![]()
|
|
||||||||
J. Biol. Chem., Vol. 277, Issue 50, 47991-48001, December 13, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
§,
¶,
, and
**
From the
Diabetes Unit and Medical Services and the
Department of Molecular Biology, Massachusetts General Hospital, and
the Department of Medicine, Harvard Medical School, Boston,
Massachusetts 02114 and
MDS Proteomics, Toronto, Ontario M9W
7H4, Canada
Received for publication, March 19, 2002, and in revised form, September 12, 2002
| |
ABSTRACT |
|---|
|
|
|---|
The protein kinase MST1 is proapoptotic when
overexpressed in an active form, however, its physiologic regulation
and cellular targets are unknown. An overexpressed inactive MST1 mutant
associates in COS-7 cells with an endogenous 761-amino acid polypeptide
known as "death-associated protein 4" (DAP4). The DAPs are a
functionally heterogeneous array of polypeptides previously isolated by
Kimchi and colleagues (Kimchi, A. (1998) Biochim. Biophys.
Acta 1377, F13-F33 in a screen for elements involved in
the interferon MST1 (1) (also known as Krs-2 (2)) is a
487-aa1 mammalian protein
kinase best classified as a group II GC kinase (3, 4). MST1 (and its
close homolog MST2/Krs-1) contains a Ste20-related kinase catalytic
domain in the amino-terminal segment (aa 30-270) followed by a
noncatalytic tail that contains successively an autoinhibitory domain
(aa 331-394), a dimerization domain (after aa 431), and a nuclear
localization signal at the COOH terminus (1, 2, 5). Although initially
identified as a kinase activated late after transformation by v-Src,
MST kinase activity can also be activated by certain severe stresses,
such as 0.25 M sodium arsenite or heat shock at 55 °C,
as well as by protein phosphatase inhibitors such as okadaic acid (2).
Nevertheless, the physiologic regulation of MST1 and -2 remains
obscure. MST1 contains a caspase 3 cleavage site at DMED326, just
amino-terminal to the autoinhibitory domain, and cleavage of MST1
occurs during apoptosis initiated by a variety of stimuli, which yields
a 36-kDa catalytic fragment whose specific activity is increased about 10-fold over the parent MST1 (6-8). In addition, overexpression of
either wild-type MST1 or a carboxyl-terminal truncated mutant (but not
a kinase inactive MST) is itself sufficient to initiate apoptosis.
Reciprocally, overexpression of a kinase-inactive mutant of MST1 is
able to partially suppress the apoptosis induced by the anti-tumor
agents cytotrienin A (9), MT-21 (10), or staurosporine, suggesting that
the recruitment of MST plays a significant role in the apoptosis
induced by these agents. The mechanism of MST-induced apoptosis is not
well defined; overexpression of MST1 is accompanied by activation of
SAPK/JNK (6, 9, 11), and coexpression with a dominant inhibitory SAPK
mutant partially suppresses MST1-induced apoptosis (12). Moreover,
whereas wild-type MST1 is a cytoplasmic protein, caspase-cleaved MST
enters the nucleus and induces chromatin condensation followed by
internucleosomal DNA fragmentation (13, 14), suggesting that nuclear
entry of MST may be important to the expression of its proapoptotic action.
In an effort to gain further insight into the mechanism of MST1
cellular actions, we transiently overexpressed a kinase-inactive, caspase-resistant mutant of MST1 and analyzed by mass spectrometry the
polypeptides recovered in association with MST1. Herein we characterize
the physical and functional interactions of MST1 with one candidate
partner identified thereby, death-associated protein 4 (DAP4).
Identification of DAP4 as a MST1-associated Protein--
In an
effort to identify proteins that associate with MST1 in intact cells
with sufficient avidity to survive extraction and washing, a
FLAG-tagged MST1 was overexpressed transiently in COS-7 cells and
recovered by affinity purification on anti-FLAG-agarose. The MST1 was
rendered kinase inactive by mutation at the ATP binding site (K59R) so
as to avoid the induction of apoptosis, and the caspase 3 cleavage site
was also mutated (D326N). Cells transfected in parallel with empty
vector were processed in tandem. Forty-eight hours after transfection,
the cells were extracted into buffer containing 1% Triton X-100 A with
protease inhibitors. The supernatant of a 13,500 × g,
15-min centrifugation was adsorbed onto FLAG-agarose, washed
extensively in the lysis buffer with and without 1 M NaCl, eluted at pH 2.5, concentrated, and subjected to SDS-PAGE. After staining with Coomassie Blue, the lane containing the sample prepared from cells transfected with empty vector showed only a faint band of
light chain; the lane containing FLAG-MST1 exhibited a major band at 61 kDa and 10 minor bands at about 1-10% abundance of the 61-kDa
FLAG-MST1. Each of the latter was excised, subjected to tryptic
digestion in situ, and analyzed by tandem mass spectrometry, using the nanospray MS-MS approach (15). Among the seven bands at
Mr < 61,000, five were fragments of
MST1. Among the three bands at Mr > 61,000, two
were heat shock proteins (HSP 90 and 70). A third band, at
Mr 88,000, contained 5 tryptic peptide
fragments, two of which could be assigned to p52rIPK
(regulator of the inhibitor of
protein kinae R), a 492-amino acid
polypeptide modulator of the PKR inhibitor, p58IPK (16),
and three other tryptic peptides that could be identified within the
human expressed sequence tag polypeptide GI1616050 (AA076164).
Alignment of overlapping human, mouse, and rat expressed sequence tags
enabled the assembly of a sequence that extended amino-terminal from
GI1616050 to produce an identical overlap with amino acids 389-488 of
p52rIPK. Combining the sequence of p52rIPK and
the overlapping human, mouse, and rat expressed sequence tags yielded a
polypeptide of 761 amino acids. Blast of this combined sequence against
human genomic sequences yielded several matches exceeding 90% on
different chromosomes. Shortly thereafter a 761-amino acid sequence was
deposited in the nonredundant data bank (accession number AF081567) by
Barzilay and Kimchi under the name "death-associated protein 4,"
which differed at five amino acids from our assembled sequence. The
sequence of DAP4 is shown in Fig. 1A; it is identical with
p52rIPK over the NH2-terminal 488 amino acids.
DNA Constructs and Manipulations--
DAP4 was cloned from human
skeletal muscle cell cDNA library using PCR 5' primer,
GCGGGATCCATGCCGAACTTCTGCGCTGCC, and 3' primer, GGCGGCCGCTTAGGTATTTTCCACAGTTTC. Mouse MST1 cDNA was kindly provided by Leonard Zon (Children's Hospital, Boston, MA). Constructs encoding wild-type p53 and a mutant p53 miniprotein (p53 aa 302-393) (17, 18)
were generous gifts from Dr. Moshe Oren. DNA manipulations were
performed using the standard techniques (19). Full-length, truncated,
and point mutations of constructs were subcloned into different
plasmids including pCMV5 FLAG, pEBG GST, pEGFP-C1, pEGFP-N1, and
pdsRed-N1. All the constructs were verified by DNA sequencing.
Cell Cultures and Transfection--
COS-7, HEK 293, and HeLa
cells were cultivated in Dulbecco's modified Eagle's medium
supplemented with 10% fetal bovine serum (Sigma), 100 units/ml
penicillin, and 0.1 mg/ml streptomycin in 10% CO2
atmosphere at 37 °C. NIH 3T3 were cultivated as above except 10%
bovine calf serum (Invitrogen) was used. Cells were replaced at
a density of 3-5 × 106 per 10-cm dish and
transfected 5 h later with a total of 8 µg of DNA and 30 µl of
LipofectAMINE per dish following the manufacturer's instruction (Invitrogen).
Cell Lysate, Immunoprecipitation, and Immunoblot Assay--
The
binding assays in vitro employed extracts from HEK 293 cells
expressing recombinant FLAG or GST fusion proteins individually. At
48 h after transfection, cells were snap frozen and stored at
The studies of binding in vivo, mapping of the sites of
DAP4/MST1 association, DAP4/p53 association, and DAP4 dimerization were
carried out after cotransfection of the constructs indicated into COS-7
or HEK 293 cells. The procedures of cell lysis and immunoaffinity
purification were as described above.
Immunocytochemistry and Fluorescence Microscopy of Cultured
Cells--
HEK 293, HeLa, and NIH 3T3 cells were cultured in 60-mm
plates and transfected with 3-4 µg of GFP/red fluorescent
protein-tagged cDNA constructs using 15 µl of
LipofectAMINE. In some cases, 6 µl of FuGENE (Roche Molecular
Biochemicals) or 15 µl of LipofectAMINE 2000 (Invitrogen) were used.
At 24 h after transfection, cells were incubated with 0.2 µg/ml
Hoechst 33342 for 30 min at 37 °C and observed directly by
fluorescence microscopy. The same plates were also observed after 48 and 72 h transfection. To examine the effect of leptomycin B on
cellular localization, 10 ng/ml leptomycin B or carrier was added to
the cells at 24 h after transfection, and images were taken from
20 min to 1 h after addition of leptomycin B.
When used for immunocytochemistry, cells were seeded onto glass
coverslips 24 h before the transfection. At the times indicated after transfection, cells were washed with PBS, fixed in methanol for
10 min, and blocked in 2% bovine serum albumin in PBS for 10 min.
Anti-FLAG mAb (10 µg/ml) was added for 30 min followed by washing
with PBS. The secondary antibody, fluorescein isothiocyanate-conjugated anti-mouse antibody (Cappel), was used at a 1:400 dilution for 30 min
then washed with PBS. Cells were incubated with 0.2 µg/ml Hoechst
33342 for an additional 30 min and washed again in PBS. The coverslips
were then mounted on a glass slide using Fluoromount-G (Southern
Biotechnology). Images were collected using a Zeiss Axiovert S100M
microscope (Carl Zeiss) connected to a CCD camera. The figures were
prepared using MetaMorph Imaging software (Universal Imaging).
Cell Death Assay--
The method used for measuring cell death
was modified from Rabizadeh et al. (20) and Sperandio
et al. (21). Briefly, HEK 293 cells were cultured in
Dulbecco's modified Eagle's medium containing 10% fetal bovine
serum. Transient transfections were performed using LipofectAMINE 2000 according to the manufacturer's instructions. A total of 1 × 106 cells were seeded in 60-mm plates and 15 µl of
LipofectAMINE 2000 was used. Twenty-four to forty-eight hours after
transfection, the pro-apoptotic agent tamoxifen was added at a final
concentration of 20-25 µM to increase the rate of
apoptosis. Floating cells were collected at 20-24 h after the addition
of tamoxifen and cell death was assessed by trypan blue exclusion method.
MST1 Kinase Assay--
For the experiment shown in Fig. 7, HEK
293 cells were transfected with FLAG-tagged MST1 and DAP4 (total 8 µg/plate in a 60-mm plate) using LipofectAMINE; some cells were
incubated with zVAD-fmk at 50 µM (BioMol) and other cells
were transfected with plasmid encoding BV p35 (22) along with the DAP4
and MST1. At 72 h after transfection, cells were rinsed, frozen,
and harvested into 0.6 ml of lysis buffer, followed by centrifugation
at 13,500 × g for 10 min. Supernatant were incubated
for 3 h at 4 °C with anti-FLAG antibody prebound to protein G
beads. The beads were then washed 4 times with 1 ml of lysis buffer and
3 times with 1 ml of kinase buffer (40 mM Hepes, pH 7.5, 10 mM MgCl2, 20 mM
In the experiments shown in Figs. 8, A and B, and
9C, the kinase assay was performed as above except using
purified, soluble proteins. To obtain the proteins, individual
FLAG-tagged constructs were transfected into HEK 293 cells. At 48 h after transfection, the clarified supernatant of a concentrated cell
lysate was incubated with 15 µl of FLAG-agarose beads (Sigma) for
3 h at 4 °C. The beads were washed 4 times with 1 ml of lysis
buffer, 4 times with 1 ml of lysis buffer containing 0.5 M
LiCl, and the FLAG-tagged proteins were then eluted by three successive
incubations in lysis buffer containing 0.1 mg/ml FLAG peptide (Sigma)
for 10 min on ice. The elutes were combined and centrifuged for 5 min
at 5000 × g through Spin-X centrifuge tube filters (Corning).
Statistical Analysis--
Data are presented as mean ± S.E. Treatment effects were evaluated using a two-tailed Student's
t test. A p value <0.05 was considered to be
statistically significant.
Characterization of the Human DAP4 Gene Family--
DAP4 was
identified as a polypeptide that was co-isolated with recombinant,
kinase-inactive MST1 (see "Materials and Methods"). In view of the
prior recovery of DAP4 in a functional screen for elements involved in
interferon-induced apoptosis, we attempted to determine whether DAP4
participated in MST-induced apoptosis.
Blast of the DAP4 polypeptide sequence against the human genome
sequence data base yields seven polypeptide sequences (shown in Fig.
1A) that exhibit >75%
identity in amino sequence with DAP4; we have arbitrarily named these
polypeptides as DAP4A (Chr11) through DAP4G(Chr1) in order of
decreasing identity. In addition, other homologous sequences can be
identified at a second site on Chr11 (65% identity to DAP4), on Chr13
(63% identity), Chr4 (52% identity), Chr6 (45% identity), and Chr15
(47% identity), with probable additional homologues on Chr6, -13, -1, and -12, and a third homologous gene on Chr11; altogether 17 human
DAP4-related genes were identifiable. The DAP4A
DNA sequence on Chr11 is identical to the deposited DAP4
cDNA, and certainly encodes the gene corresponding this cDNA
polypeptide. The DAP4A gene contains at least three introns,
and the DAP4C sequence on Chr3 contains at least one intron,
however, the DAP4B sequence on chromosome 8 lacks introns, and may represent a processed psuedogene. Among these
polypeptides only the genes on Chr11 (DAP4A) and Chr3
(DAP4C) encode sequences identical to the five peptides
identified by MS analysis of the 88-kDa MST1-associated polypeptide
(indicated in Fig. 1), and the sequence on Chr8 (DAP4B)
differs by 1 aa of the aggregate 66 aa within these peptides. Based on
available data we conclude that the polypeptide recovered in
association with MST1 is either DAP4A (=DAP4) or DAP4C; the latter is
87% identical in amino acid sequence to DAP4A. The DAP4 polypeptides
contain no domain motifs identifiable within the Prosite, Pfam, or
Interpro algorithrims.
