HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 51, 49621-49630, December 20, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/51/49621    most recent M207672200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Fierobe, H.-P. Articles by Bélaïch, J.-P. Search for Related Content PubMed PubMed Citation Articles by Fierobe, H.-P. Articles by Bélaïch, J.-P. Social Bookmarking                      What's this?

Degradation of Cellulose Substrates by Cellulosome Chimeras

SUBSTRATE TARGETING VERSUS PROXIMITY OF ENZYME COMPONENTS^*

Henri-Pierre Fierobe^§, Edward A. Bayer^¶, Chantal Tardif, Mirjam Czjzek^**, Adva Mechaly^¶, Anne Bélaïch, Raphael Lamed, Yuval Shoham^§§, and Jean-Pierre Bélaïch

From the  Bioénergétique et Ingéniérie des Protéines, CNRS, IBSM, 13402 Marseille, France, the ^¶ Department of Biological Chemistry, The Weizmann Institute of Science, Rehovot 76100, Israel, the  Université de Provence, 13331 Marseille, the ^** Architecture Fonctionnelle des Macromolécules, CNRS, IBSM, 13402 Marseille, France, the  Department of Molecular Microbiology and Biotechnology, Tel Aviv University, Ramat Aviv 69978, and the ^§§ Department of Food Engineering and Biotechnology, and Institute of Catalysis Science and Technology, Technion-Israel Institute of Technology, Haifa 32000, Israel

Received for publication, July 30, 2002, and in revised form, October 7, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

A library of 75 different chimeric cellulosomes was constructed as an extension of our previously described approach for the production of model functional complexes (Fierobe, H.-P., Mechaly, A., Tardif, C., Bélaïch, A., Lamed, R., Shoham, Y., Bélaïch, J.-P., and Bayer, E. A. (2001) J. Biol. Chem. 276, 21257-21261), based on the high affinity species-specific cohesin-dockerin interaction. Each complex contained three protein components: (i) a chimeric scaffoldin possessing an optional cellulose-binding module and two cohesins of divergent specificity, and (ii) two cellulases, each bearing a dockerin complementary to one of the divergent cohesins. The activities of the resultant ternary complexes were assayed using different types of cellulose substrates. Organization of cellulolytic enzymes into cellulosome chimeras resulted in characteristically high activities on recalcitrant substrates, whereas the cellulosome chimeras showed little or no advantage over free enzyme systems on tractable substrates. On recalcitrant cellulose, the presence of a cellulose-binding domain on the scaffoldin and enzyme proximity on the resultant complex contributed almost equally to their elevated action on the substrate. For certain enzyme pairs, however, one effect appeared to predominate over the other. The results also indicate that substrate recalcitrance is not necessarily a function of its crystallinity but reflects the overall accessibility of reactive sites.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

A number of cellulolytic anaerobic microorganisms degrade plant cell wall cellulose by means of macromolecular complexes termed cellulosomes (1-8). In addition to a collection of cellulases, these large complexes can also include enzymes specialized for the degradation of other plant cell wall polymers, such as hemicellulases and pectinases (9, 10). Bacterial cellulosomes are typically composed of a scaffolding protein containing several cohesin domains, which bind to the dockerin domains of the catalytic subunits. The complete dissociation of all known bacterial cellulosomes into individual components requires harsh treatments, such as elevated temperatures and/or the presence of chaotropic agents, thus reflecting the strength of the cohesin-dockerin interaction. In the case of Clostridium cellulolyticum and Clostridium thermocellum, the interaction is Ca²⁺-dependent (11, 12) and of high affinity (10⁹ M¹; see Refs. 11 and 13).

The scaffoldins produced by C. cellulolyticum and C. thermocellum contain multiple cohesin domains and a single family 3A cellulose-binding domain (CBD).¹ The latter is located at the N terminus of the C. cellulolyticum scaffoldin, whereas the scaffoldin CBD from C. thermocellum adopts an internal position (14, 15). It has been shown for both species that the cohesins can interact with any of the dockerin domains of the same species, suggesting a random incorporation of the catalytic subunits along the scaffoldin (16-18). The cohesin-dockerin interaction, however, is species-specific, at least between these two clostridia (19).

In a previous study (20), we exploited the species specificity of the cohesin-dockerin interaction to selectively incorporate desired enzymes into precise positions within chimeric cellulosome complexes. For this purpose, a chimeric scaffoldin containing an optional CBD and divergent cohesins from each species binds selectively the appropriate dockerin-containing enzymes. In this manner, two cellulases from C. cellulolyticum, the family-5 CelA and the family-48 CelF, were engineered to bear the dockerin domain of CelS from C. thermocellum. The hybrid enzymes were then incorporated onto the chimeric scaffoldins together with the native CelA or CelF. It was observed that complexation induced enhanced levels of synergy, especially in the case of the heterogeneous enzyme mixtures (i.e. the native CelA and the hybrid CelF or vice versa).

In the present report, the technology involving the use of cellulosome chimeras was further extended to study binary mixtures of all available cellulases from C. cellulolyticum bound to a chimeric scaffoldin. To increase the number of enzyme pairs that can be incorporated in the complex, the native dockerin of CelE, one of the two major enzymes of the cellulosomes (17) (the other one being CelF), was also replaced by the dockerin of CelS from C. thermocellum. Thus three different dockerin-engineered hybrid cellulases (CelA, CelE, and CelF) are now available for combination with one of the five available wild-type cellulases (CelA, CelC, CelE, CelF, and CelG). In addition, the collection of the four previously described chimeric scaffoldins, containing either one or lacking a family-3A CBD, was extended to include a fifth chimeric scaffoldin that bears a family-3A CBD at both extremities. In total, 75 different chimeric cellulosomes were assembled in vitro by mixing the three types of components, and their activity was assayed on various cellulose substrates of different source, crystallinity, and ultrastructure.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Plasmids and Strains-- The plasmids and encoded proteins used in this work are summarized in Fig. 1. Previous reports described the construction of pJFAc (21), pJFAt (20), pETEc (22), pETFc (23), pETFt (20), pETGc (24), pETscaf1 (20), pETscaf2 (20), pETscaf3 (20), pETscaf4 (20), pETCipC1 (14), pETcoh1A (11), pET2CBD (18), and pQE-Coh2 (25).

View larger version (34K): [in this window] [in a new window]   Fig. 1.   Schematic representation of the recombinant proteins used in this study. White (C. thermocellum) and gray (C. cellulolyticum) symbols denote the source of the respective domains (see Key to symbols). Cohesin domains are numbered according to their original position in the respective native cellulosomal scaffoldin. A hydrophilic domain (X2) of unknown function is part of the C. cellulolyticum scaffoldin. An immunoglobulin-like domain (Ig) is part of 9Ec and 9Et. In the shorthand notation for the enzymes, numbers indicate the corresponding family of the catalytic domain; A, C, E, F, and G refer to the original name of the enzymes (CelA, CelC, CelE, CelF, and CelG, respectively); c and t indicate the source of the dockerin domain, C. cellulolyticum or C. thermocellum, respectively.

The plasmid pJFCc, encoding Cel8C of C. cellulolyticum containing a His tag at the C terminus, was obtained by inserting the primer 5'-TCAGCTAAAAGTTAAACTGCTTAACCACCACCACCACCACCACTAGC-3' into a BlpI site (the His tag is underlined in all sequences) located at the 3'-extremity of the coding sequence of pC17 (26).

Replacement of the native dockerin of Cel9E by the dockerin of C. thermocellum Cel48S was performed by the overlap-extension PCR method (27). The C. thermocellum dockerin-encoding region of pJFAt was amplified using the forward primer 5'-GATGAAAAGGGGCCAGAGATTGCCAAGACAAGCCCTAGCCCATC-3' and reverse primer 5'-CCCCCCCTCGAGTTAGTGGTGGTGGTGGTGGTGGTTCTTGTACGGCAAT GT-3', thus introducing an XhoI site (boldface type) at the 3'-extremity of the coding sequence. The region coding for the C-terminal part of the catalytic domain of Cel9E (including the unique BamHI site in pETEc) was amplified using the forward 5'-GTCATATGCTTATGAATTCAG-3' and reverse 5'-GATGGGCTAGGGCTTGTCTTGGCAATCTCTGGCCCCTTTTCATC-3' primers. The two resultant overlapping fragments (overlapping regions in italics) were mixed, and a combined fragment was synthesized using the external primers. The fragment was cloned into BamHI-XhoI linearized pETEc, thereby generating pETEt.

pETscaf5 was constructed from pETCip1X (20) coding for the miniCipC1 (C. cellulolyticum) and pET2CBD encoding cohesin2-CBD from CipA of C. thermocellum. The region encoding cohesin2-CBD from C. thermocellum was amplified using the forward 5'-GGGCGGCTCGAGGTTCCGTCAGACGGT-3' and reverse 5'-GGGCGGCTCGAGTATTGCATTCGGATCATC-3' primers, introducing an XhoI site (boldface) at both extremities of the coding sequence. The resulting fragment was cloned into XhoI-linearized pETCip1X, thus generating pETscaf5.

Positive clones were verified by DNA sequencing. DH5 and JM109 Escherichia coli strains (Clontech, Palo Alto CA) were used as production hosts for pJF and pQE derivatives, respectively. For pET derivatives, BL21(DE3) (Novagen, Madison, WI), was used as production host.

Production and Purification of Recombinant Proteins-- E. coli was grown at 37 °C to A₆₀₀ = 1.5 in Luria-Bertani medium supplemented with glycerol (12 g/liter) and the appropriate antibiotic. The culture was then cooled to 25 (5Ac, 5At, 8Cc, all cohesin(s)-containing proteins), 18 (48Fc and 48Ft), or 15 °C (9Ec, 9Et, and 9Gc), and isopropyl thio--D-galactoside was added to a final concentration of 400 (5Ac, 5At, 8Cc, all cohesin(s)-containing proteins) or 40 µM (48Fc, 48Ft, 9Ec, 9Et, and 9Gc). After 16 h, the cells were harvested by centrifugation (3000 × g, 20 min), resuspended in 30 mM Tris-HCl, pH 8, and broken in a French press. The purification of His-tagged proteins (see Fig. 1) was performed on nickel-nitrilotriacetic acid resin (28) (Qiagen, Venlo, The Netherlands). Scaf1, Scaf2, miniCipC1, and C2-CBDt were purified on Avicel PH101 (Fluka, Buchs, Switzerland) as described previously (18). Purification was achieved on Q-Sepharose fast flow (Amersham Biosciences) equilibrated in 25 mM Tris-HCl, pH 8.5. The proteins of interest were eluted by a linear gradient from 0 to 400 mM NaCl in 25 mM Tris-HCl, pH 8.5. The concentration of purified proteins was routinely estimated by absorbance (280 nm) in 6 M guanidine hydrochloride and 25 mM sodium phosphate, pH 6.5, using the program ProtParam tool (www.expasy.ch/tools/protparam.html) and also by quantitative amino acid analysis on a Beckman 6300 system (Fullerton, CA) using ninhydrin detection. The protein samples were dialyzed by ultrafiltration against 10 mM Tris-HCl, pH 8.0, 1 mM CaCl₂, aliquoted, and stored at 20 °C.

Purification of the -Glucosidase and the Cellulosome of C. cellulolyticum-- The -glucosidase Novozyme 188 (Novozymes, Bagsvaerd, Denmark) produced by Aspergillus niger was purified by gel filtration as described previously (29) except that AcA34 Ultrogel (Sepracor, Villeneuve-la-Garenne, France), equilibrated in 50 mM Tris-HCl, pH 7.5, 0.2 M NaCl, was used. The activity of the fractions was analyzed using p-nitrophenyl -D-glucopyranoside (Sigma), and the purity was verified by SDS-PAGE (Phast System, Amersham Biosciences). Fractions containing a single band at around 100 kDa were pooled and concentrated using a PM10 membrane (Millipore, Bedford, MA) with a cut-off of 10 kDa. The protein concentration was determined by the method of Lowry et al. (30), using bovine serum albumin as the standard.

The cellulosome produced by C. cellulolyticum was purified as described previously (17) from 1 liter of culture after 5 days of growth in a medium containing 7.5 g/liter of cellulose as the carbon source. The final protein concentration was determined as above.

Nondenaturing PAGE-- Samples (10 µM final concentration) were mixed at room temperature in 20 mM Tris maleate, pH 6.0, 10 mM CaCl₂, and 100 mM NaCl, and 1-4 µl were subjected to PAGE (4-15% gradient) using a PhastSystem device (Amersham Biosciences).

Stability of the Free Enzymes and Chimeric Cellulosomes-- Proteins (10 µM final concentration) were mixed at room temperature in 20 mM Tris maleate, pH 6.0, 1 mM CaCl₂, 0.01% NaN₃, and incubated at 37 °C. Aliquots were pipetted at 0, 1, 6, and 24 h, and their residual activity toward carboxymethyl cellulose (Sigma) (8 g/liter) was determined as described previously (21). The samples were also subjected to nondenaturing PAGE (4-15% gradient) and to SDS-PAGE (12.5%) after addition of loading buffer (25% v/v) and 5 min of boiling.

Enzyme Activity-- An aqueous suspension of homogenized ribbons of bacterial cellulose (BC) was prepared from Nata de coco (Daiwa Fine Products, Singapore) as described previously (29). Bacterial microcrystalline cellulose (BMCC) was prepared from BC as described previously (31). The concentration was determined by dry weight and by neutral sugar analysis (32). Phosphoric acid swollen (PAS)-cellulose was obtained from Avicel PH101 according to Ref. 33. Relative crystallinity indices of the cellulose suspensions (20 ml, 1 g/liter) were verified by x-ray diffraction (31) after vacuum filtration and air drying. The celluloses were resuspended in 20 mM Tris maleate, 1 mM CaCl₂, and 0.01% NaN₃. Aliquots (40 µl) of the protein samples (10 µM in 20 mM Tris maleate, pH 6.0, 10 mM CaCl₂, and 100 mM NaCl) were incubated at 37 °C with 4 ml of substrate. The final protein concentration was thus 0.1 µM. At 0, 1, 6, and 24 h, 0.9-ml aliquots were centrifuged and examined for reducing sugars (34).

In selected experiments, purified -glucosidase (see above) was added at a final concentration of 0.05 g/liter. In this case, aliquots were examined after centrifugation for reducing sugars (34) and glucose content using the glucose oxidase method (35).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Library of Chimeric Cellulosome Components-- The recombinant and engineered proteins (scaffoldins and enzymes), used in this study for incorporation into cellulosome chimeras, are presented in Fig. 1. Based on data published earlier (20), which demonstrated that scaffoldins containing a single CBD (Scaf1, -2, and -3) induced higher stimulation than those lacking a CBD (Scaf4), a fifth hybrid scaffoldin, derived from Scaf3, was designed and produced in E. coli. The resultant protein (Scaf5) contained a second family 3A CBD, stemming from CipA of C. thermocellum and located at the C terminus. Thus, Scaf5 contains one family 3A CBD from both species. The replacement of the intrinsic dockerin domain of CelE from C. cellulolyticum by the dockerin of CelS from C. thermocellum was also performed, thereby generating 9Et. For the purposes of this study, the enzymes are given a descriptive notation (see Fig. 1), whereby the initial number designates the corresponding glycosylhydrolase family (36); the capital letter refers to the original name of the C. cellulolyticum cellulase (i.e. CelE in this instance), and the lowercase letter indicates the origin of the dockerin domain (either C. cellulolyticum or C. thermocellum). Three hybrid C. cellulolyticum cellulases, bearing a C. thermocellum dockerin, were therefore available, 5At, 9Et, and 48Ft, and can be complemented for assembly of chimeric complexes by one of the five available native cellulases 5Ac (21), 8Cc (26), 9Ec (22), 48Fc (37), and 9Gc (24). C. cellulolyticum cellulases 5Ac and 8Cc were described previously as typical endoglucanases (21, 26), whereas 9Gc is an unusual endocellulase, the activity pattern of which resembles that of the homologous enzyme Cel9A from Thermobifida fusca (24, 38). Cellulosomal enzyme subunits 9Ec and 48Fc, however, were unambiguously identified as endo-processive cellulases (22, 37). As shown in Fig. 1, 9Ec (or 9Et) and 9Gc contain additional accessory domain(s) compared with the other cellulases used in the present study; 9Ec has a family-4 CBM and an Ig-like domain at the N terminus, whereas 9Gc contains a family-3C CBM between the catalytic domain and the C-terminal dockerin domain. Thus 15 different enzyme pairs can be incorporated onto each of the five hybrid scaffoldin leading to 75 different cellulosome chimeras.

The various proteins were produced in E. coli and were purified by a two-step procedure. The first step involved affinity chromatography on either cellulose or nickel-nitrilotriacetic acid according to the presence of a CBD or His tag, respectively; final purification was subsequently achieved by a chromatography on an anion exchanger.

Verification of Complex Formation-- Prior to addition of the substrate, stoichiometric mixtures of two desired enzymes and a test scaffoldin were subjected to nondenaturing PAGE in order to verify complex formation. As described previously (20), all ternary mixtures resulted in a single major band of altered mobility, indicating that complete or near-complete complex formation was observed in all cases.

Activity toward Avicel-- Enzyme pairs in the free state displayed little or no synergy on 3.5 g/liter Avicel, except the 48Ft + 9Gc pair for which the synergy reaches 2 (Table I). In contrast, most ternary complexes were found to be more active than the corresponding free enzyme pairs. The enhancement of the activity increased with incubation time to reach a maximum at 24 h, in the case of scaffoldins containing one or two CBDs, whereas for Scaf4-containing complexes the maximum enhancement was often reached after 6 h and remained constant until the end of the kinetic study (data not shown). The highest stimulation factors (SF, Table I), because of complexation, were observed for 5At and 9Gc bound to Scaf1 or Scaf2. In general, for a given enzyme pair, the same "hierarchy" between the scaffoldins in terms of activity enhancement was found: Scaf1 = Scaf2 > Scaf3 > Scaf5  Scaf4, thus indicating that the second family 3A CBD introduced in Scaf5 has a negative impact on the activity of the complexes, because Scaf3-containing complexes were more efficient. Lower but significant enhancements were observed for complexes containing Scaf4; the values varied from 3.5 (5At + 9Gc) to no enhancement for homogeneous enzyme pairs such as 9Et + 9Ec, indicating that in most cases bringing two different cellulases together is enough to trigger enhanced synergy. This suggests that the increase of activity observed when enzyme pairs are bound to Scaf2, for instance, is because of both the proximity of the catalytic domains in the complex and the presence of the family 3A CBD of the scaffoldin. To estimate the relative contribution of the CBD and the proximity in this type of complex, the data obtained with Scaf2 and -4 (Table I) were plotted in Fig. 2A. On the abscissa are reported the enhanced synergies exclusively due to enzyme proximity (SF_Scaf4), and the ordinates represent the calculated contribution of the CBD in Scaf2-based complexes (SF_Scaf2/SF_Scaf4). Many spots are located near or just above the diagonal line, indicating that both the CBD and the proximity of the enzymes contribute almost equally to the enhanced synergy observed for the Scaf2-based complexes. For selected enzyme pairs, however, one effect seemed to predominate over the other. For example, the inclusion of 48Ft and 8Cc into a Scaf4-based complex has no impact on the activity, and the observed enhancement when these cellulases are bound to Scaf2 would presumably reflect the presence of the CBD of the scaffoldin. On the other hand, the impact of the enzyme proximity is predominant when the cellulase pair 5At + 9Gc is attached to Scaf2, although the CBD still induces an additional 2-fold increase. An unexpected result concerns the homogeneous enzyme pair 5At + 5Ac, which, as previously reported (20), is 30-40% more active when bound to Scaf4. On the basis of these data, the impact of the complexation of these two enzyme pairs was subjected to additional investigation.

View larger version (14K): [in this window] [in a new window]   Fig. 2.   Calculated contribution of the CBD and proximity effects on the hydrolysis of Avicel (A) and BC (B). Data are from Table I (A) and Table II (B). On the x axis are reported ratios of stimulation factors for Scaf4 (SFScaf4), and on the y axis are reported (SFScaf2)/(SFScaf4). Vertical line (x = 1) discriminates between enzyme pairs displaying enhanced synergy in Scaf4-based complexes (x > 1) and enzyme pairs that are not stimulated (or are inhibited) by the binding to this scaffoldin (x  1). Horizontal line (y = 1) denotes enzyme pairs wherein binding to Scaf2 induces additional activity compared with Scaf4 (y > 1). The diagonal line (y = x) symbolizes an equal contribution between the proximity (SFScaf4), and the CBD effect ((SFScaf2)/(SFScaf4)). White numbers refer to the following enzyme pairs: 1, 5At + 5Ac; 2, 5At + 8Cc; 3, 5At + 9Ec; 4, 5At + 48Fc; 5, 5At + 9Gc; 6, 9Et + 5Ac; 7, 9Et + 8Cc; 8, 9Et + 9Ec; 9, 9Et + 48Fc; 10, 9Et + 9Gc; 11, 48Ft + 5Ac; 12, 48Ft + 8Cc; 13, 48Ft + 9Ec; 14, 48Ft + 48Fc; and 15, 48Ft + 9Gc.

Enhancement of the Activity of 5At + 9Gc and 5At + 5Ac-- The enzyme pair 5At and 9Gc was incubated for 24 h at 37 °C, either in the free state or bound to Scaf2 and Scaf4. The carboxymethylcellulase activity of the three mixtures was assayed at specific time intervals and found to remain constant even after 24 h of incubation in all cases (similar results were obtained with 5At + 5Ac, data not shown). Thus, the enhancement of the activity observed when 5At + 9Gc are bound to Scaf2 or Scaf4 is not due to a stabilization of the enzymes by complexation. The stability of the complexes at 37 °C was also investigated by subjecting the samples to nondenaturing PAGE (Fig. 3, A and B). In the case of the Scaf2-containing complex, after 24 h, the intensity of the major band corresponding to the ternary complex was reduced by less than 15%, whereas ~55% of the intensity was lost in the case of the Scaf4-containing complex. SDS-PAGE analysis performed on the same samples (Fig. 3, C and D) revealed that the observed reduction of the ternary complex was in fact due to a decay of Scaf4, because the intensity of the corresponding band decreased proportionally.

View larger version (62K): [in this window] [in a new window]   Fig. 3.   Stability of Scaf2- and Scaf4-based complexes with 5At + 9Gc. Samples containing 10 µM of Scaf2:5At/9Gc (A and C) or 10 µM of Scaf4:5At/9Gc (B and D) were incubated at 37 °C. At 0, 1, 6, and 24 h (time of incubation indicated on top of the lanes), aliquots were subjected to nondenaturing PAGE (A and B), or to SDS-PAGE (C and D).

The Avicelase activity of 5At and 9Gc was also assayed when these enzymes were complexed to either separate complementary cohesins or to single-cohesin/CBD constructs derived from the desired scaffoldin of C. cellulolyticum and C. thermocellum (see Fig. 1). The results (Fig. 4) indicate that the enhanced synergy, when the cellulases are bound to Scaf4, stems from the proximity of the cellulases in the complex and not from the binding of the dockerin domain to the corresponding cohesin, because attachment of the enzymes to separate cohesins induces only a 20% increase in activity. The individual association of both enzymes to a family 3A CBD and the resulting enhanced activity of the combined system also show that proximity of the enzymes in the Scaf2-based complex is an important factor.

View larger version (22K): [in this window] [in a new window]   Fig. 4.   Avicelase activity of 5At and 9Gc in the free and various complexed states. The designated proteins were mixed in stoichiometric amounts, and the status of the protein mixtures was verified by nondenaturing PAGE (data not shown) prior to addition of the crystalline cellulose. The amount of released soluble sugars was determined after 24 h of incubation at 37 °C. The data show the mean and S.D. of three independent experiments.

In contrast to the latter results, a similar experiment performed with 5At + 5Ac (Fig. 5) shows that the modest but significant enhancement observed when this homogeneous enzyme pair is anchored to Scaf4 is exclusively due to the binding of the dockerin domain to the corresponding cohesin. Because both enzymes are stable at 37 °C (no significant loss in carboxymethylcellulase activity after 24 h of incubation, see above), the gain in activity cannot be explained by a stabilization of the enzymes by complexation. These data rather suggest that the binding to the cohesin may induce minor conformational changes, which lead to slightly more active enzymes on Avicel.

View larger version (12K): [in this window] [in a new window]   Fig. 5.   Kinetic studies of Avicel hydrolysis by 5At + 5Ac in the free state or complexed to individual complementary cohesins or to Scaf4. The proteins were mixed in stoichiometric amounts, and the status of the protein mixtures was verified by nondenaturing PAGE (data not shown) prior to addition of the substrate. The amount of reducing soluble sugars was determined after 0, 1, 6, and 24 h of incubation at 37 °C. Curves are labeled as follows: 5At + 5Ac in the free state (), 5At bound to Coh2t + 5Ac bound to Coh1c (), and 5At + 5Ac complexed onto Scaf4 ().

Activity toward Ribbons of BC-- At a substrate concentration of 3.5 g/liter, many enzyme pairs in the free state (Table II) displayed unexpectedly high levels of synergy on this cellulose substrate, used for the first time in this work to assay C. cellulolyticum enzymes. The highest synergies were observed for pairs containing one endoglucanase (5A, 8C, or 9G) and one endoprocessive cellulase (48F or 9E). The synergy reached a value of ~10 when 48F was mixed with 5A or 8C. The complexation onto hybrid scaffoldins of the different enzyme pairs had various effects on the activity. In general, the enhancement of the activity was much lower than that found on Avicel. Most significant stimulations (above 2) were observed for endoglucanase pairs that showed low activity and no synergy in the free state when bound to Scaf1 or Scaf2. The binding to the same scaffoldins of enzyme pairs displaying high synergy in the free state (e.g. 48F + 5A or 8C) induced only a relatively modest increase in activity (50-80%). In contrast to the results obtained for Avicel as a test substrate, no obvious hierarchy between the hybrid scaffoldins could be deduced from the data reported in Table II. The binding to single-CBD scaffoldins usually induced the most significant enhancements, but not in all cases, and the difference with Scaf4 was less marked. The difference with Avicel is highlighted by the compilation of the data in Fig. 2B, in which the ratio SF_Scaf2/SF_Scaf4 was graphed as a function of SF_Scaf4. In the case of BC, the spots are less dispersed and closer to the coordinates 1,1. Another difference with Avicel is the fact that the attachment to Scaf5 induced a modest but significant inhibition of half of the enzyme pairs.

In the case of three enzyme pairs (9Et + 9Gc, 48Ft + 8Cc, and 48Ft + 9Gc, see Table II), the concentration of soluble sugars released after 24 h in both free and complexed states was in the range of 0.7-1.1 mM, and cellobiose was the main product (data not shown). In addition, these three enzyme pairs are among those least stimulated by complexation to Scaf2 or Scaf4. The possibility that feedback inhibition of the enzymes occurs at such concentrations of cellobiose was explored by adding a purified -glucosidase from A. niger in sufficient amounts (0.05 g/liter) to hydrolyze 2 mM cellobiose within 15 min at 37 °C. During the kinetic studies, the released soluble sugars were analyzed by the ferricyanide method (34) and by specific quantification of glucose (35). Because almost identical amounts were found with both techniques, it was concluded that the released cellobiose (and longer cellodextrins) was efficiently converted into glucose, and that only traces were remaining. Under these conditions, the stimulation due to complexation of these three enzyme pairs onto Scaf2 or Scaf4 was barely improved (Table III) and remains much lower than that found for the same complexes on Avicel. Thus cellobiose inhibition accounts very little for the low stimulations observed on BC.

View this table: [in this window] [in a new window]   Table III Released soluble sugars from BC (3.5 g/liter) after 24 h at 37 °C by selected enzyme pairs bound to Scaf2, Scaf4, and in the free state, in absence or in presence of -glucosidase

Comparison with Purified Cellulosomes-- Cellulosomes were purified from a culture of C. cellulolyticum grown on crystalline cellulose. The average molecular mass was previously estimated to be 600 kDa (17). The activity of the purified cellulosomes and one of the most efficient ternary complexes on Avicel and BC (Scaf2:48Ft/9Gc, see Tables I-III) were assayed on both types of crystalline cellulose at 3.5 g/liter (Fig. 6, A and B). The selected ternary complex has a molecular mass of about 200 kDa, and as for all kinetic studies described so far in the present study, the final concentration in the test tube was 0.1 µM (or 0.02 g/liter). Because the purified cellulosomes are three times larger (600 kDa), to facilitate the comparison two different concentrations of cellulosomes were used: 0.02 (0.033 µM) and 0.06 g/liter (0.1 µM). -Glucosidase was added in all cases as described above. At equivalent amounts of protein (0.02 g/liter), the cellulosomes and the selected ternary complex have almost identical levels of activity on BC, whereas on Avicel the cellulosomes are 5-fold more active. At this specific concentration, the cellulosomes have equivalent levels of specific activity on both celluloses. At similar molar equivalents (0.1 µM), the cellulosomes were found to be 10- and 3-fold more active than the ternary complex on Avicel and BC, respectively. After 24 h, 65% of the BC initially present and 44% of the Avicel were degraded.

View larger version (16K): [in this window] [in a new window]   Fig. 6.   Kinetic studies of Avicel (A) and BC (B) hydrolysis by purified cellulosome from C. cellulolyticum and by the Scaf2:48Ft/9Gc complex. -Glucosidase was added to a final concentration of 0.05 g/liter in all cases. Curves are labeled as follows: Scaf2-48Ft-9Gc complex at a final concentration of 0.1 µM (), purified cellulosome at a final concentration of ~0.033 µM (0.02 g/liter) (), and purified cellulosome at a final concentration of ~0.1 µM (0.06 g/liter) (). Released soluble sugars and glucose content were determined after 0, 1, 6, and 24 h of incubation at 37 °C by the ferricyanide and glucose oxidase methods, respectively. Similar amounts (variations within ± 5%) were found with both methods. The data show the mean of two independent experiments.

Influence of the Substrate Concentration-- The activity of the enzyme pair 48Ft + 9Gc was assayed at various concentrations of Avicel and BC, either in the free state or complexed onto Scaf2 or Scaf4. Because above 3.5 g/liter ribbons of BC constitute a thick gel, only lower concentrations were tested using this substrate, whereas in the case of Avicel, the concentration ranged from 1.5 to 15 g/liter. The results, reported in Table IV and Fig. 7, indicate that the stimulation due to the complexation onto Scaf2 is inversely proportional to the substrate concentration, whereas in the case of Scaf4, the stimulation is constant at all Avicel concentrations (~2-fold) and only varies from 2.65- to 1.1-fold on BC. Interestingly, during the kinetics, the same amounts of reducing soluble sugars were released by the Scaf2-based complex at all BC concentrations (Table IV), although after 24 h the percentage of saccharification varied from 90 (0.35 g/liter) to 10% (3.5 g/liter).

View larger version (9K): [in this window] [in a new window]   Fig. 7.   Enhanced activity for Scaf2- and Scaf4-based complexes of 48Ft + 9Gc at various concentrations of Avicel (A) and BC ribbons (B). Data are from Table IV. On the ordinates are reported the SF24h (released soluble sugars by ternary complex after 24 h/released soluble sugars by free 48Ft + 9Gc after 24 h). Curves were labeled as follows: Scaf2:48Ft/9Gc complex (), and Scaf4:48Ft/9Gc complex ().

Activity toward Other Celluloses-- The impact of the complexation of 48Ft and 9Gc onto Scaf2 and Scaf4 was also investigated in terms of activity toward the highly crystalline cellulose BMCC and the amorphous PAS-cellulose. The results are reported in Fig. 8 and compared with those obtained for Avicel and BC at the same standard concentration of 3.5 g/liter. Similar results were obtained for the action of the test complexes on Avicel and BMCC; complexation onto both types of hybrid scaffoldins induced strong increases in activity, and the difference between Scaf2 and Scaf4 was, however, less marked in the case of BMCC. As described above, the free enzymes displayed high levels of synergism (4.9-fold) on BC, and complexation onto either scaffoldin had almost no impact on the activity of this enzyme pair. On the contrary, the activity of the enzyme pair on PAS-cellulose was significantly inhibited (about 40%) by complexation onto Scaf2, whereas the Scaf4-based complex had similar levels of activity as observed for the free enzyme pair.

View larger version (24K): [in this window] [in a new window]   Fig. 8.   Influence of the type of cellulose on the activity of 48Ft and 9Gc in the free state or complexed onto Scaf2 and Scaf4. The released soluble sugars were monitored after 24 h of incubation at 37 °C by the ferricyanide method, except for PAS-cellulose, in which the amount of released soluble sugars was determined after only 80 min. The final protein concentration was 0.1 µM, and the concentration for all of the substrates was set at 3.5 g/liter. White bars, calculated release of soluble sugars by 48Ft and 9Gc; light gray bars, experimentally determined release of soluble sugars by the combined 48Ft + 9Gc pair in the free state; black bars, release of soluble sugars by the ternary complex Scaf2:48Ft/9Gc; dark gray bars, release of soluble sugars by the ternary complex Scaf4:48Ft/9Gc. The data show the mean and S.D. of two independent experiments. Note that the activity of the enzyme mixtures and complexes on PAS-cellulose is much higher than that of any of the other substrates, because of the very short assay time used for this substrate.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Cellulose is an unbranched, polymorphic homopolymer, consisting of long chains of -1,4-linked glucose residues (39-41). In nature the cellulose chains are packed in parallel fashion to form microfibrils, which are assembled into superstructures such as fibers, plant cell walls, pellicles, etc. The arrangement of the native cellulose chains into microfibrils generates crystalline regions of two different crystallographic phases (termed I and I, which differ in their hydrogen-bonding pattern) as well as less ordered "amorphous" regions. Cellulose polymorphy is reflected in the size, shape, crystallinity, and the relative proportions of the two crystallographic phases of the microfibrils. These properties will vary, depending on their source and methods of preparation. Moreover, within a single microfibril the more reactive I and relatively stable I phases usually coexist together with the disordered amorphous regions. Over the past years, a number of model cellulosic substrates have been developed to characterize the activity of cellulolytic enzymes. Among these model substrates, the least crystalline (0%) is a soluble substituted form of cellulose, CMC, that is usually very efficiently hydrolyzed by endoglucanases but not by processive cellulases. On the opposite side of the scale, cellulose microcrystals from the alga, Valonia ventricosa, are close to 100% crystalline and are considered to be one of the most recalcitrant types of celluloses to enzymatic hydrolysis (42).

In the present study, two commonly used intermediate forms of crystalline cellulose, Avicel and bacterial cellulose (BC), were selected as model substrates for assay of the 75 cellulosome chimeras; Avicel is extracted from wood pulp and presumably contains mainly the stable I crystallographic phase, characteristic of the higher plants. Avicel has a degree of polymerization (DP) of 100-250 glucopyranose units and is 50-60% crystalline (43). In contrast, BC ribbons are produced by the bacterium, Acetobacter xylinum, and the I phase is predominant (~60%) (42). The BC microfibril has a DP of ~2000 glucopyranose units and is 75% crystalline (31, 42).

By using Avicel as a model substrate, the data indicate that incorporation of cellulase pairs into a cellulosome-like particle can induce two major types of effects: (i) increased activity of the enzyme pairs, due to the presence of the family 3A scaffoldin CBD; (ii) enhanced synergy due to the proximity of the enzymes in the complex.

The contribution of the CBD to synergistic activity has already been reported for free cellulases associated to this particular type of CBD (44, 45) and for the enzyme pairs 48Ft + 5Ac and 48Fc + 5At (20). Clearly, single-CBD scaffoldins (Scaf1-3) gave the best enhancement of activity, compared with the CBD-less scaffoldin (Scaf4) or to the double-CBD scaffoldin (Scaf5). As expected, the CBD effect is inversely proportional to substrate concentration. The lower activities observed for the double-CBD Scaf5-based complexes probably reflect superfluous levels of interaction with the substrate incompatible with optimal activity of the associated enzymes. In this context, the presence of two CBDs in Scaf5 would restrict the mobility of the complexes across the surface of the substrate. Alternatively, upon binding to the substrate, Scaf5 may adopt a more rigid conformation than that of the single-CBD scaffoldins, thus limiting the mobility of the associated catalytic domains within the complex and reducing their activity toward the adjacent cellulose chains. This observation is consistent with the fact that the known bacterial scaffoldins never contain two or more family 3A CBDs (46). It may also be correlated with the fact that the C. celluloyticum cellulosomal cellulases, which have been discovered to date, lack an efficient cellulose-binding CBD.

The effect of enzyme proximity within the complex is reflected by the activity of Scaf4-based complexes. Avicelase activity of the most heterogeneous enzyme pairs was indeed increased significantly by complexation onto the CBD-less Scaf4. Interestingly, the highest level of enhancement by Scaf4-based complexes was observed for the enzyme pair, 9Gc + 5At, which displays no synergy in the free state. This probably indicates that the physical proximity and concerted action of these two endoglucanases enable them to hydrolyze additional sites. This may, however, reflect a more general phenomenon, because the enzyme pair showing the highest synergy (2-fold) in the free state, 48Ft + 9Gc, was also strongly stimulated when complexed onto Scaf4. Furthermore, the enhancement of activity due to proximity is probably underestimated, because after 24 h of incubation at 37 °C, about 50% (Fig. 3D) of Scaf4 undergoes spontaneous proteolysis (which was not observed for Scaf2).

A third effect was also observed with the homogeneous enzyme pair 5At + 5Ac, which exhibited a 40% increase in Avicelase activity when bound onto Scaf4 or independent complementary cohesins (Fig. 5). In this particular case, the results suggest that the binding of the dockerin to the corresponding cohesin induces conformational changes of the catalytic domain, leading to a slightly more active enzyme. Former studies (21) have shown that the removal of the dockerin domain of 5Ac induces significant modification in the activity pattern of this cellulase. The present study also indicates that the binding of the dockerin domain can modulate the activity of the enzyme toward crystalline cellulose. Alternatively, the presence of a dockerin domain may inhibit the catalytic domain in the free state, and the inhibition is relieved during the complexation to the cohesin.

Complexation of most enzyme pairs on a CBD-containing scaffoldin appears to induce both the CBD and the proximity effects, with respect to Avicelase activity (Fig. 2A). In two cases, however, one effect clearly predominates. In this context, the activity of the 5At + 9Gc pair was strongly stimulated by complexation onto the CBD-less Scaf4 (3.5-fold), whereas the effect of binding onto Scaf2 was much less (2-fold), suggesting that in this particular case, the proximity effect is more important. The cellulase 9Gc, contains a family 3C CBM, usually described as "helper" or "catalytic" CBMs (46). Nevertheless, the CBM3C of 9Gc exhibits a moderate but measurable affinity for crystalline cellulose (24). Thus, the strong stimulation of the Scaf4-based 5At + 9Gc pair may partly reflect the latter phenomenon leading to the enhancement of the overall proximity effect. Indeed, the two other Scaf4-based complexes that exhibit a relatively strong stimulation also contain 9Gc. In contrast, complexation of 48Ft + 8Cc onto Scaf4 showed little (20%) effect on Avicelase activity, whereas the binding onto single CBD scaffoldins induced up to a 4-fold increase in activity (see Table I and Fig. 2A). Consequently, enhancement of Avicelase activity by the latter Scaf2-complexed enzyme pair is almost exclusively due to the CBD effect, which could be the combination of the substrate-targeting function and the proposed disruptive effect that CBDs show on cellulose (45, 47, 48). In any case, it appears that the family-8 cellulase (8Cc) is particularly sensitive to the CBD effect as opposed to the proximity effect (Fig. 2).

When ribbons of BC were used as a substrate (see Table II and Fig. 2B), most enzyme pairs displayed high levels of both activity and synergy in the free state, compared with those observed for Avicel. The stimulation factors due to complexation on hybrid scaffoldins were drastically reduced. The difference between the two types of cellulose substrates is also underscored by the fact that purified cellulosomes, the ternary complex (Scaf2:48Ft/9Gc), and the free enzyme pair (48Ft + 9Gc) all show equivalent specific activities on BC. On Avicel, however, the cellulosomes are 5-fold more active than the chimeric complex, which is, in turn, 4-fold more active than the free enzyme pair. It is thus clear that Avicel is more difficult to degrade, and efficient hydrolysis of this substrate requires the large variety of cellulases contained by the cellulosomes. Such differences cannot be explained by the crystallinity, because the relative crystallinity index of BC is even higher than that of Avicel. Another difference between the two substrates concerns the ultrastructure; BC has been described as thin, long, and well dispersed ribbons, along which highly crystalline regions are interrupted by amorphous or less-ordered regions (29, 42). In contrast, Avicel is composed of large aggregates of microcrystals that have a low surface area (43, 49, 50). Thus, in BC, the crystalline and disordered domains of the ribbons are much more accessible to an enzyme or an enzyme complex, as reflected by the fact that the free enzyme pair 48Ft + 9Gc is about 10 times more active on BC than on Avicel (Tables I and II). It is therefore assumed that at the same cellulose concentration, reactive and accessible sites are much more abundant in BC than in Avicel. Interestingly, at lower concentrations of BC, complexation on both Scaf2 and Scaf4 induces drastic increases in activity of the enzyme pair (Table IV), suggesting that the impact of complexation, especially on single-CBD scaffoldins, is maximum when the amount of reactive and accessible sites of the substrate is low.

To assess this hypothesis further, the 48Ft + 9Gc pair in the free and complexed states was assayed on two other types of celluloses designed to exhibit contrasting physical properties, i.e. BMCC and PAS-cellulose. On the one hand, BMCC is obtained from BC by moderate hydrolysis with HCl. Such treatment acts selectively on the disordered or amorphous domains of the ribbons, leading to a reduction in DP to 100-150 residues and to an aggregation of the crystalline domains (31, 51). BMCC is thus slightly more crystalline than BC, and the remaining reactive sites are less accessible than in BC. The properties of BMCC would thus resemble those of Avicel more than BC. On the other hand, PAS-cellulose is produced from Avicel, whereby the reactive and accessible sites are very abundant, because the majority of the crystalline regions of the cellulose has been converted to amorphous domains.

Complexation of 48Ft + 9Gc onto either Scaf2 or Scaf4 resulted in a significant increase in activity on BMCC (Fig. 8), similar to that observed for Avicel. In contrast, on PAS-cellulose, the Scaf2-based complex exhibited lower activity than that observed either for the free enzyme pair or for the Scaf4-based complex. These data clearly indicate that the benefit of complexation depends directly upon the concentration of "accessible reactive sites" on the substrate. At high concentrations of accessible sites (e.g. as in PAS-cellulose), the mobility of the enzymes is a critical factor for reaching maximum activity. Complexation onto Scaf4, the CBD-less scaffoldin, does not seem to hinder the mobility of the enzymes, because the observed activity is similar to that of the free enzyme pair. The presence of a family 3A CBD, however, could account for the observed reduction in activity for the Scaf2-based complex on PAS-cellulose. In this respect, BC can be considered as an intermediate type of substrate, where accessible reactive sites are relatively abundant and subject to equivalently high levels of degradation by both free and complexed enzymes. Avicel and BMCC would constitute a third category of cellulose, characterized by low levels of accessibility, whereby complexation of enzyme pairs results in strong enhancement of synergy. In the case of BMCC, the proximity of the enzymes in the complex seems to prevail, whereas for Avicel, both enzyme proximity and the presence of a CBD appear to be important factors for optimal degradation of the substrate.

The data obtained with the ternary complexes strongly suggest that C. cellulolyticum cellulosomes are optimized for degradation of recalcitrant cellulose substrates, whereby recalcitrance reflects both the intrinsic crystallinity and the low accessibility of reactive sites on the substrate, such as that found in native plant cell walls. The proximity of the cellulosomal enzymes and the presence of the scaffoldin-based family 3A CBD play major roles in the synergy among the components and the resultant efficient degradation of the native substrate.

	ACKNOWLEDGEMENTS

We thank O. Valette for expert technical assistance. We also thank R. Lebrun for performing amino acid compositions, C. Villard for sugar analysis, and O. Suetsugu for providing Nata de coco.

	FOOTNOTES

^* This work was supported by the CNRS, the Conseil Général des Bouches du Rhône, the Region Provence-Alpes-Côte d'Azur, the Israel Science Foundation Grants 771/01, 446/01, and 250/99, the Otto Meyerhof Center for Biotechnology (established by the Minerva Foundation, Munich, Germany), and funds from the Technion-Niedersachsen Cooperation (Hannover, Germany).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^§ To whom correspondence should be addressed: Bioénergétique et Ingéniérie des Protéines, CNRS, IBSM-IFR1, 13402 Marseille, France. Tel.: 33-491-16-42-99; Fax: 33-491-71-33-21; E-mail: hpfierob@ibsm.cnrs-mrs.fr.

Published, JBC Papers in Press, October 22, 2002, DOI 10.1074/jbc.M207672200

	ABBREVIATIONS

The abbreviations used are: CBD, cellulose-binding domain; CBM, carbohydrate-binding module; BC, bacterial cellulose; BMCC, bacterial microcrystalline cellulose; PAS-cellulose, phosphoric acid swollen cellulose; DP, degree of polymerization.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				B. A. Pinheiro, M. R. Proctor, C. Martinez-Fleites, J. A. M. Prates, V. A. Money, G. J. Davies, E. A. Bayer, C. M. G. A. FontesM, H.-P. Fierobe, and H. J. Gilbert The Clostridium cellulolyticum Dockerin Displays a Dual Binding Mode for Its Cohesin Partner J. Biol. Chem., June 27, 2008; 283(26): 18422 - 18430. [Abstract] [Full Text] [PDF]

				V. V. Zverlov, M. Klupp, J. Krauss, and W. H. Schwarz Mutations in the Scaffoldin Gene, cipA, of Clostridium thermocellum with Impaired Cellulosome Formation and Cellulose Hydrolysis: Insertions of a New Transposable Element, IS1447, and Implications for Cellulase Synergism on Crystalline Cellulose J. Bacteriol., June 15, 2008; 190(12): 4321 - 4327. [Abstract] [Full Text] [PDF]

				F. Mingardon, A. Chanal, C. Tardif, E. A. Bayer, and H.-P. Fierobe Exploration of New Geometries in Cellulosome-Like Chimeras Appl. Envir. Microbiol., November 15, 2007; 73(22): 7138 - 7149. [Abstract] [Full Text] [PDF]

				F. Mingardon, A. Chanal, A. M. Lopez-Contreras, C. Dray, E. A. Bayer, and H.-P. Fierobe Incorporation of Fungal Cellulases in Bacterial Minicellulosomes Yields Viable, Synergistically Acting Cellulolytic Complexes Appl. Envir. Microbiol., June 15, 2007; 73(12): 3822 - 3832. [Abstract] [Full Text] [PDF]

				J.-C. Blouzard, C. Bourgeois, P. de Philip, O. Valette, A. Belaich, C. Tardif, J.-P. Belaich, and S. Pages Enzyme Diversity of the Cellulolytic System Produced by Clostridium cellulolyticum Explored by Two-Dimensional Analysis: Identification of Seven Genes Encoding New Dockerin-Containing Proteins J. Bacteriol., March 15, 2007; 189(6): 2300 - 2309. [Abstract] [Full Text] [PDF]

				A. L. Carvalho, F. M. V. Dias, T. Nagy, J. A. M. Prates, M. R. Proctor, N. Smith, E. A. Bayer, G. J. Davies, L. M. A. Ferreira, M. J. Romao, et al. Evidence for a dual binding mode of dockerin modules to cohesins PNAS, February 27, 2007; 104(9): 3089 - 3094. [Abstract] [Full Text] [PDF]

				M. Hammel, H.-P. Fierobe, M. Czjzek, V. Kurkal, J. C. Smith, E. A. Bayer, S. Finet, and V. Receveur-Brechot Structural Basis of Cellulosome Efficiency Explored by Small Angle X-ray Scattering J. Biol. Chem., November 18, 2005; 280(46): 38562 - 38568. [Abstract] [Full Text] [PDF]

				R. Koukiekolo, H.-Y. Cho, A. Kosugi, M. Inui, H. Yukawa, and R. H. Doi Degradation of Corn Fiber by Clostridium cellulovorans Cellulases and Hemicellulases and Contribution of Scaffolding Protein CbpA Appl. Envir. Microbiol., July 1, 2005; 71(7): 3504 - 3511. [Abstract] [Full Text] [PDF]

				H.-P. Fierobe, F. Mingardon, A. Mechaly, A. Belaich, M. T. Rincon, S. Pages, R. Lamed, C. Tardif, J.-P. Belaich, and E. A. Bayer Action of Designer Cellulosomes on Homogeneous Versus Complex Substrates: CONTROLLED INCORPORATION OF THREE DISTINCT ENZYMES INTO A DEFINED TRIFUNCTIONAL SCAFFOLDIN J. Biol. Chem., April 22, 2005; 280(16): 16325 - 16334. [Abstract] [Full Text] [PDF]

				F. Mingardon, S. Perret, A. Belaich, C. Tardif, J.-P. Belaich, and H.-P. Fierobe Heterologous Production, Assembly, and Secretion of a Minicellulosome by Clostridium acetobutylicum ATCC 824 Appl. Envir. Microbiol., March 1, 2005; 71(3): 1215 - 1222. [Abstract] [Full Text] [PDF]

				M. Hammel, H.-P. Fierobe, M. Czjzek, S. Finet, and V. Receveur-Brechot Structural Insights into the Mechanism of Formation of Cellulosomes Probed by Small Angle X-ray Scattering J. Biol. Chem., December 31, 2004; 279(53): 55985 - 55994. [Abstract] [Full Text] [PDF]

				A. Levasseur, S. Pages, H.-P. Fierobe, D. Navarro, P. Punt, J.-P. Belaich, M. Asther, and E. Record Design and Production in Aspergillus niger of a Chimeric Protein Associating a Fungal Feruloyl Esterase and a Clostridial Dockerin Domain Appl. Envir. Microbiol., December 1, 2004; 70(12): 6984 - 6991. [Abstract] [Full Text] [PDF]

				S. Perret, A. Belaich, H.-P. Fierobe, J.-P. Belaich, and C. Tardif Towards Designer Cellulosomes in Clostridia: Mannanase Enrichment of the Cellulosomes Produced by Clostridium cellulolyticum J. Bacteriol., October 1, 2004; 186(19): 6544 - 6552. [Abstract] [Full Text] [PDF]

				S. Perret, L. Casalot, H.-P. Fierobe, C. Tardif, F. Sabathe, J.-P. Belaich, and A. Belaich Production of Heterologous and Chimeric Scaffoldins by Clostridium acetobutylicum ATCC 824 J. Bacteriol., January 1, 2004; 186(1): 253 - 257. [Abstract] [Full Text] [PDF]

				A. L. Carvalho, F. M. V. Dias, J. A. M. Prates, T. Nagy, H. J. Gilbert, G. J. Davies, L. M. A. Ferreira, M. J. Romao, and C. M. G. A. Fontes Cellulosome assembly revealed by the crystal structure of the cohesin-dockerin complex PNAS, November 25, 2003; 100(24): 13809 - 13814. [Abstract] [Full Text] [PDF]

				R. H. Doi, A. Kosugi, K. Murashima, Y. Tamaru, and S. O. Han Cellulosomes from Mesophilic Bacteria J. Bacteriol., October 15, 2003; 185(20): 5907 - 5914. [Full Text] [PDF]

				S. O. Han, H. Yukawa, M. Inui, and R. H. Doi Regulation of Expression of Cellulosomal Cellulase and Hemicellulase Genes in Clostridium cellulovorans J. Bacteriol., October 15, 2003; 185(20): 6067 - 6075. [Abstract] [Full Text] [PDF]

				S. O. Han, H. Yukawa, M. Inui, and R. H. Doi Transcription of Clostridium cellulovorans Cellulosomal Cellulase and Hemicellulase Genes J. Bacteriol., April 15, 2003; 185(8): 2520 - 2527. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/51/49621    most recent M207672200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Fierobe, H.-P. Articles by Bélaïch, J.-P. Search for Related Content PubMed PubMed Citation Articles by Fierobe, H.-P. Articles by Bélaïch, J.-P. Social Bookmarking                      What's this?