Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M108895200 on December 7, 2001

J. Biol. Chem., Vol. 277, Issue 7, 5256-5264, February 15, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/7/5256    most recent
M108895200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lo, H.-R.
Right arrow Articles by Chao, Y.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lo, H.-R.
Right arrow Articles by Chao, Y.-C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Novel Baculovirus DNA Elements Strongly Stimulate Activities of Exogenous and Endogenous Promoters*

Huei-Ru Lo, Cheng-Chung ChouDagger, Tzong-Yuan Wu§, Joyce Pui-Yee Yuen, and Yu-Chan Chao

From the Institute of Molecular Biology, Academia Sinica, Nankang, Taipei 115, Taiwan, Republic of China

Received for publication, September 14, 2001, and in revised form, December 2, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

A DNA sequence upstream from the polyhedrin gene of baculovirus Autographa californica nucleopolyhedrovirus (AcMNPV) was found to activate strongly the expression of full or minimal promoters derived from AcMNPV and other sources. Promoters tested included the minimal CMV (CMVm) promoter from human cytomegalovirus, the full heat shock 70 promoter from Drosophila, and the minimal p35 promoter from baculovirus. Deletion and mutagenesis analyses showed that this functional polyhedrin upstream (pu) activator sequence contains three open reading frames (ORFs), ORF4, ORF5, and lef2. In plasmid transfection assays, the pu sequence was able to confer high level luciferase expression driven by all of these full or minimal promoters in insect Sf21 cells. A known baculovirus enhancer, the homologous region (hr) of AcMNPV, further enhanced the expression of these promoters. Experiments showed that although multiple hr sequences function in an additive manner, pu and hr together function synergistically, resulting in as much as 18,000-fold promoter activation. Furthermore, a modified CMVm promoter containing pu and/or hr was inserted into the baculovirus genome to drive the luciferase coding region. The CMVm promoter expressed luciferase much earlier, and although it expressed a bit less than did the p10 promoter, the CMVm promoter gave rise to greater luciferase activity. Therefore, we have uncovered a cryptic viral sequence capable of activating a diverse group of promoters. Finally, these experiments demonstrate that synthetic sequences containing pu, hr, and different full or minimal promoters can generate a set of essentially unlimited novel promoters for weak to very strong expression of foreign proteins using baculovirus.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In a previous study, we established a tetracycline-responsive expression system (TRES)1 in insect cells (1). The insect TRES contains two components. The first component is a plasmid containing the p10 promoter, which drives the tetracycline-controllable transactivator (p10-tTA); the second component is a plasmid containing the tetracycline operator (tetO) DNA sequence fused to a minimal CMV (CMVm) promoter and a reporter luciferase sequence further downstream from the promoter (tetO-CMVm-Luc (2)). The CMVm is a sequence derived from the human cytomegalovirus immediate-early promoter (2). In the insect TRES, tTA is expressed from a transfected plasmid and binds to the fused tetO and CMVm (tetO-CMVm) promoter to activate the expression of luciferase. Essentially no luciferase activity can be detected if the second component, tetO-CMVm-Luc, is transfected alone; with cotransfection of the first component (p10-tTA), which expresses tTA, strong luciferase activity can be observed (1). In a previous set of experiments, we found that other than plasmid transfection, the first component, p10-tTA, can also be expressed in a recombinant baculovirus to make the TRES functional (1). In the present study, we tested whether the second component, tetO-CMVm, could be inserted and expressed in the genome of baculovirus for TRES functioning. Surprisingly, although we found that the activity of the full CMV promoter is extremely weak in insect cells (1), the CMVm promoter can be stimulated strongly in the genome of a baculovirus without tTA activation. The strong expression of the CMVm promoter could be seen by either inserting this minimal promoter in the transfer plasmid pAcUW21 (PharMingen) or in the baculovirus genome. We reason that this may be caused by the functioning of some genes or unknown enhancer sequences in the baculovirus genome, and thus the structure and function of these auxiliary sequence are worthy of further investigation.

Baculoviruses consist of a group of viruses that contain circular double-stranded DNA genomes of 90-160 kb (3). The circular 131-kb DNA genome of Autographa californica nucleopolyhedrovirus (AcMNPV) is composed almost entirely of unique DNA sequences, except for several small repeats known as homologous regions (hrs). The hrs, interspersed within the viral genome (4-6), have been found to be enhancers for early gene transcription (6, 7) and as origins of DNA replication (8, 9). The hrs form a complex directly or indirectly with IE-1, an early viral regulatory protein (10, 11), and with insect cellular proteins (12).

In infection of host insect cells by baculoviruses, three phases of viral gene expression, namely early, late, and very late, can be distinguished (13). Cells undergo significant changes during the first 6 h of infection, a time period that constitutes the early phase of infection and precedes viral DNA replication. This early phase is followed by the late phase, a period of extensive viral DNA replication, late gene expression, and budding virus production. The late phase extends from 6 h postinfection (hpi) to ~20-24 hpi. The very late phase, also known as occlusion-specific phase, begins around 20 hpi. In this phase, the very late gene products, p10 and polyhedrin, are produced in large amounts, and there is a clear microscopic indication of the formation of inclusion bodies.

The baculovirus expression vector system is one of the most popular systems for production of recombinant proteins. Recombinant proteins are expressed at very high levels under the control of two very late polyhedrin and p10 promoters (11, 12). Various sources have suggested that the expression from a very late promoter is 10-20-fold (13) or 50-fold (14) stronger than that from an early promoter or from an insect promoter. However, the cellular machinery critical for post-translational processing is generally in a deteriorated condition during the late and very late phases of baculovirus infection. Therefore, the use of early promoters for recombinant protein expression is an alternative approach to improve protein quality, although activities of the currently available early promoters are low compared with those of the very late promoters.

In this article, we found that although the full CMV promoter is not functioning properly in insect cells or baculoviruses, by the stimulation of a baculovirus sequence upstream of the polyhedrin gene, the CMVm promoter can be strongly activated. This polyhedrin gene upstream activator sequence contains at least three open reading frames (ORFs) and can strongly enhance the expression of various exogenous and endogenous promoters. Some of these promoters could be activated synergistically by this upstream sequence and hr and become stronger than the p10 promoter in transient expression assays. During the early phase of viral infection, CMVm was expressed strongly in the recombinant baculoviruses. The proteins expressed by the CMVm promoter were much less degraded with an activity better than those produced by the p10 promoter. Thus, this upstream activator sequence is a novel type of activator identified from baculovirus.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Cell Cultures and Viruses

The Spodoptera frugiperda IPLB-Sf21 (Sf21) cell line was cultured as monolayers in TNM-FH insect medium containing 8% heat-inactivated fetal bovine serum (15, 16). It was used for propagation and infection of wild type AcMNPV. All viral stocks were prepared and titers determined according to the standard protocol described by O'Reilly et al. (17). All infections and coinfections of virus AcMNPV were performed using a multiplicity of infection of 1.