DAP4 Polypeptide Expression--
A polyclonal antibody was raised
against the synthetic peptide Cys-KSELPTDNSETVENT, coupled
through its amino terminus to KLH. This sequence corresponds to the
carboxyl-terminal 15 amino acids of DAP4A, and is highly conserved
among the DAP4-related gene products described in Fig. 1A.
Immunoblot of extracts prepared from a variety of human cell lines,
using affinity purified anti-DAP4A(CT peptide) IgG (Fig. 1B)
showed the ubiquitous presence of a single major polypeptide band at
~88 kDa, which we presume to be DAP4A, and perhaps one or more of the
closely related gene products indicated in Fig. 1, many of which differ
in length from DAP4A by less than 15 amino acids. Some extracts exhibit
a second, faint band at ~103 kDa; the identity of this polypeptide is
unknown. Thus, DAP4-related polypeptides are commonly expressed in
human cell lines.
MST Binds to DAP4 in Vitro and in Vivo through the DAP4-(AA
363-761)--
We next employed PCR to isolate, from a human skeletal
muscle library, a cDNA corresponding exactly in sequence to the
human DAP4A, and proceeded to characterize its properties and its
interactions with MST1. Plasmids encoding GST or a GST-DAP4 fusion
protein were expressed separately in HEK 293 cells and each recombinant GST polypeptide was immobilized at comparable concentrations by adsorption to GSH-agarose. Extracts of cells transfected with FLAG-MST1, FLAG-MST (K59R), or empty vector were matched for
protein content and incubated with immobilized GST proteins; after
washing, the adsorbed proteins were eluted, subjected to SDS-PAGE, and probed with anti-FLAG antibody. As seen in Fig.
2A, both wild-type and
kinase-inactive MST1 polypeptides bind specifically to GST-DAP4. We
next examined the ability of MST1 and DAP4 to associate during transient coexpression. Both FLAG-MST1 wild-type (Fig. 2A)
and K59R (not shown) bind specifically to GST-DAP4. The binding
site on DAP4 for MST1 is located carboxyl-terminal to aa 362, and
predominantly after aa 489; thus MST1 associates with a segment in the
carboxyl-terminal half of DAP4 that is mostly distal to the
p52rIPK splice site.
DAP4 Dimerizes through Its Amino Terminus and Localizes to the
Nucleus--
Recombinant DAP4 is capable of homodimerization during
transient expression, as demonstrated by the specific recovery of
coexpressed FLAG-DAP4 with GST-DAP4; DAP4 homodimerization is mediated
by the DAP4 amino-terminal segment aa 1-488 (Fig.
3A); self-association increases progressively as the amino-terminal fragment is lengthened from 60 to 300 amino acids, mediating that the self-association surface
involves most of the amino-terminal half of DAP4 (Fig. 3B).
These results also indicate that DAP4 is as likely to dimerize with the
p52rIPK splice variant as with the full-length DAP4
polypeptide. We next ascertained the cellular localization of DAP4 by
examining the distribution of recombinant FLAG-DAP4 or DAP4 fused
in-frame with eGFP, either at the DAP4 NH2 or COOH
terminus; all three DAP4 polypeptides gave indistinguishable results.
DAP4 localizes exclusively in the nucleus, whether examined in HeLa
(Fig. 3C), HEK 293, or NIH 3T3 cells (not shown). DAP4
nuclear localization is determined by sequences near the DAP4 amino
terminus, between aa 1 and 120 (Fig. 3D). In contrast to
DAP4, GFP-MST1 is localized predominantly in the cytoplasm (Fig.
3C), at least prior to the onset of apoptosis. The finding
that endogenous DAP4 can be recovered from the cell in association with
MST1, together with the presence of a classical bipartite nuclear
localization signal at the MST1 carboxyl terminus (aa 469-487) led us
to inquire whether MST1 enters and exits the nucleus; we therefore
coexpressed GFP-MST1 with red fluorescent protein-DAP4 in several cell
types, and followed the localization of these polypeptides over time;
the localization of these two polypeptides remained distinct (Fig.
4A) until the onset of
apoptosis and nuclear membrane breakdown, whereupon substantial overlap ensued (not shown). If, however, NIH 3T3 cells expressing GFP-MST1 were
treated with leptomycin B, an inhibitor of CrmA-mediated nuclear export
(23), substantial MST1-GFP fluorescence became evident in the nucleus
within 20 min (Fig. 4B); identical results were seen in the
HeLa cells. Thus MST1 is transiting rapidly through the nucleus, with
its export mediated by the leptomycin B-sensitive CrmA nuclear export
apparatus. We next sought to define the MST1 NES signals; the MST1
carboxyl-terminal tail contains two candidate leucine-rich NES motifs,
at aa 361-370 and 444-451 (Fig.
5A). Each was mutated
separately as shown in Fig. 5B, resulting in the partial
localization of FLAG-MST to the nucleus. Concurrent mutation of both
motifs resulted in the exclusive localization of MST1 to the nucleus.
Similar findings were reported by Ura et al. (13). In
summary, DAP4 is a constitutively nuclear protein that can bind
directly the protein kinase MST1; the latter in turn cycles in and of
the nucleus.
DAP4 Augments MST1-induced Apoptosis--
As shown previously,
transient expression of MST1 results in a dose-dependent
apoptosis (6-14), e.g. as observed in HEK 293 cells (Fig.
6A). DAP4 expressed alone does
not induce cell death in HEK 293 (Fig. 6B) or HeLa cells
(not shown), however, coexpression of DAP4 with a low dose of MST1
substantially increases the extent of MST1-induced apoptosis. The
ability of MST1 to induce apoptosis requires an active kinase function,
and expression of MST1 (K59R) with or without DAP4 does not lead to
increased cell death (Fig. 6C).
The ability of DAP4 to augment MST1-induced apoptosis is not associated
with any change in the expression of the recombinant MST1 polypeptide
(Fig. 6, B and C). We therefore examined whether DAP4 alters FLAG-MST1 kinase activity (Fig.
