|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 6, 4317-4323, February 8, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the
Received for publication, October 9, 2001, and in revised form, November 19, 2001
We have previously shown that inhibiting
protein-tyrosine kinase increased whereas inhibiting
protein-tyrosine phosphatase (PTP) decreased renal outer medullary
potassium channel 1 (ROMK1) channel activity (1). We have now used
confocal microscopy, the patch clamp technique, and biotin labeling to
further examine the role of tyrosine phosphorylation in regulating
ROMK1 trafficking. Human embryonic kidney 293 cells were cotransfected
with c-Src and green fluorescent protein-ROMK1, which has the same
biophysical properties as those of ROMK1. Patch clamp studies have
shown that phenylarsine oxide (PAO), an inhibitor of PTP, decreased the
activity of ROMK1. Moreover, addition of PAO reduced the cell surface
localization of green fluorescent protein-ROMK1 detected by confocal
microscopy and diminished the surface ROMK1 density by 65% measured by
biotin labeling. Also, PAO treatment significantly increased the
phosphorylation of ROMK1. The notion that the effect of PAO is mediated
by stimulating tyrosine phosphorylation-induced endocytosis of ROMK1
has also been supported by findings that mutating the tyrosine residue 337 of ROMK1 to alanine abolished the effect of PAO. Finally, the
inhibitory effect of PAO on ROMK1 was completely blocked in the cells
co-transfected with dominant negative dynamin (dynaminK44A). This
indicates that the tyrosine phosphorylation-induced endocytosis of
ROMK1 is dynamin-dependent. We conclude that inhibiting PTP increases ROMK1 phosphorylation and results in a
dynamin-dependent internalization of the channel.
ROMK11 is located in the apical membrane of the
cortical collecting duct (CCD) and is
generally believed to be a key component of the native small
conductance K+ (SK) channel (2-6). The SK channels are
the major contributors to the apical K+ conductance and are
responsible for K+ secretion (4, 7). One important factor for
regulating K+ secretion is the dietary K+ intake; a
high K+ intake increases whereas a low K+ intake
decreases K+ secretion (7). The low K+ intake-induced
decrease in K+ secretion is at least partially achieved by
reducing the number of SK channels in the apical membrane of the CCD
(8).
Our preceding experiments strongly indicated that the low K+
intake-induced decrease in SK channel number was mediated by
protein-tyrosine kinase (PTK). This conclusion is supported by the
observation that inhibition of PTK increased the number of the SK
channels in the apical membrane of the CCD from rats on a
K+-deficient diet (8). In contrast, inhibition of PTP decreased the number of SK channels in the CCD from rats on a high K+
diet (9). Because the effect of inhibiting PTP on channel activity was
blocked by 20% sucrose, we speculated that inhibiting PTP increases
the endocytosis of the SK channels whereas inhibiting PTK augments the
exocytosis of the SK channels into the cell membrane. This notion is
supported by observations that inhibiting PTP with PAO reduced whereas
inhibiting PTK with herbimycin A increased the membrane location of
ROMK1 in oocytes injected with GFP-ROMK1 and c-Src (1).
Although our previous results strongly suggested that inhibiting PTP
increases the endocytosis of ROMK1, additional experiments are required
to prove the hypothesis, because ROMK1 trafficking may not be the same
in oocytes as in mammalian cells. In addition, it is difficult to
distinguish the ROMK1 channels located in the cell membrane from those
in the submembrane of oocytes. In the present study we have provided
additional evidence to support the hypothesis that inhibiting PTP
increases the tyrosine phosphorylation of ROMK1 channels and stimulates
the endocytosis of ROMK1.
Construction of GFP-ROMK and c-Src--
We used primers 5'
TGGGCCTAAAAGAATTCAGCTGCTGTGCAGACAAC (sense, nucleotides 81-115) and 5'
TTGTAGGTGGAAGGATCCCTGCTACATCTGGGTGTCG (antisense, nucleotides
1310-1346) for amplifying ROMK1 or mutant ROMK1, which was subcloned
into pcDNA3.1. GFP-ROMK1 or GFP-R1Y337A was constructed by cloning the
PCR products into the EcoRI and BamHI sites of
plasmid-enhanced GFP-C1 expression vector
(CLONTECH, Palo Alto, CA). The coding sequence of
c-Src was cut from pGEM vector with HindIII and
EcoRI and ligated into pCDNA3.1 expression vector
(Invitrogen). All vector sequences were confirmed by automated DNA sequencing at the William Keck Biotechnology Laboratory at Yale
University. dynaminK44A was a gift from Dr. Michael Caplan at Yale University.
Transfection of HEK293 Cells and Confocal
Microscopy--
Transient transfection of HEK293 cells (American Type
Culture Collection, Manassas, VA) was carried out using 3 µl
of LT1 reagent (PanVera, Madison, WI) per 35-mm cell culture dish
according to the manufacturer's instructions. The cells were
transfected with 1 µg of ROMK1+ 1 µg of c-Src, 1 µg of R1Y337A + 1 µg of c-Src, or 1 µg of ROMK1 + 1 µg of c-Src + 3 µg of
dynaminK44A. The success rate of transient transfection was over 70%,
and the experiments were carried out 48 h after transfection.
After identifying the cells for the study, we recorded cell images of
middle sections under control conditions and after PAO treatment using
a Bio-Rad MRC1000 confocal microscope. GFP fluorescence was excited at
488 nM with an argon laser beam and viewed with an inverted
Olympus microscope equipped with a ×60 oil lens. The cell image taken under control conditions served as a control picture. All images were
acquired, processed, and printed with identical parameters before and
after PAO treatment.
Biotinylation, Immunoprecipitation, and Western Blot
Analysis--
The change in cell surface ROMK1 upon treatment of the
cells with PAO was quantitated by labeling the cells with
sulfo-NHS-SS-biotin (Pierce) according to the instructions
provided by the manufacturer. HEK cells from each 35-mm dish were
trypsinized with trypsin-EDTA (Fisher) and lysed with 200 µl of cold
RIPA lysis buffer (1× PBS, 1% Igepal CA-630 (Sigma), 0.1% SDS)
containing 0.5% deoxycholate, 1 mM sodium molybdate, 1 mM sodium fluoride, 1 µM phenylmethylsulfonyl fluoride and 100 µl of protease inhibitor mixture (Sigma) per ml of
lysis buffer. The mixture was clarified at 14,000 rpm for 10 min at
4 °C, and the resultant supernatant was collected. GFP-ROMK1 fusion
protein was immunoprecipitated by incubating the resultant supernatant
with 1 µg of GFP monoclonal antibody
(CLONTECH, Palo Alto, CA) for 2 h at
4 °C. Protein A/G (20 µl)-agarose (Santa Cruz Biotechnology) was
added to the tube containing the mixture, and the tube was rotated
overnight at 4 °C. The protein A/G-agarose immune complex was
collected by centrifugation at 14,000 rpm for 2 min and washed twice
with 1× PBS containing protease/phosphatase inhibitors. After
centrifugation, 1× SDS (50 µl) sample buffer (2% SDS, 60 mm
Tris-HCl (pH 6.8), 20% glycerol, 10% 2 mercaptoethanol, 0.05%
bromphenol blue) was added to the resultant pellet followed by boiling
the mixture for 5 min. Protein concentrations were determined using the
Bio-Rad protein assay kit. The proteins were separated by SDS-PAGE and
transferred to polyvinylidene difluoride membrane (Bio-Rad). The
biotin-labeled GFP-ROMK1 proteins were detected by using NeutrAvidin
(horseradish peroxidase-conjugated) (Pierce). ROMK1 or ROMK1 mutant
protein was detected by using a polyclonal ROMK1 antibody (1:200;
Alomone Laboratories, Ltd., Jerusalem, Israel) followed by anti-rabbit
horseradish peroxidase (1:15,000; Amersham Biosciences, Inc.). The
tyrosine-phosphorylated proteins were detected using PY20, an antibody
that reacts with tyrosine-phosphorylated proteins (Upstate
Biotechnology, Lake Placid, NY).
We also studied the endocytosis of ROMK1 following the protocol
described by Collazo et al. (10). HEK cells were labeled with sulfo-NHS-SS-biotin (Pierce) followed by treatment of cells with 1 µM PAO for 15 min at 37 °C to stimulate endocytosis.
The cells were washed two times with PBS, and the surface biotin was cleaved with the cell-impermeant reducing agent, TCEP (Tris
[2-carboxyethyl] phosphine
hydrochloride) (50 mM). The internalized proteins labeled by biotin were protected from TCEP cleavage. After washing two times
with PBS, the cells were lysed with RIPA lysis buffer containing protease inhibitors. The lysate was treated as detailed above.
Patch Clamp Technique--
An Axon200A patch clamp amplifier was
used to record channel current. The current was low pass-filtered at 1 KHz by an eight-pole Bessel filter (902LPF; Frequency Devices,
Haverhill, MA) and digitized by an Axon interface (Digitada1200). Data
were acquired by an IBM-compatible Pentium computer (Gateway 2000) at a
rate of 4 KHz and analyzed using the pClamp software system 6.04 (Axon
Instruments, Burlingame, CA). Channel activity was defined as
NPo that was calculated from data samples of 60-s duration
in the steady state as shown in Equation 1,
Experimental Solution and Statistics--
The bath solution for
the patch clamp study was composed of the following (in
mM): 140 NaCl, 5 KCl, 1.8 MgCl2, 1.8 CaCl2, and 10 HEPES (pH 7.4). The pipette solution was
composed of the following (in mM): 140 mM KCl,
1.8 MgCl2, and 10 Hepes (pH 7.4). Phenylarsine oxide was
purchased from Sigma and added directly to the bath to reach the final
concentration. We present data as mean ± S.E. The student's
t test was used to determine the significance.
We first examined the properties of the GFP-ROMK fusion
protein using Western blot and the patch clamp technique. Fig.
1 is a typical Western blot showing that ROMK
antibody detects a 71-kDa protein harvested from the
immunoprecipitation of the lysate of cells transfected with GFP-ROMK1
with GFP antibody. Moreover, we had previously carried out the patch
clamp study in oocytes injected with cRNA encoding GFP-ROMK1 and
detected an inward-rectifying K+ channel with an inward
conductance of 40 picosiemens (1). This finding is also
confirmed in the present investigation in which we have detected an
inward-rectifying K+ channel with an inward slope conductance
of 40 picosiemens in HEK293 cells transfected with GFP-ROMK1 (data not
shown). The K+ channel has a high open probability and similar
channel kinetics to that of ROMK1.
After confirming that GFP-ROMK1 has the same biophysical properties as
those of ROMK1, we examined the effect of PAO on the activity of ROMK1
in HEK293 cells transfected with GFP-ROMK1 and c-Src. Fig.
2 is a typical recording showing that
addition of 1 µM PAO inhibits the activity of ROMK1 by
95 ± 9%, and NPo falls from 0.93 to 0.04 (n = 4). This observation is consistent with our
previous finding that inhibiting PTP decreased the activity of the
native ROMK1-like channels in the CCD (9). Moreover, we have
demonstrated previously that the inhibitory effect of PAO was absent in
the CCDs treated with hypertonic solution, indicating that the effect
of PAO on channel activity was mediated by stimulation of endocytosis
(9). This hypothesis was further investigated using confocal
microscopy. Fig. 3 depicts typical confocal
images obtained from HEK293 cells transfected with GFP-ROMK1 + vector (A-D) or ROMK1 + c-Src (E-H). Application of
PAO had no significant effect on the location of ROMK1 in the cells
transfected with vector (Fig. 3, A-D). In contrast,
addition of PAO altered the location of ROMK1 in the cells transfected
with c-Src. From inspection of Fig. 3, E-H, it is apparent
that the membrane location of ROMK1 diminished whereas the density of
ROMK1 in the intracellular compartment increased significantly within
15 min following PAO treatment. This strongly indicates that inhibiting
PTP stimulates the endocytosis of ROMK1 in cells transfected with
c-Src and GFP-ROMK1.
Inhibition of Protein-tyrosine Phosphatase Stimulates
the Dynamin-dependent Endocytosis of ROMK1*
,,,
Department of Pharmacology, New York
Medical College, Valhalla, New York 10595 and the
§ Department of Cellular and Molecular Physiology, Yale
University School of Medicine, New Haven, Connecticut 06510
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
where ti is the fractional open time spent at each
of the observed current levels.
(Eq. 1)
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (54K):
[in a new window]
Fig. 1.
A Western blot showing that both GFP antibody
(left panel) and ROMK antibody (right
panel) detect a 71-kDa protein harvested by
immunoprecipitation (IP) of the lysate of HEK293 cells
transfected with GFP-ROMK1. IB,
immunoblotting.
View larger version (35K):
[in a new window]
Fig. 2.
A channel recording shows the effect of
1 µM PAO on the activity of ROMK1
in HEK293 cells transfected with GFP-ROMK1 and c-Src. The
top trace shows the time course of the experiment, and two
parts of the data indicated by numbers are expanded to demonstrate the
fast time resolution. The pipette holding potential was 0 mV, and the
experiment was performed in a cell-attached patch. The channel closed
level is indicated by C.
View larger version (105K):
[in a new window]
Fig. 3.
A typical confocal image showing the effect
of PAO on the ROMK1 location in HEK293 cells transfected with GFP-ROMK1
alone (A-D) or with GFP-ROMK1 + c-Src
(E-H). The magnification of the picture is
×600, and the length of the bar represents 10 µm. The
cell image before addition of PAO is demonstrated in A
whereas B, C, and D show the ROMK1
location following addition of 1 µM PAO at 5, 10, and 15 min, respectively. E shows the cell image under control
conditions in cells transfected with GFP-ROMK1 and c-Src. F,
G, and H demonstrate the changes in ROMK1
location following addition of PAO at 5, 10, and 15 min, respectively.
Arrows indicate the cells in which a clear relocation of
ROMK1 has been observed.
To further confirm that PAO enhanced the endocytosis of ROMK1, we used
the biotin labeling technique to study the effect of PAO on ROMK1
membrane location. The cells were treated with PAO or vehicle at
37 °C for 15 min followed by labeling the surface proteins with
biotin at 4 °C. The ROMK1 channels were harvested by
immunoprecipitation of the cell lysate with GFP antibody and detected
by the ROMK antibody whereas the biotin-labeled ROMK1 channels were
identified with neutravidin (Fig.
4A). Clearly, treatment of cells
with 1 µM PAO significantly reduced the number of the
biotin-labeled ROMK1. In 11 experiments, the density of biotin-labeled
ROMK1 channels decreased by 65 ± 3% in the cells treated with
PAO in comparison to those without PAO. This strongly indicates that
inhibiting PTP facilitates the internalization of ROMK1. This
hypothesis is also supported by experiments in which the effect of PAO
on ROMK1 membrane location was studied using sulfo-NHS-SS-biotin. After
labeling the surface proteins with biotin, the cells were treated with
PAO for 15 min at 37 °C to stimulate endocytosis and then incubated
with TCEP, a reducing agent, to cleave the surface biotin (Fig.
4B). Thus, only internalized ROMK1 channels were labeled
with biotin whereas the ROMK1 channels located in the cell membrane did
not bear biotin. From inspection of Fig. 4B, it is apparent
that inhibiting PTP significantly increased the internalization of
ROMK1 channels. The amount of biotin-labeled ROMK1 in the PAO-treated
group was 75 ± 9% (n = 4) of the control (no
TCEP and PAO treatment) whereas the amount of the biotin-labeled ROMK1
in the absence of PAO was only 20 ± 4% (n = 4)
of the control value.
|
Inhibiting PTP is expected to enhance the tyrosine phosphorylation of
ROMK1, which has been shown to be a substrate of
c-Src.2 Therefore, we examined
the effect of PAO on the tyrosine phosphorylation of ROMK1 in cells
transfected with GFP-ROMK1 and c-Src. After immunoprecipitation of
ROMK1 with the GFP antibody, we detected the tyrosine phosphorylated
ROMK1 with PY20, an antibody that reacts with tyrosine-phosphorylated
proteins. Fig. 5 is a typical recording from
10 such experiments in which the effect of inhibiting PTP on the
tyrosine phosphorylation of ROMK1 was studied. Although the same amount
of ROMK1 was present in the cells treated or not treated with PAO,
inhibiting PTP significantly increased the fraction of the
tyrosine-phosphorylated ROMK1 by 110 ± 8% in comparison to those
without PAO treatment. Therefore, the data strongly suggest that PAO
increases the tyrosine phosphorylation of ROMK1 and in turn stimulates
the internalization of ROMK1.
|
Our previous experiments indicated that the tyrosine residue 337 in the
C terminus was critical for mediating c-Src-induced phosphorylation.2 Moreover, the observation that mutation
of the tyrosine residue to alanine abolished the inhibitory effect of
PAO on K+ current in oocytes injected with R1Y337A and c-Src
suggested that tyrosine residue 337 is essential for initiating
PAO-induced endocytosis (1). To further test this hypothesis, we
investigated the effect of PAO on the membrane location of ROMK1
mutant, R1Y337A. Fig. 6 is a typical confocal
image from eight such experiments showing the effect of PAO on the
distribution of R1Y337A in HEK293 cells cotransfected with c-Src and
R1Y337A. In contrast to ROMK1, addition of PAO did not change the
pattern of R1Y337A distribution, and the intensity of membrane
fluorescence was not significantly altered in the presence of PAO. The
possibility that tyrosine residue 337 is essential for facilitating the
endocytosis of ROMK1 is also supported by experiments in which the
effect of PAO on the membrane density of ROMK1 or R1Y337A was studied
using the biotin labeling technique (Fig. 7).
The cells transfected with c-Src + ROMK1 or c-Src + R1Y337A were
incubated in the presence or in the absence of PAO at 37 °C for 15 min followed by biotin labeling at 4 °C. Similar to the results
shown in Fig. 4, inhibiting PTP significantly diminished the amount of
ROMK1 located in the cell membrane as shown by the fact that the
intensity of the biotin-labeled ROMK1 decreased by 65 ± 3% in
comparison to those in the absence of PAO, although the same amount of
ROMK1 was present in cells treated or not treated with PAO. In
contrast, PAO did not significantly reduce the number of R1Y337A in the
cell membrane (95 ± 9% of the control value) in comparison to
those in the absence of PAO in cells transfected with c-Src and
R1Y337A.
|
|
After establishing that inhibiting PTP increases the endocytosis of
ROMK1 and that tyrosine residue 337 plays a key role in mediating the
effect of PAO, we expanded the study to determine whether the effect of
inhibiting PTP requires the involvement of dynamin. We first
cotransfected the HEK293 cells with dominant negative dynamin
(dynaminK44A), c-Src, and ROMK1 and found that the cells expressing
ROMK1 also successfully expressed c-Src and dynaminK44A (Fig.
8). The effect of PAO on the ROMK1
distribution has also been studied using confocal microscopy and biotin
labeling techniques. Fig. 9 is a typical
confocal image demonstrating the effect of PAO on ROMK1 distribution in
the cells transfected with GFP-ROMK1, c-Src, and dynaminK44A at a ratio
of 1:1:3. It is apparent that PAO-induced internalization of ROMK1 is
absent in the cells transfected with dynaminK44A (n = 7). The possibility that dynamin is required for the PAO-induced
endocytosis of ROMK1 is also supported by the observation that PAO did
not significantly decrease the number of ROMK1 in the membrane of cells
transfected with dynaminK44A (Fig. 10). In
10 experiments we have observed that inhibiting PTP reduced the amount
of the biotin-labeled ROMK1 by 10 ± 8% in comparison to those
without PAO treatment in cells transfected with dynaminK44A. The
difference is not significant. Therefore, this indicates that inhibiting PTP-induced endocytosis of ROMK1 requires the involvement of
dynamin.
|
|
|
| |
DISCUSSION |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
The main finding of the present investigation is that inhibiting PTP increases the internalization of ROMK1 and that the endocytosis of ROMK1 is a dynamin-dependent process. We used PAO as a tool to study the effect of tyrosine phosphorylation on ROMK1. Although it is possible that PAO may have effects other than inhibiting PTP, three lines of evidence indicated that the effect of PAO on channel activity results from inhibiting PTP-induced tyrosine phosphorylation. First, our present study shows that PAO treatment increased the tyrosine phosphorylation of ROMK1. Second, mutation of tyrosine residue 337 of ROMK1 to alanine abolished the effect of PAO on ROMK1 channel distribution. This finding is consistent with our previous observation that PAO did not affect channel activity in oocytes injected with R1Y337A (1). Third, our previous investigation has shown that inhibiting PTK can also abolish the effect of PAO on the activity of ROMK1 (1).
ROMK1 is an inwardly rectifying K+ channel that is located in the apical membrane of the CCD (3, 5, 6). The CCD is responsible for K+ secretion and the hormone-regulated sodium reabsorption (7, 12). The K+ secretion is a two-step process; K+ enters the cell via the basolateral Na+-K+-ATPase and then diffuses into the lumen across the apical K+ channels (7). Two types of K+ channels, an SK channel and a Ca2+-activated large conductance K+ channel (13-18), have been identified in the apical membrane. The SK channel is mainly responsible for K+ secretion, because the SK channel has a high density and a high channel open probability (4). Although it is still not completely understood whether ROMK1 alone is sufficient to form the native SK channel, it is well established that ROMK1 is a key component of the native SK channel in the CCD (4). Therefore, ROMK1 plays a key role in regulating K+ secretion in the kidney.
K+ secretion is regulated by hormones such as aldosterone and by a dietary K+ intake (7, 12). The stimulatory effect of aldosterone on K+ secretion may be mediated by increasing the driving force for K+ diffusion across the apical membrane rather than altering the K+ conductance (19). This view is supported by the observation that application of aldosterone alone did not increase the number of the functional SK channels in the CCD (20). The effect of the dietary K+ intake on K+ secretion is well established; a low K+ intake decreases whereas a high K+ intake increases K+ secretion in the CCD (7, 12).
The effect of the dietary K+ intake on K+ secretion is at least in part achieved by changing the number of apical SK channels. For instance, we and others (14, 20) have observed that the number of ROMK1 channels increased in the CCD harvested from rats on a high K+ diet. Moreover, the effect of a high K+ intake on ROMK1 channels was not mediated by increasing transcription or translation, because neither ROMK mRNA nor ROMK protein in the kidney harvested from rats on a high K+ diet was changed in comparison to those on a normal K+ diet (21). This indicates that post-translation factors are involved in regulating the effect of the dietary K+ intake on K+ secretion. However, the nature of the factors responsible for mediating the effect of the K+ intake on ROMK1 is not completely understood.
We have observed previously that a low K+ intake increases whereas a high K+ intake decreases the expression of c-Src and cYes PTK in the kidneys (8), suggesting the role of PTK in mediating the effect of dietary K+ intake on K+ secretion. This notion is further supported by observations that inhibiting PTK increased the number of functional ROMK1 channels in the CCD obtained from rats on a K+-deficient diet (8, 22). In contrast, inhibiting PTP decreased the number of ROMK1 channels in the tubule from rats on a high K+ diet (9). Moreover, a low K+ intake increases the PTK-sensitive recycling pool of ROMK1 channels (8). Therefore, tyrosine phosphorylation or dephosphorylation of ROMK1 is an important mechanism by which a dietary K+ intake changes the ROMK1 density in the cell membrane. It is highly possible that an increase in tyrosine phosphorylation of ROMK1 diminishes whereas a decrease in tyrosine phosphorylation of ROMK1 augments the number of the ROMK1 channels in the cell membrane. This hypothesis has been supported by the preceding findings that PAO inhibits whereas herbimycin A increases the K+ current in oocytes injected with ROMK1 and c-Src (1).
Four lines of evidence obtained from the previous and the present investigations strongly suggest that the inhibitory effect of PTK on ROMK1 channels is mediated by increasing the internalization of ROMK1 rather than by a direct inhibition induced by tyrosine phosphorylation. First, we have previously shown that addition of exogenous c-Src to the bath facing cytosolic membrane of inside-out patches did not block the channel activity (1). Second, previous investigations have found that the inhibitory effect of PAO on K+ current in oocytes injected with ROMK1 and c-Src was abolished by hypertonic solution or concanavalin A (1, 9); both maneuvers have been shown to block the endocytosis of the membrane proteins (23, 24). Third, we have previously used GFP-ROMK1 as a tool to demonstrate that PAO decreases whereas herbimycin A increases the fluorescence intensity of the membrane in oocytes injected with c-Src and GFP-ROMK1 (1). This observation has also been confirmed by the present finding that inhibiting PTP decreased the number of ROMK1 in the membrane of HEK cells using confocal microscopy and the biotin labeling technique. Finally, we have shown in the present study that the effect of PAO on the ROMK1 surface distribution was absent in the cells transfected with dominant negative dynamin.
Dynamin has been shown to be involved in clathrin-mediated vesicular
trafficking processes (25) and endocytosis of a variety of proteins
such as GLUT 4 (26, 27) and glutamate receptor (28). In the kidney,
dynamin is required for initiating endocytosis of epithelial sodium
channels (29) and Na+/H+ exchanger (10). It has
been shown that dynamin is a substrate of PTK, and phosphorylation of
dynamin is essential for inducing the internalization of
2-adrenergic receptor (30, 31). We need further experiments to
determine whether dynamin phosphorylation is required for inducing the
endocytosis of ROMK1. However, the observation that expression of
dynaminK44A abolished the effect of PAO on the internalization of ROMK1
channels strongly indicates that endocytosis of ROMK1 requires dynamin.
In the present study we have demonstrated that the tyrosine phosphorylation of ROMK1 is an important step for initiating the endocytosis of ROMK1, because mutation of tyrosine residue 337 of ROMK1 completely abolished the PAO-induced stimulation of ROMK1 endocytosis. We have previously demonstrated that ROMK1 is a substrate of c-Src, and tyrosine residue 337 is the main site of PTK-induced tyrosine phosphorylation (11). However, it is possible that phosphorylation of tyrosine residue is not the only requirement for initiating the endocytosis of ROMK1. This conclusion is based on our observation that PAO did not inhibit the activity of ROMK2 channels in oocytes.3 Moreover, inhibiting PTP did not inhibit the ROMK-like K+ channels in the thick ascending limb (11) where ROMK2 is located. This indicates that the N terminus of ROMK1 may also be required for starting the endocytosis. We need further experiments to explore the role of the N terminus in inducing the endocytosis of ROMK1.
The physiological significance of the present investigation is to
define a mechanism by which a low K+ intake decreases the
apical K+ conductance and K+ secretion. We have
demonstrated previously that the amount of tyrosine-phosphorylated ROMK
channels was significantly larger in the kidney from rats on a
K+-deficient diet than those on a high K+ diet (11).
This finding may be used to explain the observation that the positive
response of ROMK1-like K+ channels in the CCD to herbimycin A
was over 80% in the CCD from rats on a K+-deficient diet. In
contrast, the response of the K+ channel to PTK inhibitor was
absent in the CCD from rats on a high K+ diet (8). Fig.
11 is a model of a CCD principal cell
illustrating the mechanism by which low K+ intake decreases the
apical SK channels. A low K+ intake increases the expression
and activity of PTK and in turn enhances the tyrosine phosphorylation
of ROMK1. As a consequence of tyrosine phosphorylation of ROMK1, the
K+ channel is internalized, and the apical K+
conductance falls.
|
We conclude that inhibiting PTP increases the tyrosine phosphorylation
of ROMK1 and enhances the dynamin-dependent endocytosis and
that tyrosine residue 337 of ROMK1 is essential for the effect of
inhibiting PTP.
| |
ACKNOWLEDGEMENT |
|---|
We thank Melody Steinberg for helping in the preparation of the manuscript.
| |
FOOTNOTES |
|---|
* The work was supported in part by National Institutes of Health Grants DK 47402 and DK 54983.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
¶ Supported by National Institutes of Health Grant DK 54999.
To whom correspondence should be addressed: Dept. of
Pharmacology, New York Medical College, BSB Rm. 537, Valhalla, NY
10595. Tel.: 914-594-4120; Fax: 914-347-4956; E-mail:
wenhui_wang@nymc.edu.
Published, JBC Papers in Press, November 21, 2001, DOI 10.1074/jbc.M109739200
2 Lin, D. H., Sterling, H., Lerea, K. M., Welling, P., Jin, L., Giebisch, G., and Wang, W. H. (2001) J. Am. Soc. Nephrol. 12, 28.
3 Unpublished observation.
| |
ABBREVIATIONS |
|---|
The abbreviations used are: ROMK, renal outer medullary potassium channel; CCD, cortical collecting duct; SK, small conductance K; PTK, protein-tyrosine kinase; PTP, protein-tyrosine phosphatase; PAO, phenylarsine oxide; GFP, green fluorescent protein; HEK, human embryonic kidney; PBS, phosphate-buffered saline.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. |
Moral, Z.,
Deng, K.,
Wei, Y.,
Sterling, H.,
Deng, H.,
Ali, S., Gu, R. M.,
Huang, X. Y.,
Hebert, S. C.,
Giebisch, G.,
and Wang, W. H.
(2001)
J. Biol. Chem.
276,
7156-7163 |
| 2. |
Boim, M. A., Ho, K.,
Schuck, M. E.,
Bienkowski, M. J.,
Block, J. H.,
Slightom, J. L.,
Yang, Y.,
Brenner, B. M.,
and Hebert, S. C.
(1995)
Am. J. Physiol.
268,
F1132-F1140 |
| 3. | Ho, K., Nichols, C. G., Lederer, W. J., Lytton, J., Vassilev, P. M., Kanazirska, M. V., and Hebert, S. C. (1993) Nature 362, 31-38[CrossRef][Medline] [Order article via Infotrieve] |
| 4. | Wang, W. H., Hebert, S. C., and Giebisch, G. (1997) Annu. Rev. Physiol. 59, 413-436[CrossRef][Medline] [Order article via Infotrieve] |
| 5. | Xu, J. Z., Hall, A. E., Peterson, L. N., Bienkowski, M. J., Eessalu, T. E., and Hebert, S. C. (1997) Am. J. Physiol. Renal Physiol. 273, F739-F748 |
| 6. | Mennitt, P. A., Wade, J. B., Ecelbarger, C. A., Palmer, L. G., and Frindt, G. (1997) J. Am. Soc. Nephrol. 8, 1823-1830[Abstract] |
| 7. |
Giebisch, G.
(1998)
Am. J. Physiol. Renal Physiol.
274,
F817-F833 |
| 8. |
Wei, Y.,
Bloom, P.,
Lin, D. H., Gu, R. M.,
and Wang, W. H.
(2001)
Am. J. Physiol. Renal Physiol.
281,
F206-F212 |
| 9. |
Wei, Y.,
Bloom, P., Gu, R. M.,
and Wang, W. H.
(2000)
J. Biol. Chem.
275,
20502-20507 |
| 10. |
Collazo, R.,
Fan, L., Hu, M. C.,
Zhao, H.,
Wiederkehr, M. R.,
and Moe, O. W.
(2000)
J. Biol. Chem.
275,
31601-31608 |
| 11. |
Gu, R. M.,
Wei, Y.,
Falck, J. R.,
Krishna, U. M.,
and Wang, W. H.
(2001)
Am. J. Physiol. Cell. Physiol.
281,
C1188-C1195 |
| 12. |
Palmer, L. G.
(1999)
Am. J. Physiol. Renal Physiol.
277,
F821-F825 |
| 13. |
Frindt, G.,
and Palmer, L. G.
(1989)
Am. J. Physiol. Renal Physiol.
256,
F143-F151 |
| 14. |
Wang, W.,
Schwab, A.,
and Giebisch, G.
(1990)
Am. J. Physiol. Renal Physiol.
259,
F494-F502 |
| 15. |
Satlin, L. M.,
and Palmer, L. G.
(1997)
Am. J. Physiol. Renal Physiol.
272,
F397-F404 |
| 16. | Schlatter, E., Lohrmann, E., and Greger, R. (1992) Pflugers Arch. 420, 39-45[CrossRef][Medline] [Order article via Infotrieve] |
| 17. |
Hunter, M.,
Lopes, A. G.,
Boulpaep, E. L.,
and Giebisch, G.
(1984)
Proc. Natl. Acad. Sci. U. S. A.
81,
4237-4239 |
| 18. |
Frindt, G.,
and Palmer, L. G.
(1987)
Am. J. Physiol. Renal Physiol.
252,
F458-F467 |
| 19. |
Schafer, J. A.,
Troutman, S. L.,
and Schlatter, E.
(1990)
Am. J. Physiol. Renal Physiol.
258,
F199-F210 |
| 20. | Palmer, L. G., Antonian, L., and Frindt, G. (1994) J. Gen. Physiol. 105, 693-710 |
| 21. |
Frindt, G.,
Zhou, H.,
Sackin, H.,
and Palmer, L. G.
(1998)
Am. J. Physiol. Renal Physiol.
274,
F525-F531 |
| 22. |
Wang, W. H.,
Lerea, K. M.,
Chan, M.,
and Giebisch, G.
(2000)
Am. J. Physiol. Renal Physiol.
278,
F165-F171 |
| 23. |
Luttrell, L. M.,
Daaka, Y.,
Della-Rocca, G. J.,
and Lefkowitz, R. J.
(1997)
J. Biol. Chem.
272,
31648-31656 |
| 24. |
Beaumont, V.,
Hepworth, M. B.,
Luty, J. S.,
Kelly, E.,
and Henderson, G.
(1998)
J. Biol. Chem.
273,
33174-33183 |
| 25. | Marks, B., Stowell, M. H., Vallis, Y., Mills, I. G., Gibson, A., Hopkins, C. R., and McMahon, H. T. (2001) Nature 410, 231-235[CrossRef][Medline] [Order article via Infotrieve] |
| 26. |
Kao, A. W.,
Ceresa, B. P.,
Santeler, S. R.,
and Pessin, J. E.
(1998)
J. Biol. Chem.
273,
25450-25457 |
| 27. |
Al-Hasani, H.,
Hinck, C. S.,
and Cushman, S. W.
(1998)
J. Biol. Chem.
273,
17504-17510 |
| 28. |
Carroll, R. C.,
Beattie, E. C.,
Xia, H.,
Luescher, C.,
Altschuler, Y.,
Nicoll, R. A.,
Malenka, R. C.,
and von Zastrow, M.
(1999)
Proc. Natl. Acad. Sci.
96,
14112-14117 |
| 29. |
Shimkets, R. A.,
Lifton, R. P.,
and Canessa, C. M.
(1997)
J. Biol. Chem.
272,
25537-25541 |
| 30. |
Foster-Barber, A.,
and Bishop, M.
(1998)
Proc. Natl. Acad. Sci.
95,
4673-4677 |
| 31. |
Miller, W. E.,
Maudsley, S.,
Ahn, S.,
Khan, K. D.,
Luttrell, L. M.,
and Lefkowitz, R. J.
(2000)
J. Biol. Chem.
275,
11312-11319 |
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  D. Lin, E.-J. Kamsteeg, Y. Zhang, Y. Jin, H. Sterling, P. Yue, M. Roos, A. Duffield, J. Spencer, M. Caplan, et al. Expression of Tetraspan Protein CD63 Activates Protein-tyrosine Kinase (PTK) and Enhances the PTK-induced Inhibition of ROMK Channels J. Biol. Chem., March 21, 2008; 283(12): 7674 - 7681. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Babilonia, D. Lin, Y. Zhang, Y. Wei, P. Yue, and W.-H. Wang Role of gp91phox-Containing NADPH Oxidase in Mediating the Effect of K Restriction on ROMK Channels and Renal K Excretion J. Am. Soc. Nephrol., July 1, 2007; 18(7): 2037 - 2045. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Wei, Z. Wang, E. Babilonia, H. Sterling, P. Sun, and W. Wang Effect of hydrogen peroxide on ROMK channels in the cortical collecting duct Am J Physiol Renal Physiol, April 1, 2007; 292(4): F1151 - F1156. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Li, Z. Wang, P. Sun, Y. Jin, D.-H. Lin, S. C. Hebert, G. Giebisch, and W.-H. Wang Inhibition of MAPK stimulates the Ca2+-dependent big-conductance K channels in cortical collecting duct PNAS, December 19, 2006; 103(51): 19569 - 19574. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Babilonia, D. Li, Z. Wang, P. Sun, D.-H. Lin, Y. Jin, and W.-H. Wang Mitogen-Activated Protein Kinases Inhibit the ROMK (Kir 1.1)-Like Small Conductance K Channels in the Cortical Collecting Duct J. Am. Soc. Nephrol., October 1, 2006; 17(10): 2687 - 2696. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Mitola, B. Brenchio, M. Piccinini, L. Tertoolen, L. Zammataro, G. Breier, M. T. Rinaudo, J. den Hertog, M. Arese, and F. Bussolino Type I Collagen Limits VEGFR-2 Signaling by a SHP2 Protein-Tyrosine Phosphatase-Dependent Mechanism 1 Circ. Res., January 6, 2006; 98(1): 45 - 54. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W.-H. Wang Regulation of ROMK (Kir1.1) channels: new mechanisms and aspects Am J Physiol Renal Physiol, January 1, 2006; 290(1): F14 - F19. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Wei, E. Babilonia, H. Sterling, Y. Jin, and W.-H. Wang Mineralocorticoids decrease the activity of the apical small-conductance K channel in the cortical collecting duct Am J Physiol Renal Physiol, November 1, 2005; 289(5): F1065 - F1071. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Yoo, L. Fang, A. Mason, B.-Y. Kim, and P. A. Welling A Phosphorylation-dependent Export Structure in ROMK (Kir 1.1) Channel Overrides an Endoplasmic Reticulum Localization Signal J. Biol. Chem., October 21, 2005; 280(42): 35281 - 35289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-H. Cho, W. Song, K. Leitzell, E. Teo, A. D. Meleth, M. W. Quick, and R. A. J. Lester Rapid Upregulation of {alpha}7 Nicotinic Acetylcholine Receptors by Tyrosine Dephosphorylation J. Neurosci., April 6, 2005; 25(14): 3712 - 3723. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D.-H. Lin, H. Sterling, and W.-H. Wang The Protein Tyrosine Kinase-Dependent Pathway Mediates the Effect of K Intake on Renal K Secretion Physiology, April 1, 2005; 20(2): 140 - 146. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Babilonia, Y. Wei, H. Sterling, P. Kaminski, M. Wolin, and W.-H. Wang Superoxide Anions Are Involved in Mediating the Effect of Low K Intake on c-Src Expression and Renal K Secretion in the Cortical Collecting Duct J. Biol. Chem., March 18, 2005; 280(11): 10790 - 10796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Nesti, B. Everill, and A. D. Morielli Endocytosis as a Mechanism for Tyrosine Kinase-dependent Suppression of a Voltage-gated Potassium Channel Mol. Biol. Cell, September 1, 2004; 15(9): 4073 - 4088. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Sterling, D.-H. Lin, Y.-J. Chen, Y. Wei, Z.-J. Wang, J. Lai, and W.-H. Wang PKC expression is regulated by dietary K intake and mediates internalization of SK channels in the CCD Am J Physiol Renal Physiol, June 1, 2004; 286(6): F1072 - F1078. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D.-H. Lin, H. Sterling, B. Yang, S. C. Hebert, G. Giebisch, and W.-H. Wang Protein tyrosine kinase is expressed and regulates ROMK1 location in the cortical collecting duct Am J Physiol Renal Physiol, May 1, 2004; 286(5): F881 - F892. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Sterling, D.-H. Lin, Y. Wei, and W.-H. Wang Tetanus toxin abolishes exocytosis of ROMK1 induced by inhibition of protein tyrosine kinase Am J Physiol Renal Physiol, March 1, 2003; 284(3): F510 - F517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Lin, H. Sterling, K. M. Lerea, G. Giebisch, and W.-H. Wang Protein Kinase C (PKC)-induced Phosphorylation of ROMK1 Is Essential for the Surface Expression of ROMK1 Channels J. Biol. Chem., November 8, 2002; 277(46): 44278 - 44284. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Storey, D. Latchman, and S. Bevan Selective internalization of sodium channels in rat dorsal root ganglion neurons infected with herpes simplex virus-1 J. Cell Biol., September 29, 2002; 158(7): 1251 - 1262. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Luan Tyrosine phosphorylation in plant cell signaling PNAS, September 3, 2002; 99(18): 11567 - 11569. [Full Text] [PDF]
|
|
|
|
|
|
E. A. C. MacRobbie From the Cover: Evidence for a role for protein tyrosine phosphatase in the control of ion release from the guard cell vacuole in stomatal closure PNAS, September 3, 2002; 99(18): 11963 - 11968. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A.-A. Konstas, J.-P. Koch, S. J. Tucker, and C. Korbmacher Cystic Fibrosis Transmembrane Conductance Regulator-dependent Up-regulation of Kir1.1 (ROMK) Renal K+ Channels by the Epithelial Sodium Channel J. Biol. Chem., July 5, 2002; 277(28): 25377 - 25384. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |