|
Originally published In Press as doi:10.1074/jbc.M108895200 on December 7, 2001
J. Biol. Chem., Vol. 277, Issue 7, 5256-5264, February 15, 2002
Novel Baculovirus DNA Elements Strongly Stimulate Activities of
Exogenous and Endogenous Promoters*
Huei-Ru
Lo,
Cheng-Chung
Chou ,
Tzong-Yuan
Wu§,
Joyce Pui-Yee
Yuen, and
Yu-Chan
Chao¶
From the Institute of Molecular Biology, Academia Sinica, Nankang,
Taipei 115, Taiwan, Republic of China
Received for publication, September 14, 2001, and in revised form, December 2, 2001
 |
ABSTRACT |
A DNA sequence upstream from the
polyhedrin gene of baculovirus Autographa californica
nucleopolyhedrovirus (AcMNPV) was found to activate strongly the
expression of full or minimal promoters derived from AcMNPV and other
sources. Promoters tested included the minimal CMV (CMVm) promoter from
human cytomegalovirus, the full heat shock 70 promoter from
Drosophila, and the minimal p35 promoter from
baculovirus. Deletion and mutagenesis analyses showed that this
functional polyhedrin upstream (pu) activator sequence contains three open reading frames (ORFs), ORF4, ORF5, and
lef2. In plasmid transfection assays, the pu
sequence was able to confer high level luciferase expression driven by
all of these full or minimal promoters in insect Sf21 cells. A
known baculovirus enhancer, the homologous region (hr) of
AcMNPV, further enhanced the expression of these promoters. Experiments
showed that although multiple hr sequences function in an
additive manner, pu and hr together function
synergistically, resulting in as much as 18,000-fold promoter
activation. Furthermore, a modified CMVm promoter containing pu and/or hr was inserted into the baculovirus
genome to drive the luciferase coding region. The CMVm promoter
expressed luciferase much earlier, and although it expressed a bit less
than did the p10 promoter, the CMVm promoter gave rise to
greater luciferase activity. Therefore, we have uncovered a cryptic
viral sequence capable of activating a diverse group of promoters.
Finally, these experiments demonstrate that synthetic sequences
containing pu, hr, and different full or
minimal promoters can generate a set of essentially unlimited novel
promoters for weak to very strong expression of foreign proteins using baculovirus.
 |
INTRODUCTION |
In a previous study, we established a tetracycline-responsive
expression system (TRES)1 in
insect cells (1). The insect TRES contains two components. The first
component is a plasmid containing the p10 promoter, which
drives the tetracycline-controllable transactivator (p10-tTA); the
second component is a plasmid containing the tetracycline operator
(tetO) DNA sequence fused to a minimal CMV (CMVm) promoter and a reporter luciferase sequence further downstream from the promoter
(tetO-CMVm-Luc (2)). The CMVm is a sequence derived from the human
cytomegalovirus immediate-early promoter (2). In the insect TRES, tTA
is expressed from a transfected plasmid and binds to the fused
tetO and CMVm (tetO-CMVm) promoter to activate the
expression of luciferase. Essentially no luciferase activity can be
detected if the second component, tetO-CMVm-Luc, is transfected alone;
with cotransfection of the first component (p10-tTA), which expresses
tTA, strong luciferase activity can be observed (1). In a previous set
of experiments, we found that other than plasmid transfection, the
first component, p10-tTA, can also be expressed in a recombinant
baculovirus to make the TRES functional (1). In the present study, we
tested whether the second component, tetO-CMVm, could be inserted and
expressed in the genome of baculovirus for TRES functioning.
Surprisingly, although we found that the activity of the full CMV
promoter is extremely weak in insect cells (1), the CMVm promoter can
be stimulated strongly in the genome of a baculovirus without tTA
activation. The strong expression of the CMVm promoter could be seen by
either inserting this minimal promoter in the transfer plasmid pAcUW21
(PharMingen) or in the baculovirus genome. We reason that this may be
caused by the functioning of some genes or unknown enhancer sequences in the baculovirus genome, and thus the structure and function of these
auxiliary sequence are worthy of further investigation.
Baculoviruses consist of a group of viruses that contain circular
double-stranded DNA genomes of 90-160 kb (3). The circular 131-kb DNA
genome of Autographa californica nucleopolyhedrovirus (AcMNPV) is composed almost entirely of unique DNA sequences, except
for several small repeats known as homologous regions (hrs). The hrs, interspersed within the viral genome (4-6), have
been found to be enhancers for early gene transcription (6, 7) and as
origins of DNA replication (8, 9). The hrs form a complex
directly or indirectly with IE-1, an early viral regulatory protein
(10, 11), and with insect cellular proteins (12).
In infection of host insect cells by baculoviruses, three phases of
viral gene expression, namely early, late, and very late, can be
distinguished (13). Cells undergo significant changes during the first
6 h of infection, a time period that constitutes the early phase
of infection and precedes viral DNA replication. This early phase is
followed by the late phase, a period of extensive viral DNA
replication, late gene expression, and budding virus production. The
late phase extends from 6 h postinfection (hpi) to ~20-24 hpi.
The very late phase, also known as occlusion-specific phase, begins
around 20 hpi. In this phase, the very late gene products, p10
and polyhedrin, are produced in large amounts, and there is a clear
microscopic indication of the formation of inclusion bodies.
The baculovirus expression vector system is one of the most popular
systems for production of recombinant proteins. Recombinant proteins
are expressed at very high levels under the control of two very late
polyhedrin and p10 promoters (11, 12). Various sources have
suggested that the expression from a very late promoter is 10-20-fold
(13) or 50-fold (14) stronger than that from an early promoter or from
an insect promoter. However, the cellular machinery critical for
post-translational processing is generally in a deteriorated condition
during the late and very late phases of baculovirus infection.
Therefore, the use of early promoters for recombinant protein
expression is an alternative approach to improve protein quality,
although activities of the currently available early promoters are low
compared with those of the very late promoters.
In this article, we found that although the full CMV promoter is not
functioning properly in insect cells or baculoviruses, by the
stimulation of a baculovirus sequence upstream of the polyhedrin gene,
the CMVm promoter can be strongly activated. This polyhedrin gene
upstream activator sequence contains at least three open reading frames
(ORFs) and can strongly enhance the expression of various exogenous and
endogenous promoters. Some of these promoters could be activated
synergistically by this upstream sequence and hr and become
stronger than the p10 promoter in transient expression assays. During the early phase of viral infection, CMVm was expressed strongly in the recombinant baculoviruses. The proteins expressed by
the CMVm promoter were much less degraded with an activity better than
those produced by the p10 promoter. Thus, this upstream activator sequence is a novel type of activator identified from baculovirus.
 |
EXPERIMENTAL PROCEDURES |
Cell Cultures and Viruses
The Spodoptera frugiperda IPLB-Sf21
(Sf21) cell line was cultured as monolayers in TNM-FH insect
medium containing 8% heat-inactivated fetal bovine serum (15, 16). It
was used for propagation and infection of wild type AcMNPV. All viral
stocks were prepared and titers determined according to the standard
protocol described by O'Reilly et al. (17). All infections
and coinfections of virus AcMNPV were performed using a multiplicity of
infection of 1.
Plasmid Transfection for Transient Assay of Promoter
Activities
Plasmids tested for expression of protein tTA or luciferase were
transfected into 4 × 104 Sf21 cells seeded in
wells of a 96-well plate. Each plasmid at 0.1 µg was transfected
using 0.5 µg of Lipofectin (Invitrogen) per well in 50 µl of
serum-free TNM-FH according to the protocol provided by the
manufacturer. After transfection for 8-14 h at 27 °C, the
transfection medium was removed and replaced with 100 µl of TNM-FH
medium containing 8% heat-inactivated fetal bovine serum. After
incubation at 27 °C for 24 h, wild type AcMNPV at a
multiplicity of infection of 1 was added into Sf21 cells to assist the proper expression of the transfected promoters. Luciferase activity was assayed 3 days after infection.
Luciferase Activity Assay
Cells of each well were lysed for 10 min in 100 µl of culture
cell lysis reagent containing 100 mM potassium phosphate
(pH 7.8), 1 mM EDTA, 10% glycerol, 1% Triton X-100, and 7 mM -mercaptoethanol. After centrifugation at 14,000 rpm
for 10 min, the lysate supernatant (5-50 µl) was incubated in 180 µl of luciferase assay reagent containing 25 mM Tricine
(pH 7.8), 15 mM potassium phosphate (pH 7.8), 15 mM MgSO4, 4 mM EGTA, 1 mM ATP, and 0.1 mM dithiothreitol. 50 µl of
0.2 mM luciferin (Promega) solution was autoinjected, and
relative light units were measured by a luminometer (Berthold, Lumat LB
9501). The concentration of total protein in cell lysate was determined
using a Coomassie protein assay reagent kit (Pierce). Data (mean ± S.D.) were collected from triplicate assays of three independent
transfections or viral infection experiments.
Construction of Plasmids
Plasmids Containing CMVm and p10 Promoters--
Deletion
constructs are shown in the various figures together with their
activity assays. All PCR products were confirmed by DNA sequence
analysis. The CMVm and TRE-CMVm promoters were originally
constructed by Gossen and Bujard (2). The CMVm promoter encompasses the
sequence from +75 to 53 of the full CMV promoter, and the TRE-CMVm
promoter contains seven copies of the 42-bp tetO sequence
derived from Tn10 which are fused to the CMVm promoter (2). The
luciferase coding sequence from the pTRE-Luc plasmid (bp positions
507-2187, CLONTECH), driven by CMVm or TRE-CMVm promoters, was inserted into pAcUW21 (PharMingen,
Fig. 1) to replace the p10
promoter originally located in this plasmid. The resulting plasmids
were named pAPcmL and pAPtcmL, respectively (Fig. 1). The same
luciferase coding sequence from the pTRE-Luc plasmid was also cloned
into pAcUW21 under the control of the p10 promoter of AcMNPV
in the plasmid pAcUW21, and the resulting plasmid was named pAP10L
(Fig. 1). The full CMV promoter derived from pTet-Off (from bp
positions 68 to 673, CLONTECH) together with the
luciferase coding region were inserted into pAcUW21 in place of the
p10 promoter, and the resulting plasmid was named pAPcL
(Fig. 1). The coding region of the tTA transactivator protein, from
plasmid pTet-Off (CLONTECH) was cloned into pAcUW21
under control of the p10 promoter, and the resulting plasmid
was named pAP10T (Fig. 1).

View larger version (31K):
[in this window]
[in a new window]
|
Fig. 1.
Plasmids containing different promoter
constructs for the expression of luciferase. Different promoter
constructs were used to drive luciferase in plasmid pAcUW21
(PharMinging). Promoters used are the full CMV promoter
(p-CMV), the p10 promoter (p-p10) of
AcMNPV, the CMVm promoter (p-cm), and the TRE element fused
to CMVm promoter (p-tcm). All of these constructs are
located upstream of the polyhedrin gene. luc, the coding
region of luciferase gene; p-poly, polyhedrin promoter;
polh, the coding region of polyhedrin gene; polh
up, polyhedrin gene upstream region; polh down,
polyhedrin gene downstream region.
|
|
Deletion Constructs--
The polyhedrin gene (polh)
downstream sequences were deleted from plasmid pAPcmL (see Fig.
3A), and the resulting plasmid was named pAPcmL pd (see
Fig. 3B). Plasmid pAPcmL pd (see Fig. 3B) was
generated by first digesting pAPcmL (see Fig. 3A) with AlwNI, blunt ending it with T4 DNA polymerase, and then cutting it with
XhoI. The resulting fragment was subcloned into
XhoI-SmaI-digested plasmid pBluescript
(pBSKSM+, Stratagene). Plasmid pAPcmL pdu (see Fig.
3B) contains only partial polyhedrin gene upstream
sequences. This deletion construct was obtained by digesting pAPcmL
(see Fig. 3B) with BstXI, blunt ending it with T4
DNA polymerase, then further digesting it with XhoI,
followed by subcloning this BstXI-XhoI-digested
fragment into XhoI-SmaI-digested
pBSKSM+ (see Fig. 3B).
Plasmids pAPcmL pu1 to pAPcmL pu7 were constructed for deletion
analysis of the pu sequence (see Fig. 3C). The
pAPcmL pu1 was made by MluI digestion followed by
self-ligation of pAPcmL. Plasmids pAPcmL pu2 and pAPcmL pu3 were
generated by cutting pAPcmL with MluI and BglII
and then ligating, respectively, with a
5'-MluI/3'-BglII PCR-amplified product containing
pAPcmL nucleotides 1877-2562 and 2218-2562 (see Fig. 3C).
Plasmid pAPcmL pu4 was constructed by cutting pAPcmL with
MluI and BglII, blunt ending with T4 DNA polymerase, and re-ligating with T4 DNA ligase. To generate
pAPcmL pu5 and pAPcmL pu6, pAPcmL was digested with MluI
and BglII, and respectively ligated with the
5'-MluI/3'-BglII PCR-amplified product containing pAPcmL nucleotides 546-883 and 546-1198 (see Fig. 3C).
Plasmid pAPcmL pu7 was constructed by digesting pAPcmL with
BstXI and BglII, blunt ending with T4 DNA
polymerase, and re-ligating with T4 DNA ligase.
The ORF603 deletion construct pAPcmL 603 was generated by partial
digestion of pAPcmL with MluI and complete digestion with BglII followed by blunt ending and re-ligation. Plasmid
pAPcmL 4-5 was produced from pAPcmL pd first by MluI
partial digestion and then BglII complete digestion followed
by blunt ending and re-ligation. The derived plasmid (pBSKcmL), which
lacks ORF603, was digested further with NotI (in multiple
cloning sites at the 3'-end of ORF4) and partially cut with
MluI. These restriction sites were further blunt ended with
T4 DNA polymerase, re-ligated, and resulted in deletion of ORF4 and
part of the 5'-end of ORF5. This resulted plasmid pAPcmL 4-5.
3'-MluI and 5'-blunt ends were introduced into two
PCR-generated fragments from pAPcmL containing nucleotides 377-626 and
183-626 (Fig. 3C). Subcloning these into
NotI/blunt ended and MluI-digested pBSKcmL
produced the ORF4 deletion constructs of pAPcmL 41 and pAPcmL 42,
respectively. To test the role played by ORF5 alone, a frameshift
mutation was introduced into this ORF in plasmid pAPcmL pd. The
dinucleotide GC was inserted at positions 20 and 21 from the
translational initiation site of the ORF5 (original sequence:
ATGTATCGCACGTCAAGAATT; after GC insertion: ATGTATCGCACGTCAAGAAGCTT) to create a frameshift mutation.
The plasmid carrying this frameshift mutation was named pAPpu-5FcmL (see Fig. 3C).
Construction of Plasmids Containing the pu Sequence Up- and
Downstream from the CMVm Promoter--
All plasmids described in this
paragraph are listed in Fig. 3. Fragment cmL was derived from pTRE-Luc
(CLONTECH) containing only the CMVm promoter and a
luciferase coding sequence (Fig. 3). To produce pApu(D)cmL (Fig. 4),
pAPcmL 603 (see Fig. 3C) was digested with
AlwNI, blunt ended, and then cut with XhoI (for AlwNI and XhoI sites, see Fig. 3A).
The resulting fragment was subcloned into
XhoI-SmaI-digested pBSKSM+
(Stratagene). pApu(U)cmL (Fig. 4) was generated by inserting a
5'-AatII/3'-XhoI pu fragment amplified
by PCR containing the full-length ORF4, ORF5, and lef2 into
AatII-XhoI-digested pcmL (Fig. 1). The (D) and
(U) indicate that the pu sequence is located downstream or upstream, respectively, from the CMVm promoter.
Plasmids Containing the Luciferase Gene Driven by CMVm,
Minimal p35, and hsp70 Promoters--
All plasmids constructed as
described in the following paragraph are listed in Fig. 8. Construction
of plasmid pAPhcmL is described below. An
XhoI-digested hr1 PCR fragment (4, 18) was cloned
into pcmL to generate phcmL. Using PCR, a fragment
containing hr1-CMVm promoter-luc was produced
from phcmL and ligated into pAPtcmL, which had been
digested by XhoI and EcoRV to remove the
tet operators, CMVm promoter, and luc gene. This
resulted in pAPhcmL.
Plasmid phL was constructed from plasmid pTRE-Luc
(CLONTECH) by removing a
XhoI-BamHI fragment containing tet
operators and the CMVm promoter and replacing with an hsp70
promoter from pKih35hN (18). A PCR fragment that contains
the 457-bp hr1 region (4, 18) was generated from AcMNPV
genomic DNA by PCR using primers carrying XhoI site at both
ends. The fragment was ligated in front of the hsp70
promoter in phL to generate phhL. Primers to 5' of
hr1 and 3' of SV40 poly(A) of the luc gene in
phhL were used to generate a blunt ended PCR product
containing hr1-hsp70-luc. The product
was ligated into pCR-Blunt (Invitrogen) to generate an intermediate
plasmid pCRhhL, from which the fragment containing
hr1-hsp70-luc was obtained by
digestion and then ligated into pAcUW21 (PharMingen) to generate pAPhhL.
Using the megaprimer PCR technique (19), a 45-bp minimal p35
promoter (20) fused to the luc gene was generated from
AcMNPV genomic DNA and pTRE-Luc. The product was cloned into pCR-Blunt vector to yield p35ml. An XhoI-digested hr1
fragment was cloned into the XhoI site in front of the
minimal p35 promoter to yield ph35ml. A fragment
containing hr1, minimal p35 promoter, and the luc gene was obtained from ph35ml by
ApaI digestion, blunt ended, and cloned into pAcUW21 to generate pAPh35ml. All PCR-generated fragments mentioned
above were verified by sequencing.
Western Blot Assay
Protein samples, at 0.1 µg each, were fractionated on a 12%
SDS-PAGE and then transferred to a Hyperbond P membrane (Amersham Biosciences, Inc.). The membrane was blocked with Tris-buffered saline
(TTBS: 100 mM Tris, pH 7.4, 100 mM NaCl, and
0.1% Tween 20) containing 5% non-fat dry milk (Bio-Rad Laboratories)
at room temperature for 1 h with gentle shaking on an orbital
shaker. The membrane was incubated with 1:5,000 diluted anti-luciferase antibody (Cortex Biochem) in TTBS overnight at room temperature. Unbounded antibodies were removed by two 15-min washes and two 5-min
washes in fresh TTBS buffer at room temperature with shaking. Then the
membrane was incubated with 1:2,500 diluted horseradish peroxidase-conjugated antibody for 1 h at room temperature. After removing the unbound secondary antibody by the same washes in TTBS
buffer as described above, protein bands bound by the antibody were
visualized by developing the membrane using an enhanced
chemiluminescence kit (ECL; Amersham Biosciences, Inc.) following the
protocol provided by the manufacturer.
 |
RESULTS |
The CMVm Promoter Can Be Highly Stimulated in Plasmid or in
Baculovirus Genome--
In the present study, the baculovirus transfer
plasmid pAcUW21 (PharMingen) was the primary plasmid used for further
constructions. This plasmid contains an intact polyhedrin gene and a
p10 promoter; both the gene and the promoter are sandwiched
between lateral DNA fragments adjacent to the polyhedrin gene of the
baculovirus. In Fig. 1, the luciferase coding region, as driven by the
CMV, p10, CMVm, and tetO-CMVm promoters, was cloned into
plasmid pAcW21 to result in plasmids pAPcL, pAP10L, pAPcmL, and
pAPtcmL, respectively. The resultant recombinant viruses were termed
vAPcL, vAP10L, vAPcmL, and vAPtcmL, respectively. The promoter
p10 was also used to drive tTA to yield plasmid pAP10T and
virus vAP10T. Finally, plasmid pTRE-Luc (CLONTECH)
was used as a necessary control. This is a plasmid that lacks any
baculovirus sequence, and the tetO-CMVm promoter is used to drive the
luciferase coding region.