Plasmid Transfection for Transient Assay of Promoter Activities

Plasmids tested for expression of protein tTA or luciferase were transfected into 4 × 104 Sf21 cells seeded in wells of a 96-well plate. Each plasmid at 0.1 µg was transfected using 0.5 µg of Lipofectin (Invitrogen) per well in 50 µl of serum-free TNM-FH according to the protocol provided by the manufacturer. After transfection for 8-14 h at 27 °C, the transfection medium was removed and replaced with 100 µl of TNM-FH medium containing 8% heat-inactivated fetal bovine serum. After incubation at 27 °C for 24 h, wild type AcMNPV at a multiplicity of infection of 1 was added into Sf21 cells to assist the proper expression of the transfected promoters. Luciferase activity was assayed 3 days after infection.

Luciferase Activity Assay

Cells of each well were lysed for 10 min in 100 µl of culture cell lysis reagent containing 100 mM potassium phosphate (pH 7.8), 1 mM EDTA, 10% glycerol, 1% Triton X-100, and 7 mM beta -mercaptoethanol. After centrifugation at 14,000 rpm for 10 min, the lysate supernatant (5-50 µl) was incubated in 180 µl of luciferase assay reagent containing 25 mM Tricine (pH 7.8), 15 mM potassium phosphate (pH 7.8), 15 mM MgSO4, 4 mM EGTA, 1 mM ATP, and 0.1 mM dithiothreitol. 50 µl of 0.2 mM luciferin (Promega) solution was autoinjected, and relative light units were measured by a luminometer (Berthold, Lumat LB 9501). The concentration of total protein in cell lysate was determined using a Coomassie protein assay reagent kit (Pierce). Data (mean ± S.D.) were collected from triplicate assays of three independent transfections or viral infection experiments.

Construction of Plasmids

Plasmids Containing CMVm and p10 Promoters-- Deletion constructs are shown in the various figures together with their activity assays. All PCR products were confirmed by DNA sequence analysis. The CMVm and TRE-CMVm promoters were originally constructed by Gossen and Bujard (2). The CMVm promoter encompasses the sequence from +75 to -53 of the full CMV promoter, and the TRE-CMVm promoter contains seven copies of the 42-bp tetO sequence derived from Tn10 which are fused to the CMVm promoter (2). The luciferase coding sequence from the pTRE-Luc plasmid (bp positions 507-2187, CLONTECH), driven by CMVm or TRE-CMVm promoters, was inserted into pAcUW21 (PharMingen, Fig. 1) to replace the p10 promoter originally located in this plasmid. The resulting plasmids were named pAPcmL and pAPtcmL, respectively (Fig. 1). The same luciferase coding sequence from the pTRE-Luc plasmid was also cloned into pAcUW21 under the control of the p10 promoter of AcMNPV in the plasmid pAcUW21, and the resulting plasmid was named pAP10L (Fig. 1). The full CMV promoter derived from pTet-Off (from bp positions 68 to 673, CLONTECH) together with the luciferase coding region were inserted into pAcUW21 in place of the p10 promoter, and the resulting plasmid was named pAPcL (Fig. 1). The coding region of the tTA transactivator protein, from plasmid pTet-Off (CLONTECH) was cloned into pAcUW21 under control of the p10 promoter, and the resulting plasmid was named pAP10T (Fig. 1).


View larger version (31K):
[in this window]
[in a new window]
 
Fig. 1.   Plasmids containing different promoter constructs for the expression of luciferase. Different promoter constructs were used to drive luciferase in plasmid pAcUW21 (PharMinging). Promoters used are the full CMV promoter (p-CMV), the p10 promoter (p-p10) of AcMNPV, the CMVm promoter (p-cm), and the TRE element fused to CMVm promoter (p-tcm). All of these constructs are located upstream of the polyhedrin gene. luc, the coding region of luciferase gene; p-poly, polyhedrin promoter; polh, the coding region of polyhedrin gene; polh up, polyhedrin gene upstream region; polh down, polyhedrin gene downstream region.

Deletion Constructs-- The polyhedrin gene (polh) downstream sequences were deleted from plasmid pAPcmL (see Fig. 3A), and the resulting plasmid was named pAPcmLDelta pd (see Fig. 3B). Plasmid pAPcmLDelta pd (see Fig. 3B) was generated by first digesting pAPcmL (see Fig. 3A) with AlwNI, blunt ending it with T4 DNA polymerase, and then cutting it with XhoI. The resulting fragment was subcloned into XhoI-SmaI-digested plasmid pBluescript (pBSKSM+, Stratagene). Plasmid pAPcmLDelta pdu (see Fig. 3B) contains only partial polyhedrin gene upstream sequences. This deletion construct was obtained by digesting pAPcmL (see Fig. 3B) with BstXI, blunt ending it with T4 DNA polymerase, then further digesting it with XhoI, followed by subcloning this BstXI-XhoI-digested fragment into XhoI-SmaI-digested pBSKSM+ (see Fig. 3B).

Plasmids pAPcmLDelta pu1 to pAPcmLDelta pu7 were constructed for deletion analysis of the pu sequence (see Fig. 3C). The pAPcmLDelta pu1 was made by MluI digestion followed by self-ligation of pAPcmL. Plasmids pAPcmLDelta pu2 and pAPcmLDelta pu3 were generated by cutting pAPcmL with MluI and BglII and then ligating, respectively, with a 5'-MluI/3'-BglII PCR-amplified product containing pAPcmL nucleotides 1877-2562 and 2218-2562 (see Fig. 3C). Plasmid pAPcmLDelta pu4 was constructed by cutting pAPcmL with MluI and BglII, blunt ending with T4 DNA polymerase, and re-ligating with T4 DNA ligase. To generate pAPcmLDelta pu5 and pAPcmLDelta pu6, pAPcmL was digested with MluI and BglII, and respectively ligated with the 5'-MluI/3'-BglII PCR-amplified product containing pAPcmL nucleotides 546-883 and 546-1198 (see Fig. 3C). Plasmid pAPcmLDelta pu7 was constructed by digesting pAPcmL with BstXI and BglII, blunt ending with T4 DNA polymerase, and re-ligating with T4 DNA ligase.

The ORF603 deletion construct pAPcmLDelta 603 was generated by partial digestion of pAPcmL with MluI and complete digestion with BglII followed by blunt ending and re-ligation. Plasmid pAPcmLDelta 4-5 was produced from pAPcmLDelta pd first by MluI partial digestion and then BglII complete digestion followed by blunt ending and re-ligation. The derived plasmid (pBSKcmL), which lacks ORF603, was digested further with NotI (in multiple cloning sites at the 3'-end of ORF4) and partially cut with MluI. These restriction sites were further blunt ended with T4 DNA polymerase, re-ligated, and resulted in deletion of ORF4 and part of the 5'-end of ORF5. This resulted plasmid pAPcmLDelta 4-5. 3'-MluI and 5'-blunt ends were introduced into two PCR-generated fragments from pAPcmL containing nucleotides 377-626 and 183-626 (Fig. 3C). Subcloning these into NotI/blunt ended and MluI-digested pBSKcmL produced the ORF4 deletion constructs of pAPcmLDelta 41 and pAPcmLDelta 42, respectively. To test the role played by ORF5 alone, a frameshift mutation was introduced into this ORF in plasmid pAPcmLDelta pd. The dinucleotide GC was inserted at positions 20 and 21 from the translational initiation site of the ORF5 (original sequence: ATGTATCGCACGTCAAGAATT; after GC insertion: ATGTATCGCACGTCAAGAAGCTT) to create a frameshift mutation. The plasmid carrying this frameshift mutation was named pAPpu-5FcmL (see Fig. 3C).

Construction of Plasmids Containing the pu Sequence Up- and Downstream from the CMVm Promoter-- All plasmids described in this paragraph are listed in Fig. 3. Fragment cmL was derived from pTRE-Luc (CLONTECH) containing only the CMVm promoter and a luciferase coding sequence (Fig. 3). To produce pApu(D)cmL (Fig. 4), pAPcmLDelta 603 (see Fig. 3C) was digested with AlwNI, blunt ended, and then cut with XhoI (for AlwNI and XhoI sites, see Fig. 3A). The resulting fragment was subcloned into XhoI-SmaI-digested pBSKSM+ (Stratagene). pApu(U)cmL (Fig. 4) was generated by inserting a 5'-AatII/3'-XhoI pu fragment amplified by PCR containing the full-length ORF4, ORF5, and lef2 into AatII-XhoI-digested pcmL (Fig. 1). The (D) and (U) indicate that the pu sequence is located downstream or upstream, respectively, from the CMVm promoter.

Plasmids Containing the Luciferase Gene Driven by CMVm, Minimal p35, and hsp70 Promoters-- All plasmids constructed as described in the following paragraph are listed in Fig. 8. Construction of plasmid pAPhcmL is described below. An XhoI-digested hr1 PCR fragment (4, 18) was cloned into pcmL to generate phcmL. Using PCR, a fragment containing hr1-CMVm promoter-luc was produced from phcmL and ligated into pAPtcmL, which had been digested by XhoI and EcoRV to remove the tet operators, CMVm promoter, and luc gene. This resulted in pAPhcmL.

Plasmid phL was constructed from plasmid pTRE-Luc (CLONTECH) by removing a XhoI-BamHI fragment containing tet operators and the CMVm promoter and replacing with an hsp70 promoter from pKih35hN (18). A PCR fragment that contains the 457-bp hr1 region (4, 18) was generated from AcMNPV genomic DNA by PCR using primers carrying XhoI site at both ends. The fragment was ligated in front of the hsp70 promoter in phL to generate phhL. Primers to 5' of hr1 and 3' of SV40 poly(A) of the luc gene in phhL were used to generate a blunt ended PCR product containing hr1-hsp70-luc. The product was ligated into pCR-Blunt (Invitrogen) to generate an intermediate plasmid pCRhhL, from which the fragment containing hr1-hsp70-luc was obtained by digestion and then ligated into pAcUW21 (PharMingen) to generate pAPhhL.

Using the megaprimer PCR technique (19), a 45-bp minimal p35 promoter (20) fused to the luc gene was generated from AcMNPV genomic DNA and pTRE-Luc. The product was cloned into pCR-Blunt vector to yield p35ml. An XhoI-digested hr1 fragment was cloned into the XhoI site in front of the minimal p35 promoter to yield ph35ml. A fragment containing hr1, minimal p35 promoter, and the luc gene was obtained from ph35ml by ApaI digestion, blunt ended, and cloned into pAcUW21 to generate pAPh35ml. All PCR-generated fragments mentioned above were verified by sequencing.

Western Blot Assay

Protein samples, at 0.1 µg each, were fractionated on a 12% SDS-PAGE and then transferred to a Hyperbond P membrane (Amersham Biosciences, Inc.). The membrane was blocked with Tris-buffered saline (TTBS: 100 mM Tris, pH 7.4, 100 mM NaCl, and 0.1% Tween 20) containing 5% non-fat dry milk (Bio-Rad Laboratories) at room temperature for 1 h with gentle shaking on an orbital shaker. The membrane was incubated with 1:5,000 diluted anti-luciferase antibody (Cortex Biochem) in TTBS overnight at room temperature. Unbounded antibodies were removed by two 15-min washes and two 5-min washes in fresh TTBS buffer at room temperature with shaking. Then the membrane was incubated with 1:2,500 diluted horseradish peroxidase-conjugated antibody for 1 h at room temperature. After removing the unbound secondary antibody by the same washes in TTBS buffer as described above, protein bands bound by the antibody were visualized by developing the membrane using an enhanced chemiluminescence kit (ECL; Amersham Biosciences, Inc.) following the protocol provided by the manufacturer.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

The CMVm Promoter Can Be Highly Stimulated in Plasmid or in Baculovirus Genome-- In the present study, the baculovirus transfer plasmid pAcUW21 (PharMingen) was the primary plasmid used for further constructions. This plasmid contains an intact polyhedrin gene and a p10 promoter; both the gene and the promoter are sandwiched between lateral DNA fragments adjacent to the polyhedrin gene of the baculovirus. In Fig. 1, the luciferase coding region, as driven by the CMV, p10, CMVm, and tetO-CMVm promoters, was cloned into plasmid pAcW21 to result in plasmids pAPcL, pAP10L, pAPcmL, and pAPtcmL, respectively. The resultant recombinant viruses were termed vAPcL, vAP10L, vAPcmL, and vAPtcmL, respectively. The promoter p10 was also used to drive tTA to yield plasmid pAP10T and virus vAP10T. Finally, plasmid pTRE-Luc (CLONTECH) was used as a necessary control. This is a plasmid that lacks any baculovirus sequence, and the tetO-CMVm promoter is used to drive the luciferase coding region.

