Originally published In Press as doi:10.1074/jbc.M208664200 on October 23, 2002
J. Biol. Chem., Vol. 277, Issue 52, 50457-50462, December 27, 2002
MuSK Glycosylation Restrains MuSK Activation and Acetylcholine
Receptor Clustering*
Anke
Watty
and
Steven J.
Burden§
From the Molecular Neurobiology Program, Skirball Institute of
Biomolecular Medicine, New York University Medical School, New
York, New York 10016
Received for publication, August 23, 2002, and in revised form, October 11, 2002
 |
ABSTRACT |
MuSK, a muscle-specific receptor tyrosine kinase
that is activated by agrin, has a critical role in neuromuscular
synapse formation. In cultured myotubes, agrin stimulates the rapid
phosphorylation of MuSK, leading to MuSK activation and tyrosine
phosphorylation and clustering of acetylcholine receptors. Agrin,
however, fails to stimulate tyrosine phosphorylation of MuSK that is
force-expressed in myoblasts and fibroblasts, indicating that myotubes
contain an additional activity that is required for agrin to stimulate MuSK. Certain glycosyltransferases are expressed selectively at synaptic sites in skeletal muscle, raising the possibility that carbohydrate modifications of MuSK, catalyzed by glycosyltransferases expressed selectively in myotubes, may be essential for agrin to bind
and activate MuSK. We identifed two N-linked glycosylation sites in MuSK, and we expressed MuSK mutants lacking one or both N-linked sites into MuSK mutant myotubes to
determine whether N-linked carbohydrate modifications of
MuSK have a role in MuSK activation. We found that N-linked
glycosylation restrains ligand-independent tyrosine phosphorylation of
MuSK and downstream signaling but is not necessary for agrin to
stimulate MuSK.
 |
INTRODUCTION |
The formation of neuromuscular synapses requires a complex series
of interactions between developing motor neurons and muscle fibers (1,
2). Agrin, a heparansulfate proteoglycan that is synthesized by motor
neurons and stably deposited into the synaptic basal lamina, plays a
crucial role in the formation of neuromuscular synapses (3-6). Agrin
organizes postsynaptic differentiation by stimulating MuSK, a receptor
tyrosine kinase (RTK)1 that
is expressed selectively in skeletal muscle and in Torpedo electric organ, a tissue that is homologous to skeletal muscle but more
densely innervated (7-9). Agrin and MuSK are essential for synapse
formation, as mice lacking agrin or MuSK fail to form neuromuscular
synapses and consequently die at birth because of a failure to move or
breathe (10, 11). Importantly, muscle-derived proteins, including
acetylcholine receptors (AChRs), which are concentrated in the
postsynaptic membrane of muscle in wild-type mice, are instead
expressed uniformly in muscle of MuSK mutant mice (11).
Taken together with experiments showing that agrin can stimulate
multiple aspects of postsynaptic differentiation in cultured myotubes
(12), including the clustering and tyrosine phosphorylation of AChRs
(13), these results indicate that agrin stimulation of MuSK leads to
clustering of critical muscle-derived proteins, including AChRs, at
synaptic sites (1, 4-6).
The mechanisms by which agrin activates MuSK, however, are poorly
understood (1, 6). Agrin stimulates the rapid tyrosine phosphorylation
of MuSK in myotubes, consistent with the idea that MuSK is a receptor,
or a component of a receptor complex for agrin. Nonetheless, MuSK,
forced-expressed in fibroblasts or myoblasts, is not phosphorylated by
agrin (9). These results, together with a failure to detect binding
between recombinant agrin and recombinant MuSK in vitro,
indicate that additional components, which are expressed in myotubes
and not in myoblasts or fibroblasts, are essential for agrin to
activate MuSK (9). The additional myotube-specific component(s) are not
known but could include: 1) a membrane protein that binds agrin and
acts as a bona fide agrin receptor; 2) a
co-ligand that acts with agrin to bind and activate MuSK; or 3)
post-translational modifications of MuSK that allow agrin to bind
directly to MuSK (14). Consistent with the latter possibility, certain
glycosyltransferases are expressed selectively at synaptic sites in
skeletal muscle (15), resulting in the concentration of certain
carbohydrate epitopes, attached to proteins, at neuromuscular synapses
(17). We therefore sought to determine the sites of carbohydrate
modification on MuSK and whether carbohydrate modification might be
essential for agrin to activate MuSK. We identifed two
N-linked carbohydrate attachment sites on MuSK and found
that these N-linked sites are dispensable for agrin to
activate MuSK. Carbohydrate addition, however, restrains
ligand-independent MuSK activity, because mutation of both
N-linked sites increases the level of agrin-independent MuSK
phosphorylation, resulting in an increase in AChR tyrosine phosphorylation and clustering.
 |
EXPERIMENTAL PROCEDURES |
Cell Culture--
The generation of MuSK mutant
muscle cell lines has been described previously (18). MuSK
mutant myoblasts were grown in Dulbecco's modified Eagle's
medium, 4.5 mg/ml glucose, 10% fetal calf serum, 10% horse
serum, 0.5% chick embryo extract, 20 units/ml recombinant mouse
interferon-
(Invitrogen), and gentamycin at 33 °C and
induced to differentiate as myotubes by growing the cells at 39 °C
in medium lacking chick embryo extract and interferon-
(18).
Antibodies, Lectins, and Glycosidases--
The antibodies used
to immunoprecipitate rat MuSK and to immunoprecipitate and detect
Torpedo MuSK by Western blotting have been described
previously (19). Rat MuSK was detected by Western blotting using
polyclonal antibodies to MuSK that were kindly provided by W. Hoch
(20). The monoclonal antibody, 4G10, to phosphotyrosine was purchased
from Upstate Biotechnology (Lake Placid, NY). Digoxigenin (DIG)-labeled
lectins and N-glycosidase F were purchased from Roche
Molecular Biochemicals; biotin-labeled Vicia villosa
agglutinin (VVA) was purchased from E-Y Laboratories; HRP-coupled antibodies to DIG, HRP-labeled steptavidin, and
neuraminidase (NA) were purchased from Sigma.
Expression Constructs--
Single amino acid substitutions in
the rat MuSK extracellular region were generated by PCR. The mutagenic
primer (forward direction) to generate MuSK N222Q was
CCTGAATCCCACCAGGTCACCTTTGGTTCC; the mutagenic primer to generate MuSK
N338Q was CTTGTCTTCTTCCAGACCTCCTATCCC; the mutagenic primer to generate
MuSK N459Q was GATTATAAAAAAGAACAGATAACAACATTC. The mutategenic primers
for N222Q were used in combination with ATGGCATCTACTGCTTGCACAG
(forward) and GAGTCTTGAGTCAATCACTCGG (reverse); the mutagenic primers
for N338Q were used in combination with ATGGCATCTACTGCTTGCACAG
(forward) and GAGCTCCTTTACTGCCAAGC (reverse); the mutagenic primers for
N459Q were CGAGGCTCTGCTGTGTAATC (forward) and GTTATTCCTCGGATACTCCAG
(reverse). The mutated PCR fragments were cloned into the
NarI/PflMI (N222Q),
PflMI/SacII (N338Q) and SacII/BlpI (N459Q) restriction sites in rat MuSK.
The mutant MuSK constructs were subsequently subcloned into the
EcoRI site of the retroviral vector pBabe/puro (21).
Retroviral Infection of Myoblasts--
Recombinant retrovirus
was produced by transfecting Bosc 23 cells with the pBabe/puro plasmids
encoding wild-type or mutant MuSK, as described previously (18).
Myoblasts, at ~50% confluency, were infected with retrovirus and
selected subsequently in medium containing 2 µg/ml puromycin.
AChR Clustering Assay--
Myotubes were stimulated with 100 nM recombinant agrin (R&D Systems) or treated with 0.1 units/ml NA for 16 h. AChRs were labeled by staining with
Texas Red-conjugated
-bungarotoxin (Molecular Probes) for one
h. Myotubes were washed with phosphate-buffered saline, fixed with 1%
formaldehyde for 20 min, washed, mounted in Vectashield (Vector Labs)
and viewed at 630× with a Zeiss Axioskop. The number of AChR clusters
was determined, and the number of AChR clusters per field was calculated.
Immunoprecipitation and Western Blotting of MuSK and AChR from
Myotubes and Torpedo Electric Organ--
Myotubes were
serum-starved for several hours before stimulation with agrin (30 min)
or NA (2 h). Myotubes were rinsed with phosphate-buffered saline and
lysed in ice-cold lysis buffer (50 mM Tris pH 7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100)
containing 1 mM Na3VO4, 10 mM NaF, and a mixture of protease inhibitors (Roche Molecular Biochemicals). Lysates were pre-cleared by centrifugation, and antibodies to MuSK, together with Protein A-agarose, or
biotin-coupled
-bungarotoxin and streptavidin-agarose were added and
incubated overnight at 4 °C. The beads were centrifuged and washed
four times with lysis buffer. Bound proteins were eluted from the beads with SDS-PAGE sample buffer, and the eluted proteins were separated by
SDS-PAGE (7.5% polyacrylamide gels) and blotted onto nitrocellulose (Amersham Biosciences). Protein tyrosine phosphorylation, MuSK expression, and AChR
-subunit expression were detected by probing Western blots with monoclonal antibody 4G10, polyclonal antibodies to
MuSK (20), and a monoclonal antibody to the AChR
-subunit (mAb124,
gift of J. Lindstrom, University of Pennsylvania), respectively. Antibody binding was visualized with HRP-coupled secondary antibodies (Jackson ImmunoResearch) and ECL (PerkinElmer Life Sciences), and x-ray
films were scanned with a densitometer (BioRad). MuSK was
immunoprecipitated from Torpedo californica electric organ (Winckler Enterprises, San Pedro, CA), as described previously (19).
Glycosidase Treatment of MuSK--
MuSK was immunoprecipitated
from myotubes as described above. Two units of N-glycosidase
F (in 20-30 µl of 50 mM sodium phosphate, pH 7.4) were
added to the washed protein A-agarose beads; after 24 h at
37 °C, an additional two units of N-glycosidase F were added, and the reaction was allowed to proceed for a further 24 h.
Immunoprecipitated MuSK was digested with NA (50 milliunits in 50 mM sodium acetate, 2 mM EDTA, pH 4.5) for
48 h at 37 °C.
Lectin Blots--
MuSK was immunoprecipitated from
Torpedo electric organ with antibodies to MuSK, and the
single immunoprecipitate, solubilized in SDS-PAGE sample buffer, was
divided and fractionated in different lanes of a SDS-polyacrylamide gel
(7.5% polyacrylamide). Individual lanes from a Western blot were
probed with DIG-labeled lectins, according to the manufacturer's
instructions (Roche Molecular Biosciences), and the bound DIG-lectin
was visualized with HRP-coupled antibodies to DIG (Roche Molecular
Biosciences) and ECL (PerkinElmer Life Sciences). Immunoprecipitated
Torpedo MuSK was treated with NA or N-glycosidase
F, and the digested immunoprecipitates were divided and fractionated in
different lanes of a SDS-polyacrylamide gel; Western blots were probed
either with DIG-labeled lectins or antibodies to MuSK.
 |
RESULTS |
MuSK Glycosylation Analyzed by Lectin Binding--
In a first step
to determine whether MuSK is glycosylated, we isolated membranes from
Torpedo electric organ, a rich source of synaptic proteins,
including MuSK. MuSK was immunoprecipitated from nonionic detergent
lysates, and proteins in the immunoprecipitate were separated by
SDS-PAGE and transferred to nitrocellulose. Western blots were probed
with DIG-labeled lectins and HRP-coupled antibodies to DIG (Fig.
1A). This analysis reveals
that Maackia amurensis agglutinin, a lectin that recognizes
terminal sialic acid attached to galactose in an
2
3
linkage (22), and Datura stramonium agglutinin (DSA), a
lectin that recognizes terminal galactose attached to GlcNac in a
1
4 linkage (23), bind to MuSK (Fig. 1A).

View larger version (41K):
[in this window]
[in a new window]
|
Fig. 1.
Analysis of MuSK glycosylation in
Torpedo electric organ and C2 cells.
A, MuSK was immunoprecipitated from detergent-solubilized
Torpedo membranes, and Western blots were probed with
lectins that recognize different carbohydrate structures or with
antibodies to MuSK. GNA recognizes high-mannose structures in
N-linked glycans, MAA recognizes terminal sialic acid-linked
-2 3 to galactose in N- and O-glycans, DSA
recognizes terminal galactose-linked -1 4 to GlcNac in
N- and O-glycans, PNA recognizes the core
disaccharide in O-glycans after removal of terminal
carbohydrate residues, SNA recognizes terminal sialic acid-linked
-2 6 to galactose in N- and O-glycans.
B, MuSK was immunoprecipitated from detergent-solubilized
Torpedo membranes and treated with NA. Western blots were
probed with MAA, DSA, or PNA. C, MuSK was immunoprecipitated
from detergent-solubilized Torpedo membranes and treated
with N-glycosidase. Western blots were probed with MAA, DSA,
or antibodies to MuSK. D, MuSK was immunoprecipitated from
C2 cell lysates and treated with NA or N-glycosidase.
Western blots were probed with antibodies to MuSK. The
arrows indicate the positions of MuSK.
|
|
Other lectins, such as Galanthus nivalis agglutinin
(GNA), which recognizes high-mannose structures in
N-linked glycans, peanut agglutinin (PNA), which recognizes
the core disaccharide in O-glycans after removal of terminal
sugar residues, Sambucuc nigra agglutinin (SNA), which
recognizes terminal sialic acid attached to galactose in an
2
6
linkage and VVA, which binds terminal GalNac, do not bind to MuSK (Fig.
1A and data not shown). These results demonstrate that MuSK
bears carbohydrate structures that are complex but not of the
high-mannose type.
The specificity of MAA binding was further demonstrated by treating
immunoprecipitated MuSK with NA, a glycosidase that cleaves terminal
sialic acid residues (Fig. 1B). Treatment with NA abolishes MAA binding to MuSK, while leaving DSA binding unimpaired (Fig. 1B). Moreover, NA treatment does not expose binding sites
for GNA, PNA, SNA, or VVA (data not shown). Because PNA
recognizes the core of O-linked carbohydrate structures
after removal of terminal sugar residues, the lack of PNA binding in
NA-digested MuSK does not support the presence of O-linked
carbohydrates in MuSK.
N-linked Versus O-linked Carbohydrate Attachment Sites--
We
next sought to determine whether the carbohydrates recognized by MAA
and DSA are linked to asparagine (N-linked) or to serine/threonine (O-linked) residues. To distinguish between
these possibilities, we treated immunoprecipitated MuSK with
N-glycosidase F, which removes the entire carbohydrate
structure from N-linked sites and converts the asparagine
into an aspartate residue (Fig. 1C).
N-Glycosidase F treatment results both in a shift in the molecular weight of MuSK, revealed by probing Western blots with antibodies to MuSK (Fig. 1C), and in a loss of MAA and DSA
binding, demonstrating that the recognized carbohydrates are linked to MuSK via asparagine residues (Fig. 1C).
Glycosylation of Mammalian MuSK--
We next sought to determine
whether the same carbohydrate structures are present on mammalian MuSK.
The substantially lower abundance of MuSK in skeletal muscle, compared
with that in Torpedo electric organ, made it difficult to
analyze the carbohydrates attached to mammalian MuSK by probing Western
blots with lectins. Therefore, we determined whether digestion of MuSK
with N-glycosidase F or NA caused a shift in molecular
weight, as observed in MuSK isolated from Torpedo electric organ.
We immunoprecipitated MuSK from C2 myotubes, digested MuSK with
N-glycosidase F or NA and probed Western blots with
antibodies to MuSK (Fig. 1D). Incubation with
N-glycosidase F or NA caused a shift in the molecular weight
of mammalian MuSK, similar to that observed with Torpedo
MuSK, indicating that carbohydrate structures had been removed (Fig.
1D). Moreover, these results demonstrate that mammalian MuSK
bears N-linked carbohydrate, including sialic acid, and
imply that glycosylation of mouse MuSK is not fundamentally different
from glycosylation of Torpedo MuSK.
Consensus N-linked Glycosylation Sites in MuSK--
Two consensus
N-linked glycosylation sites, Asn-X-(Ser/Thr);
(X = any amino acid, except Pro), are conserved in the
extracellular domain of MuSK from fish, avian, amphibian, and mammals
(Asn-222 and Asn-338 in rat MuSK) (7, 8, 24, 25). Asn-222 is located between the second and third Ig-like domains, and Asn-338 is
within the C6 box, located between the third and fourth Ig-like domains
(Fig. 2A). A third consensus
N-linked glycosylation site is present in avian, amphibian,
and rat MuSK (Asn-459 in rat MuSK) but absent in fish and human MuSK;
in rat MuSK, Asn-459 is located within an insert, produced by
alternative splicing, between the fourth Ig-like domain and the
transmembrane domain (Fig. 2A).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 2.
Mutation of the two conserved
N-linked glycosylation sites in MuSK
alters the mobility of MuSK in SDS-PAGE. A, the cartoon
illustrates the positions of consensus N-linked
glycosylation sites Asn-X-(Ser/Thr); X = any
residue except Pro), the Ig-like domains, the C6 box, the juxtamembrane
(JM) domain and the kinase domain in rat MuSK. Asn-222 and Asn-338 are
conserved in MuSK from all classes, whereas the Asn-459 site in rat
MuSK is absent from human and Torpedo MuSK. B,
wild-type, single, double, and triple mutant forms of rat MuSK,
expressed in MuSK-deficient muscle cells, were
immunoprecipitated from cell lysates, and Western blots were probed
with antibodies to MuSK. The migration of MuSK N459Q is identical to
the other single mutants (data not shown). MuSK was fractionated in
long (25-cm) gels, which provide sufficient resolution to detect the
different mobilities of wild-type MuSK and MuSK N222Q/N338Q.
|
|
Mutation of Consensus N-linked Glycosylation Sites in Mammalian
MuSK--
We mutated the three consensus N-linked
glycosylation sites in rat MuSK, either individually or in combination,
and stably expressed the MuSK mutants in MuSK-deficient
muscle cells (18). We immunoprecipitated MuSK from the muscle cell
lines and probed Western blots of the immunoprecipitate with antibodies
to MuSK (Fig. 2B). A MuSK double mutant (N222Q/N338Q),
lacking the two conserved N-linked glycosylation sites,
migrates more rapidly than wild-type MuSK in SDS-PAGE (Fig.
2B). These results indicate that one or both of the two
conserved N-linked glycosylation sites, Asn-222 and Asn-338,
are glycosylated in vivo. We were unable to distinguish
between these two possibilities or to determine whether Asn-459 is a
carbohydrate attachment site, because the three single mutants (N222Q,
N338Q, or N459Q) lacking only one of the three consensus glycosylation
sites, migrate similar to wild-type MuSK in SDS-PAGE (Fig.
2B and data not shown). Moreover, a MuSK triple mutant
(N222Q/N338Q/N459Q), lacking all three consensus sites, migrates
similar to the MuSK double mutant (N222Q/N338Q) in SDS-PAGE (Fig.
2B).
N-linked Glycosylation of MuSK Regulates agrin-independent but Not
agrin-dependent MuSK Tyrosine Phosphorylation--
We next
sought to determine whether Asn-222, Asn-338, and Asn-459 are required
for agrin to stimulate MuSK phosphorylation. We treated muscle cell
lines, stably expressing wild-type or mutant MuSK, with agrin for 30 min, immunoprecipitated MuSK and probed Western blots with antibodies
to phosphotyrosine. Following agrin stimulation, tyrosine
phosphorylation of wild-type MuSK increases more than 10-fold (Fig.
3, A and B).
Tyrosine phosphorylation of the MuSK double mutant (N222Q/N338Q) or the
MuSK triple mutant (N222Q/N338Q/N459Q) is similarly stimulated by agrin
(Fig. 3, A and B and data not shown). In the
absence of agrin stimulation, however, tyrosine phosphorylation of the
double and triple mutants is elevated (2- to 3-fold) relative to
wild-type MuSK (Fig. 3, A and B). These results
indicate that N-linked carbohydrate addition is not
essential for agrin to stimulate tyrosine phosphorylation of MuSK but
that glycosylation restrains MuSK activation, possibly by limiting
ligand-independent dimerization.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 3.
N-linked
glycosylation of MuSK is not necessary for agrin to stimulate MuSK or
AChR tyrosine phosphorylation but restrains agrin-independent MuSK
activation. A, wild-type or double-mutant MuSK
(N222Q/N338Q), expressed in MuSK-deficient muscle cells, was
immunoprecipitated from cell lysates, and Western blots were probed
with antibodies to phosphotyrosine (PY) or MuSK. Myotubes
were either unstimulated, treated with NA (2 h), or stimulated with
agrin (30 min). In these experiments, MuSK was fractionated in
mini-gels, which provide insufficient resolution to detect the
differences in mobility of wild-type MuSK and MuSK N222Q/N338Q, which
are illustrated in Fig. 2B. B, quantitative
analysis of MuSK tyrosine phosphorylation from multiple experiments
(n = 3) shows that NA increases tyrosine
phosphorylation of wild-type MuSK (2.5 ± 0.2-fold,
p < 0.05) but not of MuSK N222Q/N338Q (0.9 ± 0.2-fold). In the absence of agrin stimulation, tyrosine
phosphorylation of MuSK N222Q/N338Q is elevated (2.1 ± 0.2, p < 0.05) relative to wild-type MuSK, and similar to
tyrosine phosphorylation of MuSK in NA-treated cells expressing
wild-type MuSK. Wild-type MuSK and MuSK N222Q/N338Q are similarly
tyrosine-phosphorylated after agrin stimulation (10 ± 3-fold,
p < 0.05 and 3.3 ± 0.4-fold, p < 0.05, respectively). C, AChRs were isolated from
MuSK-deficient muscle cells expressing either wild-type MuSK
or double-mutant MuSK (N222Q/N338Q), and Western blots were probed with
antibodies to phosphotyrosine (PY) or the AChR -subunit.
Myotubes were either unstimulated, treated with NA (2 h), or stimulated
with agrin (30 min). D, quantitative analysis of AChR
-subunit tyrosine phosphorylation from multiple experiments
(n = 3) shows that NA increases tyrosine
phosphorylation of the AChR -subunit in cells expressing wild-type
MuSK (9 ± 2-fold, p < 0.05) but not in cell
expressing MuSK N222Q/N338Q (0.9 ± 0.3-fold). In the absence of
agrin stimulation, tyrosine phosphorylation of the AChR -subunit is
greater in cells expressing MuSK N222Q/N338Q (11 ± 4-fold,
p < 0.05) than in cells expressing wild-type MuSK, and
similar to AChR -subunit tyrosine phosphorylation in NA-treated
cells expressing wild-type MuSK. Agrin stimulates similar tyrosine
phosphorylation of the AChR -subunit in cells expressing wild-type
MuSK and in cell expressing MuSK N222Q/N338Q (23 ± 5-fold,
p < 0.05 and 2 ± 0.3-fold, p < 0.05, respectively). The means ± S.E. from three experiments are
given, and the difference between two means was considered significant
if p < 0.05 (Student's t test).
|
|
N-linked Glycosylation of MuSK Regulates Agrin-independent but Not
Agrin-dependent AChR Tyrosine Phosphorylation and
Clustering--
Agrin activation of MuSK leads to tyrosine
phosphorylation of the AChR
- and
-subunits (13, 26). The
mechanisms that lead to tyrosine phosphorylation of the AChR are poorly
understood and could, in principle, require glycosylation of MuSK. We
treated myotubes expressing wild-type or mutant forms of MuSK with
agrin for 30 min, isolated AChRs with
-bungarotoxin, and probed
Western blots with antibodies to phosphotyrosine. We found that the
AChR
-subunit is tyrosine-phosphorylated similarly in agrin-treated myotubes expressing either wild-type, double mutant (N222Q/N338Q), or
triple mutant (N222Q/N338Q/N459Q) MuSK (Fig. 3, C and
D and data not shown). Therefore, N-linked
glycosylation of MuSK is not essential for agrin to stimulate tyrosine
phosphorylation of AChRs.
The extracellular domain of MuSK is thought to have an important role
in the clustering of synaptic proteins, including AChRs (27). We
therefore examined whether N-linked glycosylation of MuSK is
required for agrin to stimulate clustering of AChRs. We treated
myotubes expressing wild-type or mutant forms of MuSK with agrin, and
we determined the number of AChR clusters that formed 8-16 h later. We
found that the number of AChR clusters is similar in agrin-treated
myotubes expressing either wild-type, double mutant (N222Q/N338Q), or
triple mutant (N222Q/N338Q/N459Q) MuSK (Fig.
4). Thus, N-linked
glycosylation of MuSK is not required for agrin to stimulate AChR
clustering.

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 4.
N-linked glycosylation of MuSK is not
necessary for agrin to stimulate AChR clustering but restrains
agrin-independent AChR clustering. MuSK-deficient
myotubes, expressing either wild-type (wt) MuSK or mutant
forms of MuSK, lacking individual or multiple N-linked
glycosylation sites, were either unstimulated, treated with NA, or
stimulated with agrin. Myotubes were fixed and stained with Texas
Red-conjugated -bungarotoxin, and the number of AChR clusters was
determined. In the absence of agrin stimulation, the number of AChR
clusters is elevated in myotubes expressing MuSK N222Q/N338Q or MuSK
N222Q/N338Q/N459Q. NA increases the number of AChR clusters in myotubes
expressing wild-type MuSK or single glycosylation site MuSK mutants but
not in myotubes expressing the double or triple glycosylation site MuSK
mutant. Agrin stimulates similar AChR clustering in myotubes expressing
wild-type MuSK and glycosylation-deficient MuSK mutants. The means ± S.E. from four to five experiments are given, and the difference
between two means was considered significant (*) if p < 0.05 (Student's t test).
|
|
We next asked whether the increase in agrin-independent MuSK
phosphorylation, found in myotubes expressing the double (N222Q/N338Q) or triple (N222Q/N338Q/N459Q) MuSK mutant (Fig. 3, A and
B) leads to an increase in the level of AChR tyrosine
phosphorylation and clustering. The basal level of AChR tyrosine
phosphorylation (Fig. 3, C and D) and clustering
(Fig. 4) is indeed elevated in myotubes expressing MuSK N222Q/N338Q or
MuSK N222Q/N338Q/N459Q. These data support the idea that
N-linked carbohydrate structures bearing terminal sialic
acid minimize spontaneous MuSK activation and signal transduction.
Because mutation of single asparagine residues in MuSK fails to
increase MuSK phosphorylation (data not shown) and downstream signaling
(Fig. 4), these data support the idea that both Asn-222 and Asn-338
function as N-linked carbohydrate-attachment sites but that
glycosylation of either site is sufficient to restrain adventitious MuSK activation.
Neuraminidase Stimulates MuSK Signaling by Removing Sialic Acid
from MuSK--
Previous studies have shown that NA treatment of
wild-type myotubes increases the level of MuSK and AChR tyrosine
phosphorylation and AChR clustering, indicating that removal of sialic
acid residues from MuSK or from other proteins expressed in skeletal
muscle increases tyrosine phosphorylation of MuSK and MuSK signaling (28-31). To distinguish between these two possibilities, we compared the level of MuSK tyrosine phosphorylation, AChR tyrosine
phosphorylation, and clustering in 1) NA-treated myotubes expressing
wild-type MuSK; 2) myotubes expressing glycosylation-deficient MuSK
mutants; and 3) NA-treated myotubes expressing glycosylation-deficient MuSK mutants. We found that MuSK phosphorylation (Fig. 3, A
and B) and MuSK-dependent signaling, assessed by
AChR tyrosine phosphorylation (Fig. 3, C and D)
and AChR clustering (Fig. 4), were similarly elevated in untreated
myotubes expressing the MuSK mutants (MuSK N222Q/N338Q and MuSK
N222Q/N338Q/N459Q) and in NA-treated myotubes expressing wild-type
MuSK. Moreover, NA treatment of myotubes expressing the MuSK double
(N222Q/N338Q) or triple (N222Q/N338Q/N459Q) mutant failed to further
increase the level of MuSK tyrosine phosphorylation, AChR tyrosine
phosphorylation, or AChR clustering (Figs. 3 and 4). These results
indicate that NA increases tyrosine phosphorylation of MuSK and
MuSK-dependent signaling by removing sialic acid from from
Asn-222 and Asn-338 in MuSK rather than by removing sialic acid from
other muscle proteins.
 |
DISCUSSION |
MuSK has three consensus N-linked glycosylation sites,
and two of these sites are conserved in MuSK from all classes. Mutation of the two conserved glycosylation sites leads to an increase in MuSK
tyrosine phosphorylation, AChR tyrosine phosphorylation, and AChR
clustering. Because mutation of either site alone does not increase
MuSK activation and signaling, our data are consistent with the idea
that glycosylation at either site is sufficient to minimize
adventitious MuSK activation. Although these data are compatible with
the possibility that both sites serve as glycosylation attachment
sites, it is also possible that one of the two N-linked sites serves as the primary glycosylation site, but that an
alternative, second site can be used if the primary site is not
available. This latter idea is consistent with experiments showing that
the double, but not the single MuSK mutants migrate more rapidly than wild-type MuSK in SDS-PAGE. Because the double (N222Q/N338Q) and triple
(N222Q/N338Q/N459Q) MuSK mutants migrate similarly in SDS-PAGE and
induce similar numbers of AChR clusters, and because the Asn-459 glycosylation site is not conserved in human and Torpedo,
our data favor the idea that Asn-459 does not function as a
N-linked glycosylation site.
The lectins tested in our experiments fail to bind to MuSK after
N-linked carbohydrates were removed by
N-glycosidase F, indicating that the recognized
carbohydrates are not O-linked to MuSK. Nonetheless, it is
possible that other carbohydrate structures, which are not recognized
by these lectins, are attached to MuSK through O-linked sites. Thus, although our experiments do not demonstrate the presence of O-linked glycans on MuSK, we cannot rule out this possibility.
Attachment of carbohydrates to the consensus N-linked sites
in MuSK is not required for agrin to activate MuSK and to stimulate tyrosine phosphorylation and clustering of AChRs. These data are inconsistent with the idea that cell-type differences in MuSK glycosylation account for the inability of agrin to activate MuSK in
fibroblasts and myoblasts.
The increase in MuSK activation and signaling found in
myotubes expressing glycosylation-deficient MuSK mutants is comparable with the level of MuSK activation and signaling found in NA-treated myotubes expressing wild-type MuSK. Moreover, NA is ineffective in
further increasing MuSK signaling in myotubes expressing
glycosylation-deficient MuSK mutants. These results indicate that NA
increases MuSK signaling in wild-type myotubes by removing sialic acid
from MuSK. Our experiments, however, do not exclude the possibility
that NA also acts on other proteins that exert an inhibitory effect on MuSK.
Inhibition of N-linked glycosylation often causes defects in
the trafficking of RTKs, including kinase insert receptor/flk-1, flt-1, and the insulin receptor (32, 33), resulting in a failure of
these RTKs to accumulate at the cell surface. MuSK glycosylation mutants, however, are expressed at the cell surface, because mutants lacking individual or multiple N-linked glycosylation sites
are tyrosine-phosphorylated by agrin stimulation. Moreover, in the absence of agrin, expression of double or triple mutants leads to an
increase in AChR clustering at the cell surface. Thus,
N-linked glycosylation of MuSK is neither required to stably
express MuSK at the cell surface nor to activate MuSK by agrin. It
remains possible, however, that MuSK glycosylation mutants are
transported to the cell surface less efficiently than wild-type MuSK or
that these mutants are less stable at the cell surface.
The suppression of ligand-independent activation by N-linked
glycosylation is a feature that MuSK shares with other RTKs. N-Glycosylation of TrkA (34), insulin receptor (35), and
epidermal growth factor receptor (36) suppresses
ligand-independent activation of these RTKs. In TrkA, even partial
deglycosylation is sufficient to cause ligand-independent TrkA
phosphorylation, resulting in the recruitment of Shc and phospholipase
C-
(34). N-Linked glycosylation, however, is not
necessarily linked to inhibtion of RTKs, because N-linked
glycosylation can induce conformational changes that lead to
ligand-independent RTK dimerization and activation (37).
Although the mechanisms by which N-linked glycosylation
restrains tyrosine kinase activity are poorly understood, glycosylation may minimize spontaneous dimerization simply by steric hindrance or by
electrostatic repulsion and thereby inhibit trans-phosphorylation (38).
In COS cells, however, the low level of MuSK tyrosine phosphorylation
is not further increased by NA treatment (39). Thus,
N-glycosylation may not inhibit MuSK activation by a simple steric or electrostatic mechanism. In the epidermal growth factor receptor (40), attached carbohydrate interacts with glycosphingolipids, and the epidermal growth factor receptor-ganglioside complex minimizes spontaneous epidermal growth factor receptor dimerization. By analogy,
carbohydrate attached to MuSK may interact with glycolipids or with
other glycoproteins either in the plasma membrane or in the
extracellular matrix, and such interactions may minimize spontaneous MuSK dimerization. Because these interactions may be cell
type-specific, it is possible that such interactions mediate inhibition
of MuSK in muscle cells but not in COS cells. In this regard, other
groups have suggested that NA and
-galactosidase induce AChR
clusters by unmasking subterminal Gal
-1
3-GalNac and
Gal
-1
4-GalNac (CT carbohydrate) in proteins within the
extracellular matrix. Consistent with this idea, CT carbohydrate is
concentrated at neuromuscular synapses, and addition of either
disaccharide to cultured muscle cells induces tyrosine phosphorylation
of MuSK and clustering of AChRs (41, 42). Moreover, agrin can stimulate
MuSK tyrosine phosphorylation in non-muscle cells if these cells also
express the CT carbohydrate, implicating the CT carbohydrate as a
potential co-factor in agrin-induced MuSK activation, similar to that
for heparin in fibroblast growth factor-induced fibroblast
growth factor receptor activation (43). Taken together, these results favor a model in which the interaction between the N-linked
carbohydrates on MuSK and other carbohydrates, possibly the
Gal
-1
3-GalNac and Gal
-1
4-GalNac structures of the CT
carbohydrate, regulate activation of MuSK. Such an interaction could
mediate MuSK inhibition, partially relieved by removal of either the CT
carbohydrate or MuSK glycosylation and fully relieved by agrin-binding,
resulting in maximal MuSK activation.
 |
ACKNOWLEDGEMENTS |
We thank Cindy Sadowski for constructing the
MuSK glycosylation site mutants. We thank Matthew Friese for comments
on the manuscript and Ruth Herbst for help with generating the muscle cell lines.
 |
FOOTNOTES |
*
This work was supported in part by National Institutes of
Health Grant NS36193 (to S. J. B.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Supported by a postdoctoral fellowship from the Deutsche
Forschungsgemeinschaft. Present address: Mojave Therapeutics, 19 Bradhurst Ave., Hawthorne, NY 10532.
§
To whom correspondence should be addressed: Skirball Institute of
Biomolecular Medicine, NYU Medical School, 540 First Ave., New York, NY
10016. Tel.: 212-263-7341; Fax: 212-263-2842; E-mail: burden@saturn.med.nyu.edu.
Published, JBC Papers in Press, October 23, 2002, DOI 10.1074/jbc.M208664200
 |
ABBREVIATIONS |
The abbreviations used are:
RTK, receptor
tyrosine kinase;
AChR, acetylcholine receptor;
DIG, digoxigenin;
NA, neuraminidase;
HRP, horseradish peroxidase;
VVA, Vicia
villosa agglutinin;
GNA, Galanthus nivalis agglutinin;
DSA, Datura stramonium agglutinin;
PNA, peanut agglutinin;
MAA, Maackia amurensis agglutinin;
SNA, Sambucus
nigra agglutinin;
CT, cytotoxic T cell carbohydrate.
 |
REFERENCES |
| 1.
|
Sanes, J. R.,
and Lichtman, J. W.
(2001)
Nat. Rev. Neurosci.
2,
791-805[Medline]
[Order article via Infotrieve]
|
| 2.
|
Arber, S.,
Burden, S. J.,
and Harris, A. J.
(2002)
Curr. Opin. Neurobiol.
12,
100-103[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
McMahan, U. J.
(1990)
Cold Spring Harbor Symp. Quant. Biol.
55,
407-418[Medline]
[Order article via Infotrieve]
|
| 4.
|
Wallace, B. G.
(1996)
Bioessays
18,
777-780[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Ruegg, M. A.,
and Bixby, J. L.
(1998)
Trends Neurosci.
21,
22-27[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Glass, D. J.,
and Yancopoulos, G. D.
(1997)
Curr. Opin. Neurobiol.
7,
379-384[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Jennings, C. G.,
Dyer, S. M.,
and Burden, S. J.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
2895-2899[Abstract/Free Full Text]
|
| 8.
|
Valenzuela, D. M.,
Stitt, T. N.,
DiStefano, P. S.,
Rojas, E.,
Mattsson, K.,
Compton, D. L.,
Nunez, L.,
Park, J. S.,
Stark, J. L.,
Gies, D. R.,
Thomas, S.,
Copeland, N. G.,
Jenkins, N. A.,
Burden, S. J.,
Glass, D. J.,
and Yancopoulos, G. D.
(1995)
Neuron
15,
573-584[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Glass, D. J.,
Bowen, D. C.,
Stitt, T. N.,
Radziejewski, C.,
Bruno, J.,
Ryan, T. E.,
Gies, D. R.,
Shah, S.,
Mattsson, K.,
Burden, S. J.,
DiStefano, P. S.,
Valenzuela, D. M.,
DeChiara, T. M.,
and Yancopoulos, G. D.
(1996)
Cell
85,
513-523[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Gautam, M.,
Noakes, P. G.,
Moscoso, L.,
Rupp, F.,
Scheller, R. H.,
Merlie, J. P.,
and Sanes, J. R.
(1996)
Cell
85,
525-535[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
DeChiara, T. M.,
Bowen, D. C.,
Valenzuela, D. M.,
Simmons, M. V.,
Poueymirou, W. T.,
Thomas, S.,
Kinetz, E.,
Compton, D. L.,
Rojas, E.,
Park, J. S.,
Smith, C.,
DiStefano, P. S.,
Glass, D. J.,
Burden, S. J.,
and Yancopoulos, G. D.
(1996)
Cell
85,
501-512[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Wallace, B. G.
(1989)
J. Neurosci.
9,
1294-1302[Abstract]
|
| 13.
|
Wallace, B. G., Qu, Z.,
and Huganir, R. L.
(1991)
Neuron
6,
869-878[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Burden, S. J.
(1998)
Genes Dev.
12,
133-148[Free Full Text]
|
| 15.
|
Scott, L. J.,
Balsamo, J.,
Sanes, J. R.,
and Lilien, J.
(1990)
J. Neurosci.
10,
346-350[Abstract]
|
| 16.
| Deleted in proof
|
| 17.
|
Scott, L. J.,
Bacou, F.,
and Sanes, J. R.
(1988)
J. Neurosci.
8,
932-944[Abstract]
|
| 18.
|
Herbst, R.,
and Burden, S. J.
(2000)
EMBO J.
19,
67-77[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Watty, A.,
Neubauer, G.,
Dreger, M.,
Zimmer, M.,
Wilm, M.,
and Burden, S. J.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
4585-4590[Abstract/Free Full Text]
|
| 20.
|
Hopf, C.,
and Hoch, W.
(1998)
J. Biol. Chem.
273,
6467-6473[Abstract/Free Full Text]
|
| 21.
|
Morgenstern, J. P.,
and Land, H.
(1990)
Nucleic Acids Res.
18,
3587-3596[Abstract/Free Full Text]
|
| 22.
|
Wang, W. C.,
and Cummings, R. D.
(1988)
J. Biol. Chem.
263,
4576-4585[Abstract/Free Full Text]
|
| 23.
|
Crowley, J. F.,
Goldstein, I. J.,
Arnarp, J.,
and Lonngren, J.
(1984)
Arch. Biochem. Biophys.
231,
524-533[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Fu, A. K.,
Smith, F. D.,
Zhou, H.,
Chu, A. H.,
Tsim, K. W.,
Peng, B. H.,
and Ip, N. Y.
(1999)
Eur. J. Neurosci.
11,
373-382[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Ip, F. C.,
Glass, D. G.,
Gies, D. R.,
Cheung, J.,
Lai, K. O., Fu, A. K.,
Yancopoulos, G. D.,
and Ip, N. Y.
(2000)
Mol. Cell. Neurosci.
16,
661-673[CrossRef][Medline]
[Order article via Infotrieve]
|
| 26.
|
Mittaud, P.,
Marangi, P. A.,
Erb-Vogtli, S.,
and Fuhrer, C.
(2001)
J. Biol. Chem.
276,
14505-14513[Abstract/Free Full Text]
|
| 27.
|
Apel, E. D.,
Glass, D. J.,
Moscoso, L. M.,
Yancopoulos, G. D.,
and Sanes, J. R.
(1997)
Neuron
18,
623-635[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Martin, P. T.,
and Sanes, J. R.
(1995)
Neuron
14,
743-754[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Grow, W. A.,
Ferns, M.,
and Gordon, H.
(1999)
Dev. Neurosci.
21,
436-443[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Grow, W. A.,
Ferns, M.,
and Gordon, H.
(1999)
J. Neurobiol.
40,
356-365[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Grow, W. A.,
and Gordon, H.
(2000)
Cell Tissue Res.
299,
273-279[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Takahashi, T.,
and Shibuya, M.
(1997)
Oncogene
14,
2079-2089[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Collier, E.,
Carpentier, J. L.,
Beitz, L.,
Carol, H.,
Taylor, S. I.,
and Gorden, P.
(1993)
Biochemistry
32,
7818-7823[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Watson, F. L.,
Porcionatto, M. A.,
Bhattacharyya, A.,
Stiles, C. D.,
and Segal, R. A.
(1999)
J. Neurobiol.
39,
323-336[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Elleman, T. C.,
Frenkel, M. J.,
Hoyne, P. A.,
McKern, N. M.,
Cosgrove, L.,
Hewish, D. R.,
Jachno, K. M.,
Bentley, J. D.,
Sankovich, S. E.,
and Ward, C. W.
(2000)
Biochem. J.
347,
771-779[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Tsuda, T.,
Ikeda, Y.,
and Taniguchi, N.
(2000)
J. Biol. Chem.
275,
21988-21994[Abstract/Free Full Text]
|
| 37.
|
Fernandes, H.,
Cohen, S.,
and Bishayee, S.
(2001)
J. Biol. Chem.
276,
5375-5383[Abstract/Free Full Text]
|
| 38.
|
Hubbard, S. R.,
and Till, J. H.
(2000)
Annu. Rev. Biochem.
69,
373-398[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Borges, L. S.,
and Ferns, M.
(2001)
J. Cell Biol.
153,
1-12[Abstract/Free Full Text]
|
| 40.
|
Wang, X. Q.,
Sun, P.,
O'Gorman, M.,
Tai, T.,
and Paller, A. S.
(2001)
Glycobiology
11,
515-522[Abstract/Free Full Text]
|
| 41.
|
Parkhomovskiy, N.,
Kammesheidt, A.,
and Martin, P. T.
(2000)
Mol. Cell. Neurosci.
15,
380-397[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Martin, P. T.
(2002)
Glycobiology
12,
1R-7R[Abstract/Free Full Text]
|
| 43.
|
Rapraeger, A. C.,
Krufka, A.,
and Olwin, B. B.
(1991)
Science
252,
1705-1708[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Yokoe, M. Takahashi, M. Asahi, S. H. Lee, W. Li, D. Osumi, E. Miyoshi, and N. Taniguchi
The Asn418-Linked N-Glycan of ErbB3 Plays a Crucial Role in Preventing Spontaneous Heterodimerization and Tumor Promotion
Cancer Res.,
March 1, 2007;
67(5):
1935 - 1942.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Koles, K. D. Irvine, and V. M. Panin
Functional Characterization of Drosophila Sialyltransferase
J. Biol. Chem.,
February 6, 2004;
279(6):
4346 - 4357.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. L. McDearmon, A. C. Combs, and J. M. Ervasti
Core 1 Glycans on {alpha}-Dystroglycan Mediate Laminin-induced Acetylcholine Receptor Clustering but Not Laminin Binding
J. Biol. Chem.,
November 7, 2003;
278(45):
44868 - 44873.
[Abstract]
[Full Text]
[PDF]
|
 |
|