7), measured by the FLAG-MST1-catalyzed
phosphorylation of histone 2B in vitro. Coexpression of
increasing amounts of DAP4 with FLAG-MST1 gave an apparent 2-fold
increase in FLAG-MST1 kinase activity measured in vitro (Fig. 7, lanes 2-4). A significant caveat, however, is that
the coexpression of DAP4 with MST1 augments MST1-induced apoptosis, one
consequence of which is the partial cleavage of MST1 itself, so as to
generate a catalytic fragment with increased specific activity. The
autophosphorylation of this fragment is evident in Fig. 7 (in the
third panel from the top). We therefore also carried out this experiment by adding the caspase inhibitor zVAD to the
cells during the entire period (Fig. 7, lanes 5-7) as well as by coexpression of a plasmid encoding the baculoviral general caspase inhibitor, p35 (Fig. 7, lanes 8-10). Whereas zVAD
mildly inhibited basal and DAP4-stimulated MST1 kinase activity, p35 inhibited basal MST1 activity by 70% and essentially eliminated any
stimulation of MST1 kinase by coexpressed DAP4. Based on these results
we conclude that DAP4 does not activate the kinase activity of the
full-length MST1 polypeptide, however, by augmenting MST1-induced apoptosis, DAP4 promotes the caspase-catalyzed cleavage of MST1 and the
generation of an activated MST catalytic fragment. The ability of p35
to suppress the generation of this fragment is evident in Fig. 7
(third panel from the top), wherein the
autophosphorylation of the 36-kDa fragment is seen to be suppressed by
the presence of p35 to an extent far greater than that of the
full-length MST1 polypeptide.
We next examined the ability of DAP4 to alter MST1 kinase activity
in vitro. The addition of increasing amounts of recombinant DAP4 to purified recombinant FLAG MST1 does not significantly alter the
rate of MST1-catalyzed H2B phosphorylation (Fig.
8A). Moreover, DAP4 is itself
not significantly phosphorylated in vitro by recombinant
MST1, either in the presence (Fig. 8A) or absence (Fig.
8B) of histone 2B. In summary, DAP4 augments MST1-induced apoptosis without altering MST1 abundance or intrinsic specific activity, and without serving as a substrate for MST1.
We next sought to gain insight into the mechanism by which DAP4
augments MST-induced apoptosis. DAP4s exclusive nuclear localization suggested that it might interact with a nuclear-localized proapoptotic effector of MST1. Perhaps the best characterized proapoptotic nuclear
protein is p53 (24). A role for p53 (17, 18) in MST1-induced apoptosis
is indicated by the ability of a dominant inhibitory mutant of p53 to
suppress MST1-induced cell death by about 50% (Fig.
9A). The ability of the p53
miniprotein to inhibit MST-induced apoptosis is similar in magnitude to
its ability to inhibit apoptosis in the interleukin-3-dependent
DA-1 cell line induced by interleukin-3 withdrawal or UV (18). MST1
neither binds (Fig. 9B, left panel) nor phosphorylates p53
directly in vitro (Fig. 9C), however, recombinant
DAP4 is capable of binding endogenous (Fig. 9B, right panel)
or recombinant p53 (Fig. 9B, middle panel), both during
transient expression or directly in vitro (Fig. 9B,
left panel). We propose that the ability of DAP4 to bind p53 may
underlie, at least in part, the ability of DAP4 to promote MST1-induced
cell death.
MST1 is a protein kinase whose overexpression results in apoptosis
in many cell backgrounds. Seeking insight into the mechanism of
MST-induced apoptosis we overexpressed a kinase-inactive,
caspase-resistant mutant of the MST1 in COS-7 cells and analyzed the
copurifying endogenous polypeptides using mass spectroscopy of tryptic
digests prepared from excised gel bands. We identified five tryptic
peptides from an MST1-associated 88-kDa polypeptide that were all
encompassed within a 761-aa polypeptide previously cloned by Barzilay
and Kimchi, and named DAP4. Analysis of the DAP4 gene
family in silico revealed that the human genome data base
contains 17 distinct genes encoding polypeptides homologous to DAP4. At
least seven of these genes, each on a different chromosome, encode
polypeptides with The death-associated proteins represent a functionally
heterogeneous array of polypeptides isolated by Kimchi and colleagues (31, 32) in a screen of an antisense cDNA library for inserts that
could block interferon The current report is to our knowledge, the first description of the
properties of the DAP4 polypeptide, however, some properties of
p52rIPK, a carboxyl-terminal shortened splice variant of
DAP4, have been previously described (16). The p52rIPK
polypeptide was identified in a two-hybrid screen using as bait p58IPK, a cellular inhibitor of PKR (38, 39).
p58IPK contains nine tandem TPR motifs and a
carboxyl-terminal Dn It appears that MST1 can promote apoptosis through several, possibly
independent pathways. Ura et al. (12) reported that MST1
induction of caspase 3 activation, nucleosomal DNA fragmentation, membrane blebbing, and cell rounding can be partially inhibited by a
dominant negative mutant of JNK1/SAPK In summary, we identified DAP4 as an MST1-associated protein. DAP4,
which is encoded by a member of a gene family apparently found only in
vertebrates, is a constitutively nuclear protein. Overexpression of
DAP4 does not initiate apoptosis, but substantially augments the extent
of apoptosis caused by overexpression of MST1. MST1-induced apoptosis
is dependent, in part on p53; DAP4 binds p53 as well as MST1, and is
likely to act by promoting the p53-dependent component of
MST1-induced apoptosis.
-induced apoptosis of HeLa cells. DAP4, which is
encoded by a member of a vertebrate-only gene family, contains no
identifiable domains, but is identical over its amino-terminal 488 amino acids to p52rIPK, a putative modulator of
protein kinase R. DAP4 is a widely expressed, constitutively nuclear
polypeptide that homodimerizes through its amino terminus and binds
MST1 through its carboxyl-terminal segment. MST1 is predominantly
cytoplasmic, but cycles continuously through the nucleus, as evidenced
by its rapid accumulation in the nucleus after addition of the Crm1
inhibitor, leptomycin B. Overexpression of DAP4 does not cause
apoptosis, however, coexpression of DAP4 with a submaximal amount of
MST1 enhances MST1-induced apoptosis in a dose-dependent
fashion. DAP4 is not significantly phosphorylated by MST1 nor does it
alter MST1 kinase activity in vivo or in vitro.
MST1-induced apoptosis is suppressed by a dominant interfering mutant
of p53. MST1 is unable to directly phosphorylate p53, however, DAP4
binds endogenous and recombinant p53. DAP4 may promote MST1-induced
apoptosis by enabling colocalization of MST with p53.
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
70 °C until use. One 10-cm dish of frozen cells was scraped into 1 ml of lysis buffer (50 mM Tris base, pH 7.9, 50 mM NaCl, 0.1 mM EDTA, 20 mM
-glycerophosphate, 1 mM dithiothreitol, 1 mM
phenylmethylsulfonyl fluoride, 25 nM calyculin A, 0.5%
Triton X-100, 1 tablet/50 ml of protease inhibitor (Roche Molecular
Biochemicals)). Lysates were centrifuged at 13,500 rpm for 10 min.
Aliquots of the supernatants containing equal amounts of protein,
measured by Bradford assay (Bio-Rad), were added to 15 µl of settled
GSH-agarose beads (Amersham Biosciences) and incubated at
4 °C for 3 h. Beads were washed three times with 1 ml of lysis
buffer, once with 1 ml of lysis buffer containing 0.5 M
LiCl, and again with 1 ml of lysis buffer. Thereafter, aliquots of the
lysate from the FLAG fusion protein-transfected cells matched for
proteins were added to the beads and incubated at 4 °C for another
3 h. The beads were then washed extensively and adsorbed proteins
were eluted in 15 µl of 2× SDS sample buffer, heated at 95 °C for
10 min, separated by SDS-polyacrylamide gel electrophoresis,
transferred onto polyvinylidene difluoride membranes, and probed with
antibodies as indicated. Blots were visualized using horseradish
peroxide-conjugated secondary antibody followed by chemiluminescence as
outlined by the manufacturer (Pierce).
-glycerophosphate). The kinase assay was performed in 30 µl of
reaction buffer (40 mM Hepes, pH 7.5, 10 mM
MgCl2, 20 mM
-glycerophosphate, 0.8 µg/µl histone 2B, 100 µM ATP, and 2 µCi/tube) for
15 min at 30 °C on a thermomixer. The reaction was stopped by
addition of SDS sample buffer to 1× concentration followed by boiling
for 5 min. An aliquot of the sample was separated by SDS-PAGE on a 12%
SDS-polyacrylamide gel. After transfer to a polyvinylidene difluoride
membrane and staining with Coomassie Blue, the 32P
incorporation into DAP4, MST1, and H2B was quantified by
phosphorimaging. The same membrane was used for immunoblot
determination of polypeptide abundance after decay of the
32P signal.
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES

View larger version (83K):
[in a new window]
Fig. 1.
A, alignment of DAP4 with polypeptide
sequences derived from the human genomic DNA data base (tBlastn).
Identical/conserved residues are indicated in the black
background. Highly conserved residues are indicated in the dark
gray background. The identities relative to the deposited DAP4
cDNA are: DAP4A, 100%; DAP4B, 95%; DAP4C, 87%; DAP4D,
82% DAP4E, 78% DAP4F, 79% DAP4G, 75%. The five tryptic peptide
sequences identified by MS-MS in the digest of the 88-kDa
MST1-associated polypeptide are shown below the aligned
sequences. B, immunoblot of DAP4-related polypeptide
expression in human cell lines.

View larger version (44K):
[in a new window]
Fig. 2.
The binding of DAP4 to MST1.
A, HEK 293 cells were transfected with vectors encoding GST,
GST-DAP4, or FLAG-MST1 (wild-type or the inactive mutant K59R). The GST
proteins were immobilized on GSH-agarose, washed, and lysates from mock
transfected or MST1-transfected cells were added to the GSH-agarose
beads as indicated. After further washing, the bound proteins were
subjected to SDS-PAGE and blotted with anti-FLAG mAb immunoblot.
B, recombinant GST or a GST-DAP4 fusion protein (wild-type,
aa 1-362 and 363-761) were each coexpressed in HEK 293 cells with
empty FLAG vector or FLAG-MST1. The FLAG blot of the GSH-agarose
isolate is shown in the bottom panel. The blot is
representative of one experiment repeated 3 times.

View larger version (67K):
[in a new window]
Fig. 3.
Dimerization and localization of DAP4.
A, HEK 293 cells were co-transfected with FLAG-DAP4
wild-type and GST or GST-DAP4 wild-type or GST-DAP4 aa 1-488 or
GST-DAP4 aa 489-761. B, HEK 293 cells were co-transfected
with FLAG-DAP4 wild-type and GST or GST-DAP4 fusion proteins (aa 1-60,
1-120, 1-180, 1-240, 1-300 and wild-type). Cells were lysed and
supernatants were adsorbed to GSH-agarose. After washing, retained
polypeptides were separated on an 8% SDS-polyacrylamide gel,
transferred to a polyvinylidene difluoride membrane, and immunoblotted
with anti-FLAG antibody. The FLAG blot of the GSH-agarose isolate is
shown in the bottom panel. C, HeLa cells were
transfected with GFP, DAP4-GFP, GFP-DAP4, or GFP-MST1. D,
HeLa cells were transfected with GFP or GFP fused to fragments of DAP4
(aa 1-488, 489-761, 1-120, and 363-761). Twenty-four hours after
transfection the cells were incubated with 0.2 µg/ml Hoechst 33342 to
stain nuclei, and imaged by fluorescence microscopy.

View larger version (43K):
[in a new window]
Fig. 4.
MST1 cycles between cytoplasm and
nucleus. A, HeLa cells were transfected with GFP-MST1
and DAP4-red fluorescent protein using FuGENE according to the
manufacturer's instruction. Twenty-four hours after transfection,
cells were stained with Hoechst 33342 for 30 min and were observed
under a microscope; representative nonapoptotic and early apoptotic
cells were shown. B, leptomycin B (10 ng/ml) was added to
NIH 3T3 cells expressing GFP or GFP-MST1 at 24 h after
transfection. The images shown were obtained 20 min after the addition
of leptomycin B.

View larger version (35K):
[in a new window]
Fig. 5.
MST1 bears two nuclear export signals in its
COOH-terminal noncatalytic tail. A, two putative
nuclear export signals and the mutations introduced are indicated in
the cartoon. Within the two segments, the
Leu365/Met368/Iso370 in the aa
361-370 and Leu448/Leu449/Leu451
in the aa 444-451 were all mutated to Ala. B, HeLa cells
were transfected with FLAG-MST1 wild type (upper panels) or
FLAG-MST1 bearing mutations in one or both of the putative NES. After
fixation and blocking, cells were incubated with anti-FLAG mAb followed
by fluorescein isothiocyanate (FITC)-conjugated secondary antibodies.
Cells were then incubated with Hoechst 33342 for 30 min and imaged
under the fluorescence microscope.

View larger version (18K):
[in a new window]
Fig. 6.
Effect of DAP4 on MST1-induced cell
death. HEK 293 cells were transfected with plasmids encoding DAP4
and/or MST1 in the amounts indicated. At 72 h after transfection,
cells were collected and analyzed for apoptosis as described (20, 21).
A, the effect of different amounts of MST1 on cell death.
B, cell death in response to different amounts of DAP4
alone, or in the presence of 2 µg of MST1 and increasing amounts of
DAP4; the inset is an immunoblot of DAP4-MST1
expression in the conditions indicated. C, effect of DAP4 on
cell death induced by MST1 wild type (WT) or mutant, inactive MST1
(K59R); the inset is an immunoblot of DAP4-MST1 expression.
The result is representative of one experiment repeated at least 3 times. Data are shown as mean ± S.E. (n = 3). *,
p < 0.05 compared with the absence of DAP4.

View larger version (45K):
[in a new window]
Fig. 7.
The effect of DAP4 on MST1 activity in
vivo. HEK 293 cells were co-transfected with a constant
amount of MST1 and increasing amounts of DAP4. Some cells (lanes
5-7) were incubated with 50 µM zVAD throughout,
whereas other cells (lanes 8-10) received 4 µg of p35
plasmid DNA together with the DAP4-MST1 plasmid cDNAs. After
72 h, cells were lysed and FLAG-tagged proteins were
immunoprecipitated using anti-FLAG mAb prebound to protein G. MST1
kinase activity was measured by addition of exogenous substrate H2B.
The PhosphorImager value of H2B phosphorylation by MST1 (transfected
singly, lane 2) was set as 100%. The blot is representative
of one experiment repeated 3 times. Data were mean ± S.E.
(n = 3). *, p < 0.05. Compared with
the absence of DAP4.

View larger version (42K):
[in a new window]
Fig. 8.
DAP4 is neither a regulator nor substrate of
MST1 in vitro. FLAG-MST1, FLAG-MST1 (K59R), and
FLAG-DAP4 were each expressed individually and purified using
FLAG-agarose. After elution of the purified FLAG-tagged polypeptides, a
kinase assay was performed as described under "Materials and
Methods." A, H2B serves as substrate; B, DAP4
is substrate. In A the PhosphorImager value of H2B
phosphorylation by MST1 was set to 100%; B, MST1
autophosphorylation was set as 100%. The blot is representative of one
experiment repeated 4 times. Data are mean ± S.E.
(n = 4).

View larger version (47K):
[in a new window]
Fig. 9.
p53 participates in MST1-induced cell
death. A, the effect of dominant inhibitory p53
miniprotein (p53 aa 302-393, p53 C-fg, Refs 17 and 18) on MST1-induced
cell death. HEK 293 cells were transfected with equal amounts of total
DNA as indicated. Cell death induced by p53 or MST in the absence and
presence of the p53 miniprotein was measured. A representative
immunoblot of polypeptide expression in selected conditions is shown;
an actin blot was used as a control. B, DAP4 binds p53.
Left panel, binding of p53 to DAP4 or MST1 in
vitro: HEK 293 cells were transfected with vectors encoding GST
(G), GST-MST1 (G-MST1), GST-DAP4
(G-DAP4), or FLAG-p53 (F-p53). The GST proteins
were immobilized on GSH-agarose, washed, and then the lysates from
FLAG-p53-transfected cells were added to the GSH-agarose beads. After
washing, the bound proteins were subjected to SDS-PAGE and blotted with
anti-FLAG mAb. Middle panel, association of coexpressed DAP4
and p53. Plasmids encoding GST (G) or a GST-DAP4 fusion
protein (G-DAP4) were each coexpressed in HEK 293 cells with
empty FLAG vector or FLAG-p53 (F-p53). The FLAG blot of the
GSH-agarose isolate is shown in the bottom. Right
panel, recombinant DAP4 binds endogenous p53. HEK 293 cells were
transfected with FLAG (F) or FLAG-DAP4 (F-DAP4).
FLAG-tagged proteins were immunoprecipitated using anti-FLAG mAb
prebound to protein G. The bead was subjected to intensive washed and
run on 10% SDS-PAGE. The endogenous p53 blotting is shown in the
bottom. C, SAPK, but not MST1 phosphorylates p53 in
vitro. FLAG-p53 were expressed transiently in HEK 293 cells,
purified, and eluted from FLAG-agarose. A phosphorylation reaction was
carried out in vitro using purified recombinant MST1 or SAPK
as described under "Materials and Methods." H2B was included as a
positive control. All the blots are representative of one experiment
repeated 2-3 times. Data are mean ± S.E. (n = 3). *, p < 0.05.
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
REFERENCES
75% sequence identity to DAP4; these are shown in
Fig. 1. Some of these genes, such as DAP4B on Chr8, are
likely to be processed psuedogenes, as DAP4B lacks introns
and may have a frameshift near the translational start site. In
addition to the seven sequences shown in Fig. 1, another 10 loci can be
identified that encode clearly homologous polypeptides. Six of these 17 loci are situated nearby to another family member with three distinct
homologues identifiable on Chr11. Thus the size of this newly
discovered human gene family is substantial; moreover it is clear from
the prior description of p52rIPK (16), a 492-aa polypeptide
that is identical to DAP4A over their amino-terminal 488 amino acids,
that the expression of these genes is further diversified by
alternative mRNA splicing. The DAP4 polypeptides contain no
previously recognized domain motifs. Moreover, whereas several
zebrafish expressed tag sequences encoding closely related sequences
are deposited in the data base, analysis of the completed
Caenorhabditis elegans on Drosophila
melanogaster genomes fails to reveal polypeptide sequences
or domains with homology to the DAP4 polypeptide family. We
therefore infer that the DAP4 genes arose early in
vertebrate evolution (although an earlier origin in the chordates is
possible) and underwent a rapid expansion by gene duplication,
transposition, and mutation (25-28). It is well appreciated that a
substantial increase in gene number occurred early in vertebrate
evolution, and a substantial minority of human genes and/or domains
lack an orthologue in invertebrates (29). This has been specifically
noted for a variety of polypeptides broadly involved in apoptosis,
particularly the extracellular components, adaptors, Bcl2 family
members, and the NACHT family of NTPases (30). Although the first
molecular insight into apoptosis emerged from C. elegans,
elements such as the pyrins (and the pyrin domain), SMAC/Diablo,
calpain inhibitors, interleukin-1-like molecules, and others have no
counterparts at all nematodes or arthropods (30). The disproportionate
expansion in the repertoire of apoptotic genes in vertebrates may
reflect their greater developmental complexity or perhaps more
narrowly, the requirements of acquired immunity. Thus, the elaboration
of the DAP4 gene family during vertebrate evolution is
consistent with the participation of these polypeptides as apoptotic effectors.
-induced apoptosis in HeLa cells. Seven sets
of DNA fragments with confirmed antiapoptotic activity were recovered;
two encoded fragments of the known proteins, cathespin D and
thioredoxin. Five cDNAs encoded fragments of novel polypeptides, among which the most fully characterized at present are DAP2, also
known as DAP kinase, and DAP5. The latter is a novel 97-kDa homolog of
p220 eIF-4G that lacks the NH2-terminal eIF-4E-binding domain (33). It is suggested that DAP5 may promote translation of
mRNAs whose 5'-untranslated region segments contain IRES; many such
mRNAs encode proteins involved in the control of apoptosis, whose
translation is up-regulated during stress (34). DAP2 or DAP kinase is a
calmodulin-binding protein kinase with a carboxyl-terminal death-effector domain, and bears no structural similarities to MST1/2
(35). DAP kinase overexpression promotes apoptosis at least in part by
up-regulation of p19ARF and p53 (36). Moreover, DAP kinase
expression is frequently lost in human tumors (37). DAP1 is a 15-kDa
proline-rich phosphoprotein, whereas DAP3 is a ubiquitously expressed
46-kDa polypeptide; overexpression of each results in marked apoptosis
of HeLa cells (31). The initial identification of DAP4 by Kimchi (31)
as a possible participant in interferon
-induced apoptosis in HeLa
cells (31), together with the present finding that DAP4 binds to the
proapoptotic protein kinase MST1, raises the question of whether MST1
is a participant in interferon
-induced apoptosis in HeLa cells. In preliminary experiments we have not detected any activation of endogenous MST1 in response to interferon
, and further experiments are ongoing.
J-like domain (13, 14), and binds to PKR through
one TPR motif. p58IPK becomes available as a PKR inhibitor
upon influenza viral infection (40) or heat shock (41) and by binding
to PKR, blocks its dimerization and activation (42). p58IPK
also inhibits apoptosis in NIH 3T3 induced by double-stranded RNA as
well as by tumor necrosis factor-
(43). The availability of
p58IPK as a PKR inhibitor appears to be negatively
regulated primarily through its association with HSP40 (44);
p58IPK also binds to HSP70 (41). Based on these structural
and functional properties, p58IPK has been suggested to be
a co-chaperone (41). The p52rIPK polypeptide can bind
p58IPK and abrogate its ability to inhibit PKR, at least
when reconstituted in a yeast system. Moreover, Katze and co-workers
(41) point to amino acids 86-200 of p52rIPK/DAP4 as a
segment bearing 24% identity to the charged domain of HSP90 (aa
170-300), a region implicated in regulatory interactions with the
glucocorticoid receptor. They therefore suggest that p52rIPK (and thus DAP4) may be related to HSP90 in function
(16). Inasmuch as DAP4 encompasses 488 of the 492 amino acids of
p52rIPK it is very likely that DAP4 can also bind
p58IPK (unless this is abrogated by the unique DAP4
carboxyl-terminal segment). DAP4 binding of p58IPK would
occur through the DAP4 amino-terminal segment, distinct from the site
of MST1 binding, pointing to the possible assembly of a heterotrimeric
complex. Thus if DAP4 does bind p58IPK, the latter
polypeptide may act as a modulator of MST1 kinase activity as well as
of PKR. In fact the ability of MST1 overexpression to initiate
apoptosis suggests strongly that endogenous MST1 activity is restrained
by a cellular inhibitor; moreover the activation of endogenous MST1 by
severe cellular stress is consistent with the idea that heat shock
proteins participate in the negative regulation of MST1 activity. Thus,
further examination of the functional interactions and subcellular
localizations of p58IPK, DAP4, and MST1 is clearly warranted.
(TPY to APF). We have observed
that MST1 can activate coexpressed p54 JNK2/SAPK
(but not p38
);
and coexpression of MST1 with a catalytically inactive mutant of SEK1
(Lys to Arg) inhibits MST1-induced apoptosis by 70% (data not
shown). Thus, activation of SAPK plays a significant role in
MST1-induced apoptosis. The present finding that inhibition of p53
suppresses MST1-induced apoptosis (Fig. 9A) unveils another pathway for MST1 promotion of cell death. Although JNK/SAPK has been
reported to phosphorylate p53 Thr81, and this modification
is claimed to be necessary for stress-induced p53 activation (45), we
have been unable to detect phosphorylation of p53 Thr81
in vivo by immunoblot (using antibody provided by Ronai,
Ruttenberg Cancer Center) in the course of MST-induced
apoptosis. Moreover, MST1 does not itself directly phosphorylate
p53 in vitro (Fig. 9B). It is possible that MST1
and p53 contribute to apoptosis in an additive but largely independent
manner. Nevertheless, the partial dependence of MST1-induced apoptosis
on p53 and the ability of DAP4 to augment MST1-induced apoptosis and to
bind both MST1 and p53 raises the possibility that DAP4 may promote
MST1 action by enabling the apposition of MST1 to a p53-associated
protein that acts to enhance the proapoptotic efficacy of p53, such as JMY or ASPP (46, 47).
| |
ACKNOWLEDGEMENT |
|---|
We thank Jeanette Prendable for preparation of this manuscript.
| |
FOOTNOTES |
|---|
* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§ Supported by National Institutes of Health Training Grant T32 DK07028.
¶ Supported in part as a fellow of the Leukemia and Lymphoma Society.
** To whom correspondence should be addressed: Diabetes Research Laboratory, Dept. of Molecular Biology, Massachusetts General Hospital, 50 Blossom St., Boston, MA 02114. Tel.: 617-726-6909; Fax: 617-726-5649; E-mail: avruch@helix.mgh.harvard.edu.
Published, JBC Papers in Press, October 15, 2002, DOI 10.1074/jbc.M202630200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: aa, amino acid(s); SAPK, stress-activated protein kinase; JNK, c-Jun NH2-terminal kinase; DAP, death associated protein; GST, glutathione S-transferase; GFP, green fluorescent protein; PBS, phosphate-buffered saline; mAb, monoclonal antibody.
| |
REFERENCES |
|---|
|
|
|---|
| 1. |
Creasy, C. L.,
and Chernoff, J.
(1995)
J. Biol. Chem.
270,
21695-21700 |
| 2. |
Taylor, L. K.,
Wang, H. C.,
and Erikson, R. L.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
10099-10104 |
| 3. | Dan, I., Watanabe, N. M., and Kusumi, A. (2001) Trends Cell Biol. 11, 220-230[CrossRef][Medline] [Order article via Infotrieve] |
| 4. |
Kyriakis, J. M.
(1999)
J. Biol. Chem.
274,
5259-5262 |
| 5. |
Creasy, C. L.,
Ambrose, D. M.,
and Chernoff, J.
(1996)
J. Biol. Chem.
271,
21049-21053 |
| 6. | Graves, J. D., Gotoh, Y., Draves, K. E., Ambrose, D., Han, D. K., Wright, M., Chernoff, J., Clark, E. A., and Krebs, E. G. (1998) EMBO J. 17, 2224-2234[CrossRef][Medline] [Order article via Infotrieve] |
| 7. | Lee, K. K., Murakawa, M., Nishida, E., Tsubuki, S., Kawashima, S., Sakamaki, K., and Yonehara, S. (1998) Oncogene 16, 3029-3037[CrossRef][Medline] [Order article via Infotrieve] |
| 8. |
Reszka, A. A.,
Halasy-Nagy, J. M.,
Masarachia, P. J.,
and Rodan, G. A.
(1999)
J. Biol. Chem.
274,
34967-34973 |
| 9. |
Watabe, M.,
Kakeya, H.,
Onose, R.,
and Osada, H.
(2000)
J. Biol. Chem.
275,
8766-8771 |
| 10. | Watabe, M., Kakeya, H., and Osada, H. (1999) Oncogene 18, 5211-5220[CrossRef][Medline] [Order article via Infotrieve] |
| 11. |
Graves, J. D.,
Draves, K. E.,
Gotoh, Y.,
Krebs, E. G.,
and Clark, E. A.
(2001)
J. Biol. Chem.
276,
14909-14915 |
| 12. | Ura, S., Masuyama, N., Graves, J. D., and Gotoh, Y. (2001) Genes Cells 6, 519-530[Abstract] |
| 13. |
Ura, S.,
Masuyama, N.,
Graves, J. D.,
and Gotoh, Y.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
10148-10153 |
| 14. |
Lee, K. K.,
Ohyama, T.,
Yajima, N.,
Tsubuki, S.,
and Yonehara, S.
(2001)
J. Biol. Chem.
276,
19276-19285 |
| 15. | Figeys, D., McBroom, L. D., and Moran, M. F. (2001) Methods 24, 230-239[CrossRef][Medline] [Order article via Infotrieve] |
| 16. |
Gale, M., Jr.,
Blakely, C. M.,
Hopkins, D. A.,
Melville, M. W.,
Wambach, M.,
Romano, P. R.,
and Katze, M. G.
(1998)
Mol. Cell. Biol.
18,
859-871 |
| 17. |
Shaulian, E.,
Zauberman, A.,
Ginsberg, D.,
and Oren, M.
(1992)
Mol. Cell. Biol.
12,
5581-5592 |
| 18. | Gottlieb, E., Haffner, R., von Ruden, T., Wagner, E. F., and Oren, M. (1994) EMBO J. 13, 1368-1374[Medline] [Order article via Infotrieve] |
| 19. | Sambrook, J., and Russell, D. W. (2001) Molecular Cloning: A Laboratory Manual , Third Ed. , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY |
| 20. | Rabizadeh, S., Ye, X., Wang, J. J., and Bredesen, D. E. (1999) Cell Death Differ. 6, 1222-1227[CrossRef][Medline] [Order article via Infotrieve] |
| 21. |
Sperandio, S.,
de Belle, I.,
and Bredesen, D. E.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
14376-14381 |
| 22. | Fisher, A. J., Cruz, W., Zoog, S. J., Schneider, C. L., and Friesen, P. D. (1999) EMBO J. 18, 2031-2039[CrossRef][Medline] [Order article via Infotrieve] |
| 23. | Fukuda, M., Asano, S., Nakamura, T., Adachi, M., Yoshida, M., Yanagida, M., and Nishida, E. (1997) Nature 390, 308-311[CrossRef][Medline] [Order article via Infotrieve] |
| 24. | Vousden, K. H., and Lu, X. (2002) Nat. Rev. Cancer 2, 594-604[CrossRef][Medline] [Order article via Infotrieve] |
| 25. | Ohno, S. (1999) Semin. Cell Dev. Biol. 10, 517-522[CrossRef][Medline] [Order article via Infotrieve] |
| 26. | Holland, P. W. (1999) Semin. Cell Dev. Biol. 10, 541-547[CrossRef][Medline] [Order article via Infotrieve] |
| 27. | Kondrashov, A. S. (1999) Curr. Opin. Genet. Dev. 9, 624-629[CrossRef][Medline] [Order article via Infotrieve] |
| 28. |
Friedman, R.,
and Hughes, A. L.
(2001)
Genome Res.
11,
1842-1847 |
| 29. | Rubin, G. M. (2001) Nature 409, 820-821[CrossRef][Medline] [Order article via Infotrieve] |
| 30. |
Aravind, L.,
Dixit, V. M.,
and Koonin, E. V.
(2001)
Science
291,
1279-1284 |
| 31. | Kimchi, A. (1998) Biochim. Biophys. Acta 1377, F13-F33[Medline] [Order article via Infotrieve] |
| 32. | Levy-Strumpf, N., and Kimchi, A. (1998) Oncogene 17, 3331-3340[Medline] [Order article via Infotrieve] |
| 33. | Levy-Strumpf, N., Deiss, L. P., Berissi, H., and Kimchi, A. (1997) Mol. Cell. Biol. 17, 1615-1625[Abstract] |
| 34. |
Henis-Korenblit, S.,
Strumpf, N. L.,
Goldstaub, D.,
and Kimchi, A.
(2000)
Mol. Cell. Biol.
20,
496-506 |
| 35. |
Deiss, L. P.,
Feinstein, E.,
Berissi, H.,
Cohen, O.,
and Kimchi, A.
(1995)
Genes Dev.
9,
15-30 |
| 36. | Raveh, T., Droguett, G., Horwitz, M. S., DePinho, R. A., and Kimchi, A. (2001) Nat. Cell Biol. 3, 1-7[CrossRef][Medline] [Order article via Infotrieve] |
| 37. | Kissil, J. L., Feinstein, E., Cohen, O., Jones, P. A., Tsai, Y. C., Knowles, M. A., Eydmann, M. E., and Kimchi, A. (1997) Oncogene 15, 403-407[CrossRef][Medline] [Order article via Infotrieve] |
| 38. |
Lee, T. G.,
Tang, N.,
Thompson, S.,
Miller, J.,
and Katze, M. G.
(1994)
Mol. Cell. Biol.
14,
2331-2342 |
| 39. | Korth, M. J., Lyons, C. N., Wambach, M., and Katze, M. G. (1996) Gene (Amst.) 170, 181-188[CrossRef][Medline] [Order article via Infotrieve] |
| 40. |
Lee, T. G.,
Tomita, J.,
Hovanessian, A. G.,
and Katze, M. G.
(1992)
J. Biol. Chem.
267,
14238-14243 |
| 41. |
Melville, M. W.,
Tan, S. L.,
Wambach, M.,
Song, J.,
Morimoto, R. I.,
and Katze, M. G.
(1999)
J. Biol. Chem.
274,
3797-3803 |
| 42. |
Tan, S. L.,
Gale, M. J., Jr.,
and Katze, M. G.
(1998)
Mol. Cell. Biol.
18,
2431-2443 |
| 43. |
Tang, N. M.,
Korth, M. J.,
Gale, M., Jr.,
Wambach, M.,
Der, S. D.,
Bandyopadhyay, S. K.,
Williams, B. R.,
and Katze, M. G.
(1999)
Mol. Cell. Biol.
19,
4757-4765 |
| 44. |
Melville, M. W.,
Hansen, W. J.,
Freeman, B. C.,
Welch, W. J.,
and Katze, M. G.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
97-102 |
| 45. |
Buschmann, T.,
Potapova, O.,
Bar-Shira, A.,
Ivanov, V. N.,
Fuchs, S. Y.,
Henderson, S.,
Fried, V. A.,
Minamoto, T.,
Alarcon-Vargas, D.,
Pincus, M. R.,
Gaarde, W. A.,
Holbrook, N. J.,
Shiloh, Y.,
and Ronai, Z.
(2001)
Mol. Cell. Biol.
21,
2743-2754 |
| 46. | Shikama, N., Lee, C. W., France, S., Delavaine, L., Lyon, J., Krstic-Demonacos, M., and La Thangue, N. B. (1999) Mol. Cell 4, 365-376[CrossRef][Medline] [Order article via Infotrieve] |
| 47. | Samuels-Lev, Y., O'Connor, D. J., Bergamaschi, D., Trigiante, G., Hsieh, J. K., Zhong, S., Campargue, I., Naumovski, L., Crook, T., and Lu, X. (2001) Mol. Cell 8, 781-794[CrossRef][Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
![]() |
A. Ren, G. Yan, B. You, and J. Sun Down-regulation of Mammalian Sterile 20-Like Kinase 1 by Heat Shock Protein 70 Mediates Cisplatin Resistance in Prostate Cancer Cells Cancer Res., April 1, 2008; 68(7): 2266 - 2274. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-W. Jang, S.-J. Yang, S. Srinivasan, and K. Ye Akt Phosphorylates MstI and Prevents Its Proteolytic Activation, Blocking FOXO3 Phosphorylation and Nuclear Translocation J. Biol. Chem., October 19, 2007; 282(42): 30836 - 30844. [Abstract] [Full Text] [PDF] |