Previously, we showed that luciferase activity is extremely
low when pTRE-Luc is transfected into insect cells, but it can be
strongly stimulated by coinfection with vAP10T (1). However, we found
that when the tetO-CMVm promoter was inserted into plasmid pAcUW21,
resulting in the plasmid pAPtcmL (Fig. 1), the luciferase activity
could be increased without stimulation by tTA. More interestingly, luciferase activity was further highly stimulated upon coinfection with
wild type AcMNPV (Fig. 2A).
Viral stimulation of luciferase expression remained for the plasmid
pAPcmL (Fig. 2A). The only difference between plasmids
pAPtcmL and pAPcmL is the omission of a tetO sequence in
plasmid pAPcmL (Fig. 1). These experiments showed that although the
tetO element did not influence luciferase expression by the
CMVm promoter (in pAPtcmL, Fig. 2A), a short CMVm promoter
sequence (in pAPcmL) could give rise to strong luciferase expression in
the presence of baculovirus lateral fragments surrounding the
polyhedrin promoter. Contrarily, a longer sequence containing a full
CMV promoter (in pAPcL) blocked its high level expression. In addition
to not being expressed by plasmid transfection (Fig. 2A),
the full CMV promoter was also only weakly expressed upon infection of
recombinant baculovirus, regardless of the presence of the same
baculovirus lateral fragments (Fig. 2B). Thus, the viral
activation appeared to be restricted to a short CMVm promoter sequence
and required the presence the of polyhedrin gene lateral DNA fragments
of the baculovirus (Figs. 1 and 2).

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 2.
Promoter activity assay by plasmid
transfection. Panel A, luciferase activity assay by the
transfection of different plasmid constructs with (+) or without ( )
viral coinfection. Panel B, luciferase activity assay
by the infection of different sets of recombinant baculoviruses.
Panel C, luciferase activity assay by infection of the
recombinant virus, vAPtcmL. The tTA-producing virus, vAP10T, and
tetracycline (Tc, 0.1 µg/ml (1)) are added in some of the
experiments to test whether the expression of luciferase by vAPtcmL can
be controlled by tTA or tetracycline.
|
|
To determine whether viral activation of the CMVm promoter
only occurs in the plasmids or can also occur in the genome of the
virus, we further tested luciferase expression by infection of
recombinant viruses vAPcL, vAPtcmL, vAPcmL, and vAP10L. In order not to
miss clones with particularly high levels of luciferase expression,
multiple clones of separate recombinant viral constructs were isolated,
and the activities of promoters in different clones were tested
individually. All three tested individual vAPcL clones only expressed
weak luciferase activities. However, all individual vAPtcmL, vAPcmL,
and vAP10L clones gave rise to strong luciferase activities (Fig.
2B). The stimulation was obviously not related to the TRES
machinery because the luciferase activity of vAPtcmL infection was
neither further stimulated by the coinfection of vAP10T nor
significantly suppressed upon the addition of tetracycline (Fig.
2C).
Baculovirus Genomic Elements Are Important for the Activation of
the CMVm Promoter--
To identify the viral DNA sequences responsible
for the activation of the CMVm promoter, viral lateral fragments
appearing in the transfer vector were deleted separately using
convenient sites. According to genetic computer group (GCG) comparison,
pAPcmL (Fig. 3A) contains
seven baculovirus genes and ORFs that flank the CMVm promoter. To
investigate the roles of specific baculovirus genes or sequences in the
activation of CMVm promoter activity in baculoviruses, two deletion
plasmids were first constructed. The polyhedrin and the downstream
genes were deleted, which resulted in pAPcmL pd. With further
deletion of all or part of ORF4, ORF5, and lef2, a new
construct, pAPcmL pdu, resulted. The full luciferase activity in
cells transfected with pAPcmL followed by AcMNPV infection was used to
normalize the luciferase activity (as 100%) of the deleted plasmid
constructs. High luciferase activity remained in the transfection of
plasmid pAPcmL pd, suggesting that the polyhedrin downstream sequence
is not critical for the activation of the CMVm promoter (Fig.
3B). The construct pAPcmL pdu, which contains intact
ORF603, failed to support high luciferase expression (Fig.
3B). Therefore, viral sequences upstream of the polyhedrin gene are responsible for activation of CMVm promoter and thus deserve
further examination.

View larger version (19K):
[in this window]
[in a new window]
|
Fig. 3.
Characterization of the region responsible
for the activation of the CMVm promoter in baculovirus/insect cells
systems. Panel A, viral genes and ORFs contained in the
original plasmid pAPcmL are shown. Panels B and
C, analysis of luciferase expression in plasmids with
various deletions. In each panel, maps of the deleted
(blank bars) and remaining sequences (filled
bars) of plasmid pAPcmL are shown on the left;
normalized luciferase activities expressed by these clones are shown on
the right. Panel B, pAPcmL pd is the construct
with the complete deletion of the polyhedrin and its downstream
sequence, and pAPcmL pdu is the construct with the complete deletion
of polyhedrin and its downstream sequences and partial deletion of the
upstream sequences. Panel C, deletion analysis of the
pu sequence. pAPcmL pu1- pu7 are seven
pu-deleted constructs; pAPcmL 603 is the construct with
ORF603 deletion only; pAPcmL 4-5 is a construct with both ORF4 and
ORF5 deletions in addition to deletion of ORF603; pAPcmL 41- 42
are two constructs with partial deletion of ORF4 in addition to
deletion of ORF603. * denotes point mutation in ORF5. All plasmid
transfections in the experiments shown in panels B and
C are accompanied by coinfection of the wild type
AcMNPV.
|
|
Results of further deletions in the polyhedrin upstream sequence are
shown in Fig. 3C. All transient expression experiments were
done with coinfection of wild type AcMNPV. Because the only difference
between plasmids pAPcmL pd and pAPcmL pdu is the removal of ORF4,
ORF5, and lef2 from the former plasmid, these ORFs were further analyzed separately. Plasmids pAPcmL pu1, pAPcmL pu2, pAPcmL pu3, and pAPcmL pu4 are constructs that contain ORF4 with a
gradual removal of the ORF603 region. Transfection of these plasmids
showed that the existence of ORF4 alone has no effect on the activation
of the CMVm promoter. Plasmids pAPcmL pu5, pAPcmL pu6, pAPcmL pu7, and pAPcmL 603 are constructs containing a gradual extension of the viral DNA sequence from ORF4 to the lef2
region. Transfection of these constructs showed that plasmid
pAPcmL 603, the only plasmid that contains all three ORFs (ORF4,
ORF5, and lef2), gave rise to full activation of the CMVm
promoter. Deletion of ORF4 (pAPcmL 4-5, pAPcmL 41, and
pAPcmL 42), or both ORF4 and ORF5 (pAPcmL 4-5), from plasmid
pAPcmL 603, again, completely suppressed the activity of the CMVm promoter.
A previous set of experiments showed that the existence of ORF4,
ORF5, and lef2 confer full promoter activity. We have also demonstrated that the deletion of individual ORFs, lef2
(pAPcmL pu5, pAPcmL pu6, pAPcmL pu7) or ORF4 (pAP- cmL 41),
and pAPcmL 42 alone, abolished promoter activity. To test the role
played by ORF5 alone, a frameshift mutation in this ORF was also
constructed. It was found that the promoter activity was abolished
without having functional ORF5 (pAPpu-5FcmL, Fig. 3C). Thus,
with viral coinfection, all three ORFs, including ORF4, ORF5, and
lef2, are required and sufficient for strong activation of
the in cis-linked CMVm promoter. Mutation or deletion of any
single ORF abolishes promoter activity, and the promoter activity
cannot be activated by the combination of merely any two ORFs. Thus,
ORF4, ORF5, and lef2 all together will be termed as
polyhedrin upstream (pu) activator sequence, hereafter in
this paper.
The pu Sequence Is Only Functional in Cis in an
Orientation-independent Manner--
To determine whether the
pu sequence activates the CMVm promoter in cis or
in trans, plasmid pAcUW21, which contains the entire pu sequence, was cotransfected with pAPcmL pdu (three ORFs
deleted or truncated) or pAPcmL pu7 (lef2 truncated),
followed by AcMNPV coinfection (Fig. 4).
None of the expression levels in these two deleted clones (pAPcmL pdu
and pAPcmL pu7) was rescued by pAcUW21. When the pu
sequence was inserted upstream (pApu(U)cmL) or downstream (pApu(D)cmL)
of the CMVm promoter, the luciferase was expressed at a level similar
to that of pAPcmL (Fig. 4). These data indicate that the pu
sequence must be located in cis in an
orientation-independent manner for activation of the CMVm promoter.

View larger version (8K):
[in this window]
[in a new window]
|
Fig. 4.
Positional analysis of the pu
sequence for activation of the CMVm promoter. Plasmid pAPcmL
served as a control for 100% luciferase activity. pAcUW21 + pAPcmL pdu and pAcUW21 + pAPcmL pu7 are two sets of cotransfection
experiments. The pu sequence, which contains ORF4, ORF5, and
lef2, is located from around 1 to 1,500 bp in pAPcmL (see
Fig. 3A). The (U) indicates that the pu sequence
is located upstream of the CMVm promoter (p-cm), and the (D)
indicates that the pu sequence is located downstream of the
CMVm promoter. Transfection of different plasmids is shown on the
left, and normalized luciferase activity is shown on the
right. All transfections were done with coinfection of the
wild type AcMNPV.
|
|
The pu Sequence and hr Enhancer Function in a Synergistic
Manner--
The hrs have been shown to be enhancers for the
activation of many early baculovirus promoters (6, 7). To determine whether these enhancers also function to activate expression of the
CMVm promoter, a complete hr1 (4, 18) sequence was inserted upstream of the CMVm promoter in plasmids pcmL and pAPcmL, yielding the
new plasmids phcmL and pAPhcmL, respectively
(Fig. 5A). These newly
constructed plasmids were transfected into insect cells without (Fig.
5B) or with (Fig. 5C) coinfection with
baculovirus. Fig. 5B shows that without the coinfection of
virus, luciferase was not properly expressed solely by the transfection
of pcmL or pAPcmL, although baculovirus lateral fragments existed in
the latter plasmid. Similarly, luciferase was not properly expressed in
plasmid pAP10L without coinfection of virus (Fig. 5B).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 5.
Activation of the CMVm promoter by
pu and hr sequences with or without
viral coinfection. Panel A, map of constructs for
luciferase expression. polh up, polyhedrin upstream
sequence; polh down, polyhedrin downstream sequence.
Panel B, luciferase expression by transfection of individual
constructs without virus coinfection. Panel C, luciferase
expression by transfection of individual constructs with virus
coinfection.
|
|
With coinfection of baculovirus, luciferase was well expressed in all
plasmids by transfection (Fig. 5C). Although transfection of
plasmids pAPcmL and phcmL gave rise to better luciferase
activities than did transfection of pcmL, their activities were still
weaker than the luciferase activity expressed by transfection of
pAP10L. With the combination of pu and hr
sequences in the plasmid pAPhcmL, luciferase activity was
increased drastically (Fig. 5, B and C). Fig.
6 shows that although additional
hr copies only increased the activity of CMVm promoter
additively, pu and hr together
(pAPhcmL) function strikingly in a synergistic manner.
Further addition of more hr copies, again, only increased
the CMVm promoter activity additively (pAP4hcmL, Fig. 6).
With the synergistic effect of hr and pu
sequences upon viral coinfection, transient expression of the CMVm
promoter became much stronger than the p10 promoter, which
is one of the very strong very late baculovirus virus promoters (Figs.
5 and 6). Thus, a novel set of strong promoters, which are assembled randomly by pu and CMVm (termed PCm); or pu,
hr, and CMVm (named PHCm) sequences, can be created in the
future for the expression of foreign genes.

View larger version (37K):
[in this window]
[in a new window]
|
Fig. 6.
Cooperative activation of the CMVm promoter
by pu and/or hr sequences.
Activation of the CMVm promoter by either single and multiple
hr enhancers or cooperative activation by pu
and/or hr sequences is shown. h, clones contain
one hr sequence; 4 h, clones containing four
hr sequences. All transfections were done with coinfection
of the wild type AcMNPV. m.o.i., multiplicity of
infection.
|
|
Comparative Time Course and Quantitative Analysis of Protein
Expression Using the PHCm and p10 Promoters--
The transfer vector
pAPhcmL was recombined further into a baculovirus genome,
resulting in the recombinant virus vAPhcmL. A recombinant
baculovirus vAP10L, which expresses luciferase from the p10
promoter, was constructed as a control. The amounts of protein produced
by these two types of promoters were compared. Cells infected with
different recombinant viruses were harvested at 4 days postinfection
and subjected to Western blot analysis. More luciferase was produced by
vAP10L than by vAPhcmL or vAPcmL. Calibration using
standard luciferase (Promega Life Science) showed that the yields of
full-length 60-kDa luciferase bands were very similar, they were 205, 180, and 175 µg/ml, respectively, to these three recombinant viruses.
Interestingly, although the p10 promoter generated slightly
more full-length proteins, extensive luciferase degradation occurred.
The total luciferase produced by p10, both intact and
degraded, was found to be 405 µg/ml. In other words, half of the
luciferase produced by p10 was degraded (Fig.
7A).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 7.
Comparative luciferase expressions by
the infection of different recombinant baculoviruses. Panel
A, Western analysis of luciferase expressions by different
recombinant viruses. Lanes 5-8 are chromatographically
purified luciferase (Sigma) standards for the calibration of yields by
different recombinant viruses. Panel B, time course of
luciferase expressions by different recombinant viruses. Recombinant
viruses vAPcmL, vAPhcmL, and vAP10L were derived from
plasmids pAPcmL, pAPhcmL, and pAP10L, respectively.
WT, wild type AcMNPV used as a negative control.
|
|
Time course expression of luciferase activities by different
recombinant viruses was also compared. For infection of
vAPhcmL, luciferase expression was first detected at 4 hpi,
quickly reaching a plateau at 48 hpi. However, for vAP10L infection,
the first clear detection of luciferase expression occurred at 24 hpi,
eventually peaking at about 72 hpi (Fig. 7B). Although the total amount of luciferase protein expressed by vAP10L was about two
times greater than that expressed by vAPhcmL (Fig.
7A), the luciferase activity expressed by
vAPhcmL was two to three times higher than that expressed
by vAP10L at 96 hpi (Fig. 7B).
The pu Sequence Can Activate Other Full or Minimal
Promoters--
To determine whether the pu sequence is a
universal activator or only functional for the CMVm promoter, the full
heat shock 70 promoter and minimal p35 promoter were also
tested (Fig. 8). We found that
pu and hr sequences were able to activate all
three promoters with or without viral coinfection. However, much higher yields were observed upon coinfection with AcMNPV. Because these experiments involved many constructs under different experimental conditions, the levels of gene expressions vary broadly. To deal with
this variability, the level of luciferase expression of pcmL without
viral coinfection was set as 1 unit (1×). As shown previously, the
PHCm promoter highly expresses luciferase upon coinfection with AcMNPV
(pAPhcmL, Fig. 6). When compared with the 1 × basal
level of pcmL transfection, more than 18,000 × increase in
expression level could be achieved by pAPhcmL with viral
cotransfection (Fig. 8). A similar result was achieved with the
transfection of pAPhhL, which is a combination of the
pu and hr sequences together with heat shock 70 promoter (this will be referred to as PHH promoter). The minimal
p35 promoter was also highly activated, achieving a level of
1,960 × activation (pAPh35ml, Fig. 8), although the
activation level of this promoter was not as strong as those of the
PHCm and PHH promoters.

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 8.
Activation of different promoters by the
pu sequence. Constructs are on the
left, and expressions of luciferase are on the
right. Luciferase expression by pcmL without virus
coinfection was set as 1× for the calibration of multiples of
activation of other promoters. The luciferase coding region in plasmids
phL, phhL, and pAPhhL was driven by the full
heat shock 70 promoter, by hr plus the full heat shock 70 promoter, and by pu and hr, plus the full heat
shock 70 promoter, respectively. In addition, the luciferase coding
region in plasmids p35ml, ph35ml, and pAPh35ml
was driven by the baculovirus minimal p35 promoter, by
hr plus the minimal p35 promoter, and by
pu, hr, plus the minimal p35 promoter,
respectively. The minus sign and plus sign
indicate constructs without and with coinfection of the wild type
AcMNPV, respectively.
|
|
 |
DISCUSSION |
In this study, we have identified a pu sequence from
the genome of a baculovirus which can strongly activate the activity of
full or minimal promoters including the heat shock 70 promoter, the
CMVm promoter, and minimal p35 promoters in insect cells. Our experiments show that in cis linkage of the
pu sequence with the CMVm promoter is necessary for
activation of the target promoter. The pu sequence can
activate the CMVm promoter when either located up- or downstream from
the reporter gene. Although this is a characteristic of an enhancer,
the pu sequence is larger than conventional enhancer element. In this study, we found that hr can also act as an
enhancer on CMVm promoter. It was interesting that although more copies of hrs only increased the activity additively, the
pu region and hr sequence together functioned
synergistically to enhance the CMVm promoter to a very high expression
level (Fig. 6). These results suggest that although pu and
hr may function in different modes, they work in concert to
activate target promoters to a high level of gene expression.
The genomic structures of pu and hr differ
greatly. The pu sequence contains three ORFs or genes.
However, the hrs contain two to eight imperfect palindromic
repeats and can serve bifunctionally as an enhancer or an origin of DNA
replication (7, 9, 21-23). Interspersed throughout the genome of
baculovirus AcMNPV, there are five homologous regions (designed
hr1-hr5), with sizes from 400 to 800 bp (5). The
hr enhancer obviously can enhance the activity of the CMVm
promoter directly. It is also possible that hr may enhance
the activity of the putative promoters of the three ORFs in the
pu sequence and in turn directly or indirectly contribute to
better CMVm promoter activity. Another possibility is that hr may increase the DNA copy number by serving as a
replication origin for increased luciferase expression.
Among these three ORFs, lef2 is the best studied DNA
sequence in the pu sequence. This gene encodes one of the
late expression factors and is known to enhance expression of the late
promoter, vp39, and very late promoter, polh
(24). Furthermore, lef2 was found to assist the
transcription and DNA replication of a plasmid containing the
vp39 promoter of baculovirus (25, 26). Thus, it is possible
that lef2 may be involved in the transcription and/or
plasmid replication of the constructs used for the activation of the
CMVm, minimal p35, and heat shock 70 promoters in these studies. However, although our data showed that omission of
lef2 abolishes the function of pu (Fig.
3C), the presence of the lef2 gene or ORF alone
could not activate the CMVm promoter (data not shown). Another
experiment also showed that use of a heat shock 70 promoter, a
constitutive promoter to drive lef2 ORF also could not
activate CMVm promoter (data not shown). Coinfection of wild type
AcMNPV, which provides lef2 gene products in
trans, could not activate the CMVm promoter in a plasmid
without the complete pu sequence (Fig. 3C).
Because early promoter regions can function as
infection-dependent replicating sequences (27), the
promoter of lef2 may play a role for increasing the plasmid
copy numbers for better expression of the CMVm promoter.
Both ORF4 and ORF5 are less well studied than lef2. ORF4 is
a putative viral ORF whose function is not well characterized (4). In
Fig. 3C, we showed that any deletion of this ORF totally abolishes the activation capability of pu sequence. This
suggests that the ORF4 sequence is indispensable for the enhancing
effect of pu sequence. ORF5 does not seem to be essential
for the life cycle of baculoviruses because its truncation does not
affect late and very late gene expression (24). However, results of transient expression of plasmid pAPpu-5FcmL (Fig. 3C)
revealed that the frameshift mutation of this ORF abolished high level expression of the CMVm promoter. The presence of all three ORFs in the
pu sequence suggests that the protein products derived from
them may also play a role in the activation of target promoters. To
study the possible function(s) of these protein products in activation
of the CMVm promoter, we are currently analyzing the other two ORFs,
ORF4 and lef2, by frameshift mutagenesis using single
nucleotide insertion. Frameshift mutagenesis will abolish the
production of protein products without significantly changing the DNA
sequence in this 1.5-kb pu region, which may serve as enhancers. We hope that the results from these experiments will reveal
any possible function of these protein products in the activation of
various promoters in insect cells.
It is also worthy to note that a number of previous experiments have
shown that the full CMV promoter is not functioning properly in insects
or in baculoviruses (1, 28). We have found, however, that with the
activation of the pu sequence, the CMVm promoter, although
foreign to the baculovirus, functions very well in both systems.
Recently, Ramachandran et al. (29) identified two genomic regions (I and II) upstream from the polyhedrin gene which can influence transcription of the polyhedrin promoter. Interestingly, pu is sandwiched between regions I and II without
overlapping these two regions. Whether pu is only useful for
the activation of different promoters as shown in this report or is
also involved in the activation of the polyhedrin promoter is a topic
currently under investigation.
In these experiments, the polyhedrin gene, driven by one of the strong
very late promoters, was used as a marker for the identification of
recombinant viruses. The p10 promoter, another strong very late promoter (30, 31), was used for activity comparison with the PHCm
promoter. By using luciferase, a cytosolic protein, we found that the
amount of intact 60-kDa luciferase protein produced from the PHCm
promoter was about the same as that produced by the p10
promoter in recombinant baculoviruses. This was because of a serious
protein degradation resulting from the use of p10 promoter
(Fig. 7A). Extensive degradation of the engineered proteins is an ever existing problem in a baculovirus expression vector system
(32-34), and the use of the PHCm promoter probably offers one of the
best resolutions for obtaining biologically intact and functional
foreign proteins in the future.
Furthermore, when yields of luciferase were analyzed by activity, the
PHCm promoter gave rise to higher activity (more than 2-fold higher at
different stages) than did the p10 promoter (Fig. 7B). As mentioned earlier, for cytosolic proteins,
baculovirual very late promoters usually give much higher yields
(10-50-fold) of foreign proteins than early promoters (13, 14).
Therefore, the early PHCm promoter is probably stronger than most, if
not all, of the currently known early type promoters that can be
expressed in recombinant baculoviruses. It has been shown that the
unfolding of a protein may result in protease degradation (35, 36), and
improper protein modifications occur at a late stage of infection (37-39). These previous observations imply that the production of
relatively lower quantity of protein with better activity may be the
result of a relatively better folding or modifications on proteins
generated by the early type PHCm promoter than those generated by the
very late p10 promoter.
Thus, the synthetic PHCm early promoter provides an excellent
alternative to the very late promoters for the mass production of high
quality foreign proteins using baculovirus. Our experiments also showed
that pu is a potential activator for a broad range of full
or minimal promoters in the polyhedrin locus. The polyhedrin locus is
the most frequently used region in the baculovirus genome for the
expression of foreign genes using early, late, very late or exogenous
promoters (13, 14, 40, 41). It is now clear that most, if not all, of
the promoters inserted at this locus would be activated to high degrees
by the pu sequence. The levels of gene expression in this
locus should differ greatly from the expression levels in their
original loci, and such differences were largely neglected before.
Therefore, identification of the pu sequence also makes a
significant contribution to the understanding of the mechanisms for
foreign gene expression using baculovirus, even though the insertion of
different promoters to the polyhedrin locus has been a common and
prolonged practice since 1983 (42).
 |
ACKNOWLEDGEMENTS |
We thank Drs. D. Hou, J. W. Hardwick,
and D. Finley for reviewing the data and for useful discussions, and
K. J. Deen and D. Chamberlin for careful reading and editing of
the manuscript.
 |
FOOTNOTES |
*
This work was supported by a grant from the Academia Sinica
and Grant NSC 89-2313-B-001-003 from National Science Council, Taiwan,
Republic of China.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Present address: Institute of Biomedical Sciences, Academia
Sinica, Nankang, Taipei 115, Taiwan, ROC.
§
Present address: Institute of Biotechnology, National Chiayi
University, Chiayi 600, Taiwan, ROC.
¶
To whom correspondence should be addressed. Tel.:
886-2-2788-2697; Fax: 886-2-2788-2697 or 886-2-2782-6085; E-mail:
mbycchao@ ccvax.sinica.edu.tw.
Published, JBC Papers in Press, December 7, 2001, DOI 10.1074/jbc.M108895200
 |
ABBREVIATIONS |
The abbreviations used are:
TRES, tetracycline-responsive expression system;
AcMNPV, Autographa
californica nucleopolyhedrovirus;
CMVm, minimal CMV promoter;
hpi, hours postinfection;
hr, homologous region;
Luc, luciferase;
ORF, open reading frame;
PCm, promoter contains pu and CMVm;
PHCm, promoter contains pu, hr, and CMVm;
PHH, promoter contains pu, hr, and heat shock 70 promoter;
pu, polyhedrin upstream activator sequence;
Sf21, Spodoptera frugiperda cell;
tetO, tetracycline operator;
TRE, a sequence containing seven copies of the
tetO element;
Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl] glycine;
tTA, tetracycline-controllable transactivator.
 |
REFERENCES |
| 1.
|
Wu, T. Y.,
Lin, D. G.,
Chen, S. L.,
Chen, C. Y.,
and Chao, Y. C.
(2000)
J. Biotechnol.
80,
75-83[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Gossen, M.,
and Bujard, H.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
5547-5551[Abstract/Free Full Text]
|
| 3.
|
Blissard, G. W.,
and Rohrmann, G. F.
(1990)
Annu. Rev. Entomol.
35,
127-155[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Ayres, M. D.,
Howard, S. C.,
Kuzio, J.,
Lopez-Ferber, M.,
and Possee, R. D.
(1994)
Virology
202,
586-605[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Cochran, M. A.,
and Faulkner, P.
(1983)
J. Virol.
45,
961-970[Abstract/Free Full Text]
|
| 6.
|
Guarino, L. A.,
and Summers, M. D.
(1986)
J. Virol.
60,
215-223[Abstract/Free Full Text]
|
| 7.
|
Guarino, L. A.,
Gonzalez, M. A.,
and Summers, M. D.
(1986)
J. Virol.
60,
224-229[Abstract/Free Full Text]
|
| 8.
|
Kool, M.,
Voeten, J. T.,
Goldbach, R. W.,
Tramper, J.,
and Vlak, J. M.
(1993)
J. Gen. Virol.
74,
2661-2668[Abstract/Free Full Text]
|
| 9.
|
Pearson, M.,
Bjornson, R.,
Pearson, G.,
and Rohrmann, G.
(1992)
Science
257,
1382-1384[Abstract/Free Full Text]
|
| 10.
|
Choi, J.,
and Guarino, L. A.
(1995)
J. Virol.
69,
4548-4551[Abstract]
|
| 11.
|
Kovacs, G. R.,
Choi, J.,
Guarino, L. A.,
and Summers, M. D.
(1992)
J. Virol.
66,
7429-7437[Abstract/Free Full Text]
|
| 12.
|
Guarino, L. A.,
and Dong, W.
(1991)
J. Virol.
65,
3676-3680[Abstract/Free Full Text]
|
| 13.
|
Morris, T. D.,
and Miller, L. K.
(1992)
J. Virol.
66,
7397-7405[Abstract/Free Full Text]
|
| 14.
|
Jarvis, D. L.,
Weinkauf, C.,
and Guarino, L. A.
(1996)
Protein Expression Purif.
8,
191-203[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Lee, J. C.,
Chen, H. H.,
and Chao, Y. C.
(1998)
J. Virol.
72,
9157-9165[Abstract/Free Full Text]
|
| 16.
|
Lin, J. L.,
Lee, J. C., Li, M. L.,
and Chao, Y. C.
(1999)
J. Virol.
73,
128-139[Abstract/Free Full Text]
|
| 17.
|
O'Reilly, D. R.,
Miller, L. K.,
and Luckow, V. A.
(1994)
Baculovirus Expression Vectors: A Laboratory Manual
, Oxford University Press, New York
|
| 18.
|
Lee, J. C.,
and Chao, Y. C.
(1998)
J. Gen. Virol.
79,
2293-2300[Abstract]
|
| 19.
|
Barik, S.
(1997)
Methods Mol. Biol.
67,
173-182[Medline]
[Order article via Infotrieve]
|
| 20.
|
Rodems, S. M.,
and Friesen, P. D.
(1993)
J. Virol.
67,
5776-5785[Abstract/Free Full Text]
|
| 21.
|
Habib, S.,
Pandey, S.,
Chatterji, U.,
Burma, S.,
Ahmad, A. J.,
and Hasnain, S. E.
(1996)
DNA Cell Biol.
15,
737-747[Medline]
[Order article via Infotrieve]
|
| 22.
|
Kool, M.,
Voeten, J. T.,
Goldbach, R. W.,
and Vlak, J. M.
(1994)
Virology
198,
680-689[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Pearson, M. N.,
Bjornson, R. M.,
Ahrens, C.,
and Rohrmann, G. F.
(1993)
Virology
197,
715-725[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Passarelli, A. L.,
and Miller, L. K.
(1993)
J. Virol.
67,
2149-2158[Abstract/Free Full Text]
|
| 25.
|
Lu, A.,
and Miller, L. K.
(1995)
J. Virol.
69,
975-982[Abstract]
|
| 26.
|
Todd, J. W.,
Passarelli, A. L.,
and Miller, L. K.
(1995)
J. Virol.
69,
968-974[Abstract]
|
| 27.
|
Wu, Y.,
and Carstens, E. B.
(1996)
J. Virol.
70,
6967-6972[Abstract/Free Full Text]
|
| 28.
|
Pfeifer, T. A.,
Hegedus, D. D.,
Grigliatti, T. A.,
and Theilmann, D. A.
(1997)
Gene (Amst.)
188,
183-190[CrossRef][Medline]
[Order article via Infotrieve]
|
| 29.
|
Ramachandran, A.,
Jain, A.,
Arora, P.,
Bashyam, M. D.,
Chatterjee, U.,
Ghosh, S.,
Parnaik, V. K.,
and Hasnain, S. E.
(2001)
J. Biol. Chem.
276,
23440-23449[Abstract/Free Full Text]
|
| 30.
|
Vlak, J. M.,
Klinkenberg, F. A.,
Zaal, K. J.,
Usmany, M.,
Klinge-Roode, E. C.,
Geervliet, J. B.,
Roosien, J.,
and van Lent, J. W.
(1988)
J. Gen. Virol.
69,
765-776[Abstract/Free Full Text]
|
| 31.
|
Weyer, U.,
and Possee, R. D.
(1989)
J. Gen. Virol.
70,
203-208[Abstract/Free Full Text]
|
| 32.
|
Pham, M. Q.,
Naggie, S.,
Wier, M.,
Cha, H. J.,
and Bentley, W. E.
(1999)
Biotechnol. Bioeng.
62,
175-182[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Schmid, G.,
and Bischoff, A.
(1998)
in
New Developments and New Applications in Animal Cell Technology
(Werten, O.-W., ed)
, pp. 303-306, Kluwer Academia Publishers, The Netherlands
|
| 34.
|
Martensen, P. M.,
and Justesen, J.
(2001)
BioTechniques
30,
728-790
|
| 35.
|
Benaroudj, N.,
Tarcsa, E.,
Cascio, P.,
and Goldberg, A. L.
(2001)
Biochimie (Paris)
83,
311-318[Medline]
[Order article via Infotrieve]
|
| 36.
|
Noda, Y.,
Fujiwara, K.,
Yamamoto, K.,
Fukuno, T.,
and Segawa, S.
(1994)
Biopolymers
34,
217-226[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Jarvis, D. L.,
and Summers, M. D.
(1989)
Mol. Cell. Biol.
9,
214-223[Abstract/Free Full Text]
|
| 38.
|
Jarvis, D. L.,
Fleming, J. G. W.,
Kovacs, G. R.,
Summers, M. D.,
and Guarino, L. A.
(1990)
Bio/Technology
8,
950-955[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Murphy, C. I.,
Lennick, M.,
Lehar, S. M.,
Beltz, G. A.,
and Young, E.
(1990)
Genet. Anal. Tech. Appl.
7,
160-171[Medline]
[Order article via Infotrieve]
|
| 40.
|
Kost, T. A.,
and Condreay, J. P.
(1999)
Curr. Opin. Biotechnol.
10,
428-433[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Rapp, J. C.,
Wilson, J. A.,
and Miller, L. K.
(1998)
J. Virol.
72,
10197-10206[Abstract/Free Full Text]
|
| 42.
|
Smith, G. E.,
Summers, M. D.,
and Fraser, M. J.
(1983)
Mol. Cell. Biol.
3,
2156-2165[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. Y.-Y. Liu, C.-H. Wang, W.-K. Hsiao, H.-R. Lo, C. P. Wu, and Y. C. Chao
RING and Coiled-Coil Domains of Baculovirus IE2 Are Critical in Strong Activation of the Cytomegalovirus Major Immediate-Early Promoter in Mammalian Cells
J. Virol.,
April 15, 2009;
83(8):
3604 - 3616.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Y. Y. Liu, C. H. Wang, J. C. Wang, and Y. C. Chao
Stimulation of baculovirus transcriptome expression in mammalian cells by baculoviral transcriptional activators
J. Gen. Virol.,
August 1, 2007;
88(8):
2176 - 2184.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Viswanathan, B. Venkaiah, M. S. Kumar, S. Rasheedi, S. Vrati, M. D. Bashyam, and S. E. Hasnain
The Homologous Region Sequence (hr1) of Autographa californica Multinucleocapsid Polyhedrosis Virus Can Enhance Transcription from Non-baculoviral Promoters in Mammalian Cells
J. Biol. Chem.,
December 26, 2003;
278(52):
52564 - 52571.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|