI site following the indicated carboxyl-terminal residue (sequence details are available upon request). The digested DNA fragments were cloned into a BamHI/EcoRI-digested pGEX-4T-1 (Amersham Biosciences) expression vector, which allowed expression of GST- Zeste fusion proteins with an intervening thrombin cleavage site. These proteins were expressed in Escherichia coli BL21-CodonPlus(DE3)-RIL (Stratagene). An overnight culture grown at 30 °C was diluted 50-fold in fresh LB-media and grown at 37 °C for 90 min. The temperature was shifted to 30 °C for 30 min, and at A600 = 0.55, IPTG was added to a final concentration of 0.4 mM, and the protein was expressed at 30 °C for another 3 h. Cells were harvested, washed with phosphate-buffered saline, and stored at -80 °C. All protein procedures were carried out at 4 °C using HEMG buffer (25 mM HEPES-KOH, pH 7.6, 0.1 mM EDTA, 12.5 mM MgCl2, and 10% glycerol) and varying amounts of NaCl. To isolate the recombinant protein the lysis was carried out in HEMG buffer also containing 1 mM dithiothreitol, 0.2 mM AEBSF ((2-aminoethyl)benzenesulfonyl fluoride), 1 µM pepstatin, 0.1 mM leupeptin, 0.5 mM sodium metabisulphite, 0.2 mM phenylmethylsulfonyl fluoride, 0.1% Nonidet P-40, and 0.5 mg/ml lysozyme. After incubation for 45 min, a freeze-thaw step was performed, and the cells were sonicated several times. After centrifugation at 15,000 rpm in a SS-34 rotor for 25 min, the tagged proteins were affinity-purified from the supernatant on glutathione-Sepharose 4B. After extensive washes, the recombinant proteins were eluted by thrombin cleavage at room temperature for 45 min. The elution was done in HEMG buffer containing 150 mM NaCl and 1 mM dithiothreitol, giving two extra amino acids (glycine-serine) at the amino terminus of the recombinant proteins. The protein concentrations of the preparations were determined by UV-measurements (all around 0.4 mM) and verified by Coomassie staining. The fractions were aliquoted and stored at -80 °C. Analyses of the affinity-purified DBD proteins by denaturing SDS-PAGE showed a single band with the expected molecular mass, ranging from ~7 to 17 kDa (Fig. 2B, upper panel).


View larger version (25K):
[in this window]
[in a new window]
 
Fig. 2.   A 76-residue Myb-related domain of Zeste suffices for sequence-specific DNA binding. A, functional domains of Drosophila melanogaster Zeste. Six functional domains are schematically shown (DBD, DNA-binding domain; (-), highly negative charged domain; QA, glutamine- and alanine-rich; Pro, proline-rich; and Leu-Zip, leucine-zipper domain). Below, the schematic representation of the different recombinant proteins used in these studies. B, preparation of the different Zeste-DBD constructs. The different recombinant GST-tagged proteins were expressed in E. coli BL21-CodonPlus(DE3)-RIL cells and, after extract preparation, affinity purified on glutathione-Sepharose matrix. The purified proteins were analyzed by SDS-PAGE followed by Coomassie Blue staining. The positions and molecular mass (kDa) of protein standards are indicated on the left. The ability of the various purified proteins to bind a DNA probe containing a single Zeste-binding site were analyzed by a band shift assay (lanes 1-6). Lane 7 shows the binding reaction performed in the absence of a Zeste polypeptide.

DNA-binding Assays-- For band shift assays, double-stranded oligonucleotides (Figs. 3 and 5) were end-labeled with T4 polynucleotide kinase. DNA-binding reactions were performed in 25 µl of binding buffer (0.5× HEMG, 50 mM NaCl, 0.05% Nonidet P-40) in the presence of 50 ng poly(dIdC)-poly(dIdC), ~150 fmol of labeled probe, and 1.15, 0.58, or 0.29 µM protein. All binding reactions were carried out at room temperature for 25 min and were analyzed on an 8% polyacrylamide gel, run in 0.5× Tris-glycine/0.1% Nonidet P-40 buffer at room temperature. For kinetic analysis, a titration of 0.0045 µM to 4.6 µM protein by 2-fold increments was done in the absence of poly(dIdC)- poly(dIdC) (Fig. 4). For footprinting studies, a 51-base pairs double-stranded oligonucleotide harboring a single Zeste site was used. It is based on the Ubx promoter, and has the following sequence for the top strand: GCCGCTGATAATGTCCTAAAAACGAGTGGAAAACAGGCGCGCGCCTGTTAT (the Zeste recognition site and flanking sequences are indicated in bold). Either the top or the bottom strand was labeled using the T4 polynucleotide kinase. DNase I footprinting reactions were carried out in a total volume of 50 µl of binding buffer supplemented with 100 ng of poly(dIdC)-poly(dIdC). After binding at room temperature for 25 min, 2 µl of 100 mM CaCl2 and 2 units DNase I were added. Digestion was allowed at room temperature for 1 min and terminated by addition of 100 µl 20 mM EDTA, 0.2 M NaCl, 1% SDS, and 0.25 mg/ml glycogen, followed by phenol-chloroform extraction and ethanol precipitation. The samples were analyzed on a 15% sequencing gel. Hydroxyl radical footprinting reactions were carried out in 50 µl of binding buffer containing 1.6% glycerol and in the absence of poly(dIdC)-poly(dIdC). After binding, 9 µl of a freshly prepared mixture of 0.13 mM EDTA, 0.07 mM ferrous ammonium sulfate, 2% H2O2, and 67 mM sodium ascorbate was added. The cleavage reactions were stopped by addition of 30 µl of 0.2 M thiourea. Next, 1 µg of salmon sperm DNA and 2 µM EDTA were added. The samples were processed as described above. Most experiments were repeated several times and quantified using a Amersham Biosciences PhosphorImager.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 3.   Determination of the minimal DNA sequence required for DBD binding. A series of double-stranded oligonucleotides, which were either 22 base pairs or truncated upstream (left, l) or downstream of the Zeste site (right, R), were labeled and tested for binding in a band shift assay using decreasing Zeste-DBD concentrations. The autoradiographs were examined, and the mutants were grouped into either wild-type (++) affinity, less than 2-fold reduced (+), over 4-fold reduced (±), and more than 10-fold (-) reduced affinity.


View larger version (45K):
[in this window]
[in a new window]
 
Fig. 4.   Determination of the Kd of Zeste-DBD. The double-stranded oligonucleotide 17L (see Fig. 3) was incubated with increasing amounts of Zeste-DBD. Next, the DNA occupancy was determined in a mobility shift assay. The percentage of bound DNA was determined by quantitation of the gel using a Amersham Biosciences PhosphorImager and plotted against the DBD concentration (see "Experimental Procedures"). Under conditions when the total DNA concentration is well below the Kd, the Kd approximates the protein concentration at which 50% of the DNA is bound. The concentration of 17L in these reactions was about 6 nM, which allowed us to estimate a Kd of ~1.3 × 10-7 M, the protein concentration at which 50% of the DNA is bound.

In Vitro Transcription Assays-- Transcription reactions and primer extension analysis were carried out essentially as described by Kadonaga (43). The template was plasmid 4ZpblueTATA, which contained either 4 optimized Zeste-binding sites (GATCCCGAGTGGTTCGTATGTCGAGTGGCTAACCCTTCCACTCGATCCATGGTCGAGTGGGAATTCCG) or 4 mutant Zeste sites containing the indicated mutation (Fig. 5) upstream of a consensus TATA box and initiator element. Briefly, transcription reactions were performed in a total volume of 25 µl and contained 40 ng of template DNA (in the form of naked DNA), 40 mM HEPES-KOH, pH 7.6, 70 mM KCl, 0.6 mM ATP, 1% polyvinyl alcohol (molecular mass of 10,000), 0.1 µl of RNase inhibitor, and 0.8 mM DDT. The basal transcription machinery was provided by addition of 0.2 µl of the Heparin H0.4 fraction partially purified from 0-12 h Drosophila embryo nuclear extracts (15). Upon addition of Zeste, reactions were incubated for 20 min at room temperature prior to the start of transcription by addition of 0.6 mM each of CTP, GTP, and UTP. After 30 min at 30 °C transcription was stopped by the addition of 100 µl of stop buffer (20 mM EDTA, 1% SDS, 0.2 M NaCl, 0.25 mg/ml yeast RNA, and 50 µg/ml Proteinase K). The RNA transcripts were visualized by primer extension using a radiolabeled primer (PV313) (15) and analyzed on an 8% denaturing polyacrylamide gel. Transcription gels were quantified using an Amersham Biosciences PhosphorImager.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 5.   Identification of the Zeste consensus recognition sequence. A, to determine the critical sequence-determinants for Zeste-DNA recognition, we systematically mutated various bases within the core recognition sequence as well as positions flanking the consensus. We used the double-stranded oligonucleotide 17L and various 17L-derived mutants in a band shift assay in the presence of decreasing amounts of Zeste-DBD. A selection of representative autoradiographs are shown. The mutants were grouped into either wild-type (++) affinity, less than 2-fold reduced (+), over 4-fold reduced (±), and more than 10-fold (-) reduced affinity. These results suggest (T/C/g)GAGTG(A/G/c) as the Zeste consensus recognition sequence (shown at the bottom of the table). The lines flanking the consensus sequence indicate sequence-independent bases, critical for DNA binding by the Zeste-DBD. B, effects of distinct Zeste site mutations on transcription. In vitro transcription assays were used to compare the level of Zeste-dependent transcription on a template harboring 4 consensus Zeste elements (wild-type, mut 11 and 23) or templates containing suboptimal Zeste sites (mut 15, 18, 19, 20, 22, and 24). The mutations present in the various templates (indicated above the lanes) are shown in Fig. 5A. Transcription reactions were performed either in the absence or presence of increasing amounts of purified full-length Zeste. Transcription products were detected by primer extension, separated on an 8% denaturing polyacrylamide gel, and subjected to autoradiography. The gels were quantified by phosphorimager analysis, which revealed an approximately 20-fold activation of transcription by Zeste on the templates with optimal binding sites, whereas the level of activation on the mutant templates was between 5-10-fold reduced.


    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The Zeste-DBD Is Related to the Myb Domain-- Like most transcription factors, Zeste has a modular organization, and distinct structural and functional domains can be recognized (Fig. 2A). Among its prominent features are an amino-terminal DBD and a carboxyl-terminal leucine zipper oligomerization domain. The leucine zipper domain mediates coiled-coil interactions that lead to the formation of higher-order Zeste multimers (26). As a result, Zeste binds DNA cooperatively as an oligomer, and a typical natural response element for Zeste contains 4 or more Zeste-binding sites (24). Although the DBD of Zeste was identified and narrowed down to amino acids 47-138 well over a decade ago (27), its relationship with other DBDs remained unresolved. In an attempt to identify potential structural motifs in Zeste, we first identified protein sequences that are highly conserved between Zeste from two distinct fly species, Drosophila virilis and Drosophila melanogaster, and used these regions to search protein databases. A BLAST search of the SWISS-PROT data base revealed a clear relationship between Zeste and the Myb-DBD as well as with the Myb-related SANT domain. Fig. 1 illustrates the primary sequence similarity between the Zeste-DBD and the Myb-DBD obtained following a clustal W alignment and further optimization by manual editing. In addition to an overall sequence similarity, there is strict conservation of critical hydrophobic residues that are involved in the formation of the hydrophobic core of the Myb-DBD. Furthermore, the conserved glycines and prolines at the end of helices 2 and 3 in the Zeste-DBD are conserved, whereas the glycine/proline after helix 1 is not conserved in Zeste. Moreover, a structure prediction using the PredictProtein program (Swiss Institute of Bioinformatics) suggested that the Zeste-DBD may also have a tri-helical structure. Taken together, these observations are consistent with the idea that the Zeste-DBD may form a protein fold similar to that found in the Myb domain. However, all three putative alpha  helices within the Zeste-DBD are extended relative to those present in the Myb domain. Compared with the Myb domain, the putative helices 1, 2, and 3 are respectively 12, 4, and 10 residues longer. It should be noted that helix 1 is extended in the area where the conserved glycine is lacking. Although this hypothesis awaits a three-dimensional structure determination, these findings suggest that the Zeste-DBD forms an extended Myb-like domain.

To determine whether the Myb-related domain in Zeste was sufficient to mediate sequence-specific DNA binding, we expressed the series of polypeptides indicated in Fig. 2A. The various constructs were expressed as GST-fusion proteins in E. coli, and following purification on a Gluthathione-Sepharose matrix the Zeste polypeptides were released from the GST portion by thrombin cleavage. These polypeptides were resolved by SDS-PAGE and visualized by Coomassie staining, revealing comparable concentrations and purity (Fig. 2B, top panel). Next, we compared the ability of the distinct Zeste-DBD polypeptides to recognize and bind a 22 base pair DNA oligomer harboring a single Zeste-binding site derived from the Drosophila Ubx promoter (9). As shown in Fig. 2B (bottom panel), all Zeste polypeptides tested efficiently bound the Zeste site. Thus, the minimal 76-residue Zeste polypeptide Z (51-126) that is homologous to a single Myb repeat is sufficient for DNA binding. Hope-Struhl bandshift assays demonstrated that the Zeste-DBD binds DNA as a monomer (our data not shown) (24). In the DNA-binding experiments described below we used this polypeptide and refer to it as DBD.

Determination of the Minimal DNA Sequence Required for DBD Binding-- To determine the outer borders of the DNA sequence required for Zeste-DBD binding, we generated a series of oligonucleotides that were progressively shortened toward a Zeste site derived from the Ubx promoter (core sequence: CGAGTG, Fig. 3). We chose an oligonucleotide of 22 base pairs as our longest DNA fragment because it encompassed the Zeste DNase I footprinting borders (data not shown, see also Fig. 6). For reference we numbered the top strand bases from 1 to 22, as indicated in Fig. 3. A series of double-stranded oligonucleotides, which were either 22 base pairs or shortened upstream (left, L) or downstream of the Zeste site (right, R), were labeled and tested for binding in a band shift assay using decreasing DBD concentrations. The autoradiographs were examined, and the mutants were grouped into either wild-type (++) affinity, less than 2-fold reduced (+), over 4-fold reduced (±), and more than 10-fold (-) reduced affinity. The shortest oligonucleotide recognized with apparent wild-type affinity (16RL) was 16 base pairs long. Interestingly, the core Zeste recognition sequence CGAGTG is located asymmetrically within this minimal DNA oligomer. Efficient binding by the Zeste-DBD required 6 additional base pairs downstream of the core recognition motif (20R) but only 3 base pairs upstream of the core (17L). Moreover, an oligonucleotide with only 1 flanking base pair upstream of the core (15L) was still recognized by Zeste. In contrast, binding to an oligonucleotide with 4 flanking base pairs downstream of the core was no longer detectable (18R). These results indicated that DNA binding by the Zeste-DBD required extensive contacts with the DNA downstream of the core recognition sequence (Fig. 3).


View larger version (51K):
[in this window]
[in a new window]
 
Fig. 6.   DNase I and hydroxyl radical footprinting analysis of Zeste-DBD DNA contacts. A, DNase I footprinting analysis of the Zeste-DBD. A 51-base pair double-stranded oligo containing a single natural Zeste site (see Fig. 3) was labeled at either the top or bottom strand and incubated with Zeste-DBD. DNase I digestion patterns were determined either in the absence (-) or presence of DBD (+), and products were analyzed on a 15% denaturing polyacrylamide gel in parallel with G+A sequencing reactions. The positions of the fragments on the gel are indicated, and protected regions are indicated by brackets. B, hydroxyl radical footprinting analysis of Zeste-DBD. DNA was treated with hydroxyl radicals after incubation with decreasing amounts of DBD (indicated by a triangle) or without protein (-), and the products were analyzed on a 15% denaturing polyacrylamide gel in parallel with G+A sequencing reactions. The positions of the fragments on the gel and the protected regions, determined by quantification of individual fragments, are indicated. C, quantification of the hydroxyl radical footprinting by phosphorimaging analysis of the gel shown in Fig. 6B. Open circles indicate the lanes without protein, whereas closed circles correspond to the reactions containing Zeste-DBD. D, summary of the footprinting results in a schematic representation of the contacts that were identified for Zeste-DBD on the synthetic oligomer, based on the Ubx promoter. The numbering of the bases allows a comparison with the corresponding fragments on the gels in Fig. 6, A and B. The outer brackets indicate the DNase I footprints, whereas the inner brackets correspond to the hydroxyl radical footprints.

To determine the equilibrium dissociation constant (Kd) of the Zeste-DBD DNA binding, we used the band shift assay for binding saturation experiments. The amount of protein was increased in the presence of a fixed amount of radiolabeled, double-stranded oligonucleotide DNA at a concentration of about 6 nM. The fraction of DNA bound by Zeste-DBD was obtained by computer quantitation of the gel using an Amersham Biosciences PhosphorImager and plotted against the DBD concentration (Fig. 4). Under conditions when the total DNA concentration is well below the Kd, the protein concentration at which 50% of the DNA is bound approximates the Kd. Using this approach, we obtained a Kd value of 1.8 × 10-7 M for the longest oligonucleotide (22 base pairs) and a Kd of 1.3 × 10-7 M for 17L, whereas oligonucleotide 16RL was bound with an estimated Kd of 2.4 × 10-7 M. These results indicated that the isolated Zeste-DBD bound its recognition sequence with a modest binding affinity of about 1.8 × 10-7 M. As discussed below, oligomerization of full-length Zeste results in highly cooperative binding to multiple binding sites present in its natural response elements (24).

DNA Sequence Determinants for Recognition by Zeste-DBD-- A previous comparison of natural Zeste-binding elements suggested (T/C)GAG(T/C)G as its consensus recognition sequence (8). Because our determination of the minimal DNA sequence required for DBD binding suggested the need for extended DNA contacts, we wondered whether there might be sequence constraints for the positions flanking the consensus. We were particularly intrigued by this possibility because we noted that natural Zeste sites are frequently flanked by a stretch of A/T-rich sequences.3 To determine their relative importance, we systematically mutated various bases within the core recognition sequence as well as positions flanking the consensus. As indicated in Fig. 5A, we used the double-stranded oligonucleotide 17L and various 17L-derived mutants in a band shift assay in the presence of decreasing amounts of Zeste-DBD. The autoradiographs were examined, and the mutants were grouped into either wild-type (++) affinity, less than 2-fold reduced (+), over 4-fold reduced (±), and more than 10-fold (-) reduced affinity. Our results suggest a refinement of the Zeste consensus recognition sequence to (T/C/g)GAGTG(A/G/c). Although essential for Zeste binding, the DNA contacts outside these 7 base pairs appear to be sequence-independent because they are not significantly affected by mutations. These results suggest that Zeste may make important sequence-independent contacts with the DNA backbone, in particular downstream of the consensus site.

To ascertain that changes in Zeste-DNA interactions influence transcriptional activity, we performed reconstituted transcription experiments. We compared the ability of Zeste to activate transcription on a template harboring 4 consensus Zeste elements with its ability to activate a series of templates containing either optimal or suboptimal Zeste sites. For this experiment we made a selection of the mutants analyzed in Fig. 5A, which involve distinct positions within the Zeste consensus sequence. Other than the point mutations in the Zeste recognition sequences, all templates used in the transcription experiments were identical. The general transcription factors were provided by a partially purified Drosophila embryo extract, and full-length Zeste was isolated from Sf9 cells infected with recombinant baculoviruses (15). Transcription reactions with each of the 9 distinct templates were performed either in the absence or presence of increasing amounts of purified full-length Zeste, and transcription was monitored by primer extension. As shown in Fig. 5B, Zeste strongly stimulated transcription of the templates with optimal Zeste-binding sites (wild-type, mut 11 and 23). In contrast, activation of transcription by Zeste on the various mutant templates (mut 15, 18, 19, 20, 22, and 24) was clearly decreased (about 5-10-fold reduced) compared with the templates with optimal Zeste-binding sites. It should be noted that the transcription templates contain multiple Zeste sites, allowing for cooperative DNA binding. Therefore, mutations that impair Zeste binding could still support weak transcriptional activation (e.g. mut 15 and 20). Nevertheless, all mutations in the recognition sequence that affect Zeste-DNA interactions compromise the ability of Zeste to activate transcription. Thus, we conclude that transcriptional activation by Zeste is critically dependent on its recognition sequence.

Identification of Zeste-DBD DNA Backbone Contacts-- Our analyses suggested that, in addition to essential sequence-specific contacts with the core recognition element, sequence-independent contacts with the DNA backbone play an important role during Zeste DNA binding. To determine the DNA sequence contacted by the Zeste-DBD, we first performed a DNase I footprinting analysis using a 51-base pair oligomer containing the Zeste recognition site and flanking sequences used in previous experiments (Fig. 3). As shown in Fig. 6A, Zeste-DBD protects 11 bases on the top strand (A7-A16) and 17 bases on the bottom strand (T4-G20), respectively, from DNase I digestion. Because DNase I is a bulky, asymmetrical enzyme, its use in footprinting reactions provides only a low-resolution probe for protein-DNA contacts. To examine Zeste-DBD DNA contacts with a higher resolution we used hydroxyl radical footprinting analysis (Fig. 6B). Hydroxyl radicals, generated by iron(II)-promoted reduction of hydrogen peroxide, attack the deoxyribose sugars in the DNA backbone. Sugars that are in close contact with protein are completely or partially protected against cutting. Thus, this technique identifies contacts with the sugar/phosphate backbone of DNA. The hydroxyl radical footprints of Zeste-DBD revealed only a small protected region on the top strand and two distinct regions, separated by about 5 base pairs, on the bottom strand (Fig. 6B). The bands were quantified by phosphorimaging analysis, and the relative amounts of label present at the various positions were plotted in a graph (Fig. 6C). The quantification confirms the striking difference between the top and bottom strand with respect to the extent of backbone contacts made by Zeste-DBD. Although a single small region (A8-G10) on the top strand is protected, there are two separate footprints on the bottom strand: a small, partially protected region (T6-T7) and a larger, strongly protected region (A13-T18). The DBD-sugar contacts identified by hydroxyl radical footprinting are indicated on the Zeste consensus recognition sequence (indicated by the inner brackets) (Fig. 6D). The backbone contacts identified by the hydroxyl radical footprinting cover 13 base pairs and only partially overlap with the positions that are critical for sequence-specific recognition by Zeste. Models to explain DNA binding by the Zeste-DBD are discussed below.

    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

We have identified a structural relationship between the DBDs of Zeste and Myb. Sequence alignments revealed a clear similarity between the Zeste-DBD and the Myb repeats and SANT domains. In particular, all the key residues involved in the formation of the hydrophobic core of Myb are strictly conserved in the DBD of Zeste (Fig. 1). However, whereas Myb requires minimally two of its three repeats for sequence-specific DNA binding (44, 45), the minimal DBD of Zeste corresponds to a single, extended Myb repeat. Structure predictions suggest that, like Myb, the DBD of Zeste forms a tri-helical fold. However, all three helices in Zeste appear to be significantly extended compared with Myb and Myb-related DBDs, such as those of Rap1p, TRF1, and homeodomains (Fig. 1 and data not shown). All these proteins comprise a tri-helical structure, with helix 2 and 3 forming an HTH motif in which helix 3 mediates specific base sequence recognition through major groove contacts.

The manner of disposition of the recognition helix within the major groove is distinct among Myb-related DBDs. For instance, the recognition helices of the scRap1p DBD domains are aligned at almost right angles to the DNA axis (39), whereas those of the Myb-protein essentially follow the path of the major groove (32). Moreover, the recognition helix in homeodomain DBDs is tilted toward the direction of the major groove so that the helix lies along the floor of the groove (46). It is unclear how Zeste docks on the DNA; however, both sequence conservation and structure predictions suggest that Zeste forms an extended Myb-like DBD with helix 2 and 3, forming an elongated HTH motif that interacts with the major groove. The elongated helix 1 of Zeste might reach further than the amino-terminal arm of Myb, TRF1, or Rap1p, which would be consistent with the remarkably extended DNA contacts observed in this study.

Our results also suggest further differences in the way that Zeste and the other Myb domain proteins interact with their recognition sites. DNA mutagenesis studies revealed (T/C/g)GAGTG(A/G/c) as the consensus Zeste recognition sequence. This sequence does not appear to be related to the Myb (47), Rap1p (39), and TRF1 (41, 42) recognition sites. Moreover, in addition to the sequence-specific base recognition, critical non-sequence-dependent contacts are made with the flanking sequences. Surprisingly, Zeste binding requires particularly extended non-sequence-specific contacts downstream of the consensus sequence, whereas only a few positions directly upstream are important. Supporting asymmetrical docking of the Zeste-DBD to DNA, DNase I footprinting showed a relatively small footprint on the top strand (11 base pairs) compared with a large (17 base pairs) protected region on the bottom strand. Moreover, the high-resolution hydroxyl radical footprinting revealed one small footprint on the top strand but two separate footprints on the bottom strand. Taken together, these results suggest that Zeste docks asymmetrically on its recognition element.

The protein contacts with the backbone sugars that we identified using hydroxyl radical footprinting (Fig. 6B) as well as the bases critical for sequence recognition by Zeste (Fig. 5) are indicated on a DNA double helix structure (Fig. 7). For comparison, we have included the backbone (phosphate) and base contacts made by the Myb repeat 2 domain (32). First, it is striking that all Zeste DNA contacts map to one face of the DNA. Compared with Myb, the Zeste contacts are more spread out, covering 13 base pairs of DNA compared with 9 base pairs contacted by Myb repeat 2. Other Myb domain proteins like TRF1 contact 10 base pairs (41), whereas, like c-Myb, the DNA contacts made by the homeodomains of Matalpha 2, Engrailed, and Antennapedia cover 9 base pairs (48, 49). The DBD of Zeste recognizes only a single DNA site like Myb, hRap1, and TRF1. It is tempting to speculate that these spread-out DNA contacts are a consequence of the extended Myb-like DBD of Zeste. In particular, helix 1 is predicted to be significantly longer and may be responsible for additional backbone contacts.


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 7.   Comparison of DNA binding of the Zeste-DBD with c-Myb repeat 2 domain. The protein contacts with the backbone sugars that we identified using hydroxyl radical footprinting (Fig. 6) as well as the bases critical for sequence recognition by Zeste (Fig. 5) are indicated on a DNA double helix structure. For comparison, we have included the backbone (phosphate) and base contacts made by c-Myb repeat 2, as identified by Ogata et al. (32). The base-specific contacts are indicated in blue, and both the sugar and phosphate contacts are indicated in red. It should be noted that the Zeste DNA contacts map to one face of the DNA and are more spread out than the c-Myb repeat 2 contacts. The Zeste DNA contacts cover 13 base pairs of DNA compared with 9 base pairs contacted by Myb repeat 2 (32).

Although Myb-proteins contain three repeats and scRap1p has 2 subdomains, the DBD of Zeste, similar to TRF1 and hRap1, comprises a single repeat. Furthermore, the Zeste-DBD binds DNA as a monomer (data not shown) (24), with a relatively modest Kd of around 10-7 M. However, full-length Zeste oligomerizes through coiled-coil interactions mediated by its carboxyl-terminal leucine zipper, a motif absent in the constructs used in this study. Zeste oligomers bind highly cooperatively to multiple binding elements present in natural response sequences, thus achieving high affinity DNA binding (24, 26).

In summary, our results indicate that the Zeste-DBD is a special variant of the Myb domain DNA recognition fold. Not only is it extended compared with other tri-helical DBDs such as the homeodomain and Myb domain, but there also appears to be significant differences in the way the DNA is contacted. It will be of great interest to determine the three-dimensional structure of the Zeste-DBD DNA recognition site to reveal the structural basis of this interaction.

The striking positioning of the Zeste DNA contacts on one side of the DNA helix may have important functional consequences for the ability of Zeste to interact with the chromatin template. Previously, we obtained data suggesting that Zeste was able to efficiently bind to a chromatinized site in the absence of a chromatin-remodeling factor (15). An attractive possibility, to allow Zeste binding to nucleosomal DNA, would be that Zeste contacts the DNA double helix facing away from the histones. Our future studies will be aimed at testing this hypothesis and determining whether Zeste may first bind chromatin and subsequently recruits chromatin-remodeling factors, such as the Brahma complex, to mediate further opening of the chromatin structure. This, in turn, may allow binding of other transcription factors. Such studies may provide further insight in the molecular mechanism by which Zeste regulates gene expression.

    ACKNOWLEDGEMENTS

We thank Karin Langenberg and Tokameh Mahmoudi for assistance with the transcription experiments and Eric Kalkhoven, Jan van der Knaap, Jennifer Rohn, and Lee Fradkin for critical reading of the manuscript.

    FOOTNOTES

* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger To whom correspondence should be addressed. Tel.: 31-71-527-6325 or 31-71-527-6115; Fax: 31-71-527-6284; E-mail: verrijzer@lumc.nl.

Published, JBC Papers in Press, September 26, 2002, DOI 10.1074/jbc.M202341200

2 T. Mahmoudi and C. P. Verrijzer, submitted for publication.

3 L. Mohrmann and C. P. Verrijzer, unpublished results.

    ABBREVIATIONS

The abbreviations used are: trxG, trithorax group; PcG, polycomb group; DBD, DNA-binding domain; HTH, helix-turn-helix; Rap1p, repressor activator protein 1; TRF1, telomere repeat binding factor 1; SANT, SWI3, ADA2, N-CoR, and TFIIIB; GST, glutathione S- transferase; IPTG, isopropyl-1-thio-beta -D-galactopyranoside.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Kennison, J. A. (1995) Annu. Rev. Genet. 29, 289-303[CrossRef][Medline] [Order article via Infotrieve]
2. Paro, R. (1995) Trends Genet. 11, 295-297[CrossRef][Medline] [Order article via Infotrieve]
3. Pirrotta, V. (1998) Cell 93, 333-336[CrossRef][Medline] [Order article via Infotrieve]
4. Lyko, F., and Paro, R. (1999) Bioessays 21, 824-832[CrossRef][Medline] [Order article via Infotrieve]
5. Francis, N. J., and Kingston, R. E. (2001) Nat. Rev. Mol. Cell. Biol. 2, 409-421[CrossRef][Medline] [Order article via Infotrieve]
6. Mahmoudi, T., and Verrijzer, C. P. (2001) Oncogene 20, 3055-3066[CrossRef][Medline] [Order article via Infotrieve]
7. Benson, M., and Pirrotta, V. (1987) EMBO J. 6, 1387-1392[Medline] [Order article via Infotrieve]
8. Biggin, M. D., Bickel, S., Benson, M., Pirrotta, V., and Tjian, R. (1988) Cell 53, 713-722[CrossRef][Medline] [Order article via Infotrieve]
9. Biggin, M. D., and Tjian, R. (1988) Cell 53, 699-711[CrossRef][Medline] [Order article via Infotrieve]
10. Laney, J. D., and Biggin, M. D. (1992) Genes Dev. 6, 1531-1541[Abstract/Free Full Text]
11. Pirrotta, V., Bickel, S., and Mariani, C. (1988) Genes Dev. 2, 1839-1850[Abstract/Free Full Text]
12. Rastelli, L., Chan, C. S., and Pirrotta, V. (1993) EMBO J. 12, 1513-1522[Medline] [Order article via Infotrieve]
13. Brown, J. L., Mucci, D., Whiteley, M., Dirksen, M. L., and Kassis, J. A. (1998) Mol. Cell 1, 1057-1064[CrossRef][Medline] [Order article via Infotrieve]
14. Judd, B. H. (1995) Genetics 141, 245-253[Abstract]
15. Kal, A. J., Mahmoudi, T., Zak, N. B., and Verrijzer, C. P. (2000) Genes Dev. 14, 1058-1071[Abstract/Free Full Text]
16. Phillips, M. D., and Shearn, A. (1990) Genetics 125, 91-101[Abstract]
17. Pelegri, F., and Lehmann, R. (1994) Genetics 136, 1341-1353[Abstract]
18. Saurin, A. J., Shao, Z., Erdjument-Bromage, H., Tempst, P., and Kingston, R. E. (2001) Nature 412, 655-660[CrossRef][Medline] [Order article via Infotrieve]
19. Lewis, E. B. (1954) Am. Nat. 88, 225-239[CrossRef]
20. Benson, M., and Pirrotta, V. (1988) EMBO J. 7, 3907-3915[Medline] [Order article via Infotrieve]
21. Dorsett, D. (1999) Curr. Opin. Genet. Dev. 9, 505-514[CrossRef][Medline] [Order article via Infotrieve]
22. Pirrotta, V. (1999) Biochim. Biophys. Acta 1424, M1-M8[Medline] [Order article via Infotrieve]
23. Rosen, C., Dorsett, D., and Jack, J. (1998) Genetics 148, 1865-1874[Abstract/Free Full Text]
24. Chen, J. D., and Pirrotta, V. (1993) EMBO J. 12, 2075-2083[Medline] [Order article via Infotrieve]
25. Chen, J. D., and Pirrotta, V. (1993) EMBO J. 12, 2061-2073[Medline] [Order article via Infotrieve]
26. Chen, J. D., Chan, C. S., and Pirrotta, V. (1992) Mol. Cell. Biol. 12, 598-608[Abstract/Free Full Text]
27. Mansukhani, A., Crickmore, A., Sherwood, P. W., and Goldberg, M. L. (1988) Mol. Cell. Biol. 8, 615-623[Abstract/Free Full Text]
28. Pabo, C. O., and Sauer, R. T. (1992) Annu. Rev. Biochem. 61, 1053-1095[CrossRef][Medline] [Order article via Infotrieve]
29. Wolberger, C. (1996) Curr. Opin. Struct. Biol. 6, 62-68[CrossRef][Medline] [Order article via Infotrieve]
30. Gabrielsen, O. S., Sentenac, A., and Fromageot, P. (1991) Science 253, 1140-1143[Abstract/Free Full Text]
31. Graf, T. (1992) Curr. Opin. Genet. Dev. 2, 249-255[CrossRef][Medline] [Order article via Infotrieve]
32. Ogata, K., Morikawa, S., Nakamura, H., Sekikawa, A., Inoue, T., Kanai, H., Sarai, A., Ishii, S., and Nishimura, Y. (1994) Cell 79, 639-648[CrossRef][Medline] [Order article via Infotrieve]
33. Pinson, B., Brendeford, E. M., Gabrielsen, O. S., and Daignan-Fornier, B. (2001) Nucleic Acids Res. 29, 527-535[Abstract/Free Full Text]
34. Ebneth, A., Schweers, O., Thole, H., Fagin, U., Urbanke, C., Maass, G., and Wolfes, H. (1994) Biochemistry 33, 14586-14593[CrossRef][Medline] [Order article via Infotrieve]
35. Ogata, K., Morikawa, S., Nakamura, H., Hojo, H., Yoshimura, S., Zhang, R., Aimoto, S., Ametani, Y., Hirata, Z., and Sarai, A. (1995) Nat. Struct. Biol. 2, 309-320[CrossRef][Medline] [Order article via Infotrieve]
36. Saikumar, P., Murali, R., and Reddy, E. P. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 8452-8456[Abstract/Free Full Text]
37. Oda, M., Furukawa, K., Ogata, K., Sarai, A., Ishii, S., Nishimura, Y., and Nakamura, H. (1997) Protein Eng 10, 1407-1414[Abstract/Free Full Text]
38. Shore, D. (1994) Trends Genet. 10, 408-412[CrossRef][Medline] [Order article via Infotrieve]
39. Konig, P., Giraldo, R., Chapman, L., and Rhodes, D. (1996) Cell 85, 125-136[CrossRef][Medline] [Order article via Infotrieve]
40. Aasland, R., Stewart, A. F., and Gibson, T. (1996) Trends Biochem. Sci. 21, 87-88[CrossRef][Medline] [Order article via Infotrieve]
41. Konig, P., Fairall, L., and Rhodes, D. (1998) Nucleic Acids Res. 26, 1731-1740[Abstract/Free Full Text]
42. Nishikawa, T., Okamura, H., Nagadoi, A., Konig, P., Rhodes, D., and Nishimura, Y. (2001) Structure (Camb.) 9, 1237-1251[Medline] [Order article via Infotrieve]
43. Kadonaga, J. T. (1990) J. Biol. Chem. 265, 2624-2631[Abstract/Free Full Text]
44. Sakura, H., Kanei-Ishii, C., Nagase, T., Nakagoshi, H., Gonda, T. J., and Ishii, S. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 5758-5762[Abstract/Free Full Text]
45. Howe, K. M., Reakes, C. F., and Watson, R. J. (1990) EMBO J. 9, 161-169[Medline] [Order article via Infotrieve]
46. Kissinger, C. R., Liu, B. S., Martin-Blanco, E., Kornberg, T. B., and Pabo, C. O. (1990) Cell 63, 579-590[CrossRef][Medline] [Order article via Infotrieve]
47. Tanikawa, J., Yasukawa, T., Enari, M., Ogata, K., Nishimura, Y., Ishii, S., and Sarai, A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9320-9324[Abstract/Free Full Text]
48. Gehring, W. J., Qian, Y. Q., Billeter, M., Furukubo-Tokunaga, K., Schier, A. F., Resendez-Perez, D., Affolter, M., Otting, G., and Wuthrich, K. (1994) Cell 78, 211-223[CrossRef][Medline] [Order article via Infotrieve]
49. Wolberger, C., Vershon, A. K., Liu, B., Johnson, A. D., and Pabo, C. O. (1991) Cell 67, 517-528[CrossRef][Medline] [Order article via Infotrieve]
50. Hanaoka, S., Nagadoi, A., Yoshimura, S., Aimoto, S., Li, B., de Lange, T., and Nishimura, Y. (2001) J. Mol. Biol. 312, 167-175[CrossRef][Medline] [Order article via Infotrieve]
51. Nishikawa, T., Nagadoi, A., Yoshimura, S., Aimoto, S., and Nishimura, Y. (1998) Structure 6, 1057-1065[Medline] [Order article via Infotrieve]


Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. ProteomicsHome page
I. Matic, M. van Hagen, J. Schimmel, B. Macek, S. C. Ogg, M. H. Tatham, R. T. Hay, A. I. Lamond, M. Mann, and A. C. O. Vertegaal
In Vivo Identification of Human Small Ubiquitin-like Modifier Polymerization Sites by High Accuracy Mass Spectrometry and an in Vitro to in Vivo Strategy
Mol. Cell. Proteomics, January 1, 2008; 7(1): 132 - 144.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. L. Brown, D. J. Grau, S. K. DeVido, and J. A. Kassis
An Sp1/KLF binding site is important for the activity of a Polycomb group response element from the Drosophila engrailed gene
Nucleic Acids Res., September 9, 2005; 33(16): 5181 - 5189.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Lederer, B. M. Jockusch, and M. Rothkegel
Profilin regulates the activity of p42POP, a novel Myb-related transcription factor
J. Cell Sci., January 15, 2005; 118(2): 331 - 341.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
T. Mahmoudi, L. M. P. Zuijderduijn, A. Mohd-Sarip, and C. P. Verrijzer
GAGA facilitates binding of Pleiohomeotic to a chromatinized Polycomb response element
Nucleic Acids Res., July 15, 2003; 31(14): 4147 - 4156.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/49/47385    most recent
M202341200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mohrmann, L.
Right arrow Articles by Verrijzer, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mohrmann, L.
Right arrow Articles by Verrijzer, C. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement