![]()
|
|
||||||||
J. Biol. Chem., Vol. 277, Issue 52, 50768-50775, December 27, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, October 2, 2002
Estrogen binds to receptors that
translocate to the plasma membrane and to the nucleus. The rapid,
non-genomic actions of this sex steroid are attributed to membrane
action, while gene transcription occurs through nuclear receptor
function. However, gene transcription can also result from estrogen
signaling initiated at the membrane, but the relative importance of
this mechanism is not known. In vascular endothelial cells (EC),
estradiol (E2) activates several kinase
cascades, including phosphatidylinositol 3-phosphate (PI3K)/Akt,
a signaling pathway that impacts EC biology. We determined here by DNA
microarray that 40-min exposure to E2 significantly
increased 250 genes in EC, up-regulation that was substantially
prevented by the PI3K inhibitor, LY294002. This coincided with maximum
E2-induced PI3K activity at 15-30 min. An important
vascular gene strongly up-regulated by E2 in our array
produces cyclooxygenase-2 (Cox-2). In cultured EC, E2
induced both Cox-2 gene expression and new Cox-2 protein
synthesis by 40 and 60 min, respectively, and rapidly stimulated the
secretion of prostaglandins PGI2 and PGE2. The
up-regulation of gene expression reflected transcriptional
transactivation, shown using Cox-2 promoter/luciferase reporters in the EC. Soluble inhibitors or dominant negative constructs for PI3K and Akt prevented all these actions of E2.
Functionally, EC migration was induced by the sex steroid, and this was
significantly reversed by NS-398, a Cox-2 inhibitor. Gene transcription
and cell biological effects of estrogen emanate from rapid and specific signaling, integrating cell surface and nuclear actions of this steroid.
Estradiol
(E2)1 and other
steroid hormones are traditionally considered to transactivate
target genes after binding nuclear receptors (1). However,
E2 also has rapid, non-genomic effects (2-4), and these
have recently been attributed to cell membrane-initiated signaling. At
the cell surface, a small population of ER binds E2 and
activates G proteins (5-7). Multiple signaling pathways are then
rapidly stimulated by E2 in target cells that express endogenous ER Signaling from the membrane leads to the post-translational
modification of important structural and functional proteins in the
cell. In EC, E2 activates the p38-MAPKAP-2 kinase pathway; MAPKAP-2 phosphorylates and modifies the function of heat shock protein
27 (14). This important modification leads to the morphological preservation and survival of the EC and stimulates primitive capillary tube formation. In breast cancer, E2 acts as a cell
survival factor, in part by preventing chemotherapy or
radiation-induced JNK activation (9). JNK phosphorylates and
inactivates Bcl2 and Bcl-xl, leading to the assembly of the apoptosome
and caspase-mediated cell death. By preventing JNK activation and
Bcl2/Bcl-xl phosphorylation, E2 rescues the breast cancer
cells (9). This provides a mechanism for the ability of E2
to oppose therapeutic interventions in this malignancy.
In addition to post-translational protein effects, E2 is
recognized to stimulate transcription through signaling typically initiated at the membrane. As precedent for this effect of
E2, growth factor tyrosine kinase receptors (insulin-like
growth factor-1 receptor and epidermal growth factor receptor) exist in
the plasma membrane and signal through common kinase cascades to gene
transcription. E2 effects may involve the G
protein-initiated, signaling-induced synthesis or activation of
transcription factors. E2 stimulates c-fos through ERK- or PI3K-dependent pathways
(15-17), the BCL-2 gene through the modification of Sp-1
transcription factor (18), and the prolactin gene through
ERK (19). E2 activation of PI3K in EC results from the
membrane ER-p85 regulatory subunit (PI3K) association, and this
signaling to nitric oxide production rescues rats from
ischemia-reperfusion injury (20). However, insight is largely lacking
as to the full extent and importance of the specific integration of
membrane signaling and nuclear effects of the sex steroid.
We therefore identified the transcriptional targets in EC that are
rapidly up-regulated from E2 signaling through the
activation of PI3K. We also describe in depth the ability of
E2-induced PI3K activation to up-regulate one specific
gene, Cox-2, leading to the production of the enzyme,
secretion of products of Cox-2 activation, and EC migration. This
approach can be used to identify programs of gene activation that
result from membrane-initiated steroid signaling
(MISS)2 by
E2.
PI3K Activity Assay--
EC were incubated with/without 10 nM E2 and 10 µM LY294002 for up
to 6 h. Cells were then lysed, and the lysates pelleted then
dissolved in SDS sample buffer, boiled, separated, and transferred onto
nitrocellulose. Phosphorylated Akt was detected using phospho-specific monoclonal antibodies (Santa Cruz Biotechnology) and the ECL Western blot kit. Equal samples from the cells were also immunoprecipitated, and immunoblots of the precipitated kinase protein from each
experimental condition were determined to show equal gel loading. All
experiments were repeated two or three times.
DNA Arrays--
Human umbilical vein endothelial cells were
incubated without or with 10 nM E2 with or
without the specific PI3K inhibitor, LY294002 (10 µM), or
LY294002 alone, for 40 min. For validation, the experiment was repeated
a second time. Total RNA was extracted using TRIzol reagent
(Invitrogen, Carlsbad, CA) and by RNeasy columns (Qiagen, Valencia,
CA). Total RNA was adjusted to 1 µg/µl, and first-strand cDNA,
followed by double-stranded cDNA was synthesized from
poly(A)+ mRNA by the Microarray Facility at the
University of California, Irvine. This was done using the SuperScript
double-stranded cDNA synthesis kit (Invitrogen) and poly(T)
nucleotide primers that contained a sequence recognized by T7 RNA
polymerase. A portion of the resulting double-stranded cDNA was
used as a template to generate biotin-tagged cRNA from an in
vitro transcription reaction (IVT) using the BioArray High-Yield
RNA transcript labeling kit (T7) (Enzo Diagnostics, Farmingdale, NY).
15 µg of the biotin-tagged cRNA was fragmented to strands of 35-200
bases in length following prescribed protocols (Affymetrix GeneChip
Expression Analysis Technical Manual). 10 µg of the fragmented cRNA
was hybridized with rotation at 45 °C for 16 h to probe sets
present on an Affymetrix human U95a array (Affymetrix, Santa Clara,
CA). The arrays were automatically washed and stained with
streptavidin-phycoerythrin. Probe arrays were then scanned
on a Hewlett-Packard GeneArray scanner. Affymetrix Microarray Suite 5.0 was used to quantify and analyze the average difference in intensities
between conditions of the experiment, for each represented gene. The
comparisons between conditions were outputted as -fold increase or
decrease, or no change, and data were compared with determine which
genes were E2-responsive in a PI3K-dependent
fashion. This output was then inserted into a stringent, Bayesian-based
statistical analysis program (Cyber-T) (21), available as a web
interface at the University of California at Irvine. The upper 2.5% of
genes identified as being significantly different by Cyber-T (and in
agreement with the Affymetrix analysis) are presented in table form.
RT-PCR and Reporter Assays--
Validation of differential
expression was performed by RT-PCR for four genes identified in the
microarray and was standardized to glyceraldehyde-3-phosphate
dehydrogenase. cDNA was prepared from 3 µg of total RNA
isolated from EC, primed with random hexamers (Invitrogen), and
reverse-transcribed with Superscript II (Invitrogen) per the
manufacturer's instructions. The primers were prepared by
Invitrogen for the following sequences; Cox-2,
TGGGAAGCCTTCTCTAACCTCTCCT and CTTTGACTGTGGGAGGATACATCTC;
CREM, TGGAAACAGTTGAATCACAG; and CTACTAATCTGTTTTGGGAG;
EGR2, CAGTACCCTGGTGCCAGCTG and TGTGGATCTCTCTGGCACGG; JUN-B; CCGGATGTGCACGAAAATGGAACAG and ACCGTCCGCAAAGCCCTCCTG;
glyceraldehyde-3-phosphate dehydrogenase; ACCACAGTCCATGCCATCAC and
TCCACCACCCTGTTGCTGTA. PCR reactions were performed using 200 nM of primers with 2 µl of cDNA in 50 µl of
Platinum PCR supermix (Invitrogen). After an initial denaturation step
of 94 °C for 4 min, 25-35 cycles of 94 °C for 30 s,
55-61 °C for 45 s, 72 °C for 30-45 s, and a final
extension at 72 °C for 10 min. The PCR products were separated by
electrophoresis in a 1.2% agarose gel and visualized by ethidium bromide staining. The cycle number and annealing temperature was adjusted for each of the genes amplified.
For reporter assays, BAEC were transiently transfected with 10 µg of
the PGL-3 plasmid containing 1.8 kb of the human Cox-2 promoter driving a luciferase reporter fusion protein (22), kindly
provided by Dr. David Dixon (Vanderbilt). The liposome-mediated transfection was carried out as previously described (6, 9), and the
cells were recovered in serum overnight, then synchronized without
serum over 24 h before experiments (in phenol red-free medium).
Cells were then incubated for 6 h with10 nM
E2 with or without either LY294002 (10 µM), a
soluble inhibitor of NF Cox-2 Protein and PGI2 Secretion--
For protein
synthesis, BAECs were exposed to 0.1-10 nM E2
for 60 min, preceded where indicated for 30 min by incubation with ICI
182,780 (1 µM), LY294002 (10 µM), or
wortmannin (PI3K inhibitor) (100 nM). Additional BAECs were
either transiently transfected with dominant negative myc-tagged
pMT2-AH-Akt (kindly provided by Dr. Julian Downward) (23), or dominant
negative PI-3K p85 subunit (pcDNA3-delta p85, lacking residues
478-513) (kindly provided by Dr. Barry Posner) (24), as previously
described (25), or with pcDNA3 as control. The cells were recovered
and synchronized over 24 h then incubated with E2.
For PGI2 (measured as 6-keto-PGF1 EC Migration Studies--
EC were grown to monolayer confluence
on six-well plates and synchronized for 24 h in the absence of
serum. A "wound" was created by scraping the monolayer with a
single-edge razor blade, and cells were removed to the left of the
wound. Serum-free Dulbecco's modified Eagle's medium containing 10 nM E2 with or without NS-398, SC-560, LY294002,
wortmannin, or alone as control was added to separate dishes of wounded
EC for 24 h at 37 °C. The cells were then fixed in 3.7%
formaldehyde and assessed for migration (14). BAEC migration was
measured using an image analyzer system composed of an inverted
microscope and a 20- to 24-inch digitizing board (Jandel Scientific,
Corte Madera, CA) attached to a computer. The Sigma Scan program
(Jandel) was used for analysis of measurements of the distance traveled
by the cells within the calibrated area adjacent to the wound. Five
measurements in each well were taken, and results from three separate
experiments contributed to create the bar graph.
Estrogen Stimulates PI3K Activity in EC--
E2
induced substantial Akt phosphorylation by 5 min, reflecting PI3K
activation, because the phosphorylation was totally prevented by a PI3K
inhibitor (Fig. 1). The peak activity
occurred at 15 min and lasted for the 6-h duration of the experiment.
We therefore carried out our array studies to assess genes rapidly
induced by E2 via PI3K signaling, based upon these
results.
E2 Rapidly Induces Many Genes via PI3K
Activation--
EC were incubated with 10 nM
E2 or without steroid (control) for 40 min, in the presence
or absence of LY294002, a PI3K inhibitor. cRNA from each experimental
condition was used for microarray gene analysis, as delineated under
"Materials and Methods." The DNA array hybridization pattern was
analyzed by both Affymetrix statistical software and the CyberT
Bayesian-based program, and 250 genes were identified as being
significantly up-regulated by E2 (upper 2.5% of all genes)
(Fig. 2). This occurred in both E2-inducible and PI3K-reversible fashion. In comparing
control cRNA (no treatment) to cRNA from cells treated with LY294002
alone, no differences were detected. We list the genes that were 1)
up-regulated in this fashion by more than 2-fold and 2) identified to
have some known function (Table I). In
contrast, few genes were down-regulated by E2 in the
quiescent EC, and none depended upon PI3K/Akt activation, whereas
several genes were stimulated by E2 and further enhanced upon PI3K inhibition. Genes discussed in the text are given in boldface
in Table I.
As might be predicted from the time chosen, many transcription factors
were rapidly up-regulated. These included the fos, myc, and jun genes previously known to be
stimulated by estrogen (15, 26, 27), which thereby validate our
results. Here we extend the findings and implicate PI3K action in
proto-oncogene up-regulation by E2. This sex steroid was
recently shown to activate c-fos transcription in MCF-7
cells, via a PI3K/Akt pathway, targeting the serum response factor
motif in the proximal fos promoter (16). We also
found stimulation of many transcription factors not previously known to
be regulated by E2; these genes are therefore implicated in
further E2 transcriptional action. In some situations,
linked gene programs could be tentatively identified, based upon the existing literature. As an example, bone morphogenetic protein 2 (Table
I, cytokines) stimulates osteoblast precursor-cell differentiation in
part via up-regulating the AREB6 transcription factor (29). Estrogen
induces osteoblast differentiation (30), and we found that
E2 stimulates both genes here, via a PI3K-induced
mechanism. Another transcriptional target for AREB6 is the
Na+/K+-ATPase gene (31). E2
is known to stimulate the activity of this enzyme (32), potentially
linking these observations to upstream signaling. As shown here, the
HZF2 transcription factor is induced by E2 in
PI3K-dependent fashion (Table I). HZF2 has been reported to
be up-regulated by nitric oxide (NO) (33), and E2 strongly
and rapidly stimulates NO production in EC in PI3K-dependent fashion (20). NO induction by
E2 prevents the deleterious blood vessel response to
ischemia-reperfusion injury (20). Together, these results potentially
identify a linked cell biological program in EC. Several members of the
EGR family of transcription factors were identified as induced by
E2 in our array. Egr-1 is up-regulated (and important) in
the response to acute and chronic vascular injury, where it may serve a
protective function (34, 35). E2 mitigates the acute injury
response to carotid angioplasty (36), perhaps in part through inducing Egr-1 in the EC, as shown here.
Signaling molecules were also rapidly induced by E2,
including both kinases and phosphatases. Steroid and
glucocorticoid-inducible kinase activity is known to be a target for
PI3K/Akt signaling (37) and has roles in both steroid-induced memory
(38) and sodium transport (39), which are both functions of
E2 (40, 41). We also found that, via PI3K, E2
up-regulates Cot/(Tpl-2), a transformation-associated factor
and serine/threonine kinase. Akt phosphorylation of Cot induces
NF
Genes coding for structural proteins, cytokines, or enzymes were
identified as being stimulated by E2. Two members of the NGFI-B subfamily of nuclear orphan receptors, TR3 and
MINOR, were rapidly and strongly induced by
E2 via PI3K. A cytokine gene, CYR61, was
previously demonstrated to be up-regulated by E2 in breast
cancer but through an unknown mechanism (43). In EC, we implicate
signaling via PI3K. Up-regulation of the PTTG gene by
estrogen (found here) was previously shown to contribute to the
pathogenesis of E2-induced pituitary tumor formation and
the stimulation of bFGF secretion (44). E2 and bFGF are
recognized angiogenesis factors (14, 45), and therefore a potential
linkage in EC of PTTG-induced bFGF could be important for the
recognized neovascularization function of E2. The
PLAP (phospholipase A2-activating protein) gene was found to
be stimulated in our array (Table I). This protein has been reported to
contribute to up-regulate the Cox-2 gene and stimulate
prostaglandin E2 (PGE2) production (46). Based
on our results, we propose a linkage of E2-induced,
PI3K-dependent up-regulation of PLAP,
contributing to E2-induced Cox-2 up-regulation and PG
secretion/production (see below). Thus, many relevant genes are rapidly
induced by this sex steroid in response to one signal pathway typically
initiated at the plasma membrane.
Confirmation by RT-PCR of E2-induced Gene
Up-regulation--
To confirm the array studies, we carried out
semi-quantitative RT-PCR for several of the genes identified (Fig.
3). For the four genes examined
(Cox-2, JunB, CREM, and
EGR2), there was increased expression in EC after 40-min
exposure to 10 nM E2 (lane 2),
compared with the control (no E2) (lane 1).
Furthermore, this increase was significantly abrogated by addition of
the PI3K inhibitor, LY294002 (lane 3), whereas the inhibitor
alone had no effect compared with control levels (lane 4).
The results provide validation of the array data for these specific
genes.
Cox-2 Gene and E2/ER Interactions Result from Rapid
Signaling by the Steroid--
One of the genes strongly up-regulated
by E2 in our EC gene array codes for the Cox-2 enzyme
(Table I). Cox-2 activity gives rise to pGI2 and
PGE2 production, important for various aspects of vascular
function (47, 48). To explore the interactions between E2
signaling through PI3K to Cox-2 in greater depth, we first confirmed
the array results by RT-PCR (Fig. 3). We then further investigated
transcriptional regulation by E2. We therefore expressed in
BAEC a plasmid containing a 1.8-kb human Cox-2 promoter driving a luciferase reporter. This was significantly responsive to 10 nM E2, in a PI3K-dependent fashion
(Fig. 4).
One known target for PI3K/Akt signaling is the activation of the NF Cox-2 Protein Synthesis and Prostaglandin Secretion Are Stimulated
by E2--
Cox-2 protein synthesis was then determined by
Western blot. After 1-h exposure of EC to E2, the Cox-2
protein was nearly 3-fold increased in relevant E2
concentration-responsive fashion (Fig.
5A). The PI3K inhibitors, LY
294002 and wortmannin, each caused an 80% reduction in Cox-2 protein
synthesis, as did ICI 182,780, an ER antagonist. Expression of dominant
negative constructs for the p85 subunit of PI3K (DN-PI3K) or Akt
(DN-Akt) also resulted in substantial inhibition of
E2-induced Cox-2 protein expression. The dominant negative
constructs had no effects alone (data not shown).
In preliminary studies, we determined a time course for
PGE2 and PGI2 secretion in response to
E2. Compared with basal secretion (0 time), E2
stimulated an initial 2-fold PGE2 release at 10 min (first
point assessed), reaching a maximum increase at 30 min and plateauing
thereafter (data not shown). Based upon these results, BAEC were then
incubated with 10 nM E2 with or without
inhibitors of ER, PI3K, and Cox-1 or Cox-2 for 30 min. As seen in Fig.
5B, E2 stimulated a 13-fold increase of
PGE2 secretion, 75% prevented by ICI 182,780. Co-incubation of the cells with NS-398 (a specific Cox-2 inhibitor)
reversed the E2 effect by 86%. A specific Cox-1 inhibitor
(SC-560) also provided a 33% inhibition of the E2 effect, suggesting that PGE2 synthesis was mainly dependent upon
the Cox-2 enzyme. It is recognized that PGE2 and
PGI2 can both result from either Cox-1 or Cox-2 enzymatic
action, but in a given cell type or in response to a specific stimulus,
one cyclooxygenase activity may predominate over the other (53).
Importantly, the PI3K inhibitors, wortmannin and LY 294002 each
prevented E2-induced PGE2 secretion by 87%.
This is consistent with the ability of E2 to activate the
Cox-2 gene in a PI3K-dependent fashion, as
identified by microarray and reporter studies. Interestingly, the
PGE2 receptor was also found in our array to be
up-regulated by E2 via PI3K (Table I).
As for PGI2, E2 induced a 4-fold increase in
secretion (Fig. 5B). This was 60% reversed by ICI 182,780, 58% by the Cox-2 inhibitor, and 36% by the Cox-1 inhibitor. The PI3K
inhibitors also reduced the E2 induction of
PGI2 by 60%. Our results greatly extend the observations
of others that E2 can rapidly stimulate the secretion of
PGI2 from endothelial cells (54, 55). Here we show
transcriptional up-regulation of the Cox-2 gene, increased
protein production, and stimulation of both PGE2 and
PGI2 secretion, in a PI3K-dependent fashion. An
observation that is relevant for EC is that Cox-2 and cAMP-signaling
enhances angiogenesis through the induction of vascular endothelial
growth factor (56). Cox-2 and cAMP are up-regulated by E2
signaling from the membrane (2, 6, and here). This may be significant
to E2-modulated induction and developmental function of
vascular endothelial growth factor, in the formation and permeability
of the blood vessels of the ovary and uterus (56, 57).
EC Migration--
We then examined possible roles for
Cox-2-derived prostaglandins and E2 in mediating EC
migration. E2 is known to induce several aspects of
angiogenesis, including EC migration (14), and Cox-2 also importantly
participates in these processes (28). Cultured EC were "wounded,"
and the migration of EC across this wound barrier was determined after
24-h exposure to various conditions. As seen in Fig.
6, 10 nM E2
(panel B) induced a 3-fold increase in migration area
compared with control EC (panel A). The effect of
E2 was reduced 75% by a Cox-2 inhibitor (panel
C), but not significantly by a Cox-1 inhibitor (panel
D). The effect of E2 was also prevented by LY294002
(panel E) and by wortmannin (PI3K inhibitor) (panel F). The inhibitors by themselves had no effects on EC migration (data not shown). Thus, we link the Cox-2 up-regulation in EC, induced
by E2 and PI3K signaling, to a cell biological outcome.
Increasingly, the integration of membrane and nuclear actions of
steroids is recognized. An important mechanism demonstrated here is
that steroids rapidly induce through kinase signaling many genes coding
for transcription factors. We determined that the identified
transcription factor gene promoters usually lack any form of estrogen
response elements. Transcription factor up-regulation presumably then
leads to the induction of additional genes that regulate
steroid-induced cellular function. However, we also show that, by the
same signaling mechanism, steroids rapidly up-regulate genes coding for
enzymes or signaling molecules. The protein products of these genes
both directly impact cell functions (i.e. cell migration)
and induce additional transcription. Through membrane-initiated steroid
signaling (MISS), we propose that estrogen affects overall cellular
processes by post-translationally modulating the functions of existing
proteins (9, 14) and by activating discrete programs of gene expression.
*
This work was supported by grants from the Research Service
of the Department of Veterans Affairs, Avon Products Breast Cancer Research Foundation, Department of Defense Breast Cancer Research Program (Grant BC990915) and the National Institutes of Health Grant
HL-59890 (to E. R. L.).The costs of publication of this article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
**
To whom correspondence should be addressed: Medical Service
(111-I), Long Beach Veterans Administration Medical
Center/UC- Irvine, 5901 E. 7th St., Long Beach, CA 90822. Tel.:
562-826-5748; Fax: 562-826-5515; E-mail: ellis.levin@med.va.gov.
Published, JBC Papers in Press, October 7, 2002, DOI 10.1074/jbc.M210106200
2
Terminology to replace "non-genomic" effects
of steroids, as suggested by the Consensus Working Group at the FASEB
conference on Membrane Steroid Receptors, Aspen, CO, June 22-27, 2002.
3
A. Pedram, M. Razandi, M. Aitkenhead, C. C. W. Hughes, and E. R. Levin, unpublished observations.
The abbreviations used are:
E2, estradiol;
Cox, cyclooxygenase;
EC, endothelial cells;
ER, estrogen
receptor;
ERK, extracellular signal-regulated protein kinase;
JNK, c-Jun N-terminal kinase;
MAPKAP, mitogen-activated protein kinase
activated protein kinase;
PI3K, phosphatidylinositol 3-phosphate;
RT, reverse transcriptase;
PGI2, prostaglandin I2;
PGE2, prostaglandin E2;
NO, nitric oxide;
EGR, early growth response;
bFGF, basic fibroblast growth factor;
DN, dominant negative;
MISS, membrane-initiated steroid signaling;
PTTG, pituitary tumor transforming gene;
BAEC, bovine aortic
endothelial cell.
Integration of the Non-genomic and Genomic Actions of
Estrogen
MEMBRANE-INITIATED SIGNALING BY STEROID TO
TRANSCRIPTION AND CELL BIOLOGY*
§,
§,
§¶,
¶, and
§
**
Division of Endocrinology, Veterans
Affairs Medical Center, Long Beach, Long Beach, California 90822 and the Departments of § Medicine,
Pharmacology,
and ¶ Molecular Biology and Biochemistry, University of
California, Irvine, Irvine, California 92717
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
and ER
, and these pathways have been linked to discrete cellular actions of the steroid (8-11). In this respect, a
truncated MTA1 protein was recently found to be highly expressed in
aggressive breast cancer (12). This protein sequesters ER away from the
nucleus and strongly reduces E2-activated transcription yet
promotes increased ERK signaling and aggressive behavior of the tumor.
It is proposed therefore that the integration of cell surface and
nuclear signaling impacts overall cell biology (13).
![]()
MATERIALS AND METHODS
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
B (SN50M), or the corresponding inactive
control (SN50), each at 20 µM. All inhibitors were from
Calbiochem (San Diego, CA). Assays were quantified by luminometer, and
the results were adjusted for expression of co-transfected
Renilla luciferase. Triplicate determinations per condition
were carried out in each of two experiments. The combined data were
analyzed by analysis of variance plus Schefe's test, at a
p < 0.05 level of significance.
) and PGE2
secretion studies, BAEC were incubated for 0-240 min with
E2, to determine time of peak secretion. This was found to
be 30 min, as subsequent time points reflected both secretion and
accumulation. Additional studies were then conducted at 30 min. BAEC
were incubated with/without 10 nM E2, with or
without inhibitors, including NS-398 (5 µM) (Cox-2
inhibitor), or SC-560 (20 nM) (Cox-1 inhibitor). Each
condition was run in duplicate. The incubation media were collected and concentrated by lyophilization, and prostaglandin concentrations were
determined by enzyme-linked immunosorbent assay (Cayman Chemical). The
study was repeated three times, with the results reflected in the
bar graph.
![]()
RESULTS AND DISCUSSION
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES

View larger version (28K):
[in a new window]
Fig. 1.
Time course of PI3K activation in endothelial
cells by estradiol (E2). Cells were incubated with 10 nM E2 with or without 10 µM
LY294002 for the times indicated, and Akt phosphorylation as a function
of PI3K activity was determined by Western blot. Immunoblot of total
Akt protein is shown below each condition. A representative
study of two completed is shown.

View larger version (18K):
[in a new window]
Fig. 2.
Estrogen-induced genes in endothelial cells,
dependent upon phosphatidylinositol 3-kinase signaling. EC
were incubated/not incubated with 10 nM
E2 with or without LY294002 (PI3K inhibitor), or LY294002
alone, for 40 min. Total RNA from the four conditions was then
extracted for purposes of microarray analysis after cDNA/cRNA
synthesis (see "Materials and Methods"). The figure is the output
from CyberT analysis, a stringent, Bayesian-based statistical analysis
program. Duplicate determinations for all conditions were utilized for
the analysis. Genes in red are the upper 2.5% of all genes
positively regulated by E2 and mostly inhibited by
LY294002.
Genes significantly up-regulated by estradiol in a PI3K-dependent
fashion
B-dependent transduction (42), important for various
functions, including cell survival. E2 potently inhibits
hypoxia-induced EC apoptosis (14).

View larger version (18K):
[in a new window]
Fig. 3.
Validation of the microarray data by
RT-PCR. EC were incubated with 10 nM E2
(lane 2), with 10 nM E2 and LY294002
(PI3K inhibitor) (lane 3), with LY294002 alone (lane
4), or no treatment (lane 1) for 40 min. Total RNA from
the four conditions was then extracted and reverse-transcribed to
cDNA. PCR was performed using gene-specific primers (see
"Materials and Methods") for Cox-2, JunB,
CREM, and EGR-2, with glyceraldehyde-3-phosphate
dehydrogenase as a control.

View larger version (12K):
[in a new window]
Fig. 4.
E2 stimulates the activity of a
Cox-2 promoter/luciferase reporter via PI3K in
endothelial cells. EC were transfected with a plasmid to express a
1.8-kb Cox-2 promoter plasmid driving the luciferase
reporter. The cells were recovered and synchronized and then incubated
for 6 h with 10 nM E2 with or without 10 µM LY294002, or with 20 µM of either an
NF
B active inhibitor(SN50M) or an inactive analog (SN50). The
bar graph reflects the mean ± S.E. from triplicate
determinations in each of two experiments, combined for analysis. *,
p < 0.05 for control versus E2;
+, p < 0.05 for E2 versus
E2 +LY294002 by analysis of variance plus Scheffe's
test.
B
transcription factor (49, 50). We found that a soluble NF
B inhibitor
(but not its inactive control) completely reversed the E2
stimulation of the Cox-2 promoter (Fig. 4). These data support the microarray studies and the idea that the up-regulation of
the Cox-2 gene by E2 is transcriptional.
Furthermore, this E2 action depends on signaling via PI3K
and NF
B. NF
B binding sites are present within the human
Cox-2 promoter at
580 and
358. Supporting this
mechanism, we found that E2 significantly activated both
0.8 and 0.4 kb Cox-2 promoters driving luciferase reporter
constructs, suggesting that the NF
B binding site at
358 in
particular is important.3
Previous studies indicate that PI3K/Akt can regulate Cox-2 mRNA production or stability in positive or negative fashion, dependent upon
the stimulus and cellular context (51, 52).

View larger version (26K):
[in a new window]
Fig. 5.
A, E2 stimulates the
production of Cox-2 protein in EC via PI3K and Akt signaling. EC were
incubated with several concentrations of E2 for 60 min, and
Cox-2 protein was determined by Western blot of immunoprecipitated cell
lysate. In some conditions, LY294002 or ICI182780 was added 30 min
prior to 10 nM E2, or the cells were first
transfected to express pMT2-AH-Akt (DN.Akt) or
pcDNA3-delta p85 (DN.PI3-K). Control and E2
with or without LY conditions were carried out in cells transfected
with pcDNA3. A representative study is shown, and the bar
graph reflects three experiments combined. *, p < 0.05 for control versus E2; +, p < 0.05 for 10 nM E2 versus
E2 plus inhibitor. B, secretion of
PGE2 (left) and PGI2 (6-keto
prostaglandin F1alpha) (right) in response to
E2. EC were incubated with 10 nM E2
with or withoutPI3K inhibitors, or with E2 + NS-398
(Cox-2 inhibitor) or SC-560 (Cox-1 inhibitor) for 30 min (soluble
inhibitors were added 30 min prior to E2). The bar
graph represents three combined experiments.

View larger version (45K):
[in a new window]
Fig. 6.
E2 stimulates EC migration in
PI3K and Cox-2 related fashion. Cultured EC were cut with a
surgical blade, and all cells were removed on the left side of the
wound with a scraper. The remaining cells were then cultured overnight
with/without 10 nM E2 with or without PI3K and
Cox-2 inhibitors. Panel A is control cells (no
E2 or serum); panel B is E2.
Panel C is E2 + NS-398, panel D is
E2 + SC-560, panel E is E2 + LY294002, and panel F is E2 + wortmannin (50 nM). The inhibitors alone had no effects (data not shown).
The bar graph below the composite reflects three experiments
combined. *, p < 0.05 for control versus
E2; +, p < 0.05 for E2
versus E2 plus inhibitor.
![]()
FOOTNOTES
![]()
ABBREVIATIONS
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
REFERENCES
1.
Truss, M.,
and Beato, M.
(1993)
Endocrine Rev.
14,
459-479[Abstract]
2.
Aronica, S. M.,
Kraus, W. L.,
and Katznellenbogen, B. S.
(1994)
Proc. Natl. Acad. Sci.
91,
8517-8521 3.
Tesarik, J.,
and Mendoza, C.
(1995)
J. Clin. Endocrinol. Metab.
80,
1438-1443[Abstract]
4.
Le Mellay, V.,
Grosse, B.,
and Lieberherr, M.
(1997)
J. Biol. Chem.
272,
11902-11907 5.
Pietras, R.,
and Szego, C. M.
(1977)
Nature
265,
69-72[CrossRef][Medline]
[Order article via Infotrieve]
6.
Razandi, M.,
Pedram, A.,
Greene, G. L.,
and Levin, E. R.
(1999)
Mol. Endocrinol.
13,
307-319 7.
Wyckoff, M. H.,
Chambliss, K. L.,
Mineo, C.,
Yuhanna, I. S.,
Mendelsohn, M. E.,
Mumby, S. M.,
and Shaul, P. W.
(2001)
J. Biol. Chem.
276,
27071-27076 8.
Singer, C. A.,
Figueroa-Masot, X. A.,
Batchelor, R. H.,
and Dorsa, D. M.
(1999)
J. Neurosci.
19,
2455-2463 9.
Razandi, M.,
Pedram, A.,
and Levin, E. R.
(2000)
Mol. Endocrinol.
14,
1434-1447 10.
Migliaccio, A., Di,
Domenico, M.,
Castoria, G.,
de Falco, A.,
Bontempo, P.,
Nola, E.,
and Auricchio, F.
(1996)
EMBO J.
15,
1292-1300[Medline]
[Order article via Infotrieve]
11.
Chen, Z.,
Yuhanna, I. S.,
Galcheva-Gargova, Z.,
Karas, R. H.,
Mendelsohn, M. E.,
and Shaul, P. W.
(1999)
J. Clin. Invest.
103,
401-406[Medline]
[Order article via Infotrieve]
12.
Kumar, R.,
Wang, E.-A.,
Mazumdar, A.,
Talukder, A. H.,
Mandal, M.,
Yang, Z.,
Bagheri-Yarmand, R.,
Sahin, A.,
Hortobagyi, G.,
Adam, L.,
Barnes, C. J.,
and Vadlamudi, R. K.
(2002)
Nature
418,
654-657[CrossRef][Medline]
[Order article via Infotrieve]
13.
Levin, E. R.
(2001)
J. Appl. Physiol.
91,
1860-1867 14.
Razandi, M.,
Pedram, A.,
and Levin, E. R.
(2000)
J. Biol. Chem.
275,
38540-38546 15.
Watters, J. J.,
Campbell, J. S.,
Cunningham, M. J.,
Krebs, E. G.,
and Dorsa, D. M.
(1997)
Endocrinology
138,
4030-4033 16.
Duan, R.,
Xie, W., Li, X.,
McDougal, A.,
and Safe, S.
(2002)
Biochem. Biophys. Res. Commun.
294,
384-394[CrossRef][Medline]
[Order article via Infotrieve]
17.
Duan, R.,
Xie, W.,
Burghardt, R. C.,
and Safe, S.
(2001)
J. Biol. Chem.
276,
11590-11598 18.
Porter, W.,
Saville, B.,
Hoivik, D.,
and Safe, S.
(1997)
Mol. Endocrinol.
11,
1569-1580 19.
Watters, J. J.,
Chun, T. Y.,
Kim, Y. N.,
Bertics, P. J.,
and Gorski, J.
(2000)
Mol. Endocrinol.
14,
1872-1881 20.
Simoncini, T.,
Hafezi-Moghadam, A.,
Brazil, D. P.,
Ley, K.,
Chin, W. W.,
and Liao, J. K.
(2000)
Nature
407,
538-541[CrossRef][Medline]
[Order article via Infotrieve]
21.
Long, A. D.,
Mangalam, H. J.,
Chan, B. Y. P.,
Toller, L.,
Hatfield, G. W.,
and Baldi, P.
(2001)
J. Biol. Chem.
276,
19937-19944 22.
Sheng, H.,
Shao, J.,
Dixon, D. A.,
Williams, C. S.,
Prescott, S. M.,
DuBois, R. N.,
and Beauchamp, R. D.
(2000)
J. Biol. Chem.
275,
6628-6635 23.
Khwaja, A.,
Rodriguez-Viciana, P.,
Wennstrom, S.,
Warne, P. H.,
and Downward, J.
(1997)
EMBO J.
16,
2783-2793[CrossRef][Medline]
[Order article via Infotrieve]
24.
Kong, M.,
Mounier, C., Wu, J.,
and Posner, B. I.
(2000)
J. Biol. Chem.
275,
36035-36042 25.
Pedram, A., Razandi, M., and Levin, E. R. (September 3, 2002)
J. Biol. Chem. 10.1074/jbc.M202391200
26.
Hyder, S. M.,
Nawaz, Z.,
Chiapetta, C.,
Yokoyama, K.,
and Stancel, G. M.
(1995)
J. Biol. Chem.
270,
8506-8513 27.
Lazennec, G.,
Alcorn, J. L.,
and Katzenellenbogern, B. S.
(1999)
Mol. Endocrinol.
13,
969-980 28.
Matsumoto, H., Ma, W.-g.,
Daikoku, T.,
Zhao, X.,
Paria, B. C.,
Das, S. K.,
Trzaskos, J. M.,
and Dey, S.
(2002)
J. Biol. Chem.
277,
29260-29267 29.
Locklin, R. M.,
Riggs, B. L.,
Hicok, K. C.,
Horton, H. F.,
Byrne, M. C.,
and Khosla, S.
(2001)
J. Bone Miner. Res.
16,
2192-2204[CrossRef][Medline]
[Order article via Infotrieve]
30.
Plant, A.,
Samuels, A.,
Perry, M. J.,
Colley, S.,
Gibson, R.,
and Tobias, J. H.
(2002)
J. Cell Biochem.
84,
285-294[CrossRef][Medline]
[Order article via Infotrieve]
31.
Watanabe, Y.,
Kawakami, K.,
Hirayama, Y.,
and Nagano, K.
(1993)
J. Biochem.
114,
849-855 32.
Dzurba, A.,
Ziegelhoffer, A.,
Vrbjar, N.,
Styk, J.,
and Slezak, J.
(1997)
Mol. Cell Biochem.
176,
113-118[CrossRef][Medline]
[Order article via Infotrieve]
33.
Schafer, U.,
Schneider, A.,
and Neugebauer, E.
(2000)
Biochim. Biophys. Acta
1494,
269-276[Medline]
[Order article via Infotrieve]
34.
Khachigan, L. M.,
Lindner, V.,
Williams, A. J.,
and Collins, T.
(1996)
Science
271,
1427-1431[Abstract]
35.
Du, B.,
Kent, K. C.,
Bush, H., Jr.,
Schulick, A. H.,
Kreiger, K.,
Collins, T.,
and McCaffrey, T. A.
(2000)
J. Biol. Chem.
275,
39039-39047 36.
Mendelsohn, M. E.,
and Karas, R. H.
(1999)
New Engl. J. Med.
340,
1801-1811 37.
Richards, J. S.,
Sharma, S. C.,
Falender, A. E.,
and Lo, Y. H.
(2002)
Mol. Endocrinol.
16,
580-599 38.
Tsai, K. J.,
Chen, S. K., Ma, Y. L.,
Hsu, W. L.,
and Lee, E. H.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
3990-3995 39.
Faletti, C. J.,
Perrotti, N.,
Taylor, S. I.,
and Blazer-Yost, B. L.
(2002)
Am. J. Physiol.
282,
C494-C500
40.
Sherwin, B. B.
(1998)
Proc. Soc. Exp. Biol. Med.
217,
17-22[Abstract]
41.
Ediger, T. R.,
Kraus, W. L.,
Weinman, E. J.,
and Katznellenbogen, B. S.
(1999)
Endocrinology
140,
2976-2982 42.
Kane, L. P.,
Mollenauer, M. N., Xu, Z.,
Turck, C. W.,
and Weiss, A.
(2002)
Mol. Cell. Biol.
16,
5662-5674
43.
Tsai, M. S.,
Bogart, D. F., Li, P.,
Mehmi, I.,
and Lupu, R.
(2002)
Oncogene
21,
964-973[CrossRef][Medline]
[Order article via Infotrieve]
44.
Heany, A. P.,
Fernando, M.,
and Melmed, S.
(2002)
J. Clin. Invest.
109,
277-283[CrossRef][Medline]
[Order article via Infotrieve]
45.
Lederman, R. J.,
Mendensohn, F. O.,
Anderson, R. D.,
Saucedo, J. F.,
Tenaglia, A. N.,
Hermiller, J. B.,
Hillegass, W. B.,
Rocha-Singh, K.,
Moon, T. E.,
Whitehouse, M. J.,
Annex, B. H.,
and TRAFFIC investigators.
(2002)
Lancet
359,
2048-2050[CrossRef][Medline]
[Order article via Infotrieve]
46.
Ribardo, D. A.,
Kuhl, K. R.,
Peterson, J. W.,
and Chopra, A. K.
(2002)
Toxicon
40,
519-526[Medline]
[Order article via Infotrieve]
47.
Li, D. Y.,
Hardy, P.,
Abran, D.,
Martinez-Bermudez, A. K.,
Guerguerian, A. M.,
Bhattacharaya, M.,
Almazan, G.,
Peri, K. G.,
Varma, D. R.,
and Chemtob, S.
(1997)
Am. J. Physiol.
273,
R1283-R1290[Medline]
[Order article via Infotrieve]
48.
Hocheri, K.,
Endemann, D.,
Kammerl, M. C.,
Grobecker, H. F.,
and Kurtz, A.
(2002)
Br. J. Pharmacol.
136,
1117-1126[CrossRef][Medline]
[Order article via Infotrieve]
49.
Pandey, S. K., He, H. J.,
Chesley, A.,
Juhaszova, M.,
Crow, M. T.,
and Bernier, M.
(2002)
Endocrinology
143,
375-385 50.
Koul, D.,
Yao, Y.,
Abbruzzese, J. L.,
Yung, W. K.,
and Reddy, S. A.
(2001)
J. Biol. Chem.
276,
11402-11408 51.
Monick, M. M.,
Robeff, P. K.,
Butler, N. S.,
Flaherty, D. M.,
Carter, A. B.,
Peterson, M. W.,
and Hunninghake, G. W.
(2002)
J. Biol. Chem.
277,
32992-33000 52.
Tang, Q.,
Chen, W.,
Gonzales, M. S.,
Finch, J.,
Inoue, H.,
and Bowden, G. T.
(2001)
Oncogene
20,
5164-5172[CrossRef][Medline]
[Order article via Infotrieve]
53.
Coceani, F.,
Ackerley, C.,
Seidlitz, E.,
and Kelsey, L.
(2001)
Br. J. Pharmacol.
132,
241-251[CrossRef][Medline]
[Order article via Infotrieve]
54.
Akarasereenont, P.,
Techatraisak, K.,
Thaworn, A.,
and Chotewuttakorn, S.
(2000)
Inflamm. Res.
49,
460-465[CrossRef][Medline]
[Order article via Infotrieve]
55.
Shareman, T. S.,
Chambliss, K. L.,
Gibson, L. L.,
Pace, M. C.,
Mendelsohn, M. E.,
Pfister, S. L.,
and Shaul, P. W.
(2002)
Am. J. Respir. Cell Mol. Biol.
26,
610-616 56.
Amano, H.,
Hayashi, I.,
Yoshida, S.,
Yoshimura, H.,
and Majima, M.
(2002)
Hum. Cell
15,
13-24[Medline]
[Order article via Infotrieve]
57.
Ferrara, N.,
Chen, H.,
Davis-Smyth, T.,
Gerber, H. P.,
Nguyen, T. N.,
Peers, D.,
Chislom, V.,
Hillan, K. J.,
and Schwall, R. H.
(1998)
Nat. Med.
4,
336-340[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
S. D. Conzen Minireview: Nuclear Receptors and Breast Cancer Mol. Endocrinol., October 1, 2008; 22(10): 2215 - 2228. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pedram, M. Razandi, D. Lubahn, J. Liu, M. Vannan, and E. R. Levin Estrogen Inhibits Cardiac Hypertrophy: Role of Estrogen Receptor-{beta} to Inhibit Calcineurin Endocrinology, July 1, 2008; 149(7): 3361 - 3369. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Li, L. Kuo, and J. N. Stallone Estrogen potentiates constrictor prostanoid function in female rat aorta by upregulation of cyclooxygenase-2 and thromboxane pathway expression Am J Physiol Heart Circ Physiol, June 1, 2008; 294(6): H2444 - H2455. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Arpino, L. Wiechmann, C. K. Osborne, and R. Schiff Crosstalk between the Estrogen Receptor and the HER Tyrosine Kinase Receptor Family: Molecular Mechanism and Clinical Implications for Endocrine Therapy Resistance Endocr. Rev., April 1, 2008; 29(2): 217 - 233. [Abstract] [Full Text] [PDF] |
||||
![]() |
X.-D. Fu, M. Flamini, A. M. Sanchez, L. Goglia, M. S. Giretti, A. R. Genazzani, and T. Simoncini Progestogens regulate endothelial actin cytoskeleton and cell movement via the actin-binding protein moesin Mol. Hum. Reprod., April 1, 2008; 14(4): 225 - 234. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Bourdeau, J. Deschenes, D. Laperriere, M. Aid, J. H. White, and S. Mader Mechanisms of primary and secondary estrogen target gene regulation in breast cancer cells Nucleic Acids Res., January 17, 2008; 36(1): 76 - 93. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. R. Hammes and E. R. Levin Extranuclear Steroid Receptors: Nature and Actions Endocr. Rev., December 1, 2007; 28(7): 726 - 741. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pedram, M. Razandi, R. C. A. Sainson, J. K. Kim, C. C. Hughes, and E. R. Levin A Conserved Mechanism for Steroid Receptor Translocation to the Plasma Membrane J. Biol. Chem., August 3, 2007; 282(31): 22278 - 22288. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. X. McCormack and J. Moss S-LAM in a Man? Am. J. Respir. Crit. Care Med., July 1, 2007; 176(1): 3 - 5. [Full Text] [PDF] |
||||