Previously, we showed that luciferase activity is extremely low when pTRE-Luc is transfected into insect cells, but it can be strongly stimulated by coinfection with vAP10T (1). However, we found that when the tetO-CMVm promoter was inserted into plasmid pAcUW21, resulting in the plasmid pAPtcmL (Fig. 1), the luciferase activity could be increased without stimulation by tTA. More interestingly, luciferase activity was further highly stimulated upon coinfection with wild type AcMNPV (Fig. 2A). Viral stimulation of luciferase expression remained for the plasmid pAPcmL (Fig. 2A). The only difference between plasmids pAPtcmL and pAPcmL is the omission of a tetO sequence in plasmid pAPcmL (Fig. 1). These experiments showed that although the tetO element did not influence luciferase expression by the CMVm promoter (in pAPtcmL, Fig. 2A), a short CMVm promoter sequence (in pAPcmL) could give rise to strong luciferase expression in the presence of baculovirus lateral fragments surrounding the polyhedrin promoter. Contrarily, a longer sequence containing a full CMV promoter (in pAPcL) blocked its high level expression. In addition to not being expressed by plasmid transfection (Fig. 2A), the full CMV promoter was also only weakly expressed upon infection of recombinant baculovirus, regardless of the presence of the same baculovirus lateral fragments (Fig. 2B). Thus, the viral activation appeared to be restricted to a short CMVm promoter sequence and required the presence the of polyhedrin gene lateral DNA fragments of the baculovirus (Figs. 1 and 2).


View larger version (17K):
[in this window]
[in a new window]
 
Fig. 2.   Promoter activity assay by plasmid transfection. Panel A, luciferase activity assay by the transfection of different plasmid constructs with (+) or without (-) viral coinfection. Panel B, luciferase activity assay by the infection of different sets of recombinant baculoviruses. Panel C, luciferase activity assay by infection of the recombinant virus, vAPtcmL. The tTA-producing virus, vAP10T, and tetracycline (Tc, 0.1 µg/ml (1)) are added in some of the experiments to test whether the expression of luciferase by vAPtcmL can be controlled by tTA or tetracycline.

To determine whether viral activation of the CMVm promoter only occurs in the plasmids or can also occur in the genome of the virus, we further tested luciferase expression by infection of recombinant viruses vAPcL, vAPtcmL, vAPcmL, and vAP10L. In order not to miss clones with particularly high levels of luciferase expression, multiple clones of separate recombinant viral constructs were isolated, and the activities of promoters in different clones were tested individually. All three tested individual vAPcL clones only expressed weak luciferase activities. However, all individual vAPtcmL, vAPcmL, and vAP10L clones gave rise to strong luciferase activities (Fig. 2B). The stimulation was obviously not related to the TRES machinery because the luciferase activity of vAPtcmL infection was neither further stimulated by the coinfection of vAP10T nor significantly suppressed upon the addition of tetracycline (Fig. 2C).

Baculovirus Genomic Elements Are Important for the Activation of the CMVm Promoter-- To identify the viral DNA sequences responsible for the activation of the CMVm promoter, viral lateral fragments appearing in the transfer vector were deleted separately using convenient sites. According to genetic computer group (GCG) comparison, pAPcmL (Fig. 3A) contains seven baculovirus genes and ORFs that flank the CMVm promoter. To investigate the roles of specific baculovirus genes or sequences in the activation of CMVm promoter activity in baculoviruses, two deletion plasmids were first constructed. The polyhedrin and the downstream genes were deleted, which resulted in pAPcmLDelta pd. With further deletion of all or part of ORF4, ORF5, and lef2, a new construct, pAPcmLDelta pdu, resulted. The full luciferase activity in cells transfected with pAPcmL followed by AcMNPV infection was used to normalize the luciferase activity (as 100%) of the deleted plasmid constructs. High luciferase activity remained in the transfection of plasmid pAPcmLDelta pd, suggesting that the polyhedrin downstream sequence is not critical for the activation of the CMVm promoter (Fig. 3B). The construct pAPcmLDelta pdu, which contains intact ORF603, failed to support high luciferase expression (Fig. 3B). Therefore, viral sequences upstream of the polyhedrin gene are responsible for activation of CMVm promoter and thus deserve further examination.


View larger version (19K):
[in this window]
[in a new window]
 
Fig. 3.   Characterization of the region responsible for the activation of the CMVm promoter in baculovirus/insect cells systems. Panel A, viral genes and ORFs contained in the original plasmid pAPcmL are shown. Panels B and C, analysis of luciferase expression in plasmids with various deletions. In each panel, maps of the deleted (blank bars) and remaining sequences (filled bars) of plasmid pAPcmL are shown on the left; normalized luciferase activities expressed by these clones are shown on the right. Panel B, pAPcmLDelta pd is the construct with the complete deletion of the polyhedrin and its downstream sequence, and pAPcmLDelta pdu is the construct with the complete deletion of polyhedrin and its downstream sequences and partial deletion of the upstream sequences. Panel C, deletion analysis of the pu sequence. pAPcmLDelta pu1-Delta pu7 are seven pu-deleted constructs; pAPcmLDelta 603 is the construct with ORF603 deletion only; pAPcmLDelta 4-5 is a construct with both ORF4 and ORF5 deletions in addition to deletion of ORF603; pAPcmLDelta 41-Delta 42 are two constructs with partial deletion of ORF4 in addition to deletion of ORF603. * denotes point mutation in ORF5. All plasmid transfections in the experiments shown in panels B and C are accompanied by coinfection of the wild type AcMNPV.

Results of further deletions in the polyhedrin upstream sequence are shown in Fig. 3C. All transient expression experiments were done with coinfection of wild type AcMNPV. Because the only difference between plasmids pAPcmLDelta pd and pAPcmLDelta pdu is the removal of ORF4, ORF5, and lef2 from the former plasmid, these ORFs were further analyzed separately. Plasmids pAPcmLDelta pu1, pAPcmLDelta pu2, pAPcmLDelta pu3, and pAPcmLDelta pu4 are constructs that contain ORF4 with a gradual removal of the ORF603 region. Transfection of these plasmids showed that the existence of ORF4 alone has no effect on the activation of the CMVm promoter. Plasmids pAPcmLDelta pu5, pAPcmLDelta pu6, pAPcmLDelta pu7, and pAPcmLDelta 603 are constructs containing a gradual extension of the viral DNA sequence from ORF4 to the lef2 region. Transfection of these constructs showed that plasmid pAPcmLDelta 603, the only plasmid that contains all three ORFs (ORF4, ORF5, and lef2), gave rise to full activation of the CMVm promoter. Deletion of ORF4 (pAPcmLDelta 4-5, pAPcmLDelta 41, and pAPcmLDelta 42), or both ORF4 and ORF5 (pAPcmLDelta 4-5), from plasmid pAPcmLDelta 603, again, completely suppressed the activity of the CMVm promoter.

A previous set of experiments showed that the existence of ORF4, ORF5, and lef2 confer full promoter activity. We have also demonstrated that the deletion of individual ORFs, lef2 (pAPcmLDelta pu5, pAPcmLDelta pu6, pAPcmLDelta pu7) or ORF4 (pAP- cmLDelta 41), and pAPcmLDelta 42 alone, abolished promoter activity. To test the role played by ORF5 alone, a frameshift mutation in this ORF was also constructed. It was found that the promoter activity was abolished without having functional ORF5 (pAPpu-5FcmL, Fig. 3C). Thus, with viral coinfection, all three ORFs, including ORF4, ORF5, and lef2, are required and sufficient for strong activation of the in cis-linked CMVm promoter. Mutation or deletion of any single ORF abolishes promoter activity, and the promoter activity cannot be activated by the combination of merely any two ORFs. Thus, ORF4, ORF5, and lef2 all together will be termed as polyhedrin upstream (pu) activator sequence, hereafter in this paper.

The pu Sequence Is Only Functional in Cis in an Orientation-independent Manner-- To determine whether the pu sequence activates the CMVm promoter in cis or in trans, plasmid pAcUW21, which contains the entire pu sequence, was cotransfected with pAPcmLDelta pdu (three ORFs deleted or truncated) or pAPcmLDelta pu7 (lef2 truncated), followed by AcMNPV coinfection (Fig. 4). None of the expression levels in these two deleted clones (pAPcmLDelta pdu and pAPcmLDelta pu7) was rescued by pAcUW21. When the pu sequence was inserted upstream (pApu(U)cmL) or downstream (pApu(D)cmL) of the CMVm promoter, the luciferase was expressed at a level similar to that of pAPcmL (Fig. 4). These data indicate that the pu sequence must be located in cis in an orientation-independent manner for activation of the CMVm promoter.


View larger version (8K):
[in this window]
[in a new window]
 
Fig. 4.   Positional analysis of the pu sequence for activation of the CMVm promoter. Plasmid pAPcmL served as a control for 100% luciferase activity. pAcUW21 + pAPcmLDelta pdu and pAcUW21 + pAPcmLDelta pu7 are two sets of cotransfection experiments. The pu sequence, which contains ORF4, ORF5, and lef2, is located from around 1 to 1,500 bp in pAPcmL (see Fig. 3A). The (U) indicates that the pu sequence is located upstream of the CMVm promoter (p-cm), and the (D) indicates that the pu sequence is located downstream of the CMVm promoter. Transfection of different plasmids is shown on the left, and normalized luciferase activity is shown on the right. All transfections were done with coinfection of the wild type AcMNPV.

The pu Sequence and hr Enhancer Function in a Synergistic Manner-- The hrs have been shown to be enhancers for the activation of many early baculovirus promoters (6, 7). To determine whether these enhancers also function to activate expression of the CMVm promoter, a complete hr1 (4, 18) sequence was inserted upstream of the CMVm promoter in plasmids pcmL and pAPcmL, yielding the new plasmids phcmL and pAPhcmL, respectively (Fig. 5A). These newly constructed plasmids were transfected into insect cells without (Fig. 5B) or with (Fig. 5C) coinfection with baculovirus. Fig. 5B shows that without the coinfection of virus, luciferase was not properly expressed solely by the transfection of pcmL or pAPcmL, although baculovirus lateral fragments existed in the latter plasmid. Similarly, luciferase was not properly expressed in plasmid pAP10L without coinfection of virus (Fig. 5B).


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 5.   Activation of the CMVm promoter by pu and hr sequences with or without viral coinfection. Panel A, map of constructs for luciferase expression. polh up, polyhedrin upstream sequence; polh down, polyhedrin downstream sequence. Panel B, luciferase expression by transfection of individual constructs without virus coinfection. Panel C, luciferase expression by transfection of individual constructs with virus coinfection.

With coinfection of baculovirus, luciferase was well expressed in all plasmids by transfection (Fig. 5C). Although transfection of plasmids pAPcmL and phcmL gave rise to better luciferase activities than did transfection of pcmL, their activities were still weaker than the luciferase activity expressed by transfection of pAP10L. With the combination of pu and hr sequences in the plasmid pAPhcmL, luciferase activity was increased drastically (Fig. 5, B and C). Fig. 6 shows that although additional hr copies only increased the activity of CMVm promoter additively, pu and hr together (pAPhcmL) function strikingly in a synergistic manner. Further addition of more hr copies, again, only increased the CMVm promoter activity additively (pAP4hcmL, Fig. 6). With the synergistic effect of hr and pu sequences upon viral coinfection, transient expression of the CMVm promoter became much stronger than the p10 promoter, which is one of the very strong very late baculovirus virus promoters (Figs. 5 and 6). Thus, a novel set of strong promoters, which are assembled randomly by pu and CMVm (termed PCm); or pu, hr, and CMVm (named PHCm) sequences, can be created in the future for the expression of foreign genes.


View larger version (37K):
[in this window]
[in a new window]
 
Fig. 6.   Cooperative activation of the CMVm promoter by pu and/or hr sequences. Activation of the CMVm promoter by either single and multiple hr enhancers or cooperative activation by pu and/or hr sequences is shown. h, clones contain one hr sequence; 4 h, clones containing four hr sequences. All transfections were done with coinfection of the wild type AcMNPV. m.o.i., multiplicity of infection.

Comparative Time Course and Quantitative Analysis of Protein Expression Using the PHCm and p10 Promoters-- The transfer vector pAPhcmL was recombined further into a baculovirus genome, resulting in the recombinant virus vAPhcmL. A recombinant baculovirus vAP10L, which expresses luciferase from the p10 promoter, was constructed as a control. The amounts of protein produced by these two types of promoters were compared. Cells infected with different recombinant viruses were harvested at 4 days postinfection and subjected to Western blot analysis. More luciferase was produced by vAP10L than by vAPhcmL or vAPcmL. Calibration using standard luciferase (Promega Life Science) showed that the yields of full-length 60-kDa luciferase bands were very similar, they were 205, 180, and 175 µg/ml, respectively, to these three recombinant viruses. Interestingly, although the p10 promoter generated slightly more full-length proteins, extensive luciferase degradation occurred. The total luciferase produced by p10, both intact and degraded, was found to be 405 µg/ml. In other words, half of the luciferase produced by p10 was degraded (Fig. 7A).


View larger version (24K):
[in this window]
[in a new window]
 
Fig. 7.   Comparative luciferase expressions by the infection of different recombinant baculoviruses. Panel A, Western analysis of luciferase expressions by different recombinant viruses. Lanes 5-8 are chromatographically purified luciferase (Sigma) standards for the calibration of yields by different recombinant viruses. Panel B, time course of luciferase expressions by different recombinant viruses. Recombinant viruses vAPcmL, vAPhcmL, and vAP10L were derived from plasmids pAPcmL, pAPhcmL, and pAP10L, respectively. WT, wild type AcMNPV used as a negative control.

Time course expression of luciferase activities by different recombinant viruses was also compared. For infection of vAPhcmL, luciferase expression was first detected at 4 hpi, quickly reaching a plateau at 48 hpi. However, for vAP10L infection, the first clear detection of luciferase expression occurred at 24 hpi, eventually peaking at about 72 hpi (Fig. 7B). Although the total amount of luciferase protein expressed by vAP10L was about two times greater than that expressed by vAPhcmL (Fig. 7A), the luciferase activity expressed by vAPhcmL was two to three times higher than that expressed by vAP10L at 96 hpi (Fig. 7B).

The pu Sequence Can Activate Other Full or Minimal Promoters-- To determine whether the pu sequence is a universal activator or only functional for the CMVm promoter, the full heat shock 70 promoter and minimal p35 promoter were also tested (Fig. 8). We found that pu and hr sequences were able to activate all three promoters with or without viral coinfection. However, much higher yields were observed upon coinfection with AcMNPV. Because these experiments involved many constructs under different experimental conditions, the levels of gene expressions vary broadly. To deal with this variability, the level of luciferase expression of pcmL without viral coinfection was set as 1 unit (1×). As shown previously, the PHCm promoter highly expresses luciferase upon coinfection with AcMNPV (pAPhcmL, Fig. 6). When compared with the 1 × basal level of pcmL transfection, more than 18,000 × increase in expression level could be achieved by pAPhcmL with viral cotransfection (Fig. 8). A similar result was achieved with the transfection of pAPhhL, which is a combination of the pu and hr sequences together with heat shock 70 promoter (this will be referred to as PHH promoter). The minimal p35 promoter was also highly activated, achieving a level of 1,960 × activation (pAPh35ml, Fig. 8), although the activation level of this promoter was not as strong as those of the PHCm and PHH promoters.


View larger version (23K):
[in this window]
[in a new window]
 
Fig. 8.   Activation of different promoters by the pu sequence. Constructs are on the left, and expressions of luciferase are on the right. Luciferase expression by pcmL without virus coinfection was set as 1× for the calibration of multiples of activation of other promoters. The luciferase coding region in plasmids phL, phhL, and pAPhhL was driven by the full heat shock 70 promoter, by hr plus the full heat shock 70 promoter, and by pu and hr, plus the full heat shock 70 promoter, respectively. In addition, the luciferase coding region in plasmids p35ml, ph35ml, and pAPh35ml was driven by the baculovirus minimal p35 promoter, by hr plus the minimal p35 promoter, and by pu, hr, plus the minimal p35 promoter, respectively. The minus sign and plus sign indicate constructs without and with coinfection of the wild type AcMNPV, respectively.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

In this study, we have identified a pu sequence from the genome of a baculovirus which can strongly activate the activity of full or minimal promoters including the heat shock 70 promoter, the CMVm promoter, and minimal p35 promoters in insect cells. Our experiments show that in cis linkage of the pu sequence with the CMVm promoter is necessary for activation of the target promoter. The pu sequence can activate the CMVm promoter when either located up- or downstream from the reporter gene. Although this is a characteristic of an enhancer, the pu sequence is larger than conventional enhancer element. In this study, we found that hr can also act as an enhancer on CMVm promoter. It was interesting that although more copies of hrs only increased the activity additively, the pu region and hr sequence together functioned synergistically to enhance the CMVm promoter to a very high expression level (Fig. 6). These results suggest that although pu and hr may function in different modes, they work in concert to activate target promoters to a high level of gene expression.

The genomic structures of pu and hr differ greatly. The pu sequence contains three ORFs or genes. However, the hrs contain two to eight imperfect palindromic repeats and can serve bifunctionally as an enhancer or an origin of DNA replication (7, 9, 21-23). Interspersed throughout the genome of baculovirus AcMNPV, there are five homologous regions (designed hr1-hr5), with sizes from 400 to 800 bp (5). The hr enhancer obviously can enhance the activity of the CMVm promoter directly. It is also possible that hr may enhance the activity of the putative promoters of the three ORFs in the pu sequence and in turn directly or indirectly contribute to better CMVm promoter activity. Another possibility is that hr may increase the DNA copy number by serving as a replication origin for increased luciferase expression.

Among these three ORFs, lef2 is the best studied DNA sequence in the pu sequence. This gene encodes one of the late expression factors and is known to enhance expression of the late promoter, vp39, and very late promoter, polh (24). Furthermore, lef2 was found to assist the transcription and DNA replication of a plasmid containing the vp39 promoter of baculovirus (25, 26). Thus, it is possible that lef2 may be involved in the transcription and/or plasmid replication of the constructs used for the activation of the CMVm, minimal p35, and heat shock 70 promoters in these studies. However, although our data showed that omission of lef2 abolishes the function of pu (Fig. 3C), the presence of the lef2 gene or ORF alone could not activate the CMVm promoter (data not shown). Another experiment also showed that use of a heat shock 70 promoter, a constitutive promoter to drive lef2 ORF also could not activate CMVm promoter (data not shown). Coinfection of wild type AcMNPV, which provides lef2 gene products in trans, could not activate the CMVm promoter in a plasmid without the complete pu sequence (Fig. 3C). Because early promoter regions can function as infection-dependent replicating sequences (27), the promoter of lef2 may play a role for increasing the plasmid copy numbers for better expression of the CMVm promoter.

Both ORF4 and ORF5 are less well studied than lef2. ORF4 is a putative viral ORF whose function is not well characterized (4). In Fig. 3C, we showed that any deletion of this ORF totally abolishes the activation capability of pu sequence. This suggests that the ORF4 sequence is indispensable for the enhancing effect of pu sequence. ORF5 does not seem to be essential for the life cycle of baculoviruses because its truncation does not affect late and very late gene expression (24). However, results of transient expression of plasmid pAPpu-5FcmL (Fig. 3C) revealed that the frameshift mutation of this ORF abolished high level expression of the CMVm promoter. The presence of all three ORFs in the pu sequence suggests that the protein products derived from them may also play a role in the activation of target promoters. To study the possible function(s) of these protein products in activation of the CMVm promoter, we are currently analyzing the other two ORFs, ORF4 and lef2, by frameshift mutagenesis using single nucleotide insertion. Frameshift mutagenesis will abolish the production of protein products without significantly changing the DNA sequence in this 1.5-kb pu region, which may serve as enhancers. We hope that the results from these experiments will reveal any possible function of these protein products in the activation of various promoters in insect cells.

It is also worthy to note that a number of previous experiments have shown that the full CMV promoter is not functioning properly in insects or in baculoviruses (1, 28). We have found, however, that with the activation of the pu sequence, the CMVm promoter, although foreign to the baculovirus, functions very well in both systems. Recently, Ramachandran et al. (29) identified two genomic regions (I and II) upstream from the polyhedrin gene which can influence transcription of the polyhedrin promoter. Interestingly, pu is sandwiched between regions I and II without overlapping these two regions. Whether pu is only useful for the activation of different promoters as shown in this report or is also involved in the activation of the polyhedrin promoter is a topic currently under investigation.

In these experiments, the polyhedrin gene, driven by one of the strong very late promoters, was used as a marker for the identification of recombinant viruses. The p10 promoter, another strong very late promoter (30, 31), was used for activity comparison with the PHCm promoter. By using luciferase, a cytosolic protein, we found that the amount of intact 60-kDa luciferase protein produced from the PHCm promoter was about the same as that produced by the p10 promoter in recombinant baculoviruses. This was because of a serious protein degradation resulting from the use of p10 promoter (Fig. 7A). Extensive degradation of the engineered proteins is an ever existing problem in a baculovirus expression vector system (32-34), and the use of the PHCm promoter probably offers one of the best resolutions for obtaining biologically intact and functional foreign proteins in the future.

Furthermore, when yields of luciferase were analyzed by activity, the PHCm promoter gave rise to higher activity (more than 2-fold higher at different stages) than did the p10 promoter (Fig. 7B). As mentioned earlier, for cytosolic proteins, baculovirual very late promoters usually give much higher yields (10-50-fold) of foreign proteins than early promoters (13, 14). Therefore, the early PHCm promoter is probably stronger than most, if not all, of the currently known early type promoters that can be expressed in recombinant baculoviruses. It has been shown that the unfolding of a protein may result in protease degradation (35, 36), and improper protein modifications occur at a late stage of infection (37-39). These previous observations imply that the production of relatively lower quantity of protein with better activity may be the result of a relatively better folding or modifications on proteins generated by the early type PHCm promoter than those generated by the very late p10 promoter.

Thus, the synthetic PHCm early promoter provides an excellent alternative to the very late promoters for the mass production of high quality foreign proteins using baculovirus. Our experiments also showed that pu is a potential activator for a broad range of full or minimal promoters in the polyhedrin locus. The polyhedrin locus is the most frequently used region in the baculovirus genome for the expression of foreign genes using early, late, very late or exogenous promoters (13, 14, 40, 41). It is now clear that most, if not all, of the promoters inserted at this locus would be activated to high degrees by the pu sequence. The levels of gene expression in this locus should differ greatly from the expression levels in their original loci, and such differences were largely neglected before. Therefore, identification of the pu sequence also makes a significant contribution to the understanding of the mechanisms for foreign gene expression using baculovirus, even though the insertion of different promoters to the polyhedrin locus has been a common and prolonged practice since 1983 (42).

    ACKNOWLEDGEMENTS

We thank Drs. D. Hou, J. W. Hardwick, and D. Finley for reviewing the data and for useful discussions, and K. J. Deen and D. Chamberlin for careful reading and editing of the manuscript.

    FOOTNOTES

* This work was supported by a grant from the Academia Sinica and Grant NSC 89-2313-B-001-003 from National Science Council, Taiwan, Republic of China.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Dagger Present address: Institute of Biomedical Sciences, Academia Sinica, Nankang, Taipei 115, Taiwan, ROC.

§ Present address: Institute of Biotechnology, National Chiayi University, Chiayi 600, Taiwan, ROC.

To whom correspondence should be addressed. Tel.: 886-2-2788-2697; Fax: 886-2-2788-2697 or 886-2-2782-6085; E-mail: mbycchao@ ccvax.sinica.edu.tw.

Published, JBC Papers in Press, December 7, 2001, DOI 10.1074/jbc.M108895200

    ABBREVIATIONS

The abbreviations used are: TRES, tetracycline-responsive expression system; AcMNPV, Autographa californica nucleopolyhedrovirus; CMVm, minimal CMV promoter; hpi, hours postinfection; hr, homologous region; Luc, luciferase; ORF, open reading frame; PCm, promoter contains pu and CMVm; PHCm, promoter contains pu, hr, and CMVm; PHH, promoter contains pu, hr, and heat shock 70 promoter; pu, polyhedrin upstream activator sequence; Sf21, Spodoptera frugiperda cell; tetO, tetracycline operator; TRE, a sequence containing seven copies of the tetO element; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl] glycine; tTA, tetracycline-controllable transactivator.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Wu, T. Y., Lin, D. G., Chen, S. L., Chen, C. Y., and Chao, Y. C. (2000) J. Biotechnol. 80, 75-83[CrossRef][Medline] [Order article via Infotrieve]
2. Gossen, M., and Bujard, H. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5547-5551[Abstract/Free Full Text]
3. Blissard, G. W., and Rohrmann, G. F. (1990) Annu. Rev. Entomol. 35, 127-155[CrossRef][Medline] [Order article via Infotrieve]
4. Ayres, M. D., Howard, S. C., Kuzio, J., Lopez-Ferber, M., and Possee, R. D. (1994) Virology 202, 586-605[CrossRef][Medline] [Order article via Infotrieve]
5. Cochran, M. A., and Faulkner, P. (1983) J. Virol. 45, 961-970[Abstract/Free Full Text]
6. Guarino, L. A., and Summers, M. D. (1986) J. Virol. 60, 215-223[Abstract/Free Full Text]
7. Guarino, L. A., Gonzalez, M. A., and Summers, M. D. (1986) J. Virol. 60, 224-229[Abstract/Free Full Text]
8. Kool, M., Voeten, J. T., Goldbach, R. W., Tramper, J., and Vlak, J. M. (1993) J. Gen. Virol. 74, 2661-2668[Abstract/Free Full Text]
9. Pearson, M., Bjornson, R., Pearson, G., and Rohrmann, G. (1992) Science 257, 1382-1384[Abstract/Free Full Text]
10. Choi, J., and Guarino, L. A. (1995) J. Virol. 69, 4548-4551[Abstract]
11. Kovacs, G. R., Choi, J., Guarino, L. A., and Summers, M. D. (1992) J. Virol. 66, 7429-7437[Abstract/Free Full Text]
12. Guarino, L. A., and Dong, W. (1991) J. Virol. 65, 3676-3680[Abstract/Free Full Text]
13. Morris, T. D., and Miller, L. K. (1992) J. Virol. 66, 7397-7405[Abstract/Free Full Text]
14. Jarvis, D. L., Weinkauf, C., and Guarino, L. A. (1996) Protein Expression Purif. 8, 191-203[CrossRef][Medline] [Order article via Infotrieve]
15. Lee, J. C., Chen, H. H., and Chao, Y. C. (1998) J. Virol. 72, 9157-9165[Abstract/Free Full Text]
16. Lin, J. L., Lee, J. C., Li, M. L., and Chao, Y. C. (1999) J. Virol. 73, 128-139[Abstract/Free Full Text]
17. O'Reilly, D. R., Miller, L. K., and Luckow, V. A. (1994) Baculovirus Expression Vectors: A Laboratory Manual , Oxford University Press, New York
18. Lee, J. C., and Chao, Y. C. (1998) J. Gen. Virol. 79, 2293-2300[Abstract]
19. Barik, S. (1997) Methods Mol. Biol. 67, 173-182[Medline] [Order article via Infotrieve]
20. Rodems, S. M., and Friesen, P. D. (1993) J. Virol. 67, 5776-5785[Abstract/Free Full Text]
21. Habib, S., Pandey, S., Chatterji, U., Burma, S., Ahmad, A. J., and Hasnain, S. E. (1996) DNA Cell Biol. 15, 737-747[Medline] [Order article via Infotrieve]
22. Kool, M., Voeten, J. T., Goldbach, R. W., and Vlak, J. M. (1994) Virology 198, 680-689[CrossRef][Medline] [Order article via Infotrieve]
23. Pearson, M. N., Bjornson, R. M., Ahrens, C., and Rohrmann, G. F. (1993) Virology 197, 715-725[CrossRef][Medline] [Order article via Infotrieve]
24. Passarelli, A. L., and Miller, L. K. (1993) J. Virol. 67, 2149-2158[Abstract/Free Full Text]
25. Lu, A., and Miller, L. K. (1995) J. Virol. 69, 975-982[Abstract]
26. Todd, J. W., Passarelli, A. L., and Miller, L. K. (1995) J. Virol. 69, 968-974[Abstract]
27. Wu, Y., and Carstens, E. B. (1996) J. Virol. 70, 6967-6972[Abstract/Free Full Text]
28. Pfeifer, T. A., Hegedus, D. D., Grigliatti, T. A., and Theilmann, D. A. (1997) Gene (Amst.) 188, 183-190[CrossRef][Medline] [Order article via Infotrieve]
29. Ramachandran, A., Jain, A., Arora, P., Bashyam, M. D., Chatterjee, U., Ghosh, S., Parnaik, V. K., and Hasnain, S. E. (2001) J. Biol. Chem. 276, 23440-23449[Abstract/Free Full Text]
30. Vlak, J. M., Klinkenberg, F. A., Zaal, K. J., Usmany, M., Klinge-Roode, E. C., Geervliet, J. B., Roosien, J., and van Lent, J. W. (1988) J. Gen. Virol. 69, 765-776[Abstract/Free Full Text]
31. Weyer, U., and Possee, R. D. (1989) J. Gen. Virol. 70, 203-208[Abstract/Free Full Text]
32. Pham, M. Q., Naggie, S., Wier, M., Cha, H. J., and Bentley, W. E. (1999) Biotechnol. Bioeng. 62, 175-182[CrossRef][Medline] [Order article via Infotrieve]
33. Schmid, G., and Bischoff, A. (1998) in New Developments and New Applications in Animal Cell Technology (Werten, O.-W., ed) , pp. 303-306, Kluwer Academia Publishers, The Netherlands
34. Martensen, P. M., and Justesen, J. (2001) BioTechniques 30, 728-790
35. Benaroudj, N., Tarcsa, E., Cascio, P., and Goldberg, A. L. (2001) Biochimie (Paris) 83, 311-318[Medline] [Order article via Infotrieve]
36. Noda, Y., Fujiwara, K., Yamamoto, K., Fukuno, T., and Segawa, S. (1994) Biopolymers 34, 217-226[CrossRef][Medline] [Order article via Infotrieve]
37. Jarvis, D. L., and Summers, M. D. (1989) Mol. Cell. Biol. 9, 214-223[Abstract/Free Full Text]
38. Jarvis, D. L., Fleming, J. G. W., Kovacs, G. R., Summers, M. D., and Guarino, L. A. (1990) Bio/Technology 8, 950-955[CrossRef][Medline] [Order article via Infotrieve]
39. Murphy, C. I., Lennick, M., Lehar, S. M., Beltz, G. A., and Young, E. (1990) Genet. Anal. Tech. Appl. 7, 160-171[Medline] [Order article via Infotrieve]
40. Kost, T. A., and Condreay, J. P. (1999) Curr. Opin. Biotechnol. 10, 428-433[CrossRef][Medline] [Order article via Infotrieve]
41. Rapp, J. C., Wilson, J. A., and Miller, L. K. (1998) J. Virol. 72, 10197-10206[Abstract/Free Full Text]
42. Smith, G. E., Summers, M. D., and Fraser, M. J. (1983) Mol. Cell. Biol. 3, 2156-2165[Abstract/Free Full Text]


Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
C. Y.-Y. Liu, C.-H. Wang, W.-K. Hsiao, H.-R. Lo, C. P. Wu, and Y. C. Chao
RING and Coiled-Coil Domains of Baculovirus IE2 Are Critical in Strong Activation of the Cytomegalovirus Major Immediate-Early Promoter in Mammalian Cells
J. Virol., April 15, 2009; 83(8): 3604 - 3616.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
C. Y. Y. Liu, C. H. Wang, J. C. Wang, and Y. C. Chao
Stimulation of baculovirus transcriptome expression in mammalian cells by baculoviral transcriptional activators
J. Gen. Virol., August 1, 2007; 88(8): 2176 - 2184.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Viswanathan, B. Venkaiah, M. S. Kumar, S. Rasheedi, S. Vrati, M. D. Bashyam, and S. E. Hasnain
The Homologous Region Sequence (hr1) of Autographa californica Multinucleocapsid Polyhedrosis Virus Can Enhance Transcription from Non-baculoviral Promoters in Mammalian Cells
J. Biol. Chem., December 26, 2003; 278(52): 52564 - 52571.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/7/5256    most recent
M108895200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lo, H.-R.
Right arrow Articles by Chao, Y.-C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lo, H.-R.
Right arrow Articles by Chao, Y.-C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement