JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M206550200 on October 8, 2002

J. Biol. Chem., Vol. 277, Issue 50, 48234-48240, December 13, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/50/48234    most recent
M206550200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wu, M. H.
Right arrow Articles by Yung, B. Y. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wu, M. H.
Right arrow Articles by Yung, B. Y. M.

UV Stimulation of Nucleophosmin/B23 Expression Is an Immediate-early Gene Response Induced by Damaged DNA*

Ming H. WuDagger § and Benjamin Y. M. Yung§

From the Dagger  Graduate Institute of Pharmacology, National Yang Ming University, Taipei 112, Taiwan, Republic of China; and § Cancer Biochemistry Laboratory, Department of Pharmacology, College of Medicine, Chang Gung University, 259 Wen-Hwa 1st Road, Kwei-San, Tao-Yuan 333, Taiwan, Republic of China

Received for publication, July 2, 2002, and in revised form, October 8, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Nucleophosmin/B23 (NPM/B23), a nucleolar protein, was rapidly up-regulated after UV irradiation (at 254 nm; 30 J/m2) in NIH 3T3 cells and HeLa/S3 cells. Levels of NPM/B23 mRNA peaked 45-60 min after UV treatment and returned to baseline by 12 h. Transcription inhibitor actinomycin D (5 µg/ml) prevented the UV-induced increase of NPM/B23 mRNA, suggesting that UV induction of NPM/B23 was mediated at the transcriptional level. Moreover, UV-induced NPM/B23 expression was super-induced by cycloheximide (20 µg/ml), which was characteristic of immediate-early gene response. The transcriptional activation of NPM/B23 by UV was also confirmed by NPM/B23 promoter activity assay. Thymine dinucleotide, mimicking the effects of UV-induced DNA damage, was able to trigger NPM/B23 expression in the absence of genomic DNA damage. UV-induced activation of NPM/B23 promoter could not be blocked by UV-inducible pathway inhibitors, such as those of growth factor tyrosine kinase, mitogen-activated protein kinase, AP-1, NF-kappa B, and DNA-dependent kinase. Our results indicate that UV stimulation of NPM/B23 expression may be mediated through a novel UV-inducible pathway and is an immediate-early gene response induced by damaged DNA. Induction of immediate-early gene is an initial step in the regulation of cellular and genomic responses to external stimuli. Our results thus provide important evidence for an involvement of NPM/B23 in the acute response of mammalian cells to environmental stress.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

UV irradiation of eukaryotic and prokaryotic cells leads to the formation of a variety of DNA photo-products, predominantly cyclobutane pyrimidine dimers (1). Their repair is accomplished largely through the excision repair system. Although well characterized in prokaryotes as part of the SOS response inducible by UV and DNA damage (2), excision repair in eukaryotic cells has been defined recently at the biochemical and genetic levels (3). The mammalian response, also known as the UV response, is regulated by transcription factors such as AP-1, NF-kappa B (4, 5), and p53 (6). Activation of both AP-1 and NF-kappa B by UV is mediated by a signaling pathway in which the membrane-associated Ha-Ras protein plays a major role. Stimulation of Ras leads to activation of cytoplasmic protein kinases that increase AP-1 activity (7) and induce nuclear translocation of NF-kappa B (4, 8). This signaling pathway is involved in a protective function other than DNA repair (7). AP-1 transcription factors are products of immediate-early genes. Activation of the immediate-early genes is thought to be an important initial step in the regulation of cellular and genomic responses to external stimulation (5). UV damages DNA by photo-product formation (1). According to Ljungman and Zhang (9), these lesions activate p53 by blocking the transcription of active genes. The small DNA fragment thymine dinucleotide (TT; one of cyclobutane pyrimidine dimers) induces photoprotective responses in cultured cells and intact skin (10, 11). These responses include increase of melanogenesis (10), enhancement of DNA repair capacity (11, 12), and activation of the p53 tumor suppressor in the absence of initial genomic DNA damage (11). These findings suggest that mammalian cells can generate an SOS-like response to DNA damage, similar to what was previously described in prokaryotic cells (2), and that p53 is involved in this response in mammalian cells (11).

Nucleophosmin/B23 (NPM/B23,1 also called protein B23), a nucleolar phosphoprotein, is more abundant in cancer cells than in normal resting cells (13). Biosynthesis of NPM/B23 is increased markedly and promptly in association with cellular commitment for mitogensis (14, 15). NPM/B23 plays a potential role as a positive regulator of cell proliferation (14, 15). Overexpression of NPM/B23 in NIH 3T3 cells results in malignant transformation; thus, NPM/B23 seems to be associated with oncogenic activity (16). NPM/B23 inhibits DNA binding and transcriptional activity of interferon regulatory factor-1, which is a tumor suppressor (16, 17). Furthermore, NPM/B23 is down-regulated in NIH 3T3 cells during serum deprivation-induced apoptosis (18), and in HL-60 cells during sodium butyrate-induced apoptosis (19) or retinoic acid-induced differentiation (20). NPM/B23 antisense oligonucleotide treatment significantly potentiates the induction of differentiation and apoptosis (18-20). These studies indicate that NPM/B23 plays a role in the regulation of nucleolar function for cellular growth, differentiation, and apoptosis.

Searching for genes involved in UV-resistance in human cells with mRNA differential display, Higuchi et al. (21) have found that expression of NPM/B23 mRNA is induced after UV irradiation in UV-resistant cells but not in control UV-sensitive cells (22). Transfection with NPM/B23 antisense cDNA makes UV-resistant cells become partially sensitive to UV cell-killing. UV-sensitive cells demonstrate lower expression levels of NPM/B23 compared with those of normal fibroblast cells (21). In addition, increased phosphorylation and poly(ADP) ribosylation of NPM/B23 are observed after x-ray treatment of mammalian cells (23).

