HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 5, 3419-3423, February 1, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/5/3419    most recent C100642200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Blumenstein, Y. Articles by Dascal, N. Search for Related Content PubMed PubMed Citation Articles by Blumenstein, Y. Articles by Dascal, N. Social Bookmarking                      What's this?

A Novel Long N-terminal Isoform of Human L-type Ca²⁺ Channel Is Up-regulated by Protein Kinase C^*

Yakov Blumenstein, Nataly Kanevsky, Gideon Sahar, Rachel Barzilai, Tatiana Ivanina, and Nathan Dascal^§

From the Department of Physiology and Pharmacology, Sackler School of Medicine, Tel Aviv University, Ramat Aviv 69978, Israel and  Rabin Medical Center, Petach Tikva 49100, Israel

Received for publication, November 7, 2001, and in revised form, December 10, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

Human L-type voltage-dependent Ca²⁺ channels (_1C, or Ca_v1.2) are up-regulated by protein kinase C (PKC) in native tissues, but in heterologous systems this modulation is absent. In rat and rabbit, _1C has two N-terminal (NT) isoforms, long and short, with variable initial segments of 46 and 16 amino acids, respectively. The initial 46 amino acids of the long-NT _1C are crucial for PKC regulation. However, only a short-NT human _1C is known. We assumed that a long-NT isoform of human _1C may exist. By homology screening of human genomic DNA, we identified a stretch (termed exon 1a) highly homologous to rabbit long-NT, separated from the next known exon of _1C (exon 1b, which encodes the alternative, short-NT) by an ~80 kb-long intron. The predicted 46-amino acid protein sequence is highly homologous to rabbit long-NT. Reverse transcriptase PCR showed the presence of exon 1a transcript in human cardiac RNA. Expression of human long-NT _1C in Xenopus oocytes produced Ca²⁺ channel enhanced by a PKC activator, whereas the short-NT _1C was inhibited. The long-NT isoform may be the Ca²⁺ channel enhanced by PKC-activating transmitters in human tissues.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

Voltage-dependent L-type Ca²⁺ channels are crucial for cardiac and smooth muscle contraction and hormone secretion, and they regulate gene expression in the brain (1-3). Their function is highly regulated by hormones and neurotransmitters, largely via activation of protein kinases (3, 4). Regulation by PKC¹ is believed to be of substantial physiological importance, mediating all or part of the effects of several hormones and intracellular messengers (4). PKC enhances L-type Ca²⁺ currents in diverse human tissues and cell lines: heart, neuroblastoma, T-cells, and endocrine cells (5-10). Dual modulation by PKC is often observed with activation followed by, or concomitant with, inhibition (5, 10). Similar enhancement by PKC, sometimes followed by inhibition, has been described in other mammals (11, 12) and was reproduced in Xenopus oocytes expressing the cloned rabbit cardiac L-type Ca²⁺ channels (13, 14). However, expression of human L-type channels, encoded by all cDNA cloned to date, yielded Ca²⁺ channels that were only inhibited by PKC; the enhancement could not be reconstituted (15). The reason for the inability to reproduce the PKC modulation of human L-type channels remained unknown.

The main, pore-forming subunit of cardiac/smooth muscle L-type channel (_1C or Ca_v1.2), also present in the brain, is the product of the _1C gene, CACNA1C (16). Several splice variants of CACNA1C are known (17, 18). The resulting isoforms of human _1C protein show differential distribution in human tissues, and in failing versus normal myocardium. They play important roles in Ca²⁺-dependent inactivation, oxygen sensing, and drug sensitivity (18-22). However, the genomic structure of the beginning of N-terminal region of human _1C is not entirely clear. In the two best studied mammalian species, rat and rabbit, two N-terminal isoforms of _1C cDNA are known, which most probably represent variable splicing products of the same gene (23). These splice variants encode long- and short-NT _1C proteins, with variable initial segments of 46 and 16 aa, respectively (23-26) (the total length of the cytosolic part of the NT region of _1C is ~154 aa in the long-NT _1C). Traditionally, the short-NT isoform is called "neuronal" in rat and "smooth muscle" in rabbit, whereas the long-NT isoform is considered "cardiac" in rabbit. However, in rat, _1C protein containing the long-NT is found in both heart and brain (27). The known human _1C is highly homologous to short-NT isoforms of rat and rabbit; the long-NT isoforms of rat and rabbit are also highly homologous to each other. Because the human L-type channel is up-regulated by PKC, and because the initial 20 aa of the long-NT isoform are crucial for this regulation in rabbit _1C (27, 28), we reasoned that a long-NT isoform of human _1C should also exist.

Here we demonstrate the presence of an exon encoding the initial 46-aa long-NT segment in the human genomic DNA. The existence of _1C RNA containing this segment was confirmed by RT-PCR gel analysis and DNA sequencing of the RT-PCR product. Using the RT-PCR products, we have demonstrated that cDNA coding for a full-length long-NT _1C isoform expressed in Xenopus oocytes produces a Ca²⁺ channel that is enhanced by a PKC activator. The identification of the long-NT isoform of human _1C will enable the study of the molecular mechanisms of PKC modulation, which has previously been hampered by the inability to reconstitute this modulation in expression systems.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

Tissues and Oocyte Culture-- All experiments with human and animal tissues were approved by the Tel Aviv University Helsinki Committee and the Sackler School of Medicine Animal Use Committee, respectively. Rat atria and ventricles were obtained from 19-day-old Wistar rats after decapitation performed under ether anesthesia. Xenopus frogs were maintained and operated on, and oocytes were prepared as described (29). Each oocyte was injected with 2.5 ng of RNAs of _1C, ₂/, and 2A subunits and incubated for 3-4 days at 20-22 °C in NDE96 solution (96 mM NaCl, 2 mM KCl, 1 mM MgCl₂, 1 mM CaCl₂, 2.5 mM sodium pyruvate, 50 µg/ml gentamycin, 5 mM HEPES, pH 7.5).

RT-PCR Analysis-- 5 µg of total human cardiac RNA purchased from Ambion, Inc. (catalog no. 7966, lot 110P43B) was reverse-transcribed with SuperScript II reverse transcriptase (Invitrogen) with primer 3 (see text below and Fig. 2A). Each PCR reaction (50 µl) contained 2.4 µl of the product of RT reaction, 1 µl of 10 mM dNTPs, 20-50 pmol of primers, 5 µl of 10× PCR buffer, 2 µl of Mg²⁺ (2 mM), and 0.7 µl of Taq DNA polymerase (Promega). PCR was performed under the following conditions: 95 °C for 1 min, 49 °C for 1 min, and 72 °C for 2 min, repeated 35 times. The final elongation was performed at 72 °C for 5 min. The PCR products were analyzed on a 1% agarose gel.

The primers used for RT and PCR were: No. 1, CTTCGAGCCTTTGTTCAG (nt 4-21 from A in ATG of exon 1a); No. 2, TCAATGAGAATACGAGGA (nt 5-22 in exon 1b; numbering from ATG of the short-NT isoform _1C,77 (17)); No. 3, ATTGGTGGCGTTGGAATC (nt 468-451; numbering from ATG of exon 1b); No. 4, TAAAGTGAAATAAAGAGT (within the proposed intron between exon 1a and exon 1b; nt 95529-95546 in contig 3810573²; +149 nt from A in ATG of exon 1a); No. 5, ATACCACTACTGAATATA (within the same intron, nt 95896-95913 in contig 3810573; +516 nt from A in ATG in exon 1a); No. 6, AACTGAGAAAGTGGCTTT (2369 nt upstream from A in ATG of exon 1a; nt 93010-93027 in contig 3810573); No. 7, GCAGGTTAGTGTAGGAAT (1339 nt upstream from A in ATG of Exon 1a; nt 94040-94057 in contig 3810573); No. 9, CCATTCGACAATGCTGAT (nt 369-352 in exon 2; numbering from ATG of exon 1b of _1C,77); No. 10, GATACGATACGGCCATGT (within the proposed 5'-UTR of exon 1a, 147 nt upstream from A in ATG of exon 1a; nt 95232-95239 in contig 3810573).

DNA Constructs-- cDNAs of ₂/ and 2A were as described (30). cDNA of human short-NT isoform _1C,77 (Ref. 31; GenBank^TM accession No. Z34815) was obtained from Dr. R. Zuhlke and subcloned into pGEM-HJ vector (which contains 5'- and 3'-UTRs of Xenopus -globin flanking the polylinker). In the resulting construct, termed _1C,77S, the 5'-UTR of -globin is followed by a BamHI restriction site and then immediately by the initial ATG. The coding sequence of _1C,77 is followed by the 3'-UTR of -globin and then by a SalI site. The DNA of the long-NT, termed _1C,77L, was constructed as follows. The human heart cDNA obtained in the RT reaction described above was subjected to PCR with the reverse primer No. 3 (see above) and a forward primer ATTCGCGGATCCATGCTTCGAGCCTTTGTT that overlaps the first 18 nt of the coding part of exon 1a (starting with ATG) and also creates a BamHI restriction site preceding ATG. The PCR product was digested with BamHI and MfeI (a unique MfeI site is present in exon 3 upstream of primer No. 3) and inserted between these restriction sites into BamHI/MfeI-digested _1C,77S in place of the original DNA segment flanked by these sites. The 5' portion of the resulting DNA was sequenced. The sequence of the BamHI-MfeI segment obtained by this RT-PCR subcloning procedure was 100% identical to that predicted for the long-NT splice variant (based on the DNA sequence of chromosome 12), in which exon 1a is followed by exons 2 and 3 (see Fig. 1C). RNA was synthesized as described (29).

Electrophysiology-- Whole cell currents were recorded using the Gene Clamp 500 amplifier (Axon Instruments, Foster City, CA) using the two-electrode voltage clamp technique, as described (30), in a solution containing 40 mM Ba(OH)₂, 50 mM NaOH, 2 mM KOH, and 5 mM HEPES, titrated to pH 7.5 with methanesulfonic acid. PMA and bisindolylmaleimide (BIS) were purchased from Sigma. Oocytes were treated with BIS essentially as described (32). In brief, the oocyte was injected with 30 nl of a water solution of BIS at 150 µM and, in addition, incubated in 5 µM BIS 2-4 h before recording. Stimulation, data acquisition, and analysis were performed using pCLAMP software (Axon Instruments).

	RESULTS AND DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

The initial exon of the previously described (17) human _1C clone, which we now designate exon 1b, contains a 5'-UTR and encodes the first 16 aa of the short-NT _1C protein. To find out whether DNA sequences that encode an alternative, long-NT isoform of human _1C exist, we performed a standard BLAST search of human genomic DNA,² using as our query the cDNA sequence encoding the first 46 aa of the rabbit cardiac long-NT clone (24). The initial search showed the presence of a highly homologous sequence in the contig 3810573³ from human chromosome 12, locus p13.3 (Fig. 1A; the region of the initial search is highlighted by bold letters). This is within the region where the gene of _1C, CACNA1C, is located. Significantly, the sequence upstream from this segment showed significant homology to the 5'-UTR of the rabbit _1C (Fig. 1A), supporting the possibility that it may be part of an initial exon of a human L-type channel. We have designated this tentative exon as 1a. Within the presumably protein-coding part of exon 1a, a 45-base-long DNA segment, starting at base 16 (from the initial ATG) also shares 40% homology with the protein-coding part of exon 1b (Fig. 1A).

View larger version (48K): [in this window] [in a new window]   Fig. 1.   The newly identified exon 1a and the proposed DNA and protein structure of two NT isoforms of human 1C. A, nucleotide homology between rabbit heart (RH) long-NT cDNA, the homologous part of human chromosome 12 corresponding to the proposed exon 1a (ex1a), and the coding sequence of the known exon 1b (ex1b). Full homology is indicated by asterisks. Bold letters show the protein-coding sequence of long-NT isoforms. B, the location of exons and introns according to the draft map of chromosome 12 available at the NCBI site. C, the DNA sequences corresponding to proposed alternative splice variants encoding long- and short-NT isoforms of 1C. The middle section shows the 5' part of the CACNA1C gene, with boxes representing exons and angled lines representing introns. D, comparison of the protein sequences of rabbit cardiac 1C and the two proposed isoforms of the human 1C. Asterisks show fully conserved aa; bold letters highlight the PKC phosphorylation sites responsible for the inhibitory effect of PMA in rabbit 1C (35); the underlined residues are those that differ in rabbit and human long-NT 1C.

The availability of the draft sequence of the human chromosome 12 on the NCBI Human Genome site allowed us to map the location of the putative exon 1a relative to the known exons of the human _1C gene (Fig. 1B). Exon 1a precedes exon 1b and is separated from the latter by ~80 kb. We assume that this is a large intron. Two other large introns are found, according to the draft map of the chromosome, between exon 1b and exon 2 (~60 kb) and between exons 3 and 4 (~330 kb). These large introns have not been fully sequenced previously; introns of >5 and 2.4 kb have been reported (17). The location of exon 1a supports the possibility that it constitutes the first alternative exon of the CACNA1C gene. The screening procedure also confirmed the presence and the correct spatial location on chromosome 12 of all the of constant and alternative exons described by Soldatov in 1994 (17) (Fig. 1B show 10 of the 50 exons, excluding exon 1a).

Our working hypothesis was that exons 1a and 1b are alternative initial exons of the human CACNA1C gene (Fig. 1C). Exons 2 and 3 are probably constant (17), as supported by the conservation of the corresponding protein sequences in known long- and short-NT _1C isoforms in human, rat, rabbit, and mouse (Fig. 1D and Refs. 23, 27, and 28). The protein sequences of N termini of the proposed human _1C short- and long-NT isoforms are shown in Fig. 1D and are compared with the rabbit long-NT _1C. The segment corresponding to exon 2 starts after aa 46 in the long-NT isoform and after aa 16 in the short-NT isoform. The protein segment encoded by exon 3 starts at aa 155, exactly at the proposed junction between the cytosolic NT and the first transmembrane segment of the channel, IS1 (24).

To further substantiate our working hypothesis, we performed RT-PCR on total human cardiac RNA. cDNA was obtained by reverse transcription using primer No. 3 (Fig. 2A), which corresponds to the 3' end of exon 3. The analytical PCR was done with primers corresponding to segments of chromosome 12 DNA, as published at the NCBI Human Genome site, within the putative exons and introns of the 5' region of CACNA1C. The location of primers is shown in Fig. 2A. Clear bands were detected for all DNAs that contained exon 1a (Fig. 2B): protein-coding sequences of [exon 1a + exon 2 + exon 3] (lane 1) and [exon 1a + exon 2] (lane 3); [exon 1a including 5'UTR + exon 2] (lane 5). The sizes of the DNAs corresponded to those expected for an RNA transcript that contains exons 1a, 2, and 3 without 1b. Control reactions, with primers within the presumed intron regions (lanes 6 and 7) and ~1.4-2.4 kb upstream from the beginning of exon 1a (lane 8) did not yield signals. Another cDNA segment that included protein-coding sequences of exon 1a, 2, and (part of) 3 was obtained for subcloning purposes (see "Experimental Procedures") and sequenced. The size and the DNA sequence of this RT-PCR product were exactly as expected for [exon 1a + exon 2 + exon 3 up to MfeI site] without exon 1b and encoded the first 46 aa of the proposed long-NT isoform of _1C followed by protein sequences highly conserved in all known isoforms of _1C. These results strongly support the presence in human cardiac tissue of an RNA species encoding the proposed long-NT isoform shown in Fig. 1, C and D.

View larger version (58K): [in this window] [in a new window]   Fig. 2.   RT-PCR supports the existence of human long-NT isoform. A, the location of primers used for RT-PCR. B, RT-PCR products obtained with the primer pairs shown below the lanes. Primers were added to the PCR reactions at 50 pM. The sizes of DNAs expected from the hypothesis of Fig. 1A were, by lanes (in nt): 1, 547; 2, 463; 3, 449; 4, 365; 5, 591; 6-8, no PCR products were expected. C, RT-PCR with 20 pM primers, showing lanes 3 and 4 as in panel B.

A band corresponding to the DNA of exons [1b + 2 + 3] was also obtained; the size was exactly as expected for a short-NT isoform, without 1a (Fig. 2B, lane 2). Under standard conditions the band corresponding to [exon 1b +exon 2] was not detected (Fig. 2B, lane 4), but varying the conditions of PCR revealed this band, although it still remained relatively weak (Fig. 2C). Thus, RNA of the previously described short-NT isoform is also present in human cardiac tissue.

Previously, the existence of a long-NT _1C protein in rat has been demonstrated by Western blot with a polyclonal antibody directed against the unique initial 46 aa of the rabbit long-NT isoform (27). The same antibody detected a >220 kDa protein (presumably the L-type Ca²⁺ channel) in a human colon cancer cell line (33). These results corroborate the presence of the long-NT _1C protein in human tissues. Taken together, our data and those of Ref. 33 support the notion that human cardiac (and probably other) tissues contain two N-terminal isoforms of _1C protein, a long-NT and a short-NT one, which are products of alternatively spliced RNA transcripts of the 5'-terminal region of the CACNA1C gene (as shown in Fig. 1, C and D).

According to our initial hypothesis, the long-NT _1C should be up-regulated by the activation of PKC. To test this prediction, we constructed a cDNA encoding a long-NT _1C on the basis of a human short-NT _1C DNA, _1C,77 (19). Both cDNAs were subcloned into the pGEM-HJ vector and verified by DNA sequencing (see "Experimental Procedures"). The long-NT clone was designated _1C,77L and the short-NT clone _1C,77S. The corresponding RNAs were synthesized in vitro and injected into Xenopus oocytes with RNA of the ₂/ subunit with or without RNA of the 2A subunit (30). The voltage-dependent Ba²⁺ currents (I_Ba) via the expressed _1C,77L and _1C,77S Ca²⁺ channels ranged from 100 to 800 nA without 2A and from 1500 to 7000 nA with 2A. The kinetics of I_Ba of _1C,77L and _1C,77S (e.g. Fig. 3C) were very similar to each other and to those directed by rabbit cardiac _1C. The other parameters also resembled those previously reported for L-type Ca²⁺ channels of various species. For instance, as described previously for the rabbit _1C (30, 34), coexpression of the 2A subunit increased the current amplitude 9.5 ± 0.4-fold in _1C,77L and 9.3 ± 0.6-fold in _1C,77S, and shifted the voltage dependence of activation to more negative potentials, as shown by normalized current-voltage curves (Fig. 3A). Peak I_Ba was similar in the long-NT and short-NT isoforms; the small difference was statistically significant (Fig. 3B), but at present we do not know whether this reflects differences in protein expression or in the gating properties of the two isoforms.

View larger version (27K): [in this window] [in a new window]   Fig. 3.   PKC up-regulates the long-NT isoform of human 1C. In all cases, data are shown as the mean ± S.E., and the numbers of cells tested are indicated above the bars. **, indicates p < 0.01 (by t test). A, current-voltage relations of 1C,77S and 1C,77L expressed with 2/ with or without 2A. B, relative amplitudes of peak IBa of 1C,77S and 1C,77L (with 2/ + 2A) measured at +20 mV in four oocyte batches. In each oocyte, IBa was normalized to the average current amplitude of the 1C,77L group of the same batch. C, the effect of 10 nM PMA in a representative oocyte expressing 1C,77L + 2/ + 2A. IBa was measured by 300-ms steps to 20 mV from a holding potential of 80 mV delivered every 30 s. D, the time course of PMA effect in two oocytes of the same donor expressing the two 1C isoforms (with 2/ + 2A). PMA was applied at time point zero after stabilization of the leak and Ba2+ currents (see Ref. 13 for details of PMA use). E, summary of experiments done with PMA.

The prediction that the long-NT human _1C should be enhanced by PKC has been fully confirmed. The main effect of the phorbol ester -PMA (a PKC activator) was to increase the Ba²⁺ current of _1C,77L coexpressed with ₂/ with or without 2A (Fig. 3, C-E). As in the rabbit _1C channel (13), the increase reached a maximum within 5-8 min and was followed by a decrease, sometimes below the basal current level (Fig. 3D). In contrast, the short-NT _1C,77S channels were inhibited by PMA (Fig. 3D), in line with the previous report (15). On average, PMA increased the current via the long-NT channels by 22.7 ± 4.4% in the absence of 2A subunit and by 21.2 ± 4.2% in its presence (Fig. 3E). The PMA-induced increase in I_Ba was fully blocked by the specific PKC inhibitor, bisindolylmaleimide (Fig. 3E; bar marked BIS), supporting the notion that the enhancement of I_Ba by PMA was indeed mediated by PKC. Thus, in general, the modulation of the human long-NT isoform by PKC is similar to that of the rabbit cardiac channel. With rabbit cardiac L-type channel, coexpression of 2A substantially weakens the enhancement of the current by PMA (13), whereas in the human channel this action of 2A is less pronounced. It would be of interest to see whether this is due to one of the few differences in the primary amino acid composition of the 46-aa-long initial NT segment in human and rabbit (Fig. 1D, underlined amino acids).

In a different expression system (human embryonic kidney cell line tsA-201), only inhibition of the rabbit long-NT _1C by PMA has been observed (35). The inhibition crucially depended on the presence of each of the two threonines, Thr²⁷ and Thr³¹ (shown in bold in Fig. 1D), in which phosphorylation by PKC was proposed to underlie this modulation. It has been proposed that the lack of PKC-induced enhancement in tsA-201 cells may result from the absence of a specific PKC isozyme (35). At present, we do not know whether the phosphorylation of Thr³¹ (Thr²⁷ is absent in the long-NT human _1C; Fig. 1D) plays a role in any of the PKC effects observed in Xenopus oocytes. We suspect that the mechanism of PMA-induced inhibition of _1C in oocytes is different from that observed in tsA-201 cells, because a short-NT isoform of rat _1C was not sensitive to PMA in this system (35), whereas the homologous short-NT human _1C is inhibited by PKC in Xenopus oocytes (Ref. 15 and Fig. 3). Furthermore, the decrease of I_Ba is still observed in the presence of BIS (Fig. 3E), whereas in tsA-201 cells PKC inhibitors blocked the effect of PMA (35). The PMA-induced inhibition of human L-type Ca²⁺ channels observed in Xenopus oocytes requires further study.

Because the most widely observed effect of PKC activators on human L-type Ca²⁺ channels is an enhancement of the current (sometimes accompanied by an inhibition (5-10)), and because this regulation is reproduced with the long-NT _1C in Xenopus oocytes, we propose that the long-NT _1C is the isoform that underlies the PKC-induced enhancement. The homologous long-NT rabbit _1C isoform behaves in the same way when expressed in oocytes (13, 28), probably by means of an identical molecular mechanism as in human _1C. The four aa following the initial methionine in rabbit long-NT _1C, LRAL, are necessary for PKC-induced enhancement. Because this protein segment contains no putative phosphorylation sites, we have proposed that PKC phosphorylation occurs elsewhere in _1C or in an auxiliary protein, whereas the first five aa play a role in PKC anchoring or in channel gating (27). The short-NT isoform lacks these four amino acids; its initial 15-aa segment (following the first methionine) carries a partial homology to amino acids 6-20 of the long-NT isoform (Fig. 1D). In rabbit long-NT _1C, the first 20 aa play the role of the inhibitory gating element, which reduces the open probability of the L-type channel⁴ (27, 28). It would be of great interest to see whether this is also the case in human long-NT _1C. We hope that the discovery of the long-NT isoform of human _1C and the demonstration of its modulation by PKC, as described in this report, will provide the basis and the incentive for future studies of PKC targets (_1C or an auxiliary protein?) and of the interaction between the phosphorylated and gating parts of _1C in PKC modulation.

	ACKNOWLEDGEMENTS

We thank R. Zuhlke and N. Soldatov, who kindly provided the cDNA of _1C,77; G. Ast for advice; and J. Hirsch for critical reading of the manuscript.

	FOOTNOTES

^* This work was supported by Israel Basic Research Grant 47/00-16.0.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ To whom correspondence should be addressed. Tel.: 972-3-6405742; Fax: 972-3-6409113; E-mail: dascaln@post.tau.ac.il.

Published, JBC Papers in Press, December 11, 2001, DOI 10.1074/jbc.C100642200

² Found on the Web at ncbi.nlm.nih.gov/BLAST.

³ NCBI accession number AC005342.

⁴ N. Kanevsky and N. Dascal, unpublished observations.

	ABBREVIATIONS

The abbreviations used are: PKC, protein kinase C; aa, amino acid; NT, N-terminal; nt, nucleotide; UTR, untranslated region; RT, reverse transcriptase; PMA, 4-phorbol 12-myristate 13-acetate; BIS, bisindolylmaleimide; contig, group of overlapping clones.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS AND DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				S. Dai, D. D. Hall, and J. W. Hell Supramolecular Assemblies and Localized Regulation of Voltage-Gated Ion Channels Physiol Rev, April 1, 2009; 89(2): 411 - 452. [Abstract] [Full Text] [PDF]

				H. Liu, M.-m. Wu, and H. H. Zakon A Novel Na+ Channel Splice Form Contributes to the Regulation of an Androgen-Dependent Social Signal J. Neurosci., September 10, 2008; 28(37): 9173 - 9182. [Abstract] [Full Text] [PDF]

				N. Kanevsky and N. Dascal Regulation of Maximal Open Probability Is a Separable Function of Cav{beta} Subunit in L-type Ca2+ Channel, Dependent on NH2 Terminus of {alpha}1C (Cav1.2{alpha}) J. Gen. Physiol., June 26, 2006; 128(1): 15 - 36. [Abstract] [Full Text] [PDF]

				H. Zhou, K. Yu, K. L. McCoy, and A. Lee Molecular Mechanism for Divergent Regulation of Cav1.2 Ca2+ Channels by Calmodulin and Ca2+-binding Protein-1 J. Biol. Chem., August 19, 2005; 280(33): 29612 - 29619. [Abstract] [Full Text] [PDF]

				H. I. Akbarali Signal-Transduction Pathways that Regulate Smooth Muscle Function II. Receptor-ion channel coupling mechanisms in gastrointestinal smooth muscle Am J Physiol Gastrointest Liver Physiol, April 1, 2005; 288(4): G598 - G602. [Abstract] [Full Text] [PDF]

				L. Yang, G. Liu, S. I. Zakharov, J. P. Morrow, V. O. Rybin, S. F. Steinberg, and S. O. Marx Ser1928 Is a Common Site for Cav1.2 Phosphorylation by Protein Kinase C Isoforms J. Biol. Chem., January 7, 2005; 280(1): 207 - 214. [Abstract] [Full Text] [PDF]

				M. A.G. van der Heyden, T. J.M. Wijnhoven, and T. Opthof Molecular aspects of adrenergic modulation of cardiac L-type Ca2+ channels Cardiovasc Res, January 1, 2005; 65(1): 28 - 39. [Abstract] [Full Text] [PDF]

				Z. Z. Tang, M. C. Liang, S. Lu, D. Yu, C. Y. Yu, D. T. Yue, and T. W. Soong Transcript Scanning Reveals Novel and Extensive Splice Variations in Human L-type Voltage-gated Calcium Channel, Cav1.2 {alpha}1 Subunit J. Biol. Chem., October 22, 2004; 279(43): 44335 - 44343. [Abstract] [Full Text] [PDF]

				S. Weiss, T. Doan, K. E. Bernstein, and N. Dascal Modulation of Cardiac Ca2+ Channel by Gq-activating Neurotransmitters Reconstituted in Xenopus Oocytes J. Biol. Chem., March 26, 2004; 279(13): 12503 - 12510. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/5/3419    most recent C100642200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Blumenstein, Y. Articles by Dascal, N. Search for Related Content PubMed PubMed Citation Articles by Blumenstein, Y. Articles by Dascal, N. Social Bookmarking                      What's this?