 |
INTRODUCTION |
There is essentially no free copper in the cytoplasm of
Saccharomyces cerevisiae (1), and it is anticipated that
this applies to other cells. It has become apparent that copper
metallochaperones assist in the delivery of copper ions to target
proteins (such as superoxide dismutase) or to target compartments,
encouraging advantageous copper-protein partnerships while inhibiting
others en route (reviewed in Refs. 2-4). In
S. cerevisiae cells, copper is delivered to cytosolic
superoxide dismutase via CCS (5-8), to mitochondria via COX17
(9, 10) and to the Golgi via ATX1 (11, 12). It is feasible that the
lack of intracellular compartments in most prokaryotes (with the
crucial exception of most cyanobacteria) circumvents a requirement for
a network of copper metallochaperones (2), although Enterococcus
hirae contains an ATX1-like protein, CopZ, which is implicated in
efficient copper perception by the transcriptional regulator CopY (13).
Recent studies have allowed the formulation of hypotheses about how
copper is released from metallochaperones, but it is less clear how
and/or where copper metallochaperones acquire copper.
Cyanobacteria are believed to occupy an evolutionary transition in the
use of copper, the photosynthetic generation of dioxygen having
liberated this element from inorganic sulfides and made it available
for uptake and recruitment in emergent proteins (14). Photosynthetic
electron transport occurs at internal thylakoid membranes in higher
plant chloroplasts and in most cyanobacteria including
Synechocystis PCC 6803. It is possible to monitor copper trafficking to this internal compartment (with substantial copper requirements) in vivo in some of these organisms (15).
Within the thylakoid lumen is the soluble copper protein plastocyanin, which shuttles electrons between membranous photosystems (reviewed in
Ref. 16). Despite the pivotal role of plastocyanin in the primary
conversion of light to chemical energy within the biosphere, it has
been largely neglected in studies of the intracellular trafficking of
copper by metallochaperones. Thylakoid membranes of
Synechocystis PCC 6803 are also a site of respiratory
electron transport (17), and copper must be supplied to the CuA and the intramembranous CuB, sites of cytochrome oxidase.
The target for ATX1 in S. cerevisiae is CCC2 (12), a
Golgi-localized variant P-type ATPase (18), often termed CPx-type (19)
or P1-type (20). Copper-transporting CPx-type ATPases have
been described in bacteria, including cyanobacteria (21, 22), S. cerevisiae, higher plants, and man; representatives of this
protein family (reviewed in Ref. 23) are also known that transport
cadmium (24), zinc and lead (25-27), silver (28), and cobalt (29). We
recently described two such copper transporters in
Synechocystis PCC 6803, CtaA and PacS, both of which are
required for efficient switching to the use of copper in plastocyanin
rather than heme iron in cytochrome c6 for
photosynthetic electron transport (15). Disruption of ctaA
also reduced the total amount of copper cell
1, whereas
disruption of pacS conferred copper sensitivity. The presence of two CPx-type ATPases, one contributing to copper import as
well as one contributing to copper compartmentalization, makes this an
attractive model in which to study the action of any putative ATX1-like
copper metallochaperone in relation to understanding the mechanisms of
copper acquisition and release. This organism contains two additional
CPx-type ATPases, ZiaA and CoaT, which are known to be expressed in
response to and required for growth in (elevated) zinc (27) and cobalt
(29), respectively, highlighting questions about how structurally
related transporters discern and select different metals from a common
cytosol. Metallochaperones have not previously been documented in an
organism containing CPx-type ATPases with differing metal specificities.
The cytosolic N-terminal region of CCC2 contains two domains that form
a structure (
ferredoxin-like fold)
similar to the small (73 amino acids) soluble ATX1, with CCC2 and ATX1
possessing complementary acidic and basic surfaces (30). Both proteins contain the motif MXCXXC (X represents
any amino acid) required for metal binding and implicated in the
formation of bridged heterodimeric sites during copper transfer from
ATX1 to CCC2. The thermodynamic gradient for copper transfer in
vitro from ATX1 to an isolated amino-terminal domain of CCC2 is
shallow (31), raising questions about whether copper transfer is
vectoral in vivo and, if so, how? Open reading frame
(ORF)1 ssr2857
from the fully sequenced genome of Synechocystis PCC 6803 (32) encodes a 64-amino acid polypeptide with similarity to the
amino-terminal region of PacS (22%), the amino-terminal region of CtaA
(14%), and ATX1 (22%) and containing the motif CXXC but
with no associated methionine residue (Fig. 1). Several features
(described above) suggest that this could be a valuable organism for
studying copper metallochaperones, and the initial aim of this research
was therefore to establish whether or not the product of
ssr2857 interacts with amino-terminal regions of PacS and/or
CtaA to shuttle copper to the thylakoid. Our data support this, and
ssr2857 is designated atx1 although the target compartment, the proteins supplied, and the metal-binding motif are
distinct from eukaryotic ATX1.
We describe the production of mutants of Synechocystis PCC
6803 deficient in atx1, alone and in combination with
pacS or ctaA. Their phenotypes (i) show that the
action of atx1 is positive with respect to
copper-dependent thylakoid redox processes, (ii) show
that CtaA is not obligatory for Atx1 function, and (iii) are consistent
with Atx1 acting solely in the same pathway as PacS. We report in
vitro analyses of the copper binding properties of
Synechocystis PCC 6803 Atx1 and its capacity to exchange
copper with the amino-terminal region of PacS. We have exploited a
bacterial two-hybrid system to show in vivo interaction
between Synechocystis PCC 6803 Atx1 and the amino-terminal
region of PacS and a requirement for the CXXC motif of Atx1
for such interaction. An in vivo interaction between Atx1
and the amino-terminal region of CtaA was also detected. Optional
copper acquisition from the importer would imply reversal of the vector
for transfer between Atx1 and the different cytosolic N-terminal
regions of the two ATPases. Comparative modeling of these domains
therefore provides insight into the mechanisms that can facilitate
transfer. Finally, we report a lack of in vivo interaction
between Atx1 and amino-terminal regions of ZiaA and CoaT. This is the
first example of discriminatory target recognition by a
metallochaperone coinciding with discriminatory specificity of metal
transport by CPx-type ATPases.
| |
EXPERIMENTAL PROCEDURES |
Bacterial Strains, DNA Manipulations, and Southern
Analyses--
Synechocystis PCC 6803 was grown either in
liquid BG-11 medium (which contained 0.3 µM copper), on
medium C plates, or using BG-11-C that lacked copper as a micronutrient
element or BG-11-FC that also lacked micronutrient iron but contained
0.2 µM copper (15). Cells were transformed to antibiotic
resistance as described by Hagmann and Zuther (33). Escherichia
coli strains JM101, SURE, BL21, and BacterioMatchTM
(Stratagene) were grown in Luria-Bertani medium (34). DNA manipulations were performed as described by Sambrook et al. (34). Genomic DNA was purified from Synechocystis PCC 6803 using a
protocol previously described for plant cell cultures but excluding
CsCl gradients (35). Aliquots (10 µg) of DNA were digested with
selected restriction endonucleases, resolved by agarose gel
electrophoresis, transferred to nylon filters, and washed (after
probing) to a stringency of 0.5× SSC, 0.1% (w/v) SDS at 65 °C
(34). The sequences of all PCR and QuikChange (Stratagene) products
were validated by sequence determination (ABI Prism 377 DNA sequence
analyzer and Applied Biosystems 800 Molecular Biology Work station for sample preparation).
Insertional Inactivation of atx1 to Generate Single and Double
Mutants--
Synechocystis PCC 6803 genomic DNA was used as
a template for PCR with primers 5'-GGAAGCTCTTTACCGCAG-3' and
5'-GCTGCTACTATTCCGTCATAGG-3' to amplify a fragment, 2.2 kb, which
included ORF ssr2857 (atx1), which was ligated to
pGEMT (Promega) to create pCTNRX. Subsequently primers
5'-CAACTAACTGTACCCACGATATCCTGTGAAGCCTGTGCCG-3' with
5'-CGGCACAGGCTTCACAGGATATCGTGGGTACAGTTAGTTG-3' were used to introduce
an EcoRV site within atx1 (via QuikChange (Stratagene) site-directed mutagenesis according to the manufacturer's protocol), into which was ligated the chloramphenicol acetyl
transferase gene to generate pIN-ATX1.
Synechocystis PCC 6803 was transformed to chloramphenicol
resistance following incubation with pIN-ATX1 transformants selected on
solid medium containing 7.5 µg ml1 chloramphenicol
prior to growth in liquid medium. Interruption of atx1 by
insertion of the chloramphenicol acetyl transferase gene in all copies
of the Synechocystis PCC 6803 chromosome was confirmed by
Southern analysis using HincII-digested DNA and probing with
a 32P-labeled fragment of atx1 to identify a
diagnostic 2.26-kb fragment (1.76 kb in the wild type). An identical
procedure was used to inactivate atx1 in existing mutants
(15) deficient in pacS or ctaA, except that the
solid selective medium contained 25 µg ml1 kanamycin in
addition to chloramphenicol, whereas 50 µg ml1
kanamycin was added to liquid cultures of these strains.
Membrane Isolation and Assays of Cytochrome Oxidase
Activities--
Logarithmically growing cultures were subcultured on
alternate days (to ~ 1 × 106 cells
ml1) for a minimum of 7 days (to standardize growth
rates). Total membranes were prepared, and cytochrome oxidase assays
performed as described previously (15, 36) except that all assays were performed using freshly prepared membranes and freshly reduced cytochrome c. All comparisons relate to experiments
performed on a single day with equivalent trends having been observed
in separate experiments to avoid errors of interpretation resulting from day-to-day variability in these assays that possibly arise from
variation in the efficiency of reduction of the substrate and/or
changes in temperature.
Single Turnover Cytochrome Kinetics--
Measurements of
cytochromes f plus c6 were made by
analyses of flash-induced (xenon flashlamp, 15-microfarad capacitor at 1000 V, 6-µs half-peak width, filtered with RG625 glass filters and
delivered by two 10-mm diameter lightpipes to both sides of the sample
cuvette) absorbance changes (matrix deconvoluted at 554 nm) in whole
cells as described previously (15, 37, 38). Cells deficient in
ctaA were grown in BG-11-C medium supplemented with either
0.6 or 0.8 µM copper because we have previously
established (15) that such super-supplementation partly restores use of plastocyanin, increasing the likelihood of detecting phenotypes attributable to any impairment of copper trafficking to plastocyanin via Atx1. In all analyses the size of the transients did not increase on successive flashes, indicating that there was sufficient P700 to
cause full photooxidation of cytochromes f plus
c6 plus plastocyanin with a single flash. Hence,
only the 20-replicate average of the first flash transient is shown in
the figures.
Cloning, Production, and Quantification of Recombinant
Atx1--
Synechocystis PCC 6803 genomic DNA was used as
template for PCR with primers 5'-GTATCATTTCATATGACTATTCAACTAACT-3' and
5'-GGAGAATTCCGTCACTGTCTCGACCTCTGTTAC-3'. The amplified fragment of DNA
containing the atx1 ORF was ligated to pGEM-T prior to
subcloning into the NdeI/EcoRI sites of pET29a to
create pETATX1. Recombinant protein was generated in E. coli (BL21) exposed to copper (1 mM). Lysates (3 ml) were
applied to Sephadex G-75 (2.5 × 50 cm), and fractions (5 ml)
eluted in 25 mM Tris-HCl, pH 7.0 were analyzed for total
protein and for copper by atomic absorption spectrophotometry. Pooled
copper peak fractions were applied to Q-Sepharose and sequentially
eluted with 25 mM Tris-HCl, pH 7.0, followed by 0.7 M NaCl, 25 mM Tris-HCl, pH 7.0. Fractions were
again analyzed for copper and protein and copper-containing fractions
desalted on Sephadex G-25 in 25 mM Tris-HCl, pH 7.0. A
single prominent band of the anticipated size was detected by PAGE, and
the amino-terminal ten residues of sequence (Beckman LF 3000 protein
sequencer) confirmed the identity of the purified protein. A further
aliquot was hydrolyzed and analyzed for amino acid composition (Alta
Bioscience) to allow calibration of colorimetric estimations of Atx1
using Coomassie Blue R250 (correction factor = 2.46 compared with
bovine serum albumin).
Cloning, Production, and Quantification of Recombinant
PacSN--
Synechocystis PCC 6803 genomic DNA
was used as template for PCR with primers 5'-GAACATATGGCCCAAACCATC-3'
and 5'-GAAGAATTCTCATAACCCCGTTACCAATTTGGCCGA-3' (the latter annealing to
DNA 3' of the atx1 stop codon). The amplified fragment of
DNA containing codons 1-95 encoding the entire amino-terminal region
of PacS (Fig. 1), was ligated to pGEM-T prior to subcloning into the
NdeI/EcoRI sites of pET29a to create
pETPACSN. Recombinant protein was generated in E. coli (BL21) exposed to copper (1 mM). Lysates (1.5 ml)
were applied to Sephadex G-75 (1.5 × 20 cm), and fractions were
eluted in 50 mM potassium phosphate buffer, pH 7.0 analyzed
for total protein. Pooled low molecular weight protein fractions were
applied to contiguous columns of Q-Sepharose and SP-Sepharose eluted
with 50 mM potassium phosphate buffer, pH 7.0. A single
prominent band of the anticipated size was detected by PAGE. An aliquot
of protein was hydrolyzed and analyzed for amino acid composition (Alta
Bioscience) to allow calibration of colorimetric estimation of
PacSN (correction factor = 0.8 compared with bovine
serum albumin). Attempts to overexpress CtaAN have to date
produced low yields of soluble protein precluding further analyses.
Preparation of Apo and Copper-bound Recombinant
Proteins--
Proteins were incubated with reductant (10 mM dithiothreitol), transferred to a N2
atmosphere chamber, and fractionated on Sephadex G-25 equilibrated in
and eluted with hydrochloric acid, pH 2.0. If metallated protein was
required, recovered material was exposed to a 2-fold molar excess of
copper prior to the addition of 0.5 M potassium phosphate
buffer (pH 7.0) to return the pH to 7.0. The sample was further
fractionated on Sephadex G-25 equilibrated in and eluted with 50 mM potassium phosphate, pH 7.0. If an apo protein was
required, the same procedure was used but without the addition of
copper to the protein at pH 2.0.
Metal Transfer--
The method was an adaptation of that used to
investigate metal transfer between S. cerevisiae ATX1 and
Ccc2a (31). Aliquots (total volume of 0.5 ml in 50 mM
potassium phosphate, pH 7.0) of apoPacSN or copper-Atx1
were applied to Q-Sepharose (1-ml column) equilibrated with 50 mM potassium phosphate, pH 7.0, and eluted (0.5-ml
fractions) with 5 ml of the same buffer, followed by 5 ml of 1 M NaCl. All procedures were performed in a N2
atmosphere chamber using syringes to manually load and elute the
column. Identical aliquots of apoPacSN and copper-Atx1
(from the same two preparations on the same day) were mixed (total
volume again 0.5 ml) and similarly fractionated on Q-Sepharose. All
fractions were analyzed for protein using Coomassie Blue R250 and
adjusted using the respective correction factors for each protein.
Fractions were also analyzed for
p-(hydroxymercuri)phenylsulfonate (PMPS)-displaceable, 4-(2-pyridylazo)resorcinol-detectable metal (calibrated against copper), which allowed analysis of smaller volumes (at lower
concentrations) than would have been possible using atomic absorption spectrophotometry.
Analyses of Growth in Normal and Low Iron
Media--
Logarithmically growing cultures were subcultured on
alternate days for a minimum of 7 days and growth subsequently
monitored as described previously (15). BG-11-C was used to analyze
growth in the presence of iron and the absence of copper. To examine the effects of iron deprivation, cells were passaged twice in BG-11-FC
(15) supplemented with 3 mg ml1 ferric ammonium citrate
and once in BG-11-FC with no added iron before inoculation into
BG-11-FC supplemented with 10 µM deferoxamine mesylate.
Generation of Bacterial Two-hybrid Constructs Containing
pacSN, ctaAN, ziaAN,
coaTN, and atx1--
Synechocystis PCC 6803 genomic DNA was used as template for PCR with primers
5'-GAAGCGGCCGCAATGACTATTCAACTAACTG-3' with 5' GAAGAATTCGTCACTGTCTCGACCTCTGT for Atx1,
5'-GAAGCGGCCGCAATGGTTCAACTTTCCCCGAC-3' with
5'-GAAGAATTCGTAACGTTTTCCCTTGTCTC-3' for CtaAN, and
5'-GAAGCGGCCGCAATGGCCCAAACCATCAATCT-3' with
GAAGAATTCTTTGGCCGAAAACACGGGTTTC for PacSN. All PCR products included sequences encoding the respective polypeptides shown in Fig.
1, corresponding to regions preceding the first predicted transmembrane
-helix, and introduced restriction sites suitable for introduction
into BacterioMatchTM (Stratagene) two-hybrid vectors. PCR
products were ligated to pGEM-T prior to subcloning: atx1
into the NotI/EcoRI sites of pBT creating
pBTATX1; ctaAN and pacSN
into the BamHI/EcoRI sites of pTRG creating
pTRGCTAAN and pTRGPACSN, respectively. Primers 5'-GTACCCACCATTGCCTCTGAAGCCTCTGCCGAAGCTGCGACC-3' with
5'-GGTCACAGCTTCGGCAGAGGCTTCAGAGGCAATGGTGGGTAC-3' were used with pBTATX1
template DNA to convert both cysteine codons to serine codons via
QuikChange (Stratagene) site-directed mutagenesis, according to the
manufacturer's protocols. The resulting plasmid was termed pBTC12/15S.
Sequences encoding residues 1-38 and 1-111 of CoaT and ZiaA were
amplified from Synechocystis PCC 6803 genomic DNA using
primers 5'-GGATCCATGGTTGTAACTCCCCCTTCTTCTG-3' with
5'-CTCGAGCATCTGCCAGCCCAGAAAGACCAGC-3' for CoaTN and
5'-GGATCCATGACCCAATCTTCACCGCTCAAAAC-3' with
5'-CTCGAGTAGTTCTTGTTTCAGATTAAATTC-3' for ZiaAN. PCR
products were ligated to pGEM-T prior to subcloning into the
BamHI/XhoI sites of pTRG creating
pTRGCOATN and pTRGZIAAN, respectively.
Galactosidase Assays--
These were performed via a
microtiter plate-based procedure as used previously (29). Cells were
used with an A595 of 0.6 following
20 h of growth at 30 °C. Data shown in each figure relate to
the results of a replicated experiment performed on a single day.
Equivalent experiments were repeated on separate days with separate
transformants giving equivalent trends.
Structural Models--
Comparative protein models of bacterial
Atx1 were based upon the apo and metallated structures of ATX1 (39) via
satisfaction of the spatial restraints program (40) and viewed using a
Swiss protein database viewer.
| |
RESULTS |
The Product of ORF ssr2857, Atx1, Binds One Copper Atom via Thiol
Ligands--
To test whether ssr2857 encodes an ATX1-like
copper-protein, the gene was expressed in E. coli cells
grown in medium supplemented with 1 mM copper at the time
of protein production. Copper was co-purified with recombinant Atx1 of
Synechocystis PCC 6803. Copper was displaced from the
purified protein by PMPS (data not shown) consistent with thiol
coordination via the sole pair of cysteine residues (Fig.
1). The amount of Atx1-associated copper
was substoichiometric and variable in different preparations. In a
N2 atmosphere chamber, however, demetallation,
reconstitution with excess Cu+, and removal of unbound
metal by gel filtration on Sephadex G-25 recovered 30.2 nmol of Atx1
with 29.9 nmol of associated copper as determined by atomic absorption
spectrophotometry.
View larger version (30K):
[in this window]
[in a new window]
|
Fig. 1.
The product of ORF ssr2857
has sequence similarity to amino-terminal regions of PacS and
CtaA and to S. cerevisiae ATX1. An alignment of
the deduced product of ORF ssr2857, herein designated Atx1,
with predicted hydrophilic amino-terminal regions of the CPx-type
transporters PacS, CtaA, ZiaA, and CoaT from Synechocystis
PCC 6803 and ATX1 from S. cerevisiae is shown. Residues
identical to Synechocystis PCC 6803 Atx1 are
highlighted and the known (for ATX1) or predicted locations
of loops 1 and 5 are shown.
|
|
Atx1 Interacts with the Amino-terminal Region of PacS in a
Bacterial Two-hybrid Assay--
By analogy to ATX1 in S. cerevisiae, a most likely candidate partner for
Synechocystis PCC 6803 Atx1 is the amino-terminal region of
the copper transporter, PacS. PacS resides at the thylakoid membrane in
Synechococcus PCC 7942 (22) and contributes toward copper-dependent switching to the use of plastocyanin in
Synechocystis PCC 6803 (15). It is now possible to analyze
protein-protein interactions within a bacterial (E. coli)
cell (BacterioMatchTM, Stratagene), and therefore this
method has been used to identify partners for Atx1. Fig.
2A shows greatly enhanced
-galactosidase activity when Atx1 and the amino-terminal region of
PacS (PacSN) were used as target and bait within this
system compared with cells in which one or both partner(s) was/were
absent, the first in vivo observation of partner protein
interaction for a bacterial copper metallochaperone.
View larger version (22K):
[in this window]
[in a new window]
|
Fig. 2.
In a bacterial two-hybrid assay, Atx1
interacts with the amino-terminal domain PacSN via two
cysteine residues, with CtaAN, but not with
ZiaAN or CoaTN. A,
-galactosidase activity in E. coli
(BacterioMatchTM, Stratagene) either containing
(+), or not containing () atx1
and/or pacSN translational fusions within
plasmids pBT (bait) and pTRG (target). Enhanced activity was not
detected when the assay was repeated using the atx1 variant
C12/15S, in which cysteine codons 12 and 15 were converted to encode
serine (right panel). B, -galactosidase
activity in E. coli (BacterioMatchTM,
Stratagene) containing atx1 and either
pacSN, ctaAN,
ziaAN, or coaTN
translational fusions within plasmids pBT (bait) and pTRG (target).
Data are the means of triplicate determinations with S.E. (some errors
are too small to show above the columns). Similar trends were obtained
when the experiment was repeated on two further occasions using
independent transformants.
|
|
The Thiol Groups of the CXXC Motif of Atx1 Are Required for a
Detectable Two-hybrid Interaction with PacS--
Displacement of
copper from Synechocystis PCC 6803 Atx1 by PMPS implies
metal association with either or both cysteine 12 and cysteine 15 of
the CXXC motif. Metal binding to S. cerevisiae ATX1 involves an MXCXXC motif and transfer to
CCC2 is thought to involve ligands from MXCXXC
motifs of both partners; these are required for a detectable S. cerevisiae two-hybrid interaction using ATX1 and the isolated
domain of CCC2 (41). To further test our proposed analogy between
bacterial Atx1 and yeast ATX1, both cysteine 12 and cysteine 15 of
Synechocystis PCC 6803 Atx1 were converted to serine by
site-directed mutagenesis, and the bacterial two-hybrid interaction
with PacSN was reanalyzed. There was indeed no detectable
interaction between Atx1(C12/15S) and PacSN (Fig.
2A, second panel).
Atx1 Interacts with the Amino-terminal Region of CtaA in a
Bacterial Two-hybrid Assay--
Multiple different copper importers
are known to influence the activity of yeast ATX1, suggesting that it
may acquire metal indirectly without associating with the transporters
(42); however, unlike yeast, the principal importer in
Synechocystis PCC 6803 is a CPx-type ATPase. We have
therefore investigated whether bacterial Atx1 can form a stable
in vivo interaction with the amino-terminal region of CtaA.
Greatly enhanced -galactosidase activity was detected when Atx1 and
the amino-terminal region of CtaA (CtaAN) were used as
target and bait within the bacterial two-hybrid system compared with
cells in which one or both partner(s) was/were absent (data not shown).
The magnitude of activity was similar to that detected with Atx1 and
PacSN (Fig. 2B). Activity was similar to controls when the Atx1 mutant C12S/C15S was used in conjunction with CtaA (data not shown).
Atx1 Does Not Interact with the Amino-terminal Regions of ZiaA or
CoaT in a Bacterial Two-hybrid Assay--
The yeast genome encodes two
deduced CPx-type ATPases, but there is no evidence that either of these
ATPases handles metals other than copper. Synechocystis PCC
6803 therefore provides an opportunity to investigate possible
contributions of metallochaperones to metal specificity. Does bacterial
Atx1 solely interact with the amino-terminal domains of the copper
transporters, or can it interact with the equivalent regions of all
four CPx-type ATPases in this organism? There was no detectable
increase in -galactosidase activity when Atx1 and the amino-terminal
region of either ZiaA (ZiaAN) or CoaT (CoaTN)
were used within the bacterial two-hybrid system compared with cells in
which one or both partner(s) was/were absent (data not shown). Fig.
2B shows that the magnitude of activity generated by the
interaction of Atx1 with either PacSN or CtaAN is substantially greater than that obtained using either
ZiaAN or CoaTN.
The Amino-terminal Region of PacS Can Acquire Copper from Atx1 in
Vitro--
The observed in vivo interaction between
bacterial Atx1 and PacSN encourages a hypothesis that the
former donates copper to the latter. We have therefore tested whether
or not copper can transfer from Atx1 to the amino-terminal region of
PacSN in vitro. Atx1 associated strongly with
the Q-Sepharose anion exchange matrix whereas PacSN was not
retained (Fig. 3, upper
panels). Fractionation of in vitro metallated
copper-Atx1 confirmed co-migration of ~1.0 mol equivalent of copper
and conversely an absence of copper associated with in vitro
demetallated apoPacSN. Following co-incubation of two further, similar aliquots of the same preparations of
apoPacSN and copper-Atx1, the amount of copper associated
with Atx1 declined and, most importantly, copper became associated with
apoPacSN. This provides evidence in support of copper
trafficking from Atx1 to PacS. It remains formally possible that
in vitro these two proteins form a stable heterodimer that
dissociates upon chromatography, with copper then partitioning to
either partner. It is presumed that dissociation and metal transfer
occurs in vivo and is somehow driven in the direction of
PacS.
View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
Copper transfer from copper-Atx1 to
apoPacSN. Protein (open squares) and copper
(closed circles) concentrations of fractions eluted from
Q-Sepharose in the absence (first 5 ml) or presence (second 5 ml) of 1 M NaCl. Controls demonstrate that apoPacSN does
not bind to the column (top) whereas copper-Atx1 does bind
(middle). Identical second aliquots of the same two
preparations of copper-Atx1 and apoPacSN were mixed and
then chromatographed (bottom).
|
|
Cytochrome Oxidase Activity Is Less in Membranes Purified from
atx1 Synechocystis PCC 6803--
Evidence that bacterial Atx1
interacts with PacSN suggests a role in the supply of
copper to thylakoidal proteins. To test this assumption, mutant
Synechocystis PCC 6803(atx1) was obtained following integration of pIN-ATX1, which contains ORF
ssr2857 (atx1) interrupted by the chloramphenicol
acetyl transferase gene. Southern analysis confirmed integration via a
double homologous recombination event at the atx1 locus and
segregation of cells containing the antibiotic resistance gene in all
copies of the chromosome. Hereinafter the strain is called
atx1. There was indeed a small but statistically
significant decline in cytochrome oxidase activity in membranes
isolated from atx1 compared with wild type when cells
were cultured in BG-11-C medium (Fig.
4A).
View larger version (30K):
[in this window]
[in a new window]
|
Fig. 4.
Cytochrome oxidase activity in purified
membranes and kinetics of photooxidation of cytochrome
c6 in single and double mutants.
Cytochrome oxidase activity was determined using total membranes
purified from each of the genotypes after growth in BG-11-C medium.
Each analysis was performed in triplicate in each experiment, and each
panel represents an individual experiment performed on a single
occasion; some day-to-day variability in reaction rates was observed.
A, cytochrome oxidase activity is lower in purified
membranes from single mutants atx1 and pacS
but no lower in the double mutant atx1pacS.
B, cytochrome oxidase activity is lower in purified membranes from
atx1ctaA than in either respective single
mutant. C, kinetics of photooxidation and
re-reduction of cytochrome c6 in
copper-super-supplemented atx1ctaA and
ctaA. Light-induced absorbance change in intact cells was
deconvoluted at 554 nm for cytochrome c6 plus
f (A) in response to a 6-µs pulse of actinic light
(coincident with the drop in A) in cells grown in medium
super-supplemented with 0.8 µM copper. The magnitude of
the decrease in A and hence the relative amount of photooxidation of
cytochrome c6 is given on the left of
each trace. The subsequent rise corresponds to re-reduction
of cytochrome c6 by the cytochrome
b6f complex. Equivalent data were
obtained in two further experiments performed on separate occasions
with separate cultures (not shown) and also in a triplicated experiment
with cells super-supplemented with 0.6 µM copper (not
shown). The decrease in A was always greater, and the rate of return
swifter, in cells deficient in atx1 and ctaA
(bottom) compared with cells deficient in ctaA
alone (top).
|
|
ctaA and atx1 Are Additive, but pacS and atx1 Are Non-additive with
Respect to Cytochrome Oxidase Activity--
A most obvious hypothesis
is that CtaA, Atx1, and PacS act in a linear sequence to supply copper
to the thylakoid. Double mutants were therefore used to test for
epistasis. Synechocystis PCC 6803(atx1,ctaA) and
Synechocystis PCC 6803(atx1,pacS) were generated
via integration of pIN-ATX1 into the genome of kanamycin-resistant single mutants (15) Synechocystis PCC 6803(ctaA)
and Synechocystis PCC 6803(pacS). The single
transporter mutants are called ctaA and
pacS hereinafter. Southern analysis confirmed integration via a double homologous recombination event at the atx1
locus, and segregation of cells containing the antibiotic resistance gene in all copies of the chromosome in both strains, which are hereinafter called atx1ctaA and
atx1pacS. Membranes isolated from
pacS contain significantly less cytochrome oxidase
activity than either wild type or atx1 after growth in
BG-11-C medium. Significantly, cytochrome oxidase activity in membranes
from the double mutant atx1pacS was no less
than the lower of the single mutants, pacS (Fig.
4A). Thus, there is no evidence that Atx1 can influence
cytochrome oxidase activity without PacS. We previously reported a
decline in cytochrome oxidase activity in membranes isolated from
ctaA grown in BG-11-C (15). Here we report that activity
in membranes from the double mutant
atx1ctaA was significantly less than either
of the respective single mutants (Fig. 4B), showing that
Atx1 can still function in the absence of CtaA.
Photooxidation of Cytochrome c6 Is Greater and
Re-reduction Faster in atx1ctaA Compared with ctaA in
Copper-super-supplemented Media--
The observations that Atx1 from
Synechocystis PCC 6803 binds copper and is required for
normal levels of cytochrome oxidase activity support a role as a copper
metallochaperone in the supply, either directly or indirectly, of this
enzyme. Cytochrome oxidase has been detected at both the plasma
membrane and at the thylakoid membrane in this organism (43, 44)
although it is unclear whether it is active at the plasma membrane.
Photosynthetic electron transport occurs exclusively at the thylakoid
(43). Some cyanobacteria and green algae (Ref. 45 and citations
therein) adapt to inadequate copper supply by exploiting heme iron in
cytochrome c6 as an alternative to copper in
plastocyanin for shuttling electrons inside the thylakoid lumen (from
one membranous photosystem to the other). Does Atx1 contribute to
efficient switching from cytochrome c6 to plastocyanin?
Photosynthetic electron flow through cytochrome
c6 can be monitored in intact cells as the
decrease in absorbance deconvoluted at 554 nm upon exposure to a pulse
of actinic light (46) (in the dark the pool of cytochrome
c6 is largely reduced). At increasing [copper]
there is an inverse relationship between the magnitudes of
photooxidation of cytochrome c6 and
plastocyanin, with less of the former and more of the latter (15, 45,
46). We previously established that in medium containing 0.2 µM copper, photooxidation of cytochrome
c6 is greater in both ctaA and
pacS compared with wild-type cells; this correlates with
an increase in cytochrome c6 and a decrease in
plastocyanin transcript abundance (15). Super-supplementation of
ctaA with 0.8 µM copper partly reversed the
phenotype, presumably because of copper acquisition via other (perhaps
nonspecific) metal transporters, partly restoring the use of
plastocyanin (15). Here we have examined photosynthetic electron
transport in ctaA cells because the phenotype
attributable to atx1 with respect to cytochrome oxidase
activity (Fig. 4B) was most severe in a ctaA
background. Fig. 4C shows that the magnitude of the decrease
in A deconvoluted at 554 nm was greater in
atx1ctaA compared with ctaA,
implying impaired trafficking of copper to thylakoidal plastocyanin in
cells that do not contain Atx1. Equivalent trends were observed in
three independent experiments. In addition, it was noted that
re-reduction of cytochrome c6 was substantially
faster in cells deficient in atx1. This is consistent with
impaired activity of thylakoidal cytochrome oxidase because cytochrome
c6 can either donate electrons to photosystem I
or to cytochrome oxidase, and the absence of the latter leads to the
accumulation of a larger pool of reduced electron donors for cytochrome
c6.
atx1 Is Hypersensitive to Low Iron--
It was speculated that
a greater dependence upon cytochrome c6 rather
than plastocyanin for photosynthetic electron transport in
atx1 could confer a greater dependence on iron. Iron
deficiency generated by subculture in medium containing the iron
chelator deferoxamine mesylate slowed the growth of both wild-type and atx1 cells (compare y-axes on the two panels
of Fig. 5). Mutants deficient in Atx1
were even more sensitive to low iron than wild-type cells; this was
observed in two further replicate experiments (not shown). Note that
the errors on Fig. 5 are too small to show above and below the data
points. There was no significant difference in copper tolerance of
atx1 compared with wild type (data not shown).
View larger version (17K):
[in this window]
[in a new window]
|
Fig. 5.
Growth of atx1
is more severely impaired than wild type by an iron
chelator. Wild-type (squares) and atx1
(circles) cultures were grown in either BG-11-C (left
panel) or BG-11-FC supplemented with the iron chelator
deferoxamine mesylate (right panel). Data are the means of
triplicate determinations with S.E. (bars are too small to
be visible), and equivalent trends have been observed on two further
occasions.
|
|
| |
DISCUSSION |
Several lines of evidence (Figs. 2-5) support a role for
Synechocystis PCC 6803 Atx1 in the delivery of copper via
PacS to the thylakoid, providing copper for proteins involved in
photosynthetic and respiratory electron transport. It remains to be
reported whether or not analogous proteins target copper to thylakoidal plastocyanin in plant chloroplasts. That atx1 is required
for optimal cytochrome oxidase activity in a ctaA
background (Fig. 4) implies that Atx1 can acquire copper from other
locations, although it clearly does also interact with CtaA (Fig. 2).
It is proposed that bacterial Atx1, and by analogy some eukaryotic copper metallochaperones, contribute toward the efficient reuse of cell
copper by scavenging from weak cytosolic sites. Structural models of
bacterial Atx1, PacSN, and CtaAN suggest
mechanisms of ligand exchange, which, though subtly different, provide
support to those proposed for copper release from eukaryotic ATX1. The absence of any detectable interaction between Atx1 and the
amino-terminal regions of ZiaA and CoaT (Fig. 2) illustrates a
contribution of protein-protein interactions in determining metal
specificity, i.e. which metals go to which locations within
a cell.
Mutants deficient in PacS are impaired in switching from the use of
heme iron in cytochrome c6 to the use of copper
in plastocyanin for photosynthetic electron transport, which is thought
to result from a loss of thylakoid copper import by PacS (15). Here we also show loss of cytochrome oxidase activity in pacS
(Fig. 4). The association of similar phenotypes with atx1
coupled with the observation that Atx1 can interact in vivo
with (Fig. 2) and transfer copper in vitro to (Fig. 3)
PacSN supports a model in which Atx1 delivers copper to
PacS for thylakoid import (Fig.
6A). This model is analogous
to the delivery of copper to Golgi-localized CCC2 by ATX1 in S. cerevisiae, even though one of the proteins indirectly supplied by
Atx1 in Synechocystis PCC 6803, cytochrome oxidase, is a
target for the mitochondrial copper metallochaperone COX17 in S. cerevisiae (reviewed in Ref. 2). PacS appears to be the sole route
for Atx1-bound copper to reach cytochrome oxidase because the genes are
not additive (Fig. 4). As noted by others (2), it remains to be
reported whether or not the other analyzed bacterial copper
metallochaperone, CopZ, interacts in vivo with the
amino-terminal regions of CPx-type ATPases, CopA and CopB. Where do
copper metallochaperones acquire copper? Mutants deficient in CtaA
accumulate less copper and, similar to pacS, show
phenotypes associated with impaired copper supply to plastocyanin and
cytochrome oxidase, consistent with CtaA acting as the principal copper
importer at the plasma membrane (15). It is significant that CtaA is
not obligatory for Atx1 function (Fig. 4). This implies that Atx1
scavenges copper from other sources, either in the cytosol or from
secondary importers (Fig. 6B). An attractive hypothesis is
that Atx1 recycles endogenous copper, perhaps from degraded
metalloproteins or otherwise associated with adventitious
copper-binding sites in the cytosol (Fig. 6B). The severe
phenotype of atx1ctaA would result from
loss of both the principal importer and endogenous recycling of
copper.
View larger version (41K):
[in this window]
[in a new window]
|
Fig. 6.
The direct and indirect targets for Atx1 in
Synechocystis PCC 6803, sites of copper acquisition
and structural predictions. A, the arrows on
the model represent Atx1 interacting with and donating copper to the
cytosolic amino-terminal domain of thylakoid membrane-localized PacS
leading to copper import into the thylakoid. Copper is thereby
supplied to plastocyanin (PC) located within the thylakoid
lumen and cytochrome oxidase (CO) in thylakoid membranes.
B, additivity of ctaA and atx1
indicates that Atx1 can acquire copper from locations other than CtaA,
either scavenging and recycling copper from adventitious sites within
the cytosol (Adv.) or possibly interacting with secondary
copper importers. Atx1 can interact with the cytosolic amino-terminal
domain of CtaA, and the dotted arrow indicates hypothetical
but unproven copper transfer from CtaA to Atx1. C, Atx1 does
not interact (crossed lines) with either the truncated
cytosolic amino-terminal region of CoaT or the amino-terminal region of
ZiaA. The latter is composed of a histidine-rich HXH region
and a region with similarity to amino-terminal domains of CtaA and PacS
and containing a metal-binding motif GMXCXXC. The
indicated specificities of ZiaA and CoaT reflect inducing metals for
which homeostasis is known to be altered following gene deletion.
D, predicted secondary structure of apo bacterial Atx1 based
upon yeast ATX1, showing Cys ligands in loop 1 and a novel His in loop
5. The latter region is predicted to move more freely
(arrow) than in yeast ATX1 because of the absence of
subsequent -strand. E, predicted secondary structure of
copper-bacterial Atx1 based upon yeast ATX1. F, predicted
secondary structure of CtaAN, and G,
PacSN based upon yeast ATX1 and showing Tyr-65 of
PacSN.
|
|
§,
TOP
ABSTRACT
INTRODUCTION
To whom correspondence should be addressed. Tel.:
191-222-7695; Fax: 191-222-7424; E-mail:
n.j.robinson@newcastle.ac.uk.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