Recently, we have found that NPM/B23 is rapidly up-regulated after UV irradiation as p53, c-Jun, or proliferating cellular nuclear antigen (24). We also have demonstrated that NPM/B23 against UV irradiation is associated with enhancement of DNA repair and up-regulation of proliferating cellular nuclear antigen (24, 25). NPM/B23 could be a key molecule involved in regulating cellular susceptibility to UV irradiation. The biochemical and molecular events involved in cellular responses to UV irradiation may include a modulation of NPM/B23 gene expression. In this study, attempts were therefore made to elucidate how NPM/B23 is induced by UV irradiation. Our results show that UV-induced NPM/B23 expression is superinduced by cycloheximide, which is characteristic of immediate-early gene response. TT, an UV-damaged dinucleotide mimicking the effects of UV-induced DNA, was able to trigger NPM/B23 expression in the absence of genomic DNA damage. UV-induced activation of NPM/B23 promoter could not be reduced by pretreatment with UV-inducible pathway inhibitors. Our results indicate that UV stimulation of NPM/B23 expression is an immediate-early gene response induced by UV-damaged DNA, and may be a novel UV-inducible pathway.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Reagents and Antibodies-- All chemicals and anti-beta -actin monoclonal antibody (mAb) were purchased from Sigma unless indicated otherwise. Thymine dinucleotide (Midland Certified Reagent, Midland, TX) was dissolved in Tris-EDTA buffer. NF-kappa B SN50 (Calbiochem-Novabiochem, La Jolla, CA) was dissolved in PBS. PD98059 and SB203580 were both from Calbiochem-Novabiochem and were dissolved in dimethyl sulfoxide (Me2SO). Suramin (Biomol, Campus, PA) was dissolved in PBS. Curcumin and wortmannin were both dissolved in ethanol. Anti-NPM/B23 mAb was kindly provided by Dr. Pui Kwong Chan (Department of Pharmacology, Baylor College of Medicine, Houston, TX). Fluorescein-conjugated affinity-purified goat anti-mouse IgG antibody was from Cappel (Turnhout, Belgium). Rabbit polyclonal antibodies (pAb) directed against p53, c-Jun, and phosphorylated form of Tyr-182 p38 and the mAb against NF-kappa B, the phosphorylated form of Tyr-204 p44/42 extracellular signal-regulated kinase, and Thr-183/Tyr-184 c-Jun NH2-terminal kinase were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Cells Culture and UV Treatment-- Cells were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% heat-inactivated serum (Hyclone, UT) (bovine calf serum for NIH 3T3 cells; fetal bovine serum for HeLa cells), 0.5% antibiotics, and 3.7 g/L sodium bicarbonate (Merck) in a 5% CO2 humidified incubator at 37 °C. For cell immunofluorescence studies, cells were subcultured on glass slides in Petri dishes (Nunc, Denmark) 1 day before use. UV treatments (at 254 nm) were performed with a SpectrolinkerTM XL-1000 (Spectronics, New York, NY). Before UV irradiation, the culture medium was removed, and the original medium was added to cells. Cells were harvested at indicated times. For mock-treated control cells, the same procedure was followed without irradiation.

Immunofluorescence-- The immunostaining was performed as previously described (26). NIH 3T3 fibroblasts were grown on glass slides and fixed in 2% formaldehyde (Merck, Darmstadt, Germany) in PBS (8.5 mM Na2HPO4, 1.6 mM NaH2PO4, 0.145 M NaCl, pH 7.2) for 20 min at room temperature. The cells were permeabilized with acetone (Merck) at -20 °C for 3 min. After a wash with PBS three times, the fixed cells were incubated with anti-NPM/B23 mAb (diluted 1:30) at 37 °C for 1 h. Cells were then washed 3 times for 15 min each in PBS and incubated with fluorescein-conjugated affinity-purified goat anti-mouse IgG (diluted 1:30 with PBS) at 37 °C for 45 min. The cells were washed another three times for 15 min with PBS and mounted in 50% (v/v) glycerol in PBS. The results were examined under a fluorescent light microscope (Zeiss, Germany).

Western Blot-- Cell extracts were prepared as described previously (24). After normalizing for protein content, extracts were separated by 10% SDS-polyacrylamide gels, transferred to polyvinylidene difluoride membranes (Amersham Biosciences), and probed with antibodies against NPM/B23, beta -actin, or p53. For quantification of NPM/B23 in indicated times, NPM/B23 and beta -actin immuno-band intensities were determined by densitometric scanning. The values of NPM/B23 were normalized with respect to the intensities of beta -actin. Data were analyzed by Image Gauge analysis software (Fujifilm, Japan).

Northern Blot-- Total RNA was prepared from NIH 3T3 and HeLa cells by ULTRA-SPECTM RNA Isolation System (Biotecx Laboratories, Houston, TX). Aliquots of 8 µg were separated by 1.2% formaldehyde agarose gel electrophoresis, transferred to Hybond-N nylon membrane (Amersham Biosciences) by downward alkaline capillary method and fixed to membrane by drying at 80 °C for 30 min. The NPM/B23 cDNA and beta -actin cDNA labeled with [alpha -32P]dCTP (Amersham Biosciences) using a random primed kit (Promega, Madison, WI) was employed as a probe for detection of NPM/B23 mRNA. Prehybridization was carried out overnight at 42 °C in a solution containing 50% formamide, 5× Denhardt's solution (0.1% Ficoll 400, 0.1% polyvinylpyrrolidone, 0.1% bovine serum albumin), 5× SSC (1× SSC = 0.15 M NaCl, 0.015 M sodium citrate), 0.1% SDS, and 250 µg/ml denatured (95 °C, 10 min) salmon sperm DNA. Radiolabeled probe at a specific activity of 1 × 108 cpm/ml was hybridized with total RNA in the same solution for 24 h at 42 °C. Washings of the membranes for the probes were performed twice in 2× SSC and 0.1% SDS at room temperature for 5 min and once in 0.3× SSC and 0.5% SDS at room temperature for 10 min. The radioactive NPM/B23 mRNA was determined by autoradiography with PhosphoImager (Fujifilm BAS 1500; Fujifilm).

Construction of pCR3-B23CAT-- Human genomic DNA was isolated from leukocytes. Human NPM/B23 gene containing the promoter region was amplified from genomic DNA by PCR using two group-specific primers: the 5' primer (TAGCGCGCAGCTCTCTTAGGGCGATGTCCTT) and the 3' primer (TTAAGCTTCGGGTGGCGGCACGCACTTAGGTA) containing a BssHII and a HindIII restriction site at its 5' end, respectively. The PCR products were digested with BssHII and HindIII (Promega, Madison, WI), and cloned into pCR3CAT. Positive clones containing the 5' region of the NPM/B23 gene -744 to +97 relative to the initiation of transcription (+1) were screened by restriction enzyme mapping and verified by DNA sequencing. The characteristics of this 5' region of NPM/B23 gene have been described in previously (27).

Cell Transfection and Establishment of Stable Clones-- Transfections were performed using LipofectAMINETM Reagent (Invitrogen) method. Before transfection, cells (2 × 105 per well) were seeded in 6-well plates overnight. Plasmid DNA (2.5 µg) and LipofectAMINETM Reagent (12.5 µg) were each diluted in serum-free medium (150 µl). DNA and LipofectAMINETM Reagent were then mixed and incubated for 30 min at room temperature to allow DNA-liposome complex formation. Cells were rinsed twice with PBS, placed in serum-free medium (0.7 ml), and then overlaid with DNA-liposome complexes. After 6 h of incubation at 37 °C in a CO2 incubator, the DNA-containing medium was replaced by fresh medium containing 10% serum.

For stable transfections, NIH 3T3 cells were transfected with the NPM/B23 promoter-CAT construct designated pCR3-B23CAT as described above. Stably-transfected cells were selected in medium containing 600 µg/ml G418 (Calbiochem-Novabiochem).

Chloramphenicol Acetyltransferase (CAT) and Luciferase Activity Assays-- CAT assay was performed by single-phase extraction. The cells were lysed in reporter lysis buffer (Promega) 24 h after transfection. The cellular lysates were heated at 60 °C for 10 min to inactivate endogenous deacetylase activity. Total cellular lysates were diluted to 200 µl with 0.1 M Tris (pH 7.8) and added to 200 µl of reaction buffer containing 125 mM Tris (pH 8.0), 5 mM chloramphenicol, 0.2 µCi [3H]acetyl-coenzyme A (Amersham Biosciences). The reaction mixture was overlaid with 2 ml of a water-immiscible scintillation fluid Ecoscint OTM (National Diagnostic, Atlanta, GA) and then incubated at 37 °C for 5 h to measure NPM/B23 promoter activity. CAT activity was quantified in the scintillation counter (Beckman LSD5000, Palo Alto, CA). For luciferase assay, 10 µl of cell lysate was automatically mixed with the reaction buffer (100 µl of 20 mM Tricine, 1.07 mM (MgCO3)4 Mg(OH)2, 2.67 mM MgSO4, 0.1 mM EDTA, 33.3 mM dithiothreitol, 0.27 mM coenzyme A, 0.47 mM luciferin (Roche, Mannheim, Germany), 0.53 mM ATP at pH 7.8). Luciferase activity was quantified in a luminomer AutoLunmat LB953 (Berthold, Norwalk, CT). Luciferase activity was normalized to the CAT activity of the same extraction without heat treatment.

Statistical Analysis-- Data are expressed as means ± S.D. throughout the paper. Statistical analyses were performed with one-way ANOVA test by computer sofware PRISMTM (GraphPad software, San Diego, CA). p values < 0.05 were considered to be statistically significant. All assays were performed at least three times.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Stimulation of NPM/B23 Expression by UV Is an Immediate-early Gene Response-- Fig. 1 shows the immunofluorescence localization of NPM/B23 in NIH 3T3 cells after UV treatment (254 nm, 30 J/m2) at indicated times. Increase of fluorescence occurred after UV irradiation, and NPM/B23 was mainly localized in the nucleolus. The NPM/B23 immunofluorescence in the nucleoplasm was also increased, particularly at 6 and 12 h after UV treatment. This result indicated that NPM/B23 was up-regulated after UV irradiation. It was consistent with our previous immunoblot data that NPM/B23 protein synthesis in UV-treated cells was up-regulated (24, 25).


View larger version (57K):
[in this window]
[in a new window]
  		Fig. 1.   NPM/B23 immunofluorescence is increased after UV treatment. NIH 3T3 cells were grown on slides overnight and treated with UV irradiation (30 J/m2). After UV treatment, cells were fixed with 2% formaldehyde in PBS at the indicated times. The cells were then labeled with anti-NPM/B23 monoclonal antibody and FITC-conjugated secondary antibody to detect NPM/B23 using fluorescence light microscope. Left, immunofluorescence stain pictures; right, phase contrast pictures.

The time course studies showed that stimulation by UV irradiation of NPM/B23 mRNA expression was also rapid and transient in HeLa/S3 cells (Fig. 2, A and B) and NIH 3T3 cells (data not shown). NPM/B23 mRNA peaked 45-60 min after UV treatment and returned to baseline by 12 h (Fig. 2, A and B). Because such kinetics are reminiscent of immediate-early responses (28), we also examined whether induction of NPM/B23 by UV exhibits other characteristics of classical immediate-early responses. Immediate-early responses depend on increased transcription rather than mRNA stability and are, therefore, inhibited by transcription blockers, such as actinomycin D (28). Fig. 2C shows that stimulation of NPM/B23 mRNA expression by UV was inhibited by actinomycin D (5 µg/ml). Although these results resembled an immediate-early response, conclusive evidence required examination of protein synthesis inhibitors. Because immediate-early responses are primary effects that do not require synthesis of intermediate proteins, they are not blocked by inhibition of protein synthesis (28). Instead, immediate-early responses are superinduced; that is, they are increased in both duration and magnitude (28). Fig. 2B shows that the protein synthesis inhibitor cycloheximide (20 µg/ml) superinduced the UV stimulation of NPM/B23 mRNA. Taken together, our results demonstrate that stimulation of NPM/B23 by UV might be an immediate-early gene response.


View larger version (45K):
[in this window]
[in a new window]
  		Fig. 2.   Effect of actinomycin D or cycloheximide on UV-induced NPM/B23 expression in HeLa cells. Cells were pre-incubated for 30 min with or without cycloheximide (CHX, 20 µg/ml) or actinomycin D (Act-D, 5 µg/ml), and then were irradiated with UV light (30 J/m2, at 254 nm). After irradiation, the cells were harvested at indicated times and total RNA was prepared. Northern blot analysis was performed with 8 µg of RNA for each sample. The mRNA of NPM/B23 was detected by 32P-labeled NPM/B23 cDNA probe. The same membrane was hybridized with 32P-labeled beta -actin cDNA probe that was used as a control for the amount of RNA loaded.

Activation of NPM/B23 Promoter by UV Irradiation-- To further determine the effect of UV on NPM/B23 gene expression, we tested the responsiveness of the NPM/B23 promoter-reporter construct (pCR3-B23CAT) to UV treatment. NPM/B23 promoter activity was also increased after UV irradiation (30 J/m2) (Fig. 3). There was a 1.5- and 2-fold increases of NPM/B23 promoter activity in Hela/S3 cells and NIH 3T3 cells, respectively, 12 h after UV exposure (Fig. 3). NIH 3T3 fibroblast is often considered as a non-transformed cell line (29), containing normal p53 function, whereas HeLa/S3 is a p53-deficient cancer cell line (30). This result indicated that UV-induction of NPM/B23 did not require the function of the tumor suppressor p53.


View larger version (22K):
[in this window]
[in a new window]
  		Fig. 3.   The NPM/B23 promoter activity was up-regulated following UV irradiation in NIH 3T3 cells and HeLa cells. NIH 3T3 cells and HeLa cells were transiently co-transfected with NPM/B23 promoter plasmid (pCRB23CAT) and pCR3.1 Luc (as an internal control) in 10-cm dishes. Twenty-four hours after transfection, cells were subcultured onto 6-cm dish and then were treated with UV (30 J/m2 at 254 nm) or mock-treated 16 h after seeding. Six hours post-irradiation, cells were harvested and lysed by reporter lysis buffer. The cell extracts containing equal amounts of proteins were analyzed for CAT activity and luciferase activities. CAT units were normalized to luciferase values to control transfection efficiency. Increase in activation was determined by dividing the CAT activity of each sample by basal CAT activity of mock treatment. Bars, means of triplicates ± S.D. *, p < 0.05, as compared with NPM/B23 promoter activity in NIH3T3 cells or HeLa cells that were mock-treated.

UV-damaged Dinucleotides Could Induce NPM/B23 Expression-- The small DNA fragment thymine dinucleotides (TT) mimic the effects of UV irradiation and UV-mimetic DNA damage (11). TT was thus applied to determine whether UV-damaged DNA had an effect on regulation of NPM/B23. A slowing of cell growth and low percentage (<1%) of dead cells was observed during TT treatment (100 µM, 24 h; data not shown). Western blotting was employed to assay the kinetics of NPM/B23 during TT treatment (100 µM). To compare precisely the levels of NPM/B23 at each indicated time, the immuno-band intensities of NPM/B23 were quantified and normalized with the intensities of beta -actin. NPM/B23 protein level was increased by 1.6- and 2-fold at 6 and 12 h respectively in response to TT treatment (Fig. 4). In parallel, p53 was increased during TT treatment as previously reported (11) (Fig. 4A). Furthermore, the immunofluorescence of NPM/B23 was also examined in cells treated with TT (100 µM, 24 h). Similar to UV treatment (Fig. 1), NPM/B23 was also mainly localized in the nucleolus, and the intensity of fluorescence was increased in TT-treated cells (Fig. 5). The activity of the NPM/B23 promoter was also increased after TT treatment (100 µM), and there was an ~2-fold increase at 12 h after TT treatment (Fig. 6). Taken together, the results indicated that UV-damaged DNA might play an important role in up-regulation of NPM/B23 in cellular response to UV irradiation.


View larger version (29K):
[in this window]
[in a new window]
  		Fig. 4.   The protein level of NPM/B23 was up-regulated in TT-treated cells. A, the kinetics of cellular NPM/B23 during TT (100 µM) or an equal volume of Tris-EDTA buffer (vehicle) treatment. Equal amounts of proteins (20 µg) were separated by 10% SDS-PAGE and blotted onto polyvinylidene difluoride membrane. NPM/B23 (B23), p53, and beta -actin were detected by Western blot using their specific antibodies and Enhanced Chemiluminescence. The same blot was probed with different antibodies after stripping. B, quantification of NPM/B23 at indicated times. NPM/B23, p53, and beta -actin immuno-band intensities were determined by densitometric scanning. The values of NPM/B23 were normalized with respect to the intensities of beta -actin. Data were analyzed by Image Gauge analysis software (Fujifilm).


View larger version (63K):
[in this window]
[in a new window]
  		Fig. 5.   NPM/B23 immunofluorescence was increased during thymine dinucleotide (TT) treatment. NIH 3T3 cells were grown on slides overnight and then treated with 100 µM TT for 3-24 h before the cells were immunostained with anti-NPM/B23 mAb. Left, immunofluorescence stain pictures; right, phase-contrast pictures.


View larger version (17K):
[in this window]
[in a new window]
  		Fig. 6.   Activation of the NPM/B23 promoter by TT treatment. NIH 3T3 cells were transiently co-transfected with NPM/B23 promoter plasmid (pCRB23CAT) and pCR3.1 Luc (as an internal control) in 10-cm dishes. Twenty-four hours after transfection, cells were subcultured onto 6-cm dishes, and then were treated with TT (100 µM). Six hours after TT treatment, cells were harvested and lysed by reporter lysis buffer at indicated times. CAT activity was measured and normalized to the luciferase activity of the same sample. Increase in activation was determined by dividing the CAT activity of each sample by basal CAT activity of mock treatment. *, p < 0.05, as compared with NPM/B23 promoter activity in NIH3T3 cells that were mock-treated.

UV Induction of NPM/B23 Promoter Activity Was Not through Growth Factor Receptor Tyrosine Kinase/MAPK Pathway-- UVC may mimic growth factor/receptor interactions at the cell surface and activate receptor kinases (8). Suramin has been applied to block UV-induced activation of growth factor receptor tyrosine kinase (31, 32). Suramin blocks receptor tyrosine kinase-mediated signals including mitogen-activated protein kinases (MAPK) activity (31, 32). As shown in Fig. 7A, pretreatment of cells with suramin (5 µM, 30 min) suppressed UV-induced (30 J/m2) phosphorylation of MAPK (extracellular signal-regulated kinase, c-Jun NH2-terminal kinase, p38) and protein expression of c-Jun. However, pre-exposure of cells to suramin did not affect UV-induced NPM/B23 mRNA expression (Fig. 7B) and promoter activation (Fig. 7C). UV-induced NPM/B23 expression might thus be independent of growth factor receptor tyrosine kinase/MAPK pathway. Several inhibitors of UV-inducible pathway were also applied to elucidate the signals involved in UV-induced NPM/B23 expression. NF-kappa B SN50 is a cell-permeable peptide and inhibits translocation of the NF-kappa B active complex into the nucleus (33). PD98059 is a selective and cell-permeable inhibitor of MAPK kinase (34). SB203580 is a highly specific and cell-permeable inhibitor of p38 MAPK (35). Curcumin is an inhibitor of c-Jun/AP-1 activation (36, 37). Wortmannin is a DNA-dependent protein kinase inhibitor (38). In this study, pretreatment of the NIH-3T3 cells with NF-kappa B SN50 (50 µg/ml, 30 min) blocked UV-induced translocation of NF-kappa B into the nucleus (data not shown). UV-induced phosphorylation of extracellular signal-regulated kinase or c-Jun expression was decreased by pretreatment of cells with PD98059 (5 µM, 30 min) or curcumin (20 µM, 30 min), respectively (Fig. 7A). However, pretreatment (30 min) of NIH 3T3 cells with those inhibitors (NF-kappa B SN50, 50 µg/ml; PD98059, 5 µM; SB203580, 5 µM; curcumin, 20 µM; wortmannin, 0.5 µM) did not prevent UV-induced NPM/B23 transcription and promoter activation (Fig. 7, B and C). On the other hand, NPM/B23 promoter activity was elevated (~1.4-fold) in the cells treated with wortmannin (0.5 µM, 6 h; no UV treatment) alone (Fig. 7C). DNA-dependent kinase or wortmannin-target component might, by itself, participate in the regulation of NPM/B23 in cells without UV treatment.


View larger version (63K):
[in this window]
[in a new window]
  		Fig. 7.   UV-induction of NPM/B23 expression might not be mediated through receptor kinase/MAPK pathway. A, effect of suramin (Sur), PD98059 (PD), and curcumin (Cur) on UV-induced MAPK activation. NIH 3T3 cells were pretreated for 30 min with or without Sur (5 µM), PD (5 µM), or Cur (20 µM) before UV irradiation (30 J/m2 at 254 nm) or mock irradiation. One hour after UV irradiation, cells were harvested and lysed. Phosphorylated MAPK (p-extracellular signal-regulated kinase, p-p38, p-c-Jun NH2-terminal kinase) and protein expression of c-Jun were detected by immunoblot, and beta -actin was used as a loading control. B, the inhibitors of UV-inducible pathway could not block UV induction of NPM/B23 transcription. Cells were pre-incubated for 30 min with or without Sur (5 µM), PD (5 µM), SB 203580 (SB, 5 µM), Cur (20 µM), NF-kappa B SN50 (SN50, 50 µg/ml), or wortmannin (W; 0.5 µg/ml), and then were irradiated with UV light (30 J/m2, at 254 nm). One hour after irradiation, the cells were harvested and total RNA was prepared. Northern blot analysis was performed with 8 µg of RNA for each sample. The mRNA of NPM/B23 was detected by 32P-labeled NPM/B23 cDNA probe. The detection of beta -actin mRNA was used as a control for the amount of RNA loaded. C, NIH 3T3 cells stably transfected with NPM/B23 promoter plasmid (pCR3-B23CAT) were cultured in 6 cm dishes. Cells were then pretreated with UV-inducible pathway inhibitors Sur (5 µM), SN50 (50 µg/ml), PD (5 µM), SB (5 µM), Cur (20 µM), W (0.5 µM), or their vehicles (PBS, Me2SO, or ethanol) for 30 min, followed by a treatment with UV (30 J/m2 at 254 nm) or mock irradiation. Six hours post-irradiation, cells were harvested and lysed by reporter lysis buffer. The cell extracts containing equal amounts of proteins were analyzed for CAT activity. Bars, means of triplicates ± S.D. *, p < 0.05, as compared with NPM/B23 promoter activity in cells that were mock-treated.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Our results have shown that NPM/B23 is immediate-early inducible by UV irradiation. Immediate-early responses are primary effects that do not require synthesis of intermediate proteins, and they are not blocked by inhibition of protein synthesis (28, 39) Immediate-early genes encompass a variety of different protein families, including Fos, Jun, and Myc (40). Currently, there are ~100 members in the immediate-early gene set (39). The immediate-early genes can be subdivided into 2 classes: fast and slow immediate-early genes, distinguishable by their activation kinetics (41). The prototype immediate-early gene, c-fos, is a member of the fast immediate-early genes. Growth factor added to quiescent 3T3 cells stimulates transcription of c-Fos within 10 min. c-Fos expression peaks within 30 min and returns to baseline levels within 2 h (42, 43). Serum response element, cAMP response element, and sis-inducible element are required for transcription of many fast-kinetic immediate-early genes (41). On the other hand, the slow immediate-early genes display a slower induction profile after stimulation. Transcription of slow immediate-early genes has a greater lag and persists longer than the rapidly repressed fast-kinetics genes. These genes lack the consensus serum response element and other particular set of transcription control elements (44). Slow-kinetics immediate-early gene like c-myc displays a 60 min lag period before initiation of transcription in response to growth-factor stimulation (45). NPM/B23 promoter region lacks the consensus sequence of serum response element, cAMP response element, or sis-inducible element (data not shown). In addition, the UV-induced expression of NPM/B23 gene also displays a greater lag time (45-60 min) before initiation of transcription and persists longer (12 h) than fast-kinetic genes. Up-regulation of NPM/B23 could thus be a slow-kinetic immediate-early gene response to UV irradiation. Activation of immediate-early genes is thought to be an important initial step in the regulation of cellular and genomic responses to external stimulation (28). Our results implicate that NPM/B23 plays an important role in cellular response to UV.

Our results have also shown that UV-induced activation of NPM/B23 may be mediated through a novel route, rather than receptor tyrosine kinase/MAPK pathway. Treatment of cells with TT causes up-regulation of NPM/B23 and p53, in the absence of initial genomic DNA damage. DNA damage can elicit multiple responses in mammalian cells, including the activation of numerous cascades of signal transduction that result in the activation of cellular genes involved in growth control, DNA repair, and apoptosis (8, 46). Our previous studies indicate that overexpression of NPM/B23 makes cells more resistant to UV-induced cell growth inhibition and cell death, and this effect may be associated with enhancement of DNA repair activity (24, 25). NPM/B23 has been identified and characterized as genotoxic stress-induced (UV or ionizing radiation) protein (47). UV-damaged DNA may be an important factor for induction of NPM/B23 expression. UVC is strongly absorbed by DNA, and DNA itself may be an important sensor to trigger signals that induce DNA repair. This pathway is well characterized by the SOS response in prokaryotes (2), but there is no definite response in eukaryotes yet (8, 11). Furthermore, p53 is a well known molecule that arrests DNA replication and induces DNA repair in response to DNA damage (48). Our results have shown that expression of NPM/B23 is also induced by UV in p53-deficient cells (HeLa/S3 cells). NPM/B23 and some DNA repair-associated proteins (49-51) may be regulated in a p53-independent pathway.

In conclusion, the immediate-early induction of NPM/B23 indicates the existence of a new regulatory pathway that might enable cells to react rapidly upon induction of DNA damage. This is important evidence for a possible involvement of NPM/B23 in an acute response of mammalian cells to environmental stress.

    ACKNOWLEDGEMENT

We thank Hans Tsao (a graduate from Trinity Western University, Canada and research summer student in our lab) for carefully proofreading the manuscript.

    FOOTNOTES

* This work was supported by Chang Gung Memorial Hospital Research Funding Grant CMRP 997III, National Science Council (R.O.C) Grant NSC90-2315-B-182-001, and National Research Institute of Heath Council (R.O.C) Grant NHRI-EX91-8935SL.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed. Fax: 886-3-328-2015; E-mail: byung@mail.cgu.edu.tw.

Published, JBC Papers in Press, October 8, 2002, DOI 10.1074/jbc.M206550200

    ABBREVIATIONS

The abbreviations used are: NPM, nucleophosmin; CAT, chloramphenicol acetyltransferase; MAPK, mitogen-activated protein kinase; NF-kappa B, nuclear factor kappa B; TT, thymine dinucleotide; mAb, monoclonal anitbody; PBS, phosphate-buffered saline.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Tornaletti, S., and Pfeifer, G. P. (1996) Bioessays 18, 221-228[CrossRef][Medline] [Order article via Infotrieve]
2. Walker, G. C. (1985) Annu. Rev. Biochem. 54, 425-457[CrossRef][Medline] [Order article via Infotrieve]
3. Sancar, A. (1994) Science 266, 1954-1956[Free Full Text]
4. Mercurio, F., and Manning, A. M. (1999) Oncogene 18, 6163-6171[CrossRef][Medline] [Order article via Infotrieve]
5. Holbrook, N. J., and Fornace, A. J., Jr. (1991) New Biol. 3, 825-833[Medline] [Order article via Infotrieve]
6. Fuchs, S. Y., Fried, V. A., and Ronai, Z. (1998) Oncogene 17, 1483-1490[CrossRef][Medline] [Order article via Infotrieve]
7. Engelberg, D., Klein, C., Martinetto, H., Struhl, K., and Karin, M. (1994) Cell 77, 381-390[CrossRef][Medline] [Order article via Infotrieve]
8. Tyrrell, R. M. (1996) Bioessays 18, 139-148[CrossRef][Medline] [Order article via Infotrieve]
9. Ljungman, M., and Zhang, F. (1996) Oncogene 13, 823-831[Medline] [Order article via Infotrieve]
10. Eller, M. S., Yaar, M., and Gilchrest, B. A. (1994) Nature 372, 413-414[CrossRef][Medline] [Order article via Infotrieve]
11. Eller, M. S., Maeda, T., Magnoni, C., Atwal, D., and Gilchrest, B. A. (1997) Proc. Natl. Acad. Sci. U. S. A. 94, 12627-12632[Abstract/Free Full Text]
12. Goukassian, D. A., Eller, M. S., Yaar, M., and Gilchrest, B. A. (1999) J. Invest. Dermatol. 112, 25-31[CrossRef][Medline] [Order article via Infotrieve]
13. Chan, W. Y., Liu, Q. R., Borjigin, J., Busch, H., Rennert, O. M., Tease, L. A., and Chan, P. K. (1989) Biochemistry 28, 1033-1039[CrossRef][Medline] [Order article via Infotrieve]
14. Feuerstein, N., and Mond, J. J. (1987) J. Biol. Chem. 262, 11389-11397[Abstract/Free Full Text]
15. Feuerstein, N., Chan, P. K., and James, J. M. (1988) J. Biol. Chem. 263, 10608-10612[Abstract/Free Full Text]
16. Kondo, T., Minamino, N., Nagamura-Inoue, T., Matsumoto, M., Taniguchi, T., and Tanaka, N. (1997) Oncogene 15, 1275-1281[CrossRef][Medline] [Order article via Infotrieve]
17. Tanaka, N., Ishihara, M., Kitagawa, M., Harada, H., Kimura, T., Matsuyama, T., Lamphier, M. S., Aizawa, S., Mak, T. W., and Taniguchi, T. (1994) Cell 77, 829-839[CrossRef][Medline] [Order article via Infotrieve]
18. Chou, C. C., and Yung, B. Y. M. (2001) Mol. Pharmacol. 59, 38-45[Abstract/Free Full Text]
19. Liu, W. H., and Yung, B. Y. M. (1998) Oncogene 17, 3055-3064[CrossRef][Medline] [Order article via Infotrieve]
20. Hsu, C. Y., and Yung, B. Y. M. (1998) Oncogene 16, 915-923[CrossRef][Medline] [Order article via Infotrieve]
21. Higuchi, Y., Kita, K., Nakanishi, H., Wang, X. L., Sugaya, S., Tanzawa, H., Yamamori, H., Sugita, K., Yamaura, A., and Suzuki, N. (1998) Biochem. Biophys. Res. Commun. 248, 597-602[CrossRef][Medline] [Order article via Infotrieve]
22. Hirano, J., Wang, X. L., Kita, K., Higuchi, Y., Nakanishi, H., Uzawa, K., Yokoe, H., Tanzawa, H., Yamaura, A., Yamamori, H., Nakajima, N., Nishikiori, C., and Suzuki, N. (2000) Cancer Lett. 153, 183-188[CrossRef][Medline] [Order article via Infotrieve]
23. Ramsamooj, P., Natario, V., and Dritschilo, A. (1995) Radiat. Res. 143, 158-164[Medline] [Order article via Infotrieve]
24. Wu, M. H., Chang, J. H., and Yung, B. Y. M. (2002) Carcinogenesis 23, 93-100[Abstract/Free Full Text]
25. Wu, M. H., Chang, J. H., Chou, C. C., and Yung, B. Y. M. (2002) Int. J. Cancer 97, 297-305[CrossRef][Medline] [Order article via Infotrieve]
26. Yung, B. Y. M., Busch, R. K., Busch, H., Mauger, A. B., and Chan, P. K. (1985) Biochem. Pharmacol. 34, 4059-4063[CrossRef][Medline] [Order article via Infotrieve]
27. Chan, P. K., Chan, F. Y., Morris, S. W., and Xie, Z. (1997) Nucleic Acids Res. 25, 1225-1232[Abstract/Free Full Text]
28. Herschman, H. R. (1991) Annu. Rev. Biochem. 60, 281-319[CrossRef][Medline] [Order article via Infotrieve]
29. Schreiber, M., Baumann, B., Cotton, M., Angel, P., and Wagner, E. F. (1995) EMBO J. 14, 5338-5349[Medline] [Order article via Infotrieve]
30. Jia, L. Q., Osada, M., Ishioka, C., Gamo, M., Ikawa, S, Suzuki, T., Shimodaira, H., Niitani, T., Kudo, T., Akiyama, M., Kimura, N., Matsuo, M., Mizusawa, H., Tanaka, N., Koyama, H., Namba, M., Kanamaru, R., and Kuroki, T. (1997) Mol. Carcinog. 19, 243-253[CrossRef][Medline] [Order article via Infotrieve]
31. Iordanov, M., Bender, K., Ade, T., Schmid, W., Sachsenmaier, C., Engel, K., Gaestel, M., Rahmsdorf, H. J., and Herrlich, P. (1997) EMBO J. 16, 1009-1022[CrossRef][Medline] [Order article via Infotrieve]
32. Sachsenmaier, C., Adriana, A., Zinck, R., Nordheim, A., Herrich, P., and Rahmsdorf, H. J. (1994) Cell 78, 963-972[CrossRef][Medline] [Order article via Infotrieve]
33. Lin, Y. Z., Yao, S. Y., Veach, R. A., Torgerson, T. R., and Hawiger, J. (1995) J. Biol. Chem. 270, 14255-14258[Abstract/Free Full Text]
34. Pang, L., Sawada, T., Decker, S. J., and Saltiel, A. R. (1995) J. Biol. Chem. 270, 13585-13588[Abstract/Free Full Text]
35. Kramer, R. M, Roberts, E. F, Um, S. L, Börsch-Haubold, A. G, Watson, S. P., Fisher, M. J., and Jakubowski, J. A. (1996) J. Biol. Chem. 271, 27723-27729[Abstract/Free Full Text]
36. Huang, T. S., Lee, S. C., and Lin, J. K. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 5292-5296[Abstract/Free Full Text]
37. Hanazawa, S., Takeshita, A., Amano, S., Semba, T., Nirazuka, T., Katoh, H., and Kitano, S. (1993) J. Biol. Chem. 268, 9526-9532[Abstract/Free Full Text]
38. Park, J. S., Park, S. J., Peng, X., Wang, M., Yu, M. A., and Lee, S. H. (1999) J. Biol. Chem. 274, 32520-32527[Abstract/Free Full Text]
39. Sheng, M., and Greenberg, M. E. (1990) Neuron 4, 477-485[Medline] [Order article via Infotrieve]
40. Winkles, J. A. (1998) Prog. Nucleic Acid Res. Mol. Biol. 58, 41-78[Medline] [Order article via Infotrieve]
41. Freter, R. R., Alberta, J. A., Hwang, G. Y., Wrentmore, A. L, and Stiles, C. D. (1996) J. Biol. Chem. 271, 17417-17424[Abstract/Free Full Text]
42. Greenberg, M. E., and Ziff, E. B. (1984) Nature 311, 433-437[CrossRef][Medline] [Order article via Infotrieve]
43. Kelly, K., and Siebenlist, U. (1988) J. Biol. Chem. 263, 4828-4831[Abstract/Free Full Text]
44. Latinkic, B. V., and Lau, L. F. (1994) J. Biol. Chem. 269, 23163-23170[Abstract/Free Full Text]
45. Dean, M., Levine, R. A., Ran, W., Kindy, W. S., Sonenshein, G. E., and Campis, J. (1986) J. Biol. Chem. 261, 9161-9166[Abstract/Free Full Text]
46. Anderson, C. W. (1993) Trends Biochem. Sci. 18, 433-437[CrossRef][Medline] [Order article via Infotrieve]
47. Yang, C., Maiguel, D. A., and Carrier, F. (2002) Nucleic Acids Res. 30, 2251-2260[Abstract/Free Full Text]
48. Oren, M. (1999) J. Biol. Chem. 274, 36031-36034[Free Full Text]
49. Hsing, A., Faller, D. V., and Vazir, C. (2000) J. Biol. Chem. 275, 26024-26031[Abstract/Free Full Text]
50. Zhao, H., Jin, S., Fan, F., Fan, W., Tong, T., and Zhan, Q. (2000) Cancer Res. 60, 6276-6280[Abstract/Free Full Text]
51. Wang, S. C., Makino, K., Su, L. K., Pao, A. Y., Kim, J. S., and Hung, M. C. (2001) Cancer Res. 61, 2838-2842[Abstract/Free Full Text]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
M. Okada, S.-W. Jang, and K. Ye
Ebp1 Association with Nucleophosmin/B23 Is Essential for Regulating Cell Proliferation and Suppressing Apoptosis
J. Biol. Chem., December 14, 2007; 282(50): 36744 - 36754.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
T. Kato, N. Sato, S. Hayama, T. Yamabuki, T. Ito, M. Miyamoto, S. Kondo, Y. Nakamura, and Y. Daigo
Activation of Holliday Junction Recognizing Protein Involved in the Chromosomal Stability and Immortality of Cancer Cells
Cancer Res., September 15, 2007; 67(18): 8544 - 8553.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
S. R. Tew and T. E. Hardingham
Regulation of SOX9 mRNA in Human Articular Chondrocytes Involving p38 MAPK Activation and mRNA Stabilization
J. Biol. Chem., December 22, 2006; 281(51): 39471 - 39479.
[Abstract] [Full Text] [PDF]

Home page
 Microbiol. Mol. Biol. Rev.Home page
M. A. Garcia, J. Gil, I. Ventoso, S. Guerra, E. Domingo, C. Rivas, and M. Esteban
Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action
Microbiol. Mol. Biol. Rev., December 1, 2006; 70(4): 1032 - 1060.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
S. S. Negi and M. O. J. Olson
Effects of interphase and mitotic phosphorylation on the mobility and location of nucleolar protein B23
J. Cell Sci., September 1, 2006; 119(17): 3676 - 3685.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
Y.-C. Du, S. Gu, J. Zhou, T. Wang, H. Cai, M. A. MacInnes, E. M. Bradbury, and X. Chen
The Dynamic Alterations of H2AX Complex during DNA Repair Detected by a Proteomic Approach Reveal the Critical Roles of Ca2+/Calmodulin in the Ionizing Radiation-induced Cell Cycle Arrest
Mol. Cell. Proteomics, June 1, 2006; 5(6): 1033 - 1044.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
C. Thiede, S. Koch, E. Creutzig, C. Steudel, T. Illmer, M. Schaich, G. Ehninger, and for the Deutsche Studieninitiative Leukamie (DSIL)
Prevalence and prognostic impact of NPM1 mutations in 1485 adult patients with acute myeloid leukemia (AML)
Blood, May 15, 2006; 107(10): 4011 - 4020.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
T. Zou, J. N. Rao, L. Liu, B. S. Marasa, K. M. Keledjian, A.-H. Zhang, L. Xiao, B. L. Bass, and J.-Y. Wang
Polyamine depletion induces nucleophosmin modulating stability and transcriptional activity of p53 in intestinal epithelial cells
Am J Physiol Cell Physiol, September 1, 2005; 289(3): C686 - C696.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
L. A. Stark and M. G. Dunlop
Nucleolar Sequestration of RelA (p65) Regulates NF-{kappa}B-Driven Transcription and Apoptosis
Mol. Cell. Biol., July 15, 2005; 25(14): 5985 - 6004.
[Abstract] [Full Text] [PDF]

Home page
 J. Appl. Physiol.Home page
M. Horowitz, L. Eli-Berchoer, I. Wapinski, N. Friedman, and E. Kodesh
Stress-related genomic responses during the course of heat acclimation and its association with ischemic-reperfusion cross-tolerance
J Appl Physiol, October 1, 2004; 97(4): 1496 - 1507.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Li, X. Zhang, D. P. Sejas, G. C. Bagby, and Q. Pang
Hypoxia-induced Nucleophosmin Protects Cell Death through Inhibition of p53
J. Biol. Chem., October 1, 2004; 279(40): 41275 - 41279.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
K. Sato, R. Hayami, W. Wu, T. Nishikawa, H. Nishikawa, Y. Okuda, H. Ogata, M. Fukuda, and T. Ohta
Nucleophosmin/B23 Is a Candidate Substrate for the BRCA1-BARD1 Ubiquitin Ligase
J. Biol. Chem., July 23, 2004; 279(30): 30919 - 30922.
[Abstract] [Full Text] [PDF]

Home page
 Nucleic Acids ResHome page
V. Salerno, A. Napoli, M. F. White, M. Rossi, and M. Ciaramella
Transcriptional response to DNA damage in the archaeon Sulfolobus solfataricus
Nucleic Acids Res., November 1, 2003; 31(21): 6127 - 6138.
[Abstract] [Full Text] [PDF]

This Article