HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 51, 49700-49706, December 20, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/51/49700    most recent M209700200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Swamynathan, S. K. Articles by Piatigorsky, J. Search for Related Content PubMed PubMed Citation Articles by Swamynathan, S. K. Articles by Piatigorsky, J. Social Bookmarking                      What's this?

Orientation-dependent Influence of an Intergenic Enhancer on the Promoter Activity of the Divergently Transcribed Mouse Shsp/B-crystallin and Mkbp/HspB2 Genes^*

Shivalingappa K. Swamynathan and Joram Piatigorsky

From the Laboratory of Molecular and Developmental Biology, NEI, National Institutes of Health, Bethesda, Maryland 20892

Received for publication, September 20, 2002

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The mouse Shsp/B-crystallin and Mkbp/HspB2 genes are closely linked and divergently transcribed. In this study, we have analyzed the contribution of the intergenic enhancer to Shsp/B-crystallin and Mkbp/HspB2 promoter activity using dual-reporter vectors in transient transfection and transgenic mouse experiments. Deletion of the enhancer reduced Shsp/B-crystallin promoter activity by 30- and 93-fold and Mkbp/HspB2 promoter activity by 6- and 10-fold in transiently transfected mouse lens -TN4 and myoblast C2C12 cells, respectively. Surprisingly, inversion of the enhancer reduced Shsp/B-crystallin promoter activity by 17-fold, but did not affect Mkbp/HspB2 promoter activity in the transfected cells. In contrast, enhancer activity was orientation-independent in combination with a heterologous promoter in transfected cells. Transgenic mouse experiments established the orientation dependence and Shsp/B-crystallin promoter preference of the intergenic enhancer in its native context. The orientation dependence and preferential effect of the Shsp/B-crystallin enhancer on the Shsp/B-crystallin promoter provide an example of adaptive changes in gene regulation accompanying the functional diversification of duplicated genes during evolution.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Crystallins are abundant, water-soluble, cytoplasmic proteins responsible for the transparent and refractive properties of the lens. In vertebrates, the -, -, and -crystallins are the most common. -Crystallin is an aggregate of two polypeptides, A and B, both of which are members of the SHSP (small heat shock protein) family of molecular chaperones, sharing 55% identity in their amino acid sequences. Expression of crystallins is abundant in, but not restricted to, the lens. Most, if not all, crystallins found in exceedingly high concentrations in the lens are also expressed in diverse tissues in variable amounts, where they serve as metabolic enzymes or stress proteins. This exploitation of different properties of a single polypeptide via differential gene regulation in different tissues has been termed "gene sharing" (1-3).

Shsp/B-crystallin promoter activity (4) and accumulation of the Shsp/B-crystallin transcripts (5) begin in the developing lens placode as early as day 9.5 of embryonic development. Outside of the lens, Shsp/B-crystallin is expressed at considerable levels in the heart and skeletal muscle and at low levels in several other tissues (4-8). In addition, Shsp/B-crystallin is stress-inducible (9), and its overexpression has been documented in various diseases (10-13). Previous work from our laboratory demonstrated that the 164/+44 bp promoter of the Shsp/B-crystallin gene is sufficient to direct the expression of a reporter gene in the lens and that the cis-acting lens-specific regulatory regions 1 (147/118 bp) and 2 (78/46 bp) bound by both Pax-6 and retinoic acid/retinoid receptors are used for this tissue-specific activity (14-17). An upstream enhancer (426/258 bp) containing at least five cis-elements can activate the herpes simplex virus thymidine kinase promoter in transfection experiments, independent of the position and orientation of the enhancer in the plasmid (18-20).

The Mkbp/HspB2 (myotonic dystrophy protein kinase-binding protein/heat shock protein B2) gene, another member of the Shsp/-crystallin family, is divergently transcribed from 863 bp relative to the transcription start site of the Shsp/B-crystallin gene in the mouse (see Fig. 1A) (21, 22). Expression of Mkbp/HspB2 is detectable in the heart and skeletal muscle (22). Unlike Shsp/B-crystallin, Mkbp/HspB2 is not expressed in the lens and is not stress-inducible (22). Studies in mice in which both the Shsp/B-crystallin and Mkbp/HspB2 genes have been disrupted by homologous recombination demonstrated that these two genes are not essential for normal development of a transparent lens, but one or both are required to maintain the integrity of skeletal muscle cells (23).

Bidirectional gene organization described above for Mkbp/HspB2 and Shsp/B-crystallin is a common feature in eukaryotes (24). Divergent transcription of genes with differential expression profiles, such as the Shsp/B-crystallin and Mkbp/HspB2 genes, results in conflicting demands on intergenic enhancers. In this study, bidirectional, dual-reporter genes were used to test the effect of deleting or inverting the intergenic enhancer on Shsp/B-crystallin and Mkbp/HspB2 promoter activity in transfected cells and transgenic mice. Our results demonstrate that this intergenic enhancer preferentially activates the Shsp/B-crystallin promoter, although it has some effect on the Mkbp/HspB2 promoter as well. Furthermore, we show that the effect of the enhancer on Shsp/B-crystallin promoter activity is orientation-dependent in its native context. Our results thus reveal a functional specialization of this intergenic enhancer associated with the duplication and subsequent evolution of these linked Shsp-related genes arranged in a head-to-head manner.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Isolation of Total RNA and RT¹-PCR-- Total RNA was isolated from 30 mg of tissues using an RNeasy mini kit (QIAGEN Inc., Valencia, CA). Eluted RNA was quantified by measuring absorbance at 260 nm, and the concentration was adjusted with RNase-free water to 100 ng/µl. One-step RT-PCR was done using Ready-To-Go RT-PCR beads (Amersham Biosciences). 500 ng of total RNA was used to amplify the 280-bp fragment from Mkbp/HspB2 with primers 8777 (complementary nucleotides +945 to +924 in exon 2 of the Mkbp/HspB2 gene, ATAGAGCAGCTCGAACCCGCCA) and 8778 (nucleotides +665 to +684 in exon 2 of the Mkbp/HspB2 gene, CTCTATCACGGCTACTATGT), whereas 50 ng of total RNA was used to amplify the 262-bp fragment from the Shsp/B-crystallin gene with primers 8779 (nucleotides +3744 to +3763 in exon 3 of the Shsp/B-crystallin gene, GAACATGGCTTCATCTCCAG) and 8780 (complementary nucleotides +4025 to +4006 in exon 3 of the Shsp/B-crystallin gene, AGCTTCAGCACTAGTCACAG). The RT-PCR products were separated on a 1.5% agarose gel using Tris borate/EDTA.

Construction of the Reporter Vectors-- Unless otherwise stated, all nucleotide positions used here are relative to the transcription start site of the Shsp/B-crystallin gene. The 2.0-kb fragment containing the firefly luciferase gene was excised from the plasmid pGL3-Basic (Promega, Madison, WI) with SmaI and SalI and cloned into the pRL-Null vector (Promega) linearized with SmaI and SalI to generate the vector pRLFL-Null. The 959/+42 bp fragment between the mouse Shsp/B-crystallin and Mkbp/HspB2 genes, including both genes' transcription start sites, but not their translation start sites, was amplified using primers 8703 (⁹⁵⁹GACTGCTGTTGCGACTAGTAGC⁹³⁸) and 8704 (⁺⁴²GGCTAGATGAATGCAGAGTC⁺²³), purified, and ligated into the pRLFL-Null vector linearized with SmaI. Clones with both orientations of the intergenic region were isolated and labeled as pFL-HSPB2B-RL and pRL-HSPB2B-FL (where RL is Renilla luciferase and FL is firefly luciferase).

Recombinant PCR-mediated ligation (25) was used to delete or invert the 436/258 bp enhancer. For deletion, the fragment upstream of the enhancer was amplified using primers 8703 and 8844 (⁴⁵³GAACTAGGTGTCTGACTG²⁵⁶), and the fragment downstream of the enhancer was amplified using primers 8704 and 8912 (⁴⁵³CAGTCAGACACCTAGTTC⁴³⁶ joined to ²⁵⁶ACAAGGATGGGGTGGGTG²³⁹), the 5'-half of which is complementary to primer 8844. These two fragments were then ligated by PCR using primers 8703 and 8704 to amplify the 959/+42 bp fragment with a targeted deletion of the 436/258 bp enhancer. The fragment so produced was cloned into the SmaI site of the pRLFL-Null vector described above, and the resultant plasmid was labeled as pFL-HSPB2DelEB-RL.

For inverting the 436/258 bp enhancer, the intergenic region was initially amplified in three different fragments: fragment 1, 959 to 436 bp upstream of the enhancer using primers 8703 and 8844; fragment 2, 258 to +42 bp downstream of the enhancer using primers 8704 and 8847 (⁴¹⁹GAGTCCTAGAGGAGAGC⁴³⁵ joined to ²⁵⁷AACAAGGATGGGGTGGGTG²³⁹); and fragment 3, the 436/258 bp enhancer using primer 8845 (⁴³⁶TGCTCTCCTCTAGGACTC⁴¹⁹), complementary to the 5'-half of primers 8847 and 8846 (⁴⁵³CAGTCAGACACCTAGTTC⁴³⁶ joined to ²⁵⁷TCTCTGGAGCTAGGATGG²⁷⁴), the 5'-half of which is complementary to primer 8844. In the next step, fragment 3 was ligated in the inverted orientation by recombinant PCR with (a) the upstream fragment using primers 8703 and 8845 or (b) the downstream fragment using primers 8846 and 8704. These reactions generated two different fragments, upstream fragment 4 and downstream fragment 5, each with the enhancer attached in the inverted orientation. In the final step, fragments 4 and 5 were ligated by recombinant PCR using primers 8703 and 8704. The final PCR product containing the inverted enhancer was cloned into the pRLFL-Null plasmid linearized with SmaI, and the resultant plasmid was labeled pFL-HSPB2InvEB-RL. The intergenic region in all these plasmids was sequenced using ABI Big Dye terminator mixture and an ABI Prism 310 genetic analyzer to confirm the intended deletion or the inversion of the enhancer.

The vector pRL-HSPB2B-FL described above was used as the starting material for generating the vectors 820RL, 672RL, 533RL, 220RL, 190RL, and 163RL. pRL-HSPB2B-FL was digested with the following enzymes, and the resulting large fragment was religated to generate the corresponding vectors: HindIII for 820RL, AgeI and HindIII for 672RL, SphI for 533RL, SpeI for 220RL, SacI for 190RL, and PvuII and HindIII for 163RL.

The vectors pGL3-PE-3 and pGL3-PE-4 were constructed as follows. The 450/249 bp fragment was amplified using primers 9829 (nucleotides 267 to 249 with a BglII site, ATGCAGATCTATCCTTGTTCTCTGGAGCT) and 9830 (nucleotides 450 to 430 with a BglII site, ATGCAGATCTCAGACACCTAGTTCTGCTCT), digested with BglII, and cloned into the BglII site of the base vector pGL3-Promoter (Promega). Orientation of the enhancer in these clones was tested with StyI digestion, and clones containing the enhancer in different orientations were labeled pGL3-PE-3 and pGL3-PE-4.

Cell Culture, Transfections, and Dual-luciferase Assays-- Mouse lens epithelial -TN4 cells (26), rabbit lens epithelial N/N1003 cells (27), and mouse myoblast C2C12 cells (28) were propagated in Dulbecco's modified Eagle's medium (Invitrogen) containing 10% fetal bovine serum and 50 µg/ml of gentamycin in 5% CO₂. Cells in six-well plates in the mid-log phase of growth were transfected with 1 µg of different plasmids using 3 µl of FuGENE 6 (Roche Molecular Biochemicals). After 2 days, cells were washed with cold phosphate-buffered saline and lysed with 500 µl of passive lysis buffer (Promega). The lysate was clarified, and 100 µg of lysate was analyzed using a Renilla luciferase assay or dual-luciferase assay kit (Promega) and a Tropix TR717 microplate luminometer (Applied Biosystems). The measurement was integrated over 10 s with a delay of 2 s. When pCMV-gal was used to normalize the transfection efficiency across the different treatments, -galactosidase assays were performed as described (29), and the normalized amount of lysate was then used in dual-luciferase assays.

Generation of DNA Fragments for Production of Transgenic Mice-- Plasmids pFL-HSPB2B-RL, pRL-HSPB2B-FL, and pFL-HSPB2DelEB-RL or pFL-HSPB2InvEB-RL were digested with BamHI to release the fragment containing the firefly and Renilla luciferase genes under the control of the intergenic region. These fragments were eluted from agarose gels using Geneclean II (BIO 101, Inc., Vista, CA) and purified further by chloroform extraction and ethanol precipitation. The purified fragments were used to generate the transgenic mice at the NEI Transgenic Mouse Facility as described previously (30). Genomic DNA from founder mice was isolated and assayed for the presence of the transgenes by PCR using transgene-specific primers. Founders positive for the transgene were mated with wild-type FVB/N mice to obtain F₁ offspring.

Analysis of Transgenic Mice-- All analyses with the transgenic mice were done with ~8-week-old mice. About 100 mg of each tissue analyzed was homogenized in 500 µl of ice-cold 1× passive lysis buffer on ice using a hand-held Kontes homogenizer for ~30-45 s. The lysate was cleared by centrifugation at 12,000 rpm for 15 min at 4 °C. Protein concentration in the supernatant fractions was estimated using the bicinchoninic acid method (Pierce). Lysates were diluted to achieve equal concentration, and 50 µg of protein from each tissue was subjected to dual-luciferase assays as described above. For the DB28 series of transgenic mice (4), 50 µg of protein from different tissues was subjected to -galactosidase assays using chlorophenol red -D-galactopyranoside (Roche Molecular Biochemicals) as substrate (29).

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Relative Levels of Expression of Mouse Shsp/B-crystallin and Mkbp/HspB2 Genes-- Organization of the Mkbp/HspB2-Shsp/B-crystallin locus is shown in Fig. 1A. To detect the relative levels of expression of the Shsp/B-crystallin and Mkbp/HspB2 genes in various tissues of the adult mouse, semiquantitative RT-PCR was performed with 50 ng (for Shsp/B-crystallin) or 500 ng (for Mkbp/HspB2) of total RNA isolated from different tissues of an 8-week-old mouse. The resulting products were separated on a 1.5% agarose gel (Fig. 1B). Expression of the Shsp/B-crystallin gene was most abundant in the lens, followed by the heart, muscle, diaphragm, lung, and cornea. In contrast, the Mkbp/HspB2 transcripts could be detected at a low level only in the heart, muscle, and diaphragm (Fig. 1B). The trace amounts of DNA seen in the lens and lung lanes migrated below that of Mkbp/HspB2 and are an artifact of this procedure.

View larger version (36K): [in this window] [in a new window]   Fig. 1.   Organization and relative levels of expression of the mouse Shsp/B-crystallin and Mkbp/HspB2 genes. A, schematic showing the organization of the Mkbp/HspB2-Shsp/B-crystallin locus is presented above. Although the effect of the intergenic enhancer on Shsp/B-crystallin promoter activity is well known, its effect on Mkbp/HspB2 promoter activity is not. The major question addressed in this study, viz. the effect of inverting the enhancer within its natural location on the relative activities of the two promoters, is depicted below. DPE, downstream promoter element; LSR, lens-specific regulatory region; TATA, TATA box. B, semiquantitative RT-PCR analysis of relative levels of expression of Shsp/B-crystallin and Mkbp/HspB2. RT-PCR products separated on a 1.5% agarose gel are shown.

Deletion Analysis of the Effect of the Enhancer on the Mkbp/HspB2 Promoter-- To identify the role of the enhancer in the regulation of Mkbp/HspB2 promoter activity, we constructed a series of reporter vectors wherein the Renilla luciferase gene was under the control of progressively deleted Mkbp/HspB2 promoter fragments. Murine myoblast C2C12 cells, which are known to support Mkbp/HspB2 gene expression, were used for these transfections (22). Deletion of the sequence between 672 and 533 bp relative to the transcription start site of the Mkbp/HspB2 gene reduced Mkbp/HspB2 promoter activity by slightly <50% (Fig. 2). Further deletion to 163 bp had no effect on promoter activity. In the 533RL construct, the element B-E3 (containing putative binding sites for CAAT/enhancer-binding protein and/or Sp1) and the myogenic response factor binding site (known to bind muscle-enriched transcription factors MyoD, myogenin, and/or Myf-1) were deleted (20). These results suggest that the minimum promoter elements supporting the expression of the Mkbp/HspB2 promoter in C2C12 cells are located within 163 bp of its transcription start site. In addition, the 436/257 bp enhancer mediates only a 2-fold activation of the Mkbp/HspB2 promoter, in contrast to the >30-fold activation of the Shsp/B-crystallin promoter observed earlier in C2C12 cells (18, 19).

View larger version (19K): [in this window] [in a new window]   Fig. 2.   Deletion analysis of the effect of the enhancer on Mkbp/HspB2 promoter activity. Organization of the Shsp/B-crystallin and Mkbp/HspB2 intergenic region is shown at the top. Individual elements within the enhancer are shown in greater detail. Nucleotide positions without parentheses are relative to the +1 transcription start site of the Mkbp/HspB2 gene; numbers shown in parentheses are relative to the Shsp/B-crystallin transcription start site. Transient transfection assays were done in C2C12 cells with reporter vectors containing the Renilla luciferase gene under the control of the various progressively deleted fragments of the Mkbp/HspB2 promoter shown on the left. The results of Renilla luciferase assays are shown in the bar graph on the right for each of the vectors tested. HSE, heat shock response element; MRF, myogenic response factor binding site; RLU, relative luciferase units.

Transient Transfection Assays with Bidirectional Dual-reporter Vectors-- We next investigated whether inverting the enhancer will change the relative activities of the Mkbp/HspB2 and Shsp/B-crystallin promoters. Plasmids containing bidirectional dual-reporter genes under the control of the intergenic region were tested by transient transfection in mouse lens epithelial -TN4 and myoblast C2C12 cells (Fig. 3A). The Shsp/B-crystallin promoter activity was 10-fold higher in the transfected myoblast C2C12 cells than in the transfected lens epithelial -TN4 cells (Fig. 3, compare B and D). The Shsp/B-crystallin promoter was 25 and 32 times more active than the Mkbp/HspB2 promoter in the -TN4 and C2C12 cells, respectively. Deletion of the 436/258 bp enhancer reduced Shsp/B-crystallin promoter activity to ~1 and 3% and Mkbp/HspB2 promoter activity to ~10 and 16% of the corresponding activity observed with a plasmid containing the properly oriented enhancer in transfected C2C12 and -TN4 cells, respectively (Fig. 3, C and E). When the enhancer was inverted, Shsp/B-crystallin promoter activity decreased to ~6% and Mkbp/HspB2 promoter activity decreased to ~80% of the corresponding activity observed with the plasmid containing the properly oriented enhancer in transfected C2C12 and -TN4 cells (Fig. 3, C and E). These results indicate that the intergenic enhancer shows orientation dependence and preference for the Shsp/B-crystallin promoter.

View larger version (25K): [in this window] [in a new window]   Fig. 3.   Transient transfection assays with bidirectional dual-reporter vectors. A, schematic showing the structures of the dual-reporter vectors used. Null is an empty vector containing divergently positioned firefly luciferase (FL) and Renilla luciferase (RL) genes separated by a SmaI site. The intergenic region between the Shsp/B-crystallin and Mkbp/HspB2 genes was cloned into the SmaI site in the reporter vectors. Wild Type, Del E, and Inv E refer to reporter vectors containing a properly oriented, deleted, or inverted 436/257 bp enhancer, respectively. Firefly and Renilla luciferase reporter gene activities are shown as relative light units (RLU)/µg of protein assayed in B (mouse myoblast C2C12 cells) and D (mouse lens epithelial -TN4 cells). The values obtained with the null, deleted, and inverted enhancer constructs are presented as percent of the wild type for each promoter in C (C2C12 cells) and E (-TN4 cells).

Analysis of Transgenic Mice Containing Transgenes with the Properly Oriented, Deleted, or Inverted Enhancer-- Equal amounts of protein from different tissues of three lines of pFL-HSPB2B-RL transgenic mice at 8 weeks of age were analyzed by dual-luciferase assays. The results are shown in Fig. 4. Significant reporter gene activity driven by the Shsp/B-crystallin promoter occurred in the heart, skeletal muscle, diaphragm, and lens (Fig. 4A). Surprisingly, the lens showed 2-6-fold less activity compared with different muscle-related tissues (Fig. 4A), despite that the endogenous Shsp/B-crystallin transcripts were more abundant in the lens than in the muscle, heart, or diaphragm (Fig. 1B) (7). The activity of the Mkbp/HspB2 promoter was greatest in the heart, followed by the diaphragm and skeletal muscle. All other tissues tested showed near-background levels of activity for both the Shsp/B-crystallin and Mkbp/HspB2 promoters (data not shown). Similar results were obtained with pRL-HSPB2B-FL transgenic mice (data not shown).

View larger version (31K): [in this window] [in a new window]   Fig. 4.   Effect of deletion or inversion of the enhancer on Shsp/B-crystallin and Mkbp/HspB2 promoter activity in transgenic mice. A, average activity of firefly luciferase (FL) and Renilla luciferase (RL) reporter proteins in extracts from different tissues of three lines of 8-week-old transgenic mice generated with pFL-HSPB2B-RL (wild-type (WT)), pFL-HSPB2DelEB-RL (Del), or pFL-HSPB2InvEB-RL (Inv, Inv E) constructs (expressed as relative luciferase units (RLU)/µg of protein assayed on a logarithmic scale). B, the ratio of Shsp/B-crystallin to Mkbp/HspB2 promoter activity in different tissues of the transgenic mice generated with the three different constructs analyzed. Note the use of a logarithmic scale in the y axis in both A and B.

In adult pFL-HSPB2DelEB-RL transgenic mice, Shsp/B-crystallin promoter activity was <1% in the heart, skeletal muscle, and diaphragm and ~25% in the lens of the activity observed in the corresponding tissues of adult pFL-HSPB2B-RL transgenic mice (Fig. 4A). Mkbp/HspB2 promoter activity in pFL-HSPB2DelEB-RL transgenic mice decreased to ~1% of the activity observed in the muscle, heart, and diaphragm of pFL-HSPB2B-RL transgenic mice, indicating that the Shsp/B-crystallin enhancer influences Mkbp/HspB2 promoter activity also (Fig. 4A).

In adult pFL-HSPB2InvEB-RL transgenic mice, Shsp/B-crystallin promoter activity decreased to ~5% in the lens, 4% in the heart, 3% in the skeletal muscle, and 27% in the diaphragm of that in the corresponding tissues of pFL-HSPB2B-RL transgenic mice (Fig. 4A). Therefore, even though the inversion of the enhancer within its native context reduced Shsp/B-crystallin promoter activity, it did not completely eliminate the positive effects of the enhancer on the Shsp/B-crystallin promoter. Inversion of the intergenic enhancer led to a 3-fold increase in Mkbp/HspB2 promoter activity in the muscle, but there was no increase in any of the other tissues tested. Instead, Mkbp/HspB2 promoter activity in pFL-HSPB2InvEB-RL transgenic mice was reduced to ~50% in the heart and diaphragm compared with the levels detected in pFL-HSPB2B-RL transgenic mice (Fig. 4A).

The ratio of Shsp/B-crystallin to Mkbp/HspB2 promoter activity should remain the same in transgenic mice generated with a properly oriented, deleted, or inverted enhancer if the influence of the intergenic enhancer on the activity of these two promoters is comparable. However, a sharp reduction in the Shsp/B-crystallin:Mkbp/HspB2 promoter activity ratio, ranging from 20- to 50-fold depending on the tissue, was observed in the lens, heart, diaphragm, and skeletal muscle of transgenic mice containing transgenes with either a deleted or inverted enhancer compared with mice containing a transgene with a properly oriented enhancer (Fig. 4B). Therefore, even though the intergenic enhancer activated both the Mkbp/HspB2 and Shsp/B-crystallin promoters, its influence on the latter was 20-50-fold higher in different tissues.

The 2-6-fold lower activity of the Shsp/B-crystallin promoter in the lens than in the heart, diaphragm, and skeletal muscle of the transgenic mice (Fig. 4) was unexpected. However, similar results have been obtained earlier in eight lines of transgenic mice generated with a construct in which the 919/+44 bp fragment was driving the expression of the -galactosidase reporter gene.² To test whether the inclusion of upstream sequences increases Shsp/B-crystallin promoter activity in the lens, we re-examined pJH21 mice, which have a 4.0 kb/+44 bp Shsp/B-crystallin fragment driving the -galactosidase reporter transgene (4). Quantitative analysis of -galactosidase expression in different tissues of 8-week-old transgenic mice showed that Shsp/B-crystallin promoter activity was, on average, 2-fold less in the lens than in the heart (data not shown). Thus, the greater activity of the Shsp/B-crystallin promoter/enhancer in the heart than in the lens of our transgenic mice is not due to the absence of sequences as far as 4.0 kb upstream of the Shsp/B-crystallin gene, which includes the intergenic spacer and the Mkbp/HspB2 gene.

Transient Transfection Assays with the Shsp/B-crystallin Enhancer Coupled to a Heterologous Promoter in Two Different Orientations-- The orientation-dependent nature of the 436/257 bp enhancer demonstrated here differs from our earlier finding, where it enhanced the herpes simplex virus thymidine kinase promoter activity in a position- and orientation-independent manner in transfected cells (18). Considering this, we tested the orientation dependence of the enhancer in combination with a different heterologous promoter. The 450/249 bp fragment was cloned in both orientations upstream of the SV40 promoter in the pGL3-Promoter vector and transfected into C2C12 and rabbit lens epithelial N/N1003 cells. The 450/249 bp enhancer up-regulated the transcription from the SV40 promoter by ~6-9-fold, regardless of the orientation in which it was cloned (Fig. 5, B and C). Clearly, this enhancer can act in an orientation-independent manner when fused to a heterologous promoter. Thus, even though this fragment meets the established criteria for an enhancer in combination with two different heterologous promoters, it does not do so in its native context.

View larger version (30K): [in this window] [in a new window]   Fig. 5.   Transfection tests of the Shsp/B-crystallin enhancer fused to a heterologous promoter. A, schematic showing the structures of different constructs used for transient transfections in C2C12 and N/N1003 cells. The 450/249 bp enhancer was coupled with the SV40 promoter in these plasmids. B and C, transient transfection assays with pGL3-Promoter, pGL3-PE-3, and pGL3-PE-4 in C2C12 and N/N1003 cells. The enhancer stimulated SV40 promoter activity by ~6-9-fold in an orientation-independent manner in these cells. RLU, relative luciferase units.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Divergent transcription of closely linked genes within related gene clusters is a recurring theme in eukaryotes (24, 31-35). Often in these situations, intergenic regulatory elements are shared. In this study, we have analyzed the contribution of an intergenic enhancer to divergent transcription of the closely linked Shsp/B-crystallin and Mkbp/HspB2 genes. Our results demonstrate that the 436/257 bp enhancer is orientation-dependent in its influence on the Shsp/B-crystallin promoter in its native context (Figs. 3 and 4), despite the fact that it works in an orientation-independent manner with heterologous promoters (Fig. 5) (18). Furthermore, we have shown that even though the enhancer activated both the Mkbp/HspB2 and Shsp/B-crystallin promoters, it preferentially stimulated the latter by 20-50-fold in the heart, skeletal muscle, and lens of the transgenic mice. This suggests that the intergenic enhancer has evolved different promoter specificities associated with the functional diversification of the duplicated Mkbp/HspB2 and Shsp/B-crystallin genes.

Many studies on enhancers have employed transient transfection assays in cultured cells with circular plasmids, where orientation preference would be obscured by the ability of the enhancer to function either upstream or downstream of the promoter. This is overcome by the use of transgenic mice or by inserting insulators in the plasmids used to test the orientation dependence of different enhancers (36-43). The phrase "enhancing region" was proposed for an orientation-dependent DNA stimulatory sequence to reflect its properties and to distinguish it from orientation-independent enhancers (41). The orientation-dependent nature of the Shsp/B-crystallin enhancer we have discovered here places this intergenic enhancer in the category of enhancing regions rather than the more general category of enhancers.

Enhancers in the vicinity of multiple promoters can selectively activate a single promoter (44-48). Several mechanisms have been proposed to explain preferential interaction between an enhancer and a specific promoter. First, a difference in the strength or type of a given promoter can result in preferential up-regulation (44, 49-52). One possibly relevant difference between the two promoters studied here is that the Shsp/B-crystallin promoter contains a well conserved TATA box, whereas the Mkbp/HspB2 promoter lacks a TATA box, but contains a downstream promoter element (Fig. 1, DPE). A second possible mechanism involves insulators (53, 54). The 850/660 bp sequence is replete with GC-rich stretches, likely recognition sites for CCCTC binding factor CTCF, the 11-zinc finger protein critical for vertebrate insulators to function (55). Indeed, our current experiments indicate that there is an insulator between the Shsp/B-crystallin enhancer and the Mkbp/HspB2 promoter, contributing to the preferential influence of the enhancer on the Shsp/B-crystallin promoter.³ However, this insulator is not sufficient to explain the orientation dependence of the Shsp/B-crystallin enhancer in its native context. It is possible that one or more discrete cis-regulatory elements within the enhancer confer orientation dependence in its native context.

Unexpectedly, the Shsp/B-crystallin promoter was 3-4-fold less active in the lens compared with the muscle and heart in the transgenic mice (Fig. 4). Similarly, Shsp/B-crystallin promoter activity was ~10-fold less in transfected lens -TN4 cells than in transfected myoblast C2C12 cells (Fig. 3). A comparison of the relative activity of the Shsp/B-crystallin promoter in the lens and muscle of different transgenic mice taken from the present unpublished² and published (4, 16-18, 56) studies demonstrates a shift in Shsp/B-crystallin promoter activity from the lens-favored to the muscle-favored mode when the length of the upstream regulatory sequences increases from 660 to 919 bp (Fig. 6). In view of this shift, we propose that there is a lens-specific negative regulatory element within the 919/660 bp fragment (Fig. 6). It is also possible that elements within the coding sequences, introns, or downstream region of the gene counteract the influence of the lens-specific negative regulatory element in the endogenous gene, enabling its high level expression in the lens. Numerous reports have demonstrated the presence of intronic enhancers in crystallins as well as other genes (38, 57-61).

View larger version (18K): [in this window] [in a new window]   Fig. 6.   Is there a lens-specific negative regulatory element at 919/660 bp? In transgenic mice generated with reporter constructs controlled by Shsp/B-crystallin promoter fragments longer than 919/+44 bp, the activity of the Shsp/B-crystallin promoter was relatively higher in the muscle-related tissues than in the lens. In contrast, in transgenic mice generated with Shsp/B-crystallin promoter fragments shorter than or equal to 660/+44 bp, there was a lens-favored pattern of expression. We propose that there is a lens-specific negative regulatory element (NRE) within the 919/660 bp fragment of the Shsp/B-crystallin upstream regulatory sequences. FL, firefly luciferase; RL, Renilla luciferase; LacZ, -galactosidase; CAT, chloramphenicol acetyltransferase.

An alternative explanation for the relatively lower expression of the reporter genes in the lens compared with the heart or muscle may be found in the biology of the lens. In the adult lens, only the epithelial cells and a few cells in the equatorial region continue to be transcriptionally active. In contrast, in the adult heart and skeletal muscle, most of the cells are transcriptionally active. Thus, it is possible that Shsp/B-crystallin promoter activity appears lower in the lens than in the heart or skeletal muscle when considering the entire tissue; however, when calculated per cell, Shsp/B-crystallin promoter activity may be higher in the lens epithelial cells than in the heart or muscle in the adult mouse. The greater number of Shsp/B-crystallin transcripts in the lens than in the heart, skeletal muscle, or diaphragm (Fig. 1B) may be due in part to mRNA stability and thus is not inconsistent with the present results on promoter activity. Finally, SHSP/B-crystallin protein may be more stable in the lens than the reporter proteins, possibly adding to the apparent contradiction between promoter activity and crystallin accumulation in the lens.

Duplicated genes provide the requisite raw material for evolution. Functional diversification of the duplicated genes often results in new demands on their expression patterns. In mammals, there are nine known members of the SHSP family, thought to have originated from a common ancestor (62). A phylogenetic tree based on the sequence similarity of the -crystallin domain places MKBP/HSPB2 away from the cluster of HSP20 and A- and B-crystallins, all found in the lens at variable amounts, and closer to HSP27, expressed in the muscle (63). The fact that Mkbp/HspB2 was not recruited for lens expression, despite its physical proximity to the Shsp/B-crystallin gene, reflects the stringent selective pressures operating on the regulation of duplicated genes. In conclusion, the orientation dependence and preferential effect of the Shsp/B-crystallin enhancer on the Shsp/B-crystallin promoter demonstrated in this study provide an example of adaptive changes in gene regulation accompanying the functional diversification of duplicated genes during evolution.

	ACKNOWLEDGEMENTS

We thank Dr. Eric F. Wawrousek, R. Steven Lee, and Carl Haugen (NEI Transgenic Mouse Facility) for help with generating and maintaining the transgenic mice used in this study. We thank Drs. Zbynek Kozmik, David Nees, R. Barry Hough, Jyotshnabala Kanungo, Janine Davis, Zheng-Ping Xu, and Zdenek Kostrouch and Barbara Norman for useful discussions and help during the course of this work and constructive criticisms on this paper. We also acknowledge the extensive unpublished transgenic mouse experiments conducted by Dr. Elizabeth D. Kaplan referenced in Fig. 6.

	FOOTNOTES

^* The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

To whom correspondence should be addressed: Laboratory of Molecular and Developmental Biology, NEI, NIH, Bldg. 6, Rm. 201, 6 Center Dr., Bethesda, MD 20892. Tel.: 301-496-9467; Fax: 301-402-0781; E-mail: joramp@nei.nih.gov.

Published, JBC Papers in Press, October 25, 2002, DOI 10.1074/jbc.M209700200

² E. Kaplan and J. Piatigorsky, unpublished data.

³ S. K. Swamynathan and J. Piatigorsky, manuscript in preparation.

	ABBREVIATIONS

The abbreviation used is: RT, reverse transcription.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				R. Whittaker, M. S. Glassy, N. Gude, M. A. Sussman, R. A. Gottlieb, and C. C. Glembotski Kinetics of the translocation and phosphorylation of {alpha}B-crystallin in mouse heart mitochondria during ex vivo ischemia Am J Physiol Heart Circ Physiol, May 1, 2009; 296(5): H1633 - H1642. [Abstract] [Full Text] [PDF]

				I. J. Benjamin, Y. Guo, S. Srinivasan, S. Boudina, R. P. Taylor, N. S. Rajasekaran, R. Gottlieb, E. F. Wawrousek, E. D. Abel, and R. Bolli CRYAB and HSPB2 deficiency alters cardiac metabolism and paradoxically confers protection against myocardial ischemia in aging mice Am J Physiol Heart Circ Physiol, November 1, 2007; 293(5): H3201 - H3209. [Abstract] [Full Text] [PDF]

				Y. Li, R. B. Hough, and J. Piatigorsky Tissue-specific activity of the blind mole rat and the two nucleotide-mutated mouse {alpha}B-crystallin promoter in transgenic mice PNAS, February 20, 2007; 104(8): 2608 - 2613. [Abstract] [Full Text] [PDF]

				G. K. McEwen, A. Woolfe, D. Goode, T. Vavouri, H. Callaway, and G. Elgar Ancient duplicated conserved noncoding elements in vertebrates: A genomic and functional analysis Genome Res., April 1, 2006; 16(4): 451 - 465. [Abstract] [Full Text] [PDF]

				N. Ijichi, N. Tsujimoto, T. Iwaki, Y. Fukumaki, and A. Iwaki Distal Sox Binding Elements of the {alpha}B-Crystallin Gene Show Lens Enhancer Activity in Transgenic Mouse Embryos J. Biochem., March 1, 2004; 135(3): 413 - 420. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/51/49700    most recent M209700200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Swamynathan, S. K. Articles by Piatigorsky, J. Search for Related Content PubMed PubMed Citation Articles by Swamynathan, S. K. Articles by Piatigorsky, J. Social Bookmarking                      What's this?