| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
J. Biol. Chem., Vol. 277, Issue 7, 5660-5666, February 15, 2002
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Department of Biochemistry and Molecular Biology, University of Miami School of Medicine, Miami, Florida 33101-6129
Received for publication, August 29, 2001, and in revised form, November 8, 2001
 |
ABSTRACT |
|---|
 TOP
 ABSTRACT
 INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
Heat shock proteins participate in the initiation
of DNA replication of different organisms by facilitating the assembly
of initiation complexes. We have examined the effects of human heat shock proteins (Hsp40 and Hsp70) on the interaction of the herpes simplex virus type-1 initiator protein (UL9) with oriS, one of the
viral origins of replication. Hsp40 and Hsp70 act substoichiometrically to increase the affinity of UL9 for oriS. The major contributor to this
effect is Hsp40. Heat shock proteins also stimulate the ATPase activity
of UL9 with oriS and increase opening of the origin. In contrast, heat
shock proteins have no effect on the origin-independent activities of
UL9 suggesting that their role is not merely in refolding denatured
protein. These observations are consistent with a role for heat shock
proteins in activating UL9 to efficiently initiate viral
origin-dependent DNA replication. The action of heat shock
proteins in this capacity is analogous to their role in activating the
initiator proteins of other organisms.
Herpes simplex virus type-1
(HSV-1)1 is a large
double-stranded DNA virus with a genome of ~152 kbp. HSV-1
encodes its own complement of DNA replication enzymes that promotes
replication from discrete viral origins. It therefore provides a
eukaryotic-based system in which to study the mechanism of origin
unwinding. The virus-encoded proteins required for
origin-dependent replication are: a heterodimeric DNA
polymerase (UL30 and UL42), a heterotrimeric DNA helicase-primase (UL5,
UL8, and UL52), a single strand DNA-binding protein, referred to
as ICP8 (Infected Cell Polypeptide
8) (UL29), and an initiator protein (UL9) that specifically
recognizes elements within the origins and possesses ATPase and
helicase activities (for reviews, see Refs. 1 and 2). UL9 is a
homodimer of ~94-kDa protomers both in solution and when bound to its
recognition sequence (3-7). Dimerization is not necessary for origin
binding since the ~37-kDa C-terminal domain of UL9, which exists as a monomer, retains activity (8, 9).
The HSV-1 genome contains three redundant and highly homologous
origins, two copies of oriS, located within the
"c" repeats flanking the unique small segment of
the genome, and one copy of oriL, located in the middle of the unique
long segment of the genome. The origins are small (<100 bp)
palindromic sequences that consist of a central A/T-rich region flanked
by UL9-binding sites (5'-CGTTCGCACT) (for reviews, see Refs. 1 and
2).
Several lines of evidence suggest that unwinding of oriS proceeds as
follows. UL9 binds first to the high affinity recognition site, box I,
followed by cooperative binding to the lower affinity site, box II (8,
10). Protein-protein interactions between oriS-bound UL9 lead to
bending of the origin and opening of the A/T-rich region (5, 8, 11,
12). Finally, UL9 uses ATP to fuel its helicase activity to extrude
single-stranded template from the base of the UL9 complex (5). It
should also be noted that ICP8 is an essential cofactor in this process
(13, 14). Here we hypothesize that host chaperones also play an
important role in this process by modulating the oligomerization state
of UL9 with possible implications on binding affinity and
protein-protein interactions that lead to origin opening.
Molecular chaperones have been classified into several families among
which heat shock protein 70 (Hsp70) and heat shock protein 40 (Hsp40)
are involved in several fundamental cellular processes such as protein
folding, translocation across membranes, and assembly and disassembly
of protein complexes. Hsp70 is a weak ATPase whose activity is
increased upon interaction with short peptides of 8-9 residues (15).
The Hsp40 family of proteins acts as co-chaperones of Hsp70,
stimulating the intrinsic and peptide-dependent ATPase activities of Hsp70 via a conserved protein interaction domain (J-domain) (15), but also exhibits independent activities (for review,
see Ref. 16).
Studies on the involvement of chaperones in DNA replication have
revealed that they can activate certain initiator proteins and
influence the DNA binding activity of many proteins (for
reviews, see Refs. 17 and 18). Escherichia coli DnaK and
DnaJ are homologs of eukaryotic Hsp70 and Hsp40, respectively. Both
DnaK and DnaJ play important roles in the initiation of chromosomal
replication from oriC and are essential for origin-specific
initiation of replication of bacteriophage Induction of heat shock proteins (HSPs) during the replication
of several viruses such as adenovirus and cytomegalovirus suggests that
molecular chaperones function in viral replication (23). Interactions
between the human papillomavirus-11 (HPV-11) initiator protein (E1
helicase) and cellular chaperones occur through the J-domain of Hsp40
and stimulate formation of E1 double hexamers at the origin as well as
viral replication in vitro (24). Further evidence for the
role of chaperones in the initiation of viral replication is provided
by the observation that simian virus 40 (SV40) large T antigen contains
a functional J-domain that is required for efficient replication
(25).
The heat shock response has also been implicated in herpes simplex
virus replication. Thus, infection of rodent cells with HSV-1 and HSV-2
elevates Hsp70 mRNA levels within 4 h postinfection (26).
Moreover, heat shock induces reactivation of latent HSV-1 in cultured
cells (27, 28). It has been proposed that HSV-1 immediate early
proteins ICP4, ICP0, and ICP27 are involved in Hsp70 induction (29).
More recently, DNA microarray technology has been used to show the
accumulation of transcripts for the stress-response protein GADD45 in
HSV-1-infected human cells (30).
Little is known about the consequences of induction of HSPs during
HSV-1 infection. In the present work, we describe novel interactions
between the HSV-1 initiator protein, UL9, and two major inducible
products of the heat shock response, Hsp70 and Hsp40. These studies may
help to understand the mechanisms by which replication initiates at an
HSV-1 origin and of viral reactivation and have bearing on the
initiation of replication in other systems.
Materials--
ATP (disodium salt) and
[
Exonuclease-deficient Klenow fragment of E. coli DNA
polymerase I and Sequenase Version 2.0 DNA polymerase were obtained
from New England Biolabs and USB Corp., respectively. Bovine serum albumin (BSA) was obtained from Bio-Rad. UL9, His
M13 mp18 single-stranded DNA (ssDNA) was obtained from New
England Biolabs. oriS-containing pGEM822 was as described previ- ously (31). Oligodeoxyribonucleotides PB-9 (22-mer,
5'-ACTCTAGAGGATCCCCGGGTAC), PB-12 (80-mer,
5'-AATTCAAAAGAAGTGAGAACGCGAAGCGTTCGCACTTCGTCCCAATATATATATATTATTAGGGCGAAGTGCGAGCACTG), and PB-21 (20-mer, 5'-CCGGGCCTTTATGTGCGCCG) were obtained from Operon Technologies. (dT)60 was as described previously
(37). oriS* DNA was formed by heating PB-12 in 10 mM
Tris-HCl, pH 7.4, 1 mM EDTA, and 0.1 M NaCl to
95 °C followed by gradual cooling to >30 °C (38). The DNA
helicase substrate was generated by annealing PB-9 to M13 mp18 ssDNA.
PB-21 is complementary to positions 686-705 of HSV-1 oriS (39). The
oriS-containing probe for the electrophoretic mobility shift assay
(EMSA) was a 176-bp EcoRI restriction fragment derived from
pCG5 (40). The probe was 3'-end-labeled with exonuclease-deficient
Klenow fragment of E. coli DNA polymerase I,
[ Electrophoretic Mobility Shift Assay--
UL9-DNA complexes were
formed in 10 µl containing 20 mM EPPS-NaOH, pH 8.3, 2.5 mM dithiothreitol, 3 mM MgCl2, 2.5 mM ATP, 10% glycerol, and 50 mM NaCl. The
binding reactions were performed for 15 min at 37 °C with 100 fmol
of oriS DNA. For experiments containing HSPs, the indicated amounts of
HSPs and UL9 were incubated for 5 min at 37 °C prior to the addition
of DNA. Reactions were mixed with 3 µl of 80% glycerol containing
0.25% bromphenol blue and resolved by 1%
agarose-Tris-acetate-EDTA gel electrophoresis at 4 °C and 5 V/cm. Following electrophoresis, the gels were dried onto DE81 paper
(Whatman). The reaction products were analyzed and quantitated by
storage phosphor analysis with a Molecular Dynamics Storm 840. UL9-DNA
complexes are expressed as a percentage of the total radioactivity and
are corrected for background by subtracting the activity obtained in
the absence of UL9.
ATPase Assay--
ATP hydrolysis was determined using an
enzyme-linked assay as described previously (37). Reactions were
performed at 37 °C and contained 20 mM EPPS-NaOH, pH
8.3, 4.5 mM MgCl2, 2 mM ATP, 200 µM NADH, 1.5 mM phosphoenolpyruvate, 40 units/ml L-lactic dehydrogenase, 40 units/ml pyruvate
kinase, 3 mM dithiothreitol, 100 nM UL9, 25 nM Hsp40 and Hsp70, and 250 nM ICP8, and 10 µM (nucleotide) DNA cofactor as indicated. The absorbance
at 340 nm was converted to moles of ATP hydrolyzed using an extinction coefficient of 6,220 M DNA Helicase Assay--
Assays were performed essentially as
described previously (41). Reactions were performed at 37 °C and
contained 25 mM EPPS-NaOH, pH 8.3, 5.5 mM
MgCl2, 3 mM ATP, 3 mM
dithiothreitol, 10% glycerol, 0.5 nM (molecules) M13:PB-9
substrate, and proteins as indicated. The reactions were terminated by
the addition of 0.3 volumes of 90 mM EDTA, 6% SDS, 30%
glycerol, 0.25% bromphenol blue, 0.25% xylene cyanol, and 0.6 mg/ml
proteinase K followed by a 15-min incubation at 37 °C. The reaction
mixtures were resolved by electrophoresis through nondenaturing
polyacrylamide-Tris-borate-EDTA gels. Following electrophoresis,
the gels were dried onto DE81 paper (Whatman). The reaction products
were analyzed and quantitated by storage phosphor analysis with a
Molecular Dynamics Storm 840.
Potassium Permanganate Footprinting--
Distortion of the
A/T-rich region of oriS was detected by the susceptibility of unpaired
thymines to oxidation by potassium permanganate (11). Reactions (20 µl) contained 20 mM EPPS-NaOH pH 8.3, 50 mM
KCl, 10% glycerol, 5.5 mM MgCl2, 3 mM ATP, 100 nM Hsp40 and Hsp70, and UL9 as
indicated. UL9 was preincubated in the absence or presence of Hsp40 and
Hsp70. After 5 min at 37 °C, 1 µg of pGEM822 was added. Following
a 15-min incubation at 37 °C, KMnO4 was added to 30 mM, and incubation continued for 3 min. The reactions were
terminated by the addition of 2-mercaptoethanol to 1 M. DNA
samples were purified using the Wizard DNA clean-up system from
Promega. Primer PB-21 was annealed to alkali-denatured DNA. Primed DNA
was labeled with 2.5 units of Sequenase Version 2.0 DNA polymerase in
the presence of 0.4 µM dCTP, dGTP, and dTTP and 25 µM [ Stimulation of the Origin Binding Activity of UL9 by Heat Shock
Proteins--
An EMSA was used to examine whether Hsp40 and Hsp70 had
an effect on the origin binding activity of UL9. Fig.
1A shows that the mobility of
the 176-bp oriS-containing probe was retarded with increasing
concentrations of UL9. Depending on the duration of electrophoresis,
two discernible UL9-DNA complexes were detected (see also Figs.
2A and 5A). Based
on previous studies, we believe these to be due to binding of UL9 first
to the high affinity binding site box I followed by binding to box II
(8, 10). Consequently, the faster migrating UL9-DNA complex, which is
formed at lower UL9 concentrations, is due to binding of UL9 to box I,
while the slower migrating species, which is formed at higher UL9
concentrations, is due to binding of UL9 to both boxes I and II.
Addition of Hsp40 and Hsp70 to the reactions led to efficient complex
formation at lower concentrations of UL9. Careful resolution of the
UL9-DNA complexes showed that HSPs did not affect the distribution of the two species (e.g. Fig. 2A). Quantitation of
the UL9-DNA complexes indicates that addition of HSPs reduced the
amount of UL9 required for half-maximal binding from ~200 to ~40
nM, a factor of ~5-fold (Fig. 1B).
Consequently, HSPs appear to increase the affinity of UL9 for the
origin. Importantly, stimulation of the origin binding activity of UL9
was specific for HSPs since a concentration of BSA equivalent to that
of total monomeric HSPs produced only a modest effect (~2-fold),
indicating that HSPs do not merely act by stabilizing the origin
binding activity of UL9 (Fig. 1, C and D).
However, addition of BSA enhanced the stimulation by HSPs, suggesting
that nonspecific proteins contribute to the effect presumably by
increasing protein stability (Fig. 1, C and D). Moreover, the data in Fig. 1, C and D, indicate
that HSPs stimulated the origin binding activity of UL9 with a probe
(oriS*) that contains only a single recognition site (38).
HSPs had no significant effect on the dissociation of UL9 from the
origin. Fig. 2 shows that the half-life of the UL9-oriS complex in the
absence or presence of HSPs was ~5 min at room temperature in the
presence of 20-fold excess oriS* competitor. This finding supports the
notion that HSPs serve to increase the association of UL9 with oriS.
Fig. 3 shows that near-maximal
stimulation of the origin binding activity of UL9 was achieved at a
concentration of HSPs that was 50-fold lower than that of UL9 (1 nM Hsp40 and Hsp70 versus 50 nM UL9,
assuming that protein determination was accurate), suggesting that HSPs
act substoichiometrically. Curve-fit analysis showed that the
concentration required for half-maximal stimulation was 0.6 nM HSPs. Moreover, HSPs were more effective in stimulating origin binding when preincubated with UL9 than if the proteins were
added simultaneously or if UL9 was permitted to bind to the origin
prior to addition of HSPs (data not shown).
The previous experiments were performed with equimolar Hsp40 and Hsp70.
The experiment shown in Fig. 4 addresses
the effect of each protein with 50 nM UL9. At this UL9
concentration, origin binding activity is far below saturation (see
Fig. 1B) and therefore allows detection of maximal
stimulation. The data show that the major contributor to the
stimulatory effect was Hsp40 with a small effect from Hsp70. Maximal
stimulation was observed in the presence of both Hsp40 and Hsp70. Given
the high degree of evolutionary conservation between HSPs, the action
of equivalent concentrations of E. coli HSPs was compared
with that of their human homologs. Interestingly, the stimulatory
effects of the E. coli HSPs was similar to that of the human
proteins with the major effect due to DnaJ and maximum stimulation
produced by the combined action of DnaJ and DnaK. Moreover, E. coli GrpE, which has also been implicated in the initiation of
A number of techniques, including gel-filtration
chromatography, glycerol-gradient sedimentation, and electron
microscopy have been used to demonstrate that UL9 exists as a dimer
in solution (3-6). HSPs have previously been shown to activate the
initiator proteins of other systems by converting oligomeric species
into monomeric protein (21, 45). Consequently, it is possible that HSPs
modulate the oligomerization state of UL9, thereby stimulating its
origin binding activity. As a first attempt to address this possibility, the effect of HSPs on the origin binding activity of a
monomeric UL9 deletion mutant (His HSPs Stimulate the Origin-dependent ATPase Activity of
UL9--
The above experiments demonstrate that HSPs can enhance the
binding of UL9 to the origin. To determine whether HSPs can stimulate the function of UL9 at the origin, their effect on the
origin-dependent ATPase activity of UL9 was examined. The
origin-containing DNA cofactor used in these experiments was oriS*, a
putative intermediate in origin unwinding, that has previously been
shown to act efficiently as a substrate for the origin binding and
ATPase activities of UL9 (38, 46). The data in Fig.
6A show that oriS* stimulated the ATPase activity of UL9. Importantly, addition of Hsp40 and Hsp70
significantly increased the ATPase activity of UL9 with oriS*. In
contrast, there was no effect of HSPs on the DNA-independent ATPase
activity of UL9. Moreover, under the specified reaction conditions,
HSPs alone did not exhibit significant ATPase activity either in the
absence or presence of oriS*. ICP8, the HSV-1-encoded single strand
DNA-binding protein, has previously been shown to specifically
stimulate the nonspecific ssDNA-dependent ATPase activity
of UL9 (37, 41). Fig. 6B shows that ICP8 also stimulated the
origin-dependent ATPase activity of UL9. Consistent with
the data in Fig. 6A, addition of HSPs to a reaction with UL9
and ICP8 further stimulated ATP hydrolysis (Fig. 6B).
The effect of HSPs on the origin-dependent ATPase activity
of UL9 was also examined in the presence of K+, which is an
essential cofactor for the ATPase activity of Hsp70 (47).
Interestingly, substitution of 50 mM NaCl with 50 mM KCl stimulated the activity of UL9 (Fig. 6B).
Likewise, KCl elicited a larger stimulation in the presence of ICP8 and
HSPs (Fig. 6B). However, the magnitude of the effect of HSPs
was similar in the presence of NaCl or KCl, indicating that the main
function of K+ was in stimulating UL9 and not for the
effect of HSPs. Substitution of 50 mM NaCl with 50 mM KCl also led to 5.5-fold stimulation in the origin
binding activity of UL9.
The increase in ATP hydrolysis observed in the presence of HSPs was
probably due to the ATPase activity of UL9 rather than that of Hsp70
since at 25 µM ATP, which is ~20-fold lower than the
Km for ATP of UL9 (41) but sufficiently high to elicit near Vmax ATPase activity of Hsp70 (15),
the effect of HSPs on ATP hydrolysis was greatly reduced (Fig.
6C).
There was no effect of Hsp40 and Hsp70 on the nonspecific
ssDNA-dependent ATPase activity of UL9 (Fig.
7A). Both in the absence and
presence of HSPs the rate of ATP hydrolysis with (dT)60 was 1.8 pmol/s. Similarly, HSPs did not affect the nonspecific DNA helicase
activity of UL9 (Fig. 7B). The findings that HSPs only stimulate origin-dependent activities but have no effect on
the nonspecific activities of UL9 indicate that they do not merely act
as chaperones to refold denatured protein.
HSPs Enhance the Opening of the Origin by UL9--
UL9 has
previously been shown to bend and distort the origin as a first step in
the unwinding process (5, 11, 12). Distortion of the A/T-rich region in
the origin may be detected by the susceptibility of unpaired bases to
single strand-specific nucleases or reagents such as potassium
permanganate, which oxidizes unpaired thymine residues thereby creating
stop sites for a DNA polymerase in a primer extension assay (11). Fig.
8A shows that there was no
potassium permanganate sensitivity in the A/T-rich region in the
absence of UL9 or with HSPs alone. However, increasing UL9
concentrations led to potassium permanganate-induced stop sites.
Addition of Hsp40 and Hsp70 enhanced the UL9-dependent sensitivity of the A/T-rich region to potassium permanganate. Quantitation of the signal corresponding to the A/T-rich region indicates that HSPs induced their maximal effect (2.5-fold stimulation) at low UL9 concentrations at which the signal is not saturated (Fig.
8B).
In the present work, we describe that Hsp40 and Hsp70 act
catalytically and in concert to increase the affinity of UL9 for oriS.
The major contributor to this effect is Hsp40. We also observe that
HSPs stimulate the activities of UL9 at the origin
(origin-dependent ATPase and opening of the origin). It is
unlikely that the stimulation by HSPs is merely the result of refolding
of denatured UL9 since there was no effect of Hsp40 and Hsp70 on the
origin-independent DNA helicase and ATPase activities of UL9. These
findings illustrate a potential mechanism, similar to what has been
described for plasmid P1 replication among others, whereby HSV-1
origin-dependent replication is regulated by the action of HSPs.
Plasmid P1 is a system in which the role of HSPs in
origin-dependent initiation has been studied in great
depth. In this system, the first regulatory step entails the
dissociation of RepA dimers into active monomers by the action of
E. coli Hsp40 (DnaJ) and Hsp70 (DnaK) homologs (21). DnaJ,
DnaK, and GrpE function in the initiation pathway of bacteriophage Involvement of HSPs in the initiation of origin-dependent
replication has recently been realized with eukaryotic viruses. Hence,
in the case of SV40, efficient replication depends on the presence of a
J-domain in large T antigen, which presumably serves in the assembly of
a functional hexamer at the origin, and may be further aided by Hsp70
(25). Similar to our findings, the origin binding activity of the
HPV-11 initiator E1 is stimulated preferentially by Hsp40 and to a
lesser extent by Hsp70 (24). In fact, a peptide encompassing the
J-domain of Hsp40 was sufficient in stimulating E1. Consequently, the
J-domain of Hsp40 may also mediate interactions between Hsp40 and UL9.
By analogy to other replication systems, a possible mechanism by which
HSPs stimulate UL9 may be by modulating its dimerization status,
activating its binding to the origin by formation of monomers. This
notion is supported by our finding that HSPs have no effect on the
origin binding activity of a monomeric mutant UL9 that exhibits origin
binding properties similar to those of HSP-stimulated wild-type UL9.
The importance of the oligomerization status of initiator proteins was
recently addressed with the Our results indicate that origin opening (potassium permanganate
sensitivity) is directly related to the amount of UL9 bound to the
origin. Maximal stimulation of origin opening by HSPs was observed at
low UL9 concentrations, indicating that the effect of HSPs on origin
opening is secondary and that their main function is to increase origin
binding. This notion is supported by our observation that, given the
resolution of our assay, interactions between HSPs and UL9 affected
neither the mobility of the UL9-DNA complexes nor their stability.
Therefore, it is unlikely that the interactions between HSPs and UL9
affect the conformation of the initiator complexes once bound to the origin.
Since no specific induction of Hsp40 during HSV-1 infection has
previously been reported, we do not know at this point whether Hsp40
actually participates in HSV-1 initiation in vivo. The
stimulation of UL9 binding to the origin by E. coli DnaJ
suggests that the functional interaction we observe is not limited to
the inducible form of Hsp40 used in the present study. It is possible
that different members of the Hsp40 family or other J-domain-containing
proteins could fulfill this function in vivo. In any case,
in light of the requirement for efficient viral replication of a
J-domain in SV40 large T antigen and the stimulation of HPV-11
replication by the J-domain, it appears that Hsp40 may be a conserved
theme in the replication of eukaryotic DNA viruses.
Our results implicate the direct participation of HSPs in the
interaction of UL9 with the origins and thereby suggest a mechanism by
which the initiation of viral replication may be regulated. We propose
that our current results with the HSV-1 system corroborate previous
findings with other eukaryotic viruses (SV40 and HPV-11) and may have
general implications for the role of HSPs in the initiation of
eukaryotic chromosomal replication as indicated by the interaction of
Hsp70 with S. cerevisiae Orc4p (22). Finally, it is
noteworthy to mention that while the participation of host chaperones
in the replication of SV40 and HPV-11 may not be unexpected, given
their dependence on host enzymes, the proposed role of HSPs in
herpesvirus replication is unexpected since this class of virus encodes
it own DNA replication machinery.
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
and plasmid P1 (19-21).
The recent identification of an interaction between Hsp70 and
Saccharomyces cerevisiae Orc4p suggests that regulation of
eukaryotic initiator proteins may also require molecular chaperones
(22).
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
-32P]dATP (25 Ci/mmol) were from Sigma and ICN, respectively.
UL9, and ICP8 were
purified as described previously (31, 32). Protein concentrations, expressed in moles of monomeric protein, were determined using theoretical extinction coefficients of 43,626 (BSA), 89,220 (UL9), 38,250 (HisUL9), and 82,720 (ICP8) M
1
cm1 at 280 nm calculated from their predicted amino acid
sequences (33). Recombinant human Hsp40 and Hsp70 produced in E. coli were purchased from StressGen Biotechnologies Corp. E. coli HSPs DnaJ, DnaK, and GrpE were obtained from Epicentre
Technologies. The concentrations of Hsp40/DnaJ and GrpE are expressed
as moles of dimeric protein (34, 35), while those of Hsp70/DnaK are expressed as moles of monomeric protein (17). Their concentrations were
determined by the dye binding method of Bradford (36).
-32P]dATP, and unlabeled dTTP. The concentration of
the probe was determined by densitometry using the Alpha Innotech
AlphaImager 2000 imaging system and a known amount of the same DNA as a standard.
1 cm1 for NADH.
-32P]dATP for 5 min at room
temperature. Subsequently, DNA products were extended with 75 µM dNTP for 10 min at 37 °C. The samples were resolved
by 8 M urea, 5% polyacrylamide gel electrophoresis. The
reaction products were analyzed and quantitated by storage phosphor
analysis with a Molecular Dynamics Storm 840. The positions of primer
extension products were compared with a sequencing ladder of
PB-21-primed pGEM822.
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
View larger version (32K):
[in a new window]
Fig. 1.
HSPs increase the affinity of UL9 for the
origin. A, EMSA was performed as described under
"Experimental Procedures" with increasing concentrations of UL9
(25, 50, 100, 150, 200, and 300 nM, respectively) in the
absence or presence of 100 nM Hsp40 and Hsp70 as indicated.
The positions of free probe and of UL9-DNA complexes corresponding to
binding of UL9 to box I (I) or to both boxes I and II
(I+II) are as indicated. B, quantitation of the
UL9-DNA complexes shown in A formed in the absence
(empty circles) or presence (filled circles) of
HSPs. C, EMSA was performed as described under
"Experimental Procedures" with 100 fmol of oriS* DNA, 50 nM UL9, 50 nM HSPs (100 nM
monomeric Hsp40 and 50 nM Hsp70), and 150 nM
BSA as indicated. The positions of free probe and of the UL9-DNA
complex are as indicated. D, quantitation of the UL9-DNA
complexes shown in C. The activity is normalized with
respect to that observed with UL9 alone (3% DNA bound). Column
1, UL9; column 2, UL9 and HSPs; column 3,
UL9 and BSA; column 4, UL9, HSPs, and BSA.
View larger version (53K):
[in a new window]
Fig. 2.
HSPs have no effect on the stability of
UL9-oriS complexes. A, EMSA was performed as described
under "Experimental Procedures" with 50 nM UL9 in the
absence or presence of 50 nM Hsp40 and Hsp70 as indicated.
Ten minutes after addition of the probe, a 20-fold molar excess of
oriS* DNA was added, and incubation continued at room temperature for
the times indicated followed by immediate electrophoresis. The
positions of free probe and of UL9-DNA complexes corresponding to
binding of UL9 to box I (I) or to both boxes I and II
(I+II) are as indicated. B, quantitation of the
UL9-DNA complexes shown in A formed in the absence
(empty circles) or presence (filled circles) of
HSPs. Given the stimulation elicited by HSPs, the values were
normalized to the level prior to addition of competitor DNA.
View larger version (44K):
[in a new window]
Fig. 3.
Stimulation of the origin binding activity of
UL9 by HSPs is catalytic. A, EMSA was performed as
described under "Experimental Procedures" with 100 fmol of oriS*
DNA, 50 nM UL9, and increasing concentrations of HSPs (1, 2.5, 5, 10, 20, 50, and 100 nM Hsp40 and Hsp70,
respectively) as indicated. The reaction with HSPs alone contained 100 nM Hsp40 and Hsp70. The positions of free probe and of the
UL9-DNA complex are as indicated. B, quantitation of the
UL9-DNA complexes shown in A. The activity is normalized
with respect to that observed with UL9 alone (2.6% DNA bound).
and P1 replication (42, 43), also stimulated the origin binding
activity of UL9 and further increased the effect brought about by DnaJ
and DnaK. Overall, depending on the concentration of UL9, Hsp70/DnaK
stimulated origin binding activity ~2-fold, while Hsp40/DnaJ produced
a 3-fold effect. The combined action of both Hsp70/DnaK and Hsp40/DnaJ
stimulated binding up to 5-fold. As already shown in Figs. 1 and 3,
none of the HSPs alone or in combination exhibited any significant origin binding activity. As previously demonstrated, addition of ATP
stimulated the origin binding activity of UL9 ~2-fold but had no
effect on the stimulation by Hsp40 and/or Hsp70 (data not shown)
(44).
View larger version (12K):
[in a new window]
Fig. 4.
Both human and E. coli HSPs
stimulate the origin binding activity of UL9 with the major contributor
being Hsp40/DnaJ. EMSA was performed as described under
"Experimental Procedures" with 50 nM UL9 and 50 nM of the indicated human (solid bars) or
E. coli (open bars) HSPs. Column 1,
UL9; column 2, UL9 and Hsp40/DnaJ; column 3, UL9
and Hsp70/DnaK; column 4, UL9, Hsp40/DnaJ, and Hsp70/DnaK;
column 5, UL9 and GrpE; column 6, UL9 and DnaJ,
DnaK, and GrpE; column 7, Hsp40/DnaJ; column 8,
Hsp70/DnaK; column 9, Hsp40/DnaJ and Hsp70/DnaK;
column 10, GrpE; column 11, DnaJ, DnaK, and
GrpE.
UL9) was examined. HisUL9 encompasses only the C-terminal origin-binding domain of UL9 and has
been shown to be monomeric in solution (8). If the function of HSPs is
to monomerize UL9 to generate high affinity origin-binding protomers,
HisUL9 should not be affected by HSPs and behave similarly to
HSP-stimulated wild-type UL9. Fig. 5
shows that there was no effect of HSPs on the origin binding activity
of HisUL9. HisUL9 reached half-maximal binding at ~10
nM, indicating that it binds to the origin with even higher
affinity than wild-type UL9 stimulated by HSPs (Fig.
5B).
View larger version (33K):
[in a new window]
Fig. 5.
The monomeric C-terminal origin-binding
domain of UL9 binds to the origin with high affinity and is not further
stimulated by HSPs. A, EMSA was performed as described
under "Experimental Procedures" with increasing concentrations of
His UL9 (5, 10, 25, 50, and 100 nM, respectively) in the
absence or presence of 100 nM Hsp40 and Hsp70 as indicated.
The positions of free probe and of HisUL9-DNA complexes
corresponding to binding of HisUL9 to box I (I) or to
both boxes I and II (I+II) are as indicated. B,
quantitation of the HisUL9-DNA complexes shown in A
formed in the absence (empty squares) or presence
(filled squares) of HSPs.
View larger version (16K):
[in a new window]
Fig. 6.
HSPs stimulate the
origin-dependent ATPase activity of UL9. ATP
hydrolysis was measured as described under "Experimental
Procedures." A, effect of HSPs on DNA-independent and
origin-dependent ATP hydrolysis. Curve 1, UL9;
curve 2, UL9 and HSPs; curve 3, HSPs. The
arrow indicates the time at which oriS* DNA was added.
B, origin-dependent ATP hydrolysis with 50 mM NaCl (curves 1, 3, and
5) or 50 mM KCl (curves 2,
4, and 6). Curves 1 and 2,
UL9; curves 3 and 4, UL9 and ICP8; curves
5 and 6, UL9, ICP8, and HSPs. C,
origin-dependent ATP hydrolysis with UL9, ICP8, and HSPs at
25 µM (curve 1) or 2 mM
(curve 2) ATP.
View larger version (19K):
[in a new window]
Fig. 7.
HSPs have no effect on the nonspecific
ssDNA-dependent ATPase and DNA helicase activities of
UL9. A, ATP hydrolysis was measured as described under
"Experimental Procedures" with (dT)60 cofactor.
Curve 1, UL9; curve 2, UL9 and HSPs.
B, DNA unwinding was measured as described under
"Experimental Procedures." Empty circles, UL9;
filled circles, UL9 and HSPs; filled triangle,
HSPs.
View larger version (70K):
[in a new window]
Fig. 8.
HSPs enhance UL9-mediated distortion of the
A/T-rich region of oriS. Potassium permanganate footprinting was
performed as described under "Experimental Procedures."
A, primer extension products formed with increasing
concentrations of UL9 (50, 100, and 250 nM, respectively)
in the absence or presence of HSPs as indicated. The region
corresponding to the A/T-rich region and the position of thymine 601 in
oriS (39) are as indicated. B, the signal in the A/T-rich
region was quantitated and corrected for the amount of radioactivity in
each sample. The graph indicates the stimulation in potassium
permanganate sensitivity in the presence of HSPs at each UL9
concentration.
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
by releasing DnaB helicase from the initiation complex to enable
unwinding of the origin (42). In the case of
oriC-dependent replication in E. coli, HSPs have been shown to play a multifaceted role. For
example, DnaK prevents self-aggregation of the initiator protein, DnaA (45).
plasmid initiator protein. In that
study it was shown that monomers preferentially bound to the 
origin and facilitated opening of its A/T-rich region (48). As
previously mentioned, HSPs also play an active role in converting RepA
dimers into active monomers and prevent aggregation of DnaA (21, 45).
In addition, the J-domain of Hsp40 was shown to induce the formation of
double hexamers of E1 at the HPV-11 origin (24).
| |
FOOTNOTES |
|---|
* This work was supported by National Institutes of Health Grant GM62643 and American Heart Association Grant 0050973B.The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of Biochemistry
and Molecular Biology, University of Miami School of Medicine, P.O. Box
016129, Miami, FL 33101-6129. Tel.: 305-243-2934; Fax: 305-243-3955;
E-mail: pboehmer@molbio.med.miami.edu.
Published, JBC Papers in Press, November 15, 2001, DOI 10.1074/jbc.M108316200
| |
ABBREVIATIONS |
|---|
The abbreviations used are: HSV-1, herpes simplex virus type-1; BSA, bovine serum albumin; EMSA, electrophoretic mobility shift assay; EPPS, N-(2-hydroxyethyl)piperazine-N'-(3-propanesulfonic acid); HPV, human papillomavirus; HSP, heat shock protein; Hsp40, heat shock protein 40; Hsp70, heat shock protein 70; ssDNA, single-stranded DNA; SV40, simian virus 40; ICP, Infected Cell Polypeptide.
| |
REFERENCES |
|---|
|
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
|
|---|
| 1. | Boehmer, P. E., and Lehman, I. R. (1997) Annu. Rev. Biochem. 66, 347-384[CrossRef][Medline] [Order article via Infotrieve] |
| 2. |
Lehman, I. R.,
and Boehmer, P. E.
(1999)
J. Biol. Chem.
274,
28059-28062 |
| 3. |
Bruckner, R. C.,
Crute, J. J.,
Dodson, M. S.,
and Lehman, I. R.
(1991)
J. Biol. Chem.
266,
2669-2674 |
| 4. |
Fierer, D. S.,
and Challberg, M. D.
(1992)
J. Virol.
66,
3986-3995 |
| 5. | Makhov, A. M., Boehmer, P. E., Lehman, I. R., and Griffith, J. D. (1996) EMBO J. 15, 1742-1750[Medline] [Order article via Infotrieve] |
| 6. | Makhov, A. M., Boehmer, P. E., Lehman, I. R., and Griffith, J. D. (1996) J. Mol. Biol. 258, 789-799[CrossRef][Medline] [Order article via Infotrieve] |
| 7. |
Lee, S. S.,
and Lehman, I. R.
(1999)
J. Biol. Chem.
274,
18613-18617 |
| 8. |
Elias, P.,
Gustafsson, C. M.,
Hammarsten, O.,
and Stow, N. D.
(1992)
J. Biol. Chem.
267,
17424-17429 |
| 9. |
Weir, H. M.,
Calder, J. M.,
and Stow, N. D.
(1989)
Nucleic Acids Res.
17,
1409-1425 |
| 10. |
Hazuda, D. J.,
Perry, H. C.,
and McClements, W. L.
(1992)
J. Biol. Chem.
267,
14309-14315 |
| 11. |
Koff, A.,
Schwedes, J. F.,
and Tegtmeyer, P.
(1991)
J. Virol.
65,
3284-3292 |
| 12. |
He, X.,
and Lehman, I. R.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
3024-3028 |
| 13. |
Lee, S. S.,
and Lehman, I. R.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
2838-2842 |
| 14. |
He, X.,
and Lehman, I. R.
(2000)
J. Virol.
74,
5726-5728 |
| 15. |
Jordan, R.,
and McMacken, R.
(1995)
J. Biol. Chem.
270,
4563-4569 |
| 16. | Kelley, W. L. (1998) Trends Biochem. Sci. 23, 222-227[CrossRef][Medline] [Order article via Infotrieve] |
| 17. | Hartl, F. U. (1996) Nature 381, 571-579[CrossRef][Medline] [Order article via Infotrieve] |
| 18. | Konieczny, I., and Zylicz, M. (1999) Genet. Eng. 21, 95-111 |
| 19. | Malki, A., Hughes, P., and Kohiyama, M. (1991) Mol. Gen. Genet. 225, 420-426[Medline] [Order article via Infotrieve] |
| 20. | Zylicz, M. (1993) Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 339, 271-277[Medline] [Order article via Infotrieve] |
| 21. |
Wickner, S. H.
(1990)
Proc. Natl. Acad. Sci. U. S. A.
87,
2690-2694 |
| 22. |
Giraldo, R.,
and Díaz-Orejas, R.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
4938-4943 |
| 23. | Glotzer, J. B., Saltik, M., Chiocca, S., Michou, A. I., Moseley, P., and Cotten, M. (2000) Nature 407, 207-211[CrossRef][Medline] [Order article via Infotrieve] |
| 24. |
Liu, J.-S.,
Kuo, S.-R.,
Makhov, A. M.,
Cyr, D. M.,
Griffith, J. D.,
Broker, T. R.,
and Chow, L. T.
(1998)
J. Biol. Chem.
273,
30704-30712 |
| 25. |
Campbell, K. S.,
Mullane, K. P.,
Aksoy, I. A.,
Studbal, H.,
Zalvide, J.,
Pipas, J. M.,
Silver, P. A.,
Roberts, T. M.,
Schaffhausen, B. S.,
and DeCaprio, J. A.
(1997)
Genes Dev.
11,
1098-1110 |
| 26. | Kobayashi, K., Ohgitani, E., Tanaka, Y., Kita, M., and Imanishi, J. (1994) Microbiol. Immunol. 38, 321-325[Medline] [Order article via Infotrieve] |
| 27. | Moriya, A., Yoshiki, A., Kita, M., Fushiki, S., and Imanishi, J. (1994) Arch. Virol. 135, 419-425[CrossRef][Medline] [Order article via Infotrieve] |
| 28. |
Halford, W. P.,
Gebhardt, B. M.,
and Carr, D. J.
(1996)
J. Virol.
70,
5051-5060 |
| 29. |
Phillips, B.,
Abravaya, K.,
and Morimoto, R. I.
(1991)
J. Virol.
65,
5680-5692 |
| 30. |
Khodarev, N. N.,
Advani, S. J.,
Gupta, N.,
Roizman, B.,
and Weichselbaum, R. R.
(1999)
Proc. Natl. Acad. Sci. U. S. A.
96,
12062-12067 |
| 31. |
Sampson, D. A.,
Arana, M. E.,
and Boehmer, P. E.
(2000)
J. Biol. Chem.
275,
2931-2937 |
| 32. |
Boehmer, P. E.,
and Lehman, I. R.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
8444-8448 |
| 33. | Gill, S. C., and von Hippel, P. H. (1989) Anal. Biochem. 182, 319-326[CrossRef][Medline] [Order article via Infotrieve] |
| 34. | Sha, B., Lee, S., and Cyr, D. M. (2000) Struct. Fold. Des. 8, 799-807[Medline] [Order article via Infotrieve] |
| 35. |
Harrison, C. J.,
Hayer-Hartl, M., Di,
Liberto, M.,
Hartl, F.,
and Kuriyan, J.
(1997)
Science
276,
431-435 |
| 36. | Bradford, M. M. (1976) Anal. Biochem. 72, 248-254[CrossRef][Medline] [Order article via Infotrieve] |
| 37. |
Boehmer, P. E.
(1998)
J. Biol. Chem.
273,
2676-2683 |
| 38. |
Aslani, A.,
Simonsson, S.,
and Elias, P.
(2000)
J. Biol. Chem.
275,
5880-5887 |
| 39. |
Wong, S. W.,
and Schaffer, P. A.
(1991)
J. Virol.
65,
2601-2611 |
| 40. |
Hernandez, T. R.,
Dutch, R. E.,
Lehman, I. R.,
Gustafsson, C.,
and Elias, P.
(1991)
J. Virol.
65,
1649-1652 |
| 41. |
Arana, M. E.,
Haq, B.,
Tanguy Le Gac, N.,
and Boehmer, P. E.
(2001)
J. Biol. Chem.
276,
6840-6845 |
| 42. |
Wyman, C.,
Vasilikiotis, C.,
Ang, D.,
Georgopoulos, C.,
and Echols, H.
(1993)
J. Biol. Chem.
268,
25192-25196 |
| 43. |
Sozhamannan, S.,
and Chattoraj, D. K.
(1993)
J. Bacteriol.
175,
3546-3555 |
| 44. |
Gustafsson, C. M.,
Hammarsten, O.,
Falkenberg, M.,
and Elias, P.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
4629-4633 |
| 45. | Banecki, B., Kaguni, J. M., and Marszalek, J. (1998) Biochim. Biophys. Acta 1442, 39-48[Medline] [Order article via Infotrieve] |
| 46. |
Aslani, A.,
Macao, B.,
Simonsson, S.,
and Elias, P.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
7194-7199 |
| 47. | Feifel, B., Sandmeier, E., Schonfeld, H. J., and Christen, P. (1996) Eur. J. Biochem. 237, 318-321[Medline] [Order article via Infotrieve] |
| 48. | Krüger, R., Konieczny, I., and Filutowicz, M. (2001) J. Mol. Biol. 306, 945-955[CrossRef][Medline] [Order article via Infotrieve] |
This article has been cited by other articles:
|
|
 |
|
  T. Carsillo, Z. Traylor, C. Choi, S. Niewiesk, and M. Oglesbee hsp72, a Host Determinant of Measles Virus Neurovirulence J. Virol., November 15, 2006; 80(22): 11031 - 11039. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Schildgen, S. Graper, J. Blumel, and B. Matz Genome Replication and Progeny Virion Production of Herpes Simplex Virus Type 1 Mutants with Temperature-Sensitive Lesions in the Origin-Binding Protein J. Virol., June 1, 2005; 79(11): 7273 - 7278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. Trabold, M. Weinberger, L. Feng, and W. C. Burhans Activation of Budding Yeast Replication Origins and Suppression of Lethal DNA Damage Effects on Origin Function by Ectopic Expression of the Co-chaperone Protein Mge1 J. Biol. Chem., April 1, 2005; 280(13): 12413 - 12421. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Fewell, C. M. Smith, M. A. Lyon, T. P. Dumitrescu, P. Wipf, B. W. Day, and J. L. Brodsky Small Molecule Modulators of Endogenous and Co-chaperone-stimulated Hsp70 ATPase Activity J. Biol. Chem., December 3, 2004; 279(49): 51131 - 51140. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Macao, M. Olsson, and P. Elias Functional Properties of the Herpes Simplex Virus Type I Origin-binding Protein Are Controlled by Precise Interactions with the Activated Form of the Origin of DNA Replication J. Biol. Chem., July 9, 2004; 279(28): 29211 - 29217. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Trego and D. S. Parris Functional Interaction between the Herpes Simplex Virus Type 1 Polymerase Processivity Factor and Origin-Binding Proteins: Enhancement of UL9 Helicase Activity J. Virol., December 1, 2003; 77(23): 12646 - 12659. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. J. Cho, W. J. Yoon, C. H. Moon, S. J. Cha, H. Song, H. R. Cho, S. J. Jang, D. K. Chung, C. S. Jeong, and J. W. Park Molecular Cloning of a Novel Chaperone-like Protein Induced by Rhabdovirus Infection with Sequence Similarity to the Bacterial Extracellular Solute-binding Protein Family 5 J. Biol. Chem., October 25, 2002; 277(44): 41489 - 41496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Y. Lin, A. M. Makhov, J. D. Griffith, T. R. Broker, and L. T. Chow Chaperone Proteins Abrogate Inhibition of the Human Papillomavirus (HPV) E1 Replicative Helicase by the HPV E2 Protein Mol. Cell. Biol., September 15, 2002; 22(18): 6592 - 6604. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME |
