|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 7, 5040-5046, February 15, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Norris Comprehensive Cancer Center, Departments of
Pathology, Biochemistry & Molecular Biology, Molecular Microbiology
& Immunology, and Biological Sciences, University of Southern
California, Keck School of Medicine, Los Angeles, California
90089-9176
Received for publication, October 10, 2001, and in revised form, November 19, 2001
The human immunoglobulin heavy chain locus
contains 39 functional human VH elements. All 39 VH elements (with their adjacent heptamer/nonamer signal)
were tested for site-specific cleavage with purified human core RAG1
and RAG2, and HMG1 proteins in a 12/23-coupled cleavage reaction. Both
nicking and hairpin formation were measured. The individual
VH cleavage efficiencies vary over nearly a 30-fold range.
These measurements will be useful in considering the factors affecting
the generation of the immunoglobulin and T-cell receptor repertoires in
the adult humans. Interestingly, when these cleavage efficiencies are
summed for each of the VH families, the six VH
family efficiencies correspond closely to the observed profile of
unselected VH family usage in the peripheral B cells of
normal adult humans. This correspondence raises the possibility that
the dominant factor determining VH element utilization within the 1-megabase human genomic VH array is simply the
individual RAG cleavage efficiencies.
The antigen receptor repertoire is a composite of many factors
(1-3). One major factor is the efficiency with which the V, D, and J
elements are cleaved by the recombinase complex. This complex contains
RAG1 and RAG2 proteins (recombination activating genes), along with
HMG1 (or HMG2). The RAG complex binds to the heptamer/nonamer signal
sequences (also called RSS1
for recombination signal sequences) associated with each V, D, or J
element. The RAG complex makes an initial nick adjacent to the heptamer
of each signal and then generates a hairpin configuration at that site
at the coding end terminus of the V, D, or J element (4). The hairpin
formation at the coding end results in a blunt-ended double-strand
break at the end of the signal (4). A single recombination event
involves two elements, such as a V and a J, or a D and a J, or a V and
a DJ. The two elements always have recombination signal sequences (RSS)
that are different in the spacing between their heptamer and nonamer
(12 or 23 base pairs), and this is known as the 12/23 rule (5). The
12/23 rule is enforced at the hairpin formation step by the RAG complex
(6-8). The two coding ends (a D and a J, or a V and a DJ, for example) are joined by the nonhomologous DNA end joining repair pathway (2, 9)
to create the variable domain exon that encodes a portion of the
binding pocket for the antigen receptor (immunoglobulins (Ig) or T-cell
receptor). The two signal ends are also joined together by
nonhomologous DNA end joining to form a signal joint.
There is a consensus sequence for the heptamer (CACAGTG) and for the
nonamer (ACAAAAACA). This consensus appears to be the optimal one for
V(D)J recombination. However, the actual RSS associated with each V, D,
and J element usually deviates considerably from the consensus. The
variations affect recombination efficiency over several orders of
magnitude (10, 11). In addition, the terminal two or three coding end
nucleotides also influence the efficiency of nicking at the adjacent
signal, and this coding end effect can influence the efficiency of
recombination by an additional one to two orders of magnitude (12-15).
Of the more than 109 possible combinations of heptamer and
nonamer variations, only a small number (fewer than 100) of the
possible variations have been tested (10, 11, 16). Hence, although some
of the principles have been established concerning how signal and
coding end sequence can influence V(D)J recombination, the
recombination or cleavage efficiencies of the actual V, D, and J
elements relative to one another have not been systematically
determined for any of the human or murine loci. Therefore, the actual
efficiencies cannot be deduced from the current literature, and direct
experiments are required to determine the efficiencies that generate
the repertoire of the antigen receptor loci.
Another factor that is known to influence V(D)J recombination is
chromatin structure (17). There are six antigen receptor loci, and they
do not undergo recombination simultaneously because of differences in
chromatin structure. CpG methylation is one major factor that
determines the accessibility of any vertebrate genetic locus (18-20),
and the antigen receptor loci are no exception. CpG methylation is
typically accompanied by histone deacetylation, which results in a
tighter association between the nucleosome and the DNA wrapped around
it. When RAG cleavage assays have been done on short DNA fragments that
accommodate one nucleosome, cleavage is suppressed (21-24). Although
chromatin structure clearly determines the RAG complex accessibility
differences between the six antigen receptor loci, it has been
uncertain whether such effects influence the differential V, D, or J
element utilization within any one locus. Individual active antigen
receptor loci that have been examined have acetylated histones
throughout the locus (25), consistent with much earlier data indicating
that active antigen receptor loci are hypomethylated (26, 27).
In neonatal mice, it has been observed that VH segments in
proximity to the JH cluster are used more frequently than
the distal VH segments (28-31). This proximity preference
across the murine VH array is either much less marked or
not detectable in adult mice (28-30, 32). In fetal human, it has been
unclear whether or not there is a small bias in favor of the most
proximal VH (30). If there is a small bias in fetal human,
it might suggest that in mouse and, to a lesser extent, in human, the
locus opening (chromatin change) emanates from the intron enhancer
during early development and that this proximity effect dissipates with
progression to adulthood. This is especially obvious in humans where it
is clear that, in adults, there is no proximity preference within the
Ig heavy chain locus (30, 33-36).
Once the primary repertoire is generated as a result of recombination
and overlying chromatin effects, positive and negative selective forces
shape the repertoire into its observed profile in the peripheral blood.
Here, we have examined each of the VH elements in the six
human VH families for their efficiency in the initial
stages of V(D)J recombination by using human core RAG complexes to
cleave oligonucleotide fragments encompassing the signal and the
adjacent coding end nucleotides. We find that the cleavage efficiency
of each of the six families corresponds very closely to data for the
nonproductive VH usage observed in the peripheral B cells
of normal adult humans. This significant similarity suggests that the
initial (unselected) VH repertoire in the adult human adult
is determined to a significant extent by the recombination cleavage efficiency.
DNA Substrates--
All oligonucleotides were synthesized by
Operon Technologies, Inc. (Alameda, CA). Cleavage substrates were made
by annealing two complementary oligonucleotides to form a blunt-ended
double-stranded DNA. Each cleavage substrate contains a 15-bp (base
pair) coding flank and a 5-bp flank on the nonamer side. The sequences
of each VH are listed in Fig. 1. The substrate with the
12-bp spacer RSS that was chosen for pairing with each VH
element was derived from the left (upstream) side of the human
DH4-4 substrate (also called DA4). It is made by annealing
oligonucleotides KY106 (5'-GGT AGT TAC TGT AGT CAC ACA GTA GGA GGA CCC
TTC ACA AAA AGC CCC TG-3') and KY107 (5'-CAG GGG CTT TTT GTG AAG GGT
CCT CCT ACT GTG TGA CTA CAG TAA CTA CC-3'). The pre-nicked
DH4-4 substrate is composed of ML126, ML127, and KY107,
which were annealed (see below) in molar ratios of 1:1:2. The sequences
are as follows. ML126 (5'-GGT AGT TAC TGT AGT CA-3') and ML127 (5'-pC
ACA GTA GGA GGA CCC TTC ACA AAA AGC CCC TG-3').
We polyacrylamide gel-purified the full-length form of each
oligonucleotide. We then determined the concentration
spectrophotometrically. Each cleavage substrate was labeled at the
5'-end of the coding flank with [ Protein Expression and Purification--
Human RAG expression
plasmids (core RAG1: amino acids 383-1008 and full-length RAG2) were
kindly provided by Dr. Sadro Santagata and Dr. Patricia Cortes. The
core RAG2 (amino acids 1-383) expression vector was made by inserting
the corresponding PCR fragment into the pEBG vector (38). The sequence
was confirmed by dideoxynucleotide sequencing. Recombinant human RAG
proteins were expressed as glutathione S-transferase (GST)
fusion proteins by cotransfection of RAG1 (core) and RAG2 (core)
expression vectors into the human epithelial cell line 293T. (Previous
work demonstrates the similar kinetics of nicking and hairpin formation
for GST versus maltose binding protein RAG fusion proteins
(8).) The coexpressed human core RAG proteins were then purified with
glutathione-agarose (Sigma Chemical Co., St. Louis, MO). C-terminal
truncated mouse HMG1 was expressed in bacteria as a
six-histidine-tagged protein and purified over a
nickel-nitrilotriacetic acid column (Qiagen Inc., Valencia, CA).
Protein concentration was determined against known concentrations of
bovine serum albumin (fraction V) on a Coomassie Blue-stained gel with
a densitometer (Model GS710, Bio-Rad, Hercules, CA) and quantified with
Quantity One software (Bio-Rad, Hercules, CA).
Coupled Cleavage Assay--
A 5-µl reaction mixture containing
10 fmol of a 32P-labeled VH substrate, 10 fmol
of unlabeled DH4-4 (DA4), and 25 mM MOPS, pH
7.0, 2.5 mM MgCl2, 30 mM potassium
chloride, 30 mM potassium glutamate, 1 pmol of HMG1, and 20 ng of RAGs was incubated at 37 °C for 30 min. The reaction was
stopped by the addition of 5 µl of formamide and immediately heated
to 100 °C for 5 min before plunging into ice water. At least two
independent cleavages on two independent gels were done for every
VH. In addition, independent annealings were done on a
subset of VH segments that deviated more than expected
relative to the most similar VH elements. The independent
annealings were indistinguishable.
Five femtomoles of each substrate of the two specified substrates was
used (see Fig. 5, lanes 3 and 6). Ten femtomoles
was used when only one substrate is involved. The difference in band intensity for equal molar amounts of substrate is simply due to labeling efficiency differences. Such labeling efficiency differences are not a complication, because equal molar amounts are used, and the
conversion to nicked and hairpin products is expressed as a percentage
of the substrate input in that reaction.
Denaturing Polyacrylamide Gel Electrophoresis--
Reaction
products were separated on 15% polyacrylamide gels containing 7 M urea in 1× Tris borate-EDTA buffer. Gels were visualized by autoradiography with a Molecular Dynamics PhosphorImager 445SI (Sunnyvale, CA) and quantified with ImageQuaNT software (version 5).
Statistical Analysis--
Evaluations of the correlation between
RAG nicking (or hairpin formation) and published values for
nonproductive rearrangements were done as follows. The RAG nicking
contribution (expressed as a percentage) for each VH family
relative to the total was calculated as described in Table
I. The nonproductive rearrangement frequencies are taken from Refs. 37 and 38. The RAG nicking percentage
was plotted versus the nonproductive rearrangement frequency
for each of the six families. The correlation coefficient was
determined, and a probability value, p, was calculated, as given in Table I.
Experimental Strategy for Assessing the VH Array in
Paired 12/23 Cleavage Reactions--
The sequence alignment of all 39 functional human VH elements in the region relevant to
V(D)J recombination (the heptamer and nonamer of the recombination
signal sequence and the 15 bp of coding flank) illustrates that
only five of the heptamer/nonamer signals conform to the
CACAGTG/ACAAAAACC consensus (Fig.
1) (39). These five are
VH3-9, 3-43, 4-34, 4-39, and 4-59. The most common sequence
of the VH elements is shown in the top line, and this sequence differs from the optimal heptamer/nonamer in the fourth position of the nonamer. Five of the 39 VH elements have
heptamers that deviate from the optimal sequence, and 33 VH
elements have nonamers that deviate from the optimal sequence. The
effects of these deviations on recombination efficiency cannot be
reliably estimated from the current knowledge of the limited number of tested signal sequence variations.
The VH elements have previously been grouped into six
families based on the VH coding sequence (39). Within each
of the six VH families, the 23-bp spacer region between the
heptamer and the nonamer is highly homologous. The most distinct
deviation is seen for the nine members of family 1, which, by
comparison, have unique nonamer sequences and spacers relative to
members from the other VH families.
Previous work has demonstrated that the RAG cleavage efficiency of each
substrate is determined by its similarity to the optimal signal
sequence (40, 41) as well as for the coding end sequence adjacent to
the signal (42). These biochemical cleavage efficiencies correspond
very well with cellular V(D)J substrate quantitation, in those cases
where equivalent substrates have been compared (12, 42). We determined
the RAG cleavage efficiency of each human VH element by
using oligonucleotide-based DNA substrates, synthesized to correspond
to the published sequences of human functional VH elements.
Each VH substrate contains a 15-bp flank on the heptamer
side (coding flank) and a 5-bp flank on the nonamer side. Previous
studies have documented that these lengths of extension beyond the
heptamer/nonamer signal are sufficient to recapitulate any surrounding
sequence effects (42, 43). One strand of each double-stranded
oligonucleotide was labeled such that the nicked product and the
hairpin product could be distinguished from the substrate on a
denaturing polyacrylamide gel (42, 44). Cleavage was carried out with
purified human RAG proteins with Mg2+ as the divalent
cation. A 12-bp RSS partner substrate is necessary for the 12/23
coupling at the hairpin formation step (8), and this must be the same
partner for all of the VH substrates to allow comparison.
We chose DH4-4 (also called DA4), which is efficiently cleaved by the human RAG complex (data not shown). However, it is
important to note that the nicking step is independent of the presence
or absence of a partner signal (44).
Each VH substrate was assayed in replicate sets of
experiments. To compare the different sets, an optimal 23-bp spacer
substrate (KY36/37) was included in each set as a standard to normalize for any slight variations of cleavage efficiency. Human core RAG1 and
RAG2 were used rather than the more commonly used murine core RAG1 and
2, because we were interested in establishing the relative cleavage
efficiencies of the human VH repertoire.
The RAG Cleavage Efficiency of Human VH Targets Varies
Markedly--
The reaction time courses conformed to the expected
kinetics for nicking and hairpin formation (41, 44, 45), and the products increased over the initial 50 min when incubated at 37 °C
(Fig. 2). Cleavage efficiency was
determined as the percentage of the substrate that is converted to the
nicked or hairpin product at the 30-min time point. Although we used
initial reaction rates in our previous study (44), the 30-min time
point permits greater precision when comparing 39 different substrates.
The nicking and hairpin formation of a subset of the human
VH elements are illustrated in Fig.
3. Each VH element was
analyzed in two independent experiments in duplicate, and the degree of
concordance between measurements was quite good, as reflected in the
standard deviations (Fig. 1).
The nicking and hairpin formation efficiency of the VH
substrates varies markedly, depending on the sequence of the substrate. This is true even for members of the same family for those cases where
there are differences in the signal sequence or coding end. The
difference in nicking efficiency between the highest
(VH4-34) and lowest VH (VH1-58) is
28-fold. Three of the six VH family 4 members (4-34, 4-39, and 4-59), the one family 5 member, and six of the 19 family 3 members
have the highest cleavage efficiencies (Fig. 1). Not surprisingly, all
five of the VH elements with optimal heptamer/nonamer
signals (VH3-9, 3-43, 4-34, 4-39, 4-59) are among the
highest efficiency RAG-nicking targets. The most common deviation of
the VH elements, the C in the fourth position of the
nonamer, did not markedly reduce recombination efficiency as
illustrated by the fact that VH3-30, 3-53, and 3-66 are
nicked at efficiencies that are only 1.1- to 2.6-fold lower than the
VH elements with optimal heptamer/nonamer signals.
VH segments with substantial deviations in the heptamer or
nonamer, such as VH3-72, and most of the members in family
1, had lower cleavage efficiencies (Fig. 1). Some of the individual
VH substrates vary only slightly from the consensus, and
yet have large reductions in cleavage efficiency. For example,
VH3-20 has a consensus heptamer and only a one-nucleotide
deviation from the consensus nonamer, and yet it is relatively low in
cleavage efficiency.
Conversely, large deviations from the consensus are not necessarily
associated with large reductions. For example, VH5-51 has
three nucleotide deviations from the consensus nonamer, and yet it is
cleaved efficiently by the human RAG complex. However, VH1-58 also has three nucleotide deviations from the
consensus nonamer (at positions different from those of
VH5-51), and yet its cleavage is 20-fold reduced relative
to VH5-51. These instances illustrate the lack of
predictability when deviations from the consensus are present and
illustrate that direct measurements of the cleavage or recombination
efficiency are essential.
The one to three nucleotides of the coding end that directly adjacent
to the heptamer have been previously demonstrated to affect V(D)J
recombination (12-14), and this affect has been traced, at the
biochemical level, to the nicking step (42). Here we see evidence of
this when comparing VH3-15 with VH3-73 (also
compare VH4-34 with 4-59), where the only differences are
not in the signal but in the coding end (Fig. 1).
Sequence variations in the spacer region or deep into the coding flank
(more than three nucleotides from the nick site) generally show little
effect on cleavage efficiency (compare VH3-7 with 3-23, or
3-64 with 1-3, Fig. 1), consistent with previous findings that
variations at these positions do not affect recombination efficiency in
any large way (12, 15, 46-48). Nevertheless, limited effects of spacer
sequence may be observable (e.g. compare VH3-23
or 3-15 with 3-30).
The hairpin formation efficiency also varies over nearly a 28-fold
range. In general, there are no marked disparities between the nicking
and hairpin formation results (see "Discussion").
The Effect of Competition between Different VH
Elements--
At the genomic antigen receptor locus in the cell, the
RAG proteins can bind at the signal sequence of any of a number of different VH elements; hence, there is potential
competition between the elements. We were interested in whether the
cleavage studies that we had done would be affected by competition or
whether the VH substrates would be cleaved independently.
We tested this by first determining the cleavage of VH
substrates when individually paired with the DH element, as
described above. We then tested two VH substrates with the
DH element and followed the hairpin formation of these two
VH substrates in the same reaction (Fig. 4). We were able to follow the hairpin
formation of two VH substrates in the same reaction,
because hairpins of different sequence have different gel mobility,
despite having the same length.
In the first set of experiments, we chose two VH elements
that are cleaved with comparable efficiency (Fig. 4, lanes
1-3). In the second set of experiments, we chose two
VH elements that have a 5-fold difference in hairpin
formation efficiency (Fig. 4, lanes 4-6). We find that the
VH substrates are cleaved in this competitive study in a
manner that was indistinguishable from their noncompetitive cleavage
(Fig. 4, compare lane 3 with lanes 1 and
2; also compare lane 6 with lanes 4 and 5). Therefore, the VH substrates are cleaved
independently, and in vitro competition does not affect
their cleavage efficiency.
Analysis of RAG Cleavage Relative to the Observed Unselected
Repertoire--
We were interested in comparing the data observed
in vitro with the repertoire observed in the human adult
peripheral blood. The nonproductive rearrangements among B cells in the
peripheral blood are the most appropriate comparison, because these
represent recombination events prior to any immunological selection.
Other investigators have done measurements of VH usage
among nonproductive rearrangements at the human heavy chain locus by
using single-cell PCR (49-51). The number of events is insufficient to
evaluate each individual VH element, but comparisons can be
done at the level of each family. To compare our cleavage data with
those from single-cell PCR, we first calculate the cleavage efficiency
of each individual VH relative to the sum of the 39 VH elements. We then add the members for each family. We
find that this aggregate family nicking or hairpin formation efficiency
matches the data on the usage frequency of nonproductively rearranged
VH elements surprisingly well (for nicking,
p < 0.001; for hairpin formation, p < 0.01; Table I).
The usage frequencies calculated from our cleavage data as well as from
the in vivo nonproductive rearrangement data (49, 50) are
not merely a reflection of the VH family size. For example, family 1 has nine members and family 4 has only six. Yet family 4 has
higher cleavage values and in vivo usage (Table I). If all
VH elements were used with equal frequency and the
repertoire were shaped based only on family size, one would expect
family 1 to contribute 23.1% and family 4 to contribute 15.4% of the repertoire (Table I). This is not the case for either our in vitro measurements or the in vivo nonproductive
repertoire measurements (49, 50).
The similarity, at the family level, between our cleavage data and the
observed peripheral unselected repertoire may provide a mechanistic
understanding for the VH usage frequencies in
vivo. These in vivo frequencies may simply reflect how
well the VH elements are cleaved by the RAG complex. If so,
this could be of considerable practical significance. For example, with
a clearer understanding of the repertoire generation, deviations from
the baseline repertoire of VH usage might be more easily
recognized and may be useful as a very early indication of monoclonal
gammopathies due to B cell malignancies.
That the nicking efficiencies for the VH families are very
similar to the nonproductive repertoire in the peripheral blood suggests that the rate-limiting step for V(D)J recombination may be
(a) the nicking step, (b) the preceding step in
which the RAG complex binds the substrate, or (c) a
combination of these two steps. If any of the subsequent steps (hairpin
formation, hairpin opening, or any of the steps of nonhomologous end
joining) were rate-limiting, then the nicking efficiencies would not be
expected to so closely match the nonproductive peripheral repertoire.
Biological Significance of a Predictable Initial
Repertoire--
The similarity of the RAG cleavage efficiencies and
the nonproductive pre-immune repertoire is interesting from the
standpoint of factors that affect the VH usage on human
chromosome 14. The nonproductive pre-immune repertoire could
conceivably be a reflection of more factors than simply RAG cleavage
efficiencies, including such factors such as chromatin structure
(histone acetylation and CpG methylation) and local transcription. The
fact that the in vitro RAG cleavage efficiencies match those
in the nonproductive pre-immune repertoire means that if factors other
than RAG cleavage efficiency are anything other than negligible, then
they may be offsetting each other.
The VH families 2, 5, and 6 are the clearest in suggesting
that the RAG cleavage efficiencies are the dominant factor in dictating the representation in the peripheral blood repertoire. Families 5 and 6 have only one member each. VH5-51 and VH6-1 are
used in proportion to their RAG cleavage (Table I), even though they are located 630 kb apart in the human genome. The three members of
family 2 are spread across a similar distance of the VH
array, and each has very similar RAG cleavage efficiencies in our
experimental system. We find that the representation of family 2 in the
peripheral blood also is in proportion to its cleavage efficiency
(Table I). If RAG cleavage efficiency is a dominant factor determining VH element recombination, it suggests that the chromatin
structure across the 1 megabase VH array does not vary
dramatically, at least as it affects V(D)J recombination.
Our results are interesting in light of data from an independent line
of work. When most of the human IgH array (35 functional VH) was randomly integrated (via a yeast artificial
chromosome) as a transgene into the germline of mice, the rearrangement
of the VH gene families was surprisingly similar to that
seen in humans (52). These studies were done on productively rearranged alleles. Hence, immunological selection in the mouse versus
humans complicates the analysis. Nevertheless, in light of our work, the correspondence between the human unselected (nonproductive) repertoire and a transgene that is randomly integrated in a different species suggests that VH cleavage efficiencies are a
dominant factor in shaping the repertoire.
As mentioned earlier, in neonatal mice, it has been observed that
VH segments in proximity to the JH cluster are
used more frequently than the distal VH segments (28-31).
In adult humans, there is no data to suggest any proximity preference
within the Ig heavy chain locus (28-30). Therefore, there is no
contradiction between our suggestion that recombination signal strength
could be a major factor and the murine fetal data on proximity as a major factor, because fetal mice and adult humans are quite different in this regard. This difference between mice and humans is not surprising. There are other examples where Ig repertoire
diversification has been achieved by quite different mechanisms. For
example, the diversification of IgH complementarities region 3 involves generation of a Dµ protein, whereas there is no
Dµ in human, and quite different mechanisms are utilized
to ensure diversification of this portion of the heavy chain (53).
Evolution of the Human VH Array and the Individual
Recombination Efficiencies--
If the RAG cleavage efficiency is a
major determinant for the frequency of usage of VH
elements, then it is reasonable to assume that the signal (and coding
end sequences) evolved so as to optimize the level of each
VH in the repertoire as needed to handle the threat of
prevailing pathogens. Hence, there may have been two levels of
evolutionary pressure at the DNA sequence level, one being the sequence
of the V and the other being the efficiency of the signal (and adjacent
coding end) for cleavage (54). The sequence of the VH
coding region determines the range of antigens bound, whereas the
sequence of the coding end and heptamer/nonamer determine the abundance
of that VH element in the steady-state repertoire. Insofar
as that steady-state repertoire is the initial response to an invading
microbe, the balance of VH elements in that repertoire is
important. It is intriguing that the relative ratios of family usage in
this initial Ig heavy chain repertoire may be predictable from the
relative RAG cleavage efficiencies in a manner that appears
uncomplicated by other factors.
We thank Dr. Malcolm Pike (University of
Southern California) for statistical advice. We thank K. Schwarz (Ulm,
Germany) for suggesting the competition experiment. We thank C. Hsieh
and Ryan Irvine for comments on the manuscript, and we thank members of our laboratory for helpful discussion.
*
This work was supported in part by National Institutes of
Health grants (to M. R. L.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Published, JBC Papers in Press, December 5, 2001, DOI 10.1074/jbc.M109772200
The abbreviations used are:
RSS, recombination
signal sequence;
Ig, immunoglobulin;
GST, glutathione
S-transferase;
MOPS, 4-morpholinepropanesulfonic acid.
The Cleavage Efficiency of the Human Immunoglobulin Heavy Chain
VH Elements by the RAG Complex
IMPLICATIONS FOR THE IMMUNE REPERTOIRE*
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]ATP (3000 Ci/mmol) (PerkinElmer Life Sciences, Boston, MA) and T4 polynucleotide
kinase (New England BioLabs, Beverly, MA) according to the
manufacturer's instructions. Unincorporated radioisotope was removed
by using G-25 Sephadex (Amersham Biosciences, Inc., Piscataway, NJ)
spin-column chromatography. It is important to note that labeled
oligonucleotides were mixed with twice the molar amount of unlabeled
complementary oligonucleotides in a buffer containing 10 mM
Tris-hydrochloride, pH 8.0, and 100 mM NaCl (37). The
mixture was heated at 95 °C for 5 min and allowed to cool down to
room temperature for more than 1 h. The amount of unannealed labeled single-stranded oligonucleotide was less than 5% in all cases
(and was typically at undetectable levels (less than 2%)).
Frequencies for VH family in vitro RAG cleavage and for
nonproductive rearrangements in human peripheral blood
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (72K):
[in a new window]
Fig. 1.
Sequence alignment of the 39 functional human
VH elements and their adjacent recombination signals.
The terminal 15 bp of the VH elements and the adjacent
heptamer/nonamer signals were used to create the oligonucleotide-based
cleavage substrates. Sequence alignment was done with the alignment
program MultAlin available at www.toulouse.inra.fr/multalin.html. The
alignment output has been reformatted manually for a better sequence
comparison. The top line (which is VH6-1)
includes the most frequent nucleotide at each position; note that the
middle nucleotide of the nonamer is C rather than the A that
is present at this position in the V(D)J recombination consensus
nonamer. Each dash indicates the identical nucleotide listed
on the first line of sequence. Deviations from the first line of
sequence are indicated by the corresponding nucleotides. The order of
the VH elements (top to bottom)
simply reflects how closely a given VH element is to the
consensus in the top line. The name designations for the
human VH elements are those assigned by the Honjo
laboratory (39). The first number represents the family
(1 through 6), and the second number
is the individual VH designation (the individual
VH numbers are not consecutive for historical reasons).
%N and %HP indicate the mean values for the
nicking and hairpin formation efficiencies, respectively, of the RAG
cleavage assays. The sequence of the DH4-4 element used as
the partner in the RAG cleavage assays is:
CAGGGGCTTTTTGTGAAGGGTCCTCCTACTGTGTCACTACAGTAACTACC,
where the nonamer is underlined, the heptamer is in
boldface, and the 17 nucleotides following the heptamer are
the adjacent portion of the DH4-4 coding region. The
standard deviations for the nicking measurements in order (from the
top) are 0.1, 0.4, 0.4, 0.4, 0.3, 1.1, 0.3, 0.8, 0.8, 0.4, 0.6, 1.3, 0.4, 0.2, 0.3, 0.4, 0.7, 0.7, 0.4, 3.9, 1.9, 2.2, 0.6, 0.8,
1.0, 1.7, 0.5, 0.5, 0.8, 1.3, 0.1, 0.7, 0.7, 0.3, 0.9, 3.4, 0.5, 1.2, and 0.2. The standard deviations for hairpin formation measurements are
0.1, 0.1, 0.1, 0.1, 0.1, 0.1, 0.1, 0.2, 0.2, 0.2, 0.01, 0.1, 0.01, 0.1, 0.1, 0.1, 0.1, 0.1, 0.01, 0.3, 0.1, 0.1, 0.1, 0.1, 0.4, 0.3, 0.01, 0.1, 0.2, 0.3, 0.1, 0.01, 0.2, 0.01, 0.1, 0.3, 0.3, 0.3, and 0.01.
View larger version (25K):
[in a new window]
Fig. 2.
Time course of coupled RAG nicking and
hairpin formation. The accumulation of the nicked product
(A) and the hairpin product (B) measured as the
percentage converted from the substrate VH4-59 during a
time span of 50 min. N, nicked product; HP,
hairpin formation; Min, minutes.
View larger version (25K):
[in a new window]
Fig. 3.
In vitro RAG cleavage of
VH substrates. Solid lines indicate DNA
strands. The shaded triangle represents the 23 RSS. The
star symbol indicates the position of the radioisotope label
on each DNA molecule. S, substrate; N; nicked
product; HP, hairpin product. Lanes:
1, (1-18); 2, (3-7); 3, (4-34);
4, (4-39); 5, (3-23); 6, (1-8);
7, (1-24); 8, (1-58); 9, (1-46);
10, (1-45); 11, (2-5); 12, (2-26);
13, KY36/37; 14, (5-51); 15, (4-59);
16, (3-72); 17, (4-31); 18, (3-20);
19, (3-64); 20, KY36/37 (a consensus
heptamer/nonamer RSS substrate).
View larger version (12K):
[in a new window]
Fig. 4.
Competition of different VH
substrates in the same RAG cleavage reaction. Lanes
1-3, VH elements with comparable hairpin formation
efficiency (lane 1, VH6-1 and lane 2,
VH3-48) were either cleaved alone (lanes 1 and
2), or in a reaction that contains equal amounts of both
(lane 3). Only half the amount of the labeled
VH6-1 or VH3-48 is present in lane 3 as compared with lane 1 or lane 2 to preserve the
same amount of labeled VH substrates in all three lanes.
Lanes 4-6, similarly, VH elements differing
5-fold in hairpin formation efficiency (lane 4,
VH3-9 and lane 5, VH3-49) were
cleaved alone (lanes 4 and 5), or in a reaction
that contains half the amount of each (lane 6). The ratio of
the band intensity between a and b is 2.0 and is
equal to the ratio between a' and b'. The ratio
between c and d is 8.0 and is similar to the
ratio between c' and d', which is 7.6. S designates the substrate, HP designates the
hairpinned form, and N designates the nicked form.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
ACKNOWLEDGEMENTS
FOOTNOTES
The Rita & Edward Polusky Basic Cancer Research Professor.
To whom correspondence should be addressed: Norris Comprehensive Cancer
Ctr., Rm. 5428, University of Southern California, Keck School of
Medicine, 1441 Eastlake Ave., Mail Code 9176, Los Angeles, CA
90089-9176. Tel.: 323-865-0568; Fax: 323-865-3019; E-mail: lieber@usc.edu.
ABBREVIATIONS
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Fugmann, S. D.,
Lee, A. I.,
Shockett, P. E.,
Villey, I. J.,
and Schatz, D. G.
(2000)
Ann. Rev. Immunol.
18,
495-527[CrossRef][Medline]
[Order article via Infotrieve]
2.
Lieber, M. R.
(1998)
Am. J. Pathol.
153,
1323-1332 3.
Lewis, S. M.
(1994)
Adv. Immunol.
56,
27-150[Medline]
[Order article via Infotrieve]
4.
McBlane, J. F.,
Gent, D. C. v.,
Ramsden, D. A.,
Romeo, C.,
Cuomo, C. A.,
Gellert, M.,
and Oettinger, M. A.
(1995)
Cell
83,
387-395[CrossRef][Medline]
[Order article via Infotrieve]
5.
Tonegawa, S.
(1983)
Nature
302,
575-581[CrossRef][Medline]
[Order article via Infotrieve]
6.
vanGent, D. C.,
Ramsden, D. A.,
and Gellert, M.
(1996)
Cell
85,
107-113[CrossRef][Medline]
[Order article via Infotrieve]
7.
Eastman, Q. M.,
Leu, T. M. J.,
and Schatz, D. G.
(1996)
Nature
380,
85-88[CrossRef][Medline]
[Order article via Infotrieve]
8.
West, R. B.,
and Lieber, M. R.
(1998)
Mol. Cell. Biol.
18,
6408-6415 9.
Grawunder, U.,
West, R. B.,
and Lieber, M. R.
(1998)
Curr. Opin. Immunol.
10,
172-180[CrossRef][Medline]
[Order article via Infotrieve]
10.
Hesse, J. E.,
Lieber, M. R.,
Mizuuchi, K.,
and Gellert, M.
(1989)
Genes Dev.
3,
1053-1067 11.
Akira, S.,
Okazaki, K.,
and Sakano, H.
(1987)
Science
238,
1134-1138 12.
Gerstein, R. M.,
and Lieber, M. R.
(1993)
Genes Dev.
7,
1459-1469 13.
Boubnov, N. V.,
Wills, Z. P.,
and Weaver, D. T.
(1995)
Nucleic Acids Res.
23,
1060-1067 14.
Ezekiel, U. R.,
Engler, P.,
Stern, D.,
and Storb, U.
(1995)
Immunity
2,
381-389[CrossRef][Medline]
[Order article via Infotrieve]
15.
Ezekiel, U. R.,
Sun, T.,
Bozek, G.,
and Storb, U.
(1997)
Mol. Cell. Biol.
17,
4191-4197[Abstract]
16.
Ramsden, D. A.,
and Wu, G. E.
(1991)
Proc. Natl. Acad. Sci. U. S. A.
88,
10721-10725 17.
Alt, F. W.,
Blackwell, T. K.,
and Yancopoulos, G. D.
(1987)
Science
238,
1079 18.
Hsieh, C.-L.,
and Lieber, M. R.
(1992)
EMBO J.
11,
315-325[Medline]
[Order article via Infotrieve]
19.
Engler, P.,
Haasch, D.,
Pinkert, C. A.,
Doglio, L.,
Glymour, M.,
Brinster, R.,
and Storb, U.
(1991)
Cell
65,
939-947[CrossRef][Medline]
[Order article via Infotrieve]
20.
Engler, P.,
Weng, A.,
and Storb, U.
(1993)
Mol. Cell. Biol.
13,
571-577 21.
Kwon, J.,
Imbalzano, A. N.,
Matthews, A.,
and Oettinger, M. A.
(1998)
Mol. Cell
2,
829-839[CrossRef][Medline]
[Order article via Infotrieve]
22.
Kwon, J.,
Morshead, K. B.,
Guyon, J. R.,
Kingston, R. E.,
and Oettinger, M. A.
(2000)
Mol. Cell
6,
1037-1048[CrossRef][Medline]
[Order article via Infotrieve]
23.
Golding, A.,
Chandler, S.,
Ballestar, E.,
Wolffe, A. P.,
and Schlissel, M. S.
(1999)
EMBO J.
18,
3712-3723[CrossRef][Medline]
[Order article via Infotrieve]
24.
McBlane, F.,
and Boyes, J.
(2000)
Curr. Biol.
10,
483-486[CrossRef][Medline]
[Order article via Infotrieve]
25.
McMurry, M. T.,
and Krangel, M. S.
(2000)
Science
287,
495-498 26.
Storb, U.,
and Arp, B.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
6642-6646 27.
Mather, E. L.,
and Perry, R. P.
(1983)
Proc. Natl. Acad. Sci. U. S. A.
80,
4689-4693 28.
Jeong, H. D.,
Komisar, J. L.,
Kraig, E.,
and Teale, J. M.
(1988)
J. Immunol.
140,
2436-2441[Abstract]
29.
Jeong, H. D.,
and Teale, J. L.
(1988)
J. Exp. Med.
168,
589-603 30.
Wu, G. E.,
Atkinson, M.,
Ramsden, D.,
and Paige, C. J.
(1990)
Semin. Immunol.
2,
207-216[Medline]
[Order article via Infotrieve]
31.
Williams, G. S.,
Martinez, A.,
Montalbano, A.,
Tang, A.,
Mauhar, A.,
Ogawaro, K.,
Merz, D.,
Chevillard, C.,
Riblet, R.,
and Feeney, A. J.
(2001)
J. Immunol.
167,
257-263 32.
Haines, B. B.,
Angeles, C. V.,
Parmelee, A. P.,
McLean, P. A.,
and Brodeur, P. H.
(2001)
Mol. Immunol.
38,
9-18[CrossRef][Medline]
[Order article via Infotrieve]
33.
Schroeder, H. W.,
Hillson, J. L.,
and Perlmutter, R. M.
(1987)
Science
238,
791-796 34.
Gokmen, E.,
Raaphorst, F. M.,
Boldt, D. H.,
and Teale, J. M.
(1998)
Blood
92,
2802-2814 35.
Fanning, L. J.,
Connor, A. M.,
and Wu, G. E.
(1996)
Clin. Immunol. Immunopathol.
79,
1-14[CrossRef][Medline]
[Order article via Infotrieve]
36.
Schroeder, H. W.,
Hillson, J. L.,
and Perlmutter, R. M.
(1989)
Int. Immunol.
2,
41-47
37.
Harrington, J. J.,
and Lieber, M. R.
(1994)
EMBO J.
13,
1235-1246[Medline]
[Order article via Infotrieve]
38.
Weis-Garcia, F.,
Besmer, E.,
Sawchuk, D. J., Yu, W., Hu, Y.,
Cassard, S.,
Nussenzweig, M.,
and Cortes, P.
(1997)
Mol. Cell. Biol.
17,
6379-6385[Abstract]
39.
Matsuda, F.,
Ishii, K.,
Bourvagnet, P.,
Kuma, K.,
Hayashida, H.,
Miyata, T.,
and Honjo, T.
(1998)
J. Exp. Med.
188,
2151-2162 40.
Ramsden, D. A.,
McBlane, J. F.,
Gent, D. C. v.,
and Gellert, M.
(1996)
EMBO J.
15,
3197-3206[Medline]
[Order article via Infotrieve]
41.
vanGent, D. C.,
McBlane, J. F.,
Ramsden, D. A.,
Sadofsky, M. J.,
Hesse, J. E.,
and Gellert, M.
(1995)
Cell
81,
925-934[CrossRef][Medline]
[Order article via Infotrieve]
42.
Yu, K.,
and Lieber, M. R.
(1999)
Mol. Cell. Biol.
19,
8094-8102 43.
Kim, D. R.,
and Oettinger, M. A.
(1998)
Mol. Cell. Biol.
18,
4679-4688 44.
Yu, K.,
and Lieber, M. R.
(2000)
Mol. Cell. Biol.
20,
7914-7921 45.
Eastman, Q. M.,
and Schatz, D. G.
(1997)
Nucleic Acids Res.
25,
4370-4378 46.
Wei, Z.,
and Lieber, M. R.
(1993)
J. Biol. Chem.
268,
3180-3183 47.
Ramsden, D. A.,
Baetz, K.,
and Wu, G. E.
(1994)
Nucleic Acids Res.
22,
1785-1796 48.
Nadel, B.,
Tang, A.,
Escuro, G.,
Lugo, G.,
and Feeney, A. J.
(1998)
J. Exp. Med.
187,
1495-1503 49.
Brezinschek, H. P.,
Brezinschek, R. I.,
and Lipsky, P. E.
(1995)
J. Immunol.
155,
190-202[Abstract]
50.
Brezinschek, H.,
Foster, S.,
Brezinschek, R.,
Dorner, T.,
Domiati-Saad, R.,
and Lipsky, P. E.
(1997)
J. Clin. Invest.
99,
2488-2501[Medline]
[Order article via Infotrieve]
51.
Hansen, A.,
Dorner, T.,
and Lipsky, P. E.
(2000)
Int. Arch. Alergy Immunol.
123,
36-45[CrossRef][Medline]
[Order article via Infotrieve]
52.
Gallo, M. L.,
Ivanov, V. E.,
Jakobovits, A.,
and Davis, C. G.
(2000)
Eur. J. Immunol.
30,
534-540[CrossRef][Medline]
[Order article via Infotrieve]
53.
Schroeder, H. W.,
Ippolito, G. C.,
and Shiokawa, S.
(1998)
Vaccine
16,
1383-1390[CrossRef][Medline]
[Order article via Infotrieve]
54.
Hassanin, A.,
Golub, R.,
Lewis, S. M.,
and Wu, G. E.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
11415-11420
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S.-Y. Wong, C. P. Lu, and D. B. Roth A RAG1 Mutation Found in Omenn Syndrome Causes Coding Flank Hypersensitivity: A Novel Mechanism for Antigen Receptor Repertoire Restriction J. Immunol., September 15, 2008; 181(6): 4124 - 4130. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Larijani and A. Martin Single-Stranded DNA Structure and Positional Context of the Target Cytidine Determine the Enzymatic Efficiency of AID Mol. Cell. Biol., December 1, 2007; 27(23): 8038 - 8048. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Lu, K. Schwarz, and M. R. Lieber Extent to which hairpin opening by the Artemis:DNA-PKcs complex can contribute to junctional diversity in V(D)J recombination Nucleic Acids Res., November 29, 2007; 35(20): 6917 - 6923. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. C. Raghavan, C.-L. Hsieh, and M. R. Lieber Both V(D)J Coding Ends but Neither Signal End Can Recombine at the bcl-2 Major Breakpoint Region, and the Rejoining Is Ligase IV Dependent Mol. Cell. Biol., August 1, 2005; 25(15): 6475 - 6484. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Olaru, H. T. Petrie, and F. Livak Beyond the 12/23 Rule of VDJ Recombination Independent of the Rag Proteins J. Immunol., May 15, 2005; 174(10): 6220 - 6226. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N.-Y. Zheng, K. Wilson, M. Jared, and P. C. Wilson Intricate targeting of immunoglobulin somatic hypermutation maximizes the efficiency of affinity maturation J. Exp. Med., May 2, 2005; 201(9): 1467 - 1478. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. R. McLean, O. A. Olsen, I. N. Watt, P. Rathanaswami, K. B. Leslie, J. S. Babcook, and J. W. Schrader Recognition of Human Cytomegalovirus by Human Primary Immunoglobulins Identifies an Innate Foundation to an Adaptive Immune Response J. Immunol., April 15, 2005; 174(8): 4768 - 4778. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. R. Talukder, D. D. Dudley, F. W. Alt, Y. Takahama, and Y. Akamatsu Increased frequency of aberrant V(D)J recombination products in core RAG-expressing mice Nucleic Acids Res., August 24, 2004; 32(15): 4539 - 4549. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. G. Cowell, M. Davila, K. Yang, T. B. Kepler, and G. Kelsoe Prospective Estimation of Recombination Signal Efficiency and Identification of Functional Cryptic Signals in the Genome by Statistical Modeling J. Exp. Med., January 20, 2003; 197(2): 207 - 220. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Kalmanovich and R. Mehr Models for Antigen Receptor Gene Rearrangement. III. Heavy and Light Chain Allelic Exclusion J. Immunol., January 1, 2003; 170(1): 182 - 193. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Goebel, A. Montalbano, N. Ayers, E. Kompfner, L. Dickinson, C. F. Webb, and A. J. Feeney High Frequency of Matrix Attachment Regions and Cut-Like Protein x/CCAAT-Displacement Protein and B Cell Regulator of IgH Transcription Binding Sites Flanking Ig V Region Genes J. Immunol., September 1, 2002; 169(5): 2477 - 2487. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |