|
Originally published In Press as doi:10.1074/jbc.M108398200 on November 29, 2001
J. Biol. Chem., Vol. 277, Issue 8, 5891-5901, February 22, 2002
Constitutive Internalization of Constitutively Active Angiotensin
II AT1A Receptor Mutants Is Blocked by Inverse
Agonists*
Stéphanie
Miserey-Lenkei ,
Charles
Parnot ,
Sabine
Bardin ,
Pierre
Corvol§, and
Eric
Clauser ¶
From INSERM EPI 0103, Institut Cochin, 24 rue du
Faubourg Saint-Jacques, 75014 Paris, France and § INSERM
U36, Collège de France, 11 place Marcelin Berthelot,
75005 Paris, France
Received for publication, August 30, 2001, and in revised form, November 20, 2001
 |
ABSTRACT |
As constitutively active mutants (CAMs) mimic an
active conformation, they can be used to characterize the process of G
protein-coupled receptor activation. Here, we used CAMs to study the
link between activation and internalization of the angiotensin II
AT1A receptor. The cellular localization of
fluorescently tagged N111A, I245T, and L305Q mutants was determined by
confocal microscopy. In the absence of ligand, CAMs were mostly located
in intracellular vesicles, whereas the wild-type AT1A was
found at the cell surface. After 2 h incubation with inverse
agonist, losartan, CAMs were translocated to the plasma membrane.
Similar observations were made in H295, a human adrenocortical cell
line which expresses physiologically the AT1 receptor. This
phenomenon, which was not dependent on protein synthesis and the
pharmacology and kinetics of which were similar to the recycling of the
wild-type receptor, was called "externalization". After
externalization and losartan removal, the L305Q CAM underwent rapid
ligand-independent endocytocis, with the same kinetics and temperature
sensitivity as the angiotensin II-induced internalization of the
wild-type AT1A. Moreover, the addition of a second mutation
known to block internalization ( 329 truncation) prevented
intracellular localization of the CAM. These data show that
AT1A CAMs are constitutively and permanently internalized and recycled. This mechanism is different from the down-regulation observed for CAMs of other G protein-coupled receptors and thus defines
a new paradigm for the cellular regulation of CAMs.
 |
INTRODUCTION |
G protein-coupled receptors
(GPCR)1 form one of the largest
protein families, with several hundred members in humans (1). Despite
the wide variety of ligands and physiological roles, these receptors
are all structurally characterized by seven-transmembrane domains and
most of them are thought to share common activation and desensitization
mechanisms. GPCRs are supposed to isomerize spontaneously between an
inactive (R) and an active state (R*), the latter being responsible for
G protein coupling and subsequent intracellular signaling. This
two-state model is probably oversimplified but is helpful for the
interpretation of mutagenesis and pharmacological data. It is supported
by the existence of constitutively active mutants (CAMs) in the GPCR
family. These mutants mimic the active state and therefore present
permanent ligand-independent signaling. Ligands able to block this
constitutive activity are called inverse agonists. In the two-state
model, the inverse agonists have preferential affinity for the inactive
state (R). Conversely, "regular" agonists preferentially bind the
active state (R*).
Many GPCRs are desensitized after G protein activation, i.e.
they become insensitive to agonists. The binding of arrestins to the
receptor is known to play a major role in this process and is favored
by the phosphorylation of the receptor by specific GPCR kinases.
The arrestins prevent further interaction with the G proteins. They
also promote internalization via clathrin-coated pit-dependent endocytosis, which results in the
disappearance of the receptor from the plasma membrane (2). Finally,
they participate in the recycling of the receptor, which can take a few
minutes to a few hours, depending on the type of GPCR. In some cases,
some of the receptors can also be down-regulated, leading to long-term
desensitization. Activation is thus a physiological prerequisite for
receptor internalization and these two processes are probably highly
dependent on each other. As CAMs mimic the active conformation of the
receptor, they should help to elucidate the link between activation and internalization.
In this study, we used the angiotensin II (AngII) type 1 receptor
(AT1) as a model to address this question. The
AT1 receptor regulates the contraction and hypertrophy of
vascular smooth muscle cell contraction and the secretion of
aldosterone. Thus it plays a critical role in the control of blood
pressure and sodium homeostasis. This pivotal physiological role makes
the AT1 receptor an important therapeutic target and
numerous antihypertensive and cardioprotector agents have been
developed. As a consequence, it is also one of the most studied GPCRs.
Its cDNA was first cloned in 1991 (3). The AT1 receptor
(AT1A and AT1B in rodents) leads to the
G q/11-mediated activation of phospholipase C- , which
generates diacylglycerol and inositol (1,4,5)-trisphosphate. Following
the phosphorylation of the intracellular sequences (4, 5), the
AT1 receptor is rapidly internalized
(t1/2 ~ 5 min) (6-10) in clathrin-coated pits
after interaction with -arrestin 1 and dynamin 1 and 2 (11). The
receptor is then slowly and partly recycled at the plasma membrane (7,
12, 13). We were able to directly visualize the internalization process
of an EGFP-tagged AT1 receptor using confocal microscopy
(10).
Only one CAM was identified by site-directed mutagenesis (N111A) (14,
15), but we used a random mutagenesis approach to identify several
other CAMs of the AT1A receptor (16). The
ligand-independent activation of the AT1 signaling pathway
induced by these mutants is abolished by the inverse agonists, losartan
(14, 16) and irbesartan.2 To
study the link between activation and internalization/recycling, we
analyzed the cellular trafficking of three EGFP-tagged CAMs of the
AT1A receptor (N111A, I245T, and L305Q).
 |
MATERIALS AND METHODS |
Construction of the EGFP-tagged CAM and WT
Receptors--
The EGFP-AT1A receptor was constructed in
three steps: 1) the nucleotide sequence of the insulin receptor signal
peptide (sp) was amplified from the pET vector (17) with the following
primers: 5' (ACCGGTCGCCACCATGGGCACCGGGGG) and 3'
(ACCGGTAGGTGGCCCGCGGCGC), which inserted an AgeI site at
both ends of the sp. The PCR fragment was digested with AgeI
and inserted into the AgeI site of pEGFP-C3 (CLONTECH), this construct was called ps-EGFP. 2) A
linker, consisting of six copies of the myc epitope with the
following amino acid sequence:
Glu-Gln-Lys-Leu-Ile-Ser-Glu-Glu-Asp-Leu-Gly-Arg-Phe (Glu-Gln-Lys-Leu-Ile-Ser-Glu-Glu-Asp-Leu)5, was
inserted into the EagI site of pEAT1A (18).
This construct was called 6mycs-AT1A. 3) The
6mycs-AT1A vector was digested with
HindIII and XmaI and inserted into the
HindIII and XmaI site of ps-EGFP. The construct was called ps-EGFP-6mycs-AT1A and the
corresponding receptor was called EGFP-AT1A.
The EGFP-tagged CAMs were constructed as follows: the BamHI
fragment (corresponding to the fragment from amino acid 15 to the stop
codon) of ps-EGFP-6mycs-AT1A cDNA was
replaced with the corresponding BamHI fragment of
pTREC-N111A, pTREC-I245T, or pTREC-L305Q (16). The corresponding
receptors were called: EGFP-N111A, EGFP-I245T, and EGFP-L305Q,
respectively. The L305Q-EGFP mutant was constructed as follows: after a
BstBI digestion, pTREC-L305Q was blunt ended using the large
kleenow fragment and then digested by HindIII. This fragment
was inserted into the HindIII and SmaI sites of pEGFP-N1 (CLONTECH). The truncated mutants were
constructed as follows: for the EGFP- 329, the BamHI
fragment from ps-EGFP-6mycs-AT1A cDNA was
replaced with the corresponding BamHI fragment from pE 329 (19); for EGFP-L305Q- 329, the SpeI-XbaI
fragment of ps-EGFP-6mycs-AT1A 329 (EGFP- 329) was replaced with the corresponding
SpeI-XbaI fragment of pTREC-L305Q containing the
L305Q mutation.
Cell Culture and Transfection--
HEK-293 cells were obtained
from the ATCC (F-14742, 1573-CRL) and were grown in Dulbecco's
modified Eagle's medium supplemented with 7.5% fetal calf serum
(FCS), 0.5 mM glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin (all from Invitrogen). H295 cells were grown in
Dulbecco's modified Eagle's medium-Ham's F-12 (Sigma) supplemented
with 2% Utroser G, 0.5 mM glutamine, 50 units/ml
penicillin, 50 mg/ml streptomycin (Invitrogen), 5 µg/ml insulin, 5 µg/ml transferrin, and 5 ng/ml selenium (Sigma).
For stable expression, HEK-293 cells were transfected with 1 µg/500,000 cells of the plasmid of interest, by use of a liposomal transfection reagent (Dosper, Roche Molecular Diagnosis). Cell lines
stably expressing the EGFP-AT1A, EGFP-N111A, EGFP-I245T, EGFP-L305Q, EGFP- 329, and EGFP-L305Q- 329 receptors were selected for resistance to 750 µg/ml G418 (Invitrogen) and cloned by limiting dilution.
For transient aequorin transfection, the day before transfection,
HEK-EGFP-AT1A or HEK-EGFP-L305Q cells were plated in
polyallylamine (Sigma-Aldrich)-treated white opaque 96-well plates
(Culturplate, Packard) at a density of 50,000 cells/well. Cells were
then transfected with 0.1 µg/50,000 cells of the aequorin plasmid
(gift from R. Rizzuto, University of Ferrara, Ferrara, Italy, (20)),
using a liposomal transfection reagent (Dosper).
For transient H295 cell transfection, cells were plated in
polyallylamine-treated 6- or 24-well plates at 50-70% confluence the
day before transfection. Cells were then transfected with 0.35 µg/well for 24-well plates or 0.7 µg/well for 6-well plates of
AT1A-EGFP or L305Q-EGFP plasmids, using a liposomal
transfection reagent (LipofectAMINE Plus, Invitrogen). FACS analysis
indicated that ~15% of the cells were transfected.
Pharmacological and Signaling Properties of the
EGFP-AT1A, EGFP-N111A, EGFP-I245T, EGFP-L305Q, EGFP- 329,
and EGFP-L305Q- 329 Receptors in HEK-293 Cells or in H295
Cells--
1) Binding experiments with [125I]labeled Ang
II were performed on intact cells, as previously described (21) except
that the incubations with [125I]AngII were performed for
3 h at 4 °C. Binding data were analyzed by linear
regression using the Microsoft Excel 5 program.
2) To measure inositol phosphate (IP) production, cells were
transfected with 0.5 µg/200,000 cells of G q cDNA
(a gift from B. Conklin, Departments of Medicine and Pharmacology,
University of California, San Francisco, CA). The cells were
metabolically labeled with myo-[3H]inositol as
previously described (21) and then the IP content was determined by
methanol extraction and separation on a Dowex AG1-X8 (Bio-Rad) column.
To determine the functional consequences of losartan-induced
externalization, cells were pretreated with LiCl at 16 °C instead of
37 °C.
3) The aequorin assay was performed as previously described (16) on
stable HEK-EGFP-AT1A or HEK-EGFP-L305Q cell lines,
transiently transfected with the plasmid encoding the bioluminescent
calcium-sensitive protein, aequorin, in 96-well plates. 48 h after
transfection, the cells were incubated for 2 h at 37 °C in the
presence or absence of 1 µM losartan in medium
supplemented with 0.5 µM c lenterazine and 1% FCS. The
cells were subsequently washed twice with aequorin buffer and incubated
for 30 min at 16 °C in 50 µl of aequorin buffer (16). Cells were
stimulated by adding 50 µl of increasing concentrations of AngII and
the luminescence was measured 30 s later in a TopCount counter (Packard).
Fluorescence-activated Cell Sorting (FACS)--
Cells expressing
EGFP-tagged receptors were prepared and analyzed by FACS as previously
described (22).
Protein Metabolic Labeling and Immunoprecipitation--
Stable
HEK-EGFP-AT1A or HEK-EGFP-L305Q cells were starved for
1 h in methionine- and cysteine-free Ham's F-12 (Invitrogen). The
starved cells were labeled for 5 min with 50 µCi/ml of
[35S]Redivue Promix (Amersham Pharmacia Biotech) in the
same medium. Cells were then rinsed twice in PBS and incubated for
various time in Dulbecco's modified Eagle's medium supplemented with
7.5% FCS at 37 °C. Cells were then processed for
immunoprecipitation as previously described (10), except that 1 µg of
a monoclonal anti-myc antibody (9E10) was used for the
immunoprecipitation (Santa Cruz Biotechnology). Some immunoprecipitated
samples were treated with Endo H and PNGase F enzymes (both from
Biolabs) according to the manufacturers recommendations.
Biochemical Measurement of Internalization and
Recycling--
Cells were either pretreated with 10 µM
monensin (Sigma) for 1 h at 37 °C or left untreated. These
cells were incubated with 100 nM AngII for 30 min at
4 °C and then incubated at 37 °C for 30 min to allow
internalization. At this point an acid wash (0.2 M acetic
acid, 0.5 M NaCl in binding buffer, 5 min at 4 °C) was performed to remove surface bound AngII. For the recycling studies, cells were additionally incubated in Dulbecco's modified Eagle's medium supplemented with 1% FCS in the presence or absence of 10 µM monensin for various periods of time at 37 °C.
To determine the rates of internalization and recycling, binding
experiments with [125I]labeled AngII were carried out on
intact cells for 3 h at 4 °C as previously described (21).
Measurement of Internalization, Externalization, and
Re-internalization by Confocal Microscopy--
Confocal microscopy was
also used to analyze receptor trafficking as described previously (10).
Cells (50,000 cells/well) were seeded on polyallylamine-treated
chambered coverglass 8 wells (Nunc) and treated for 1 h at
37 °C with 70 µM cycloheximide (Sigma). Cells were
then incubated for 30 min at 4 °C with various ligands in Earle's
buffer (10). Internalization was promoted by incubating the cells in
Earle's complete buffer (10) at 37 or at 16 °C for various periods
of time: 30 min with 100 nM (or 10 nM in Fig. 5C) AngII, 100 nM
[Sar1-Ile8]AngII, 10 µM
L162,313, or for 2 h with 1 µM losartan and 10 µM irbesartan. For the re-internalization study, after
losartan treatment, cells were washed for 30 min at 4 °C in Earle's
complete buffer and then incubated at 37 °C or 16 °C. When
required cells were treated with 10 µM monensin for the
entire assay. After the incubation periods, the cells were rinsed in
ice-cold Earle's buffer and fixed by incubating them for 10 min in
100% methanol at 4 °C.
Cells were examined with a Leica TCS NT confocal laser scanning
microscope configured with a Leica DM IRBE inverted microscope equipped
with an argon/helium/neon laser. EGFP fluorescence was detected
following 100% excitation at 488 nm by use of a spectrophotometer set
with a window between 530 and 600 nm. Images of individual cells
(1024 × 1024 pixels) were obtained by use of a ×63 oil-immersion objective. Each image was done on a cross-section through the cells.
Quantification of the Subcellular Distribution of the
Fluorescence--
Digital image analysis using a specific macro
software (10, 22) derived from the public domain NIH Image software
(developed by the U.S. National Institutes of Health and available on
the Internet at rsb.info.nih.gov/nih-image/) was used to measure
the subcellular distribution of the EGFP-tagged receptors. This
software allowed to measure the S, C, and N values, which correspond to the mean density of the surface, cytoplasm, and nucleus fluorescence. The background fluorescence (N) was subtracted from the S and C values
to give the S' and C' values. The S'/C' ratio provides reliable
information about the level of cell surface expression and the
internalization state of the fluorescent receptor.
Statistics--
Results are expressed as mean ± S.E.
Statistical significance was assessed by the Student's t test.
 |
RESULTS |
Characterization of the EGFP-tagged CAMs of the AngII
AT1A Receptor--
The CAM N111A, I245T, L305Q, and the
wild-type (WT) AT1A receptors were tagged at the N terminus
with EGFP to determine their subcellular localization and trafficking.
A signal peptide was fused to the N terminus of EGFP to allow the
correct exportation of the chimeric protein to the plasma membrane. A
spacer, consisting of a tandem repeat of the myc epitope (63 amino acids), was inserted between EGFP and the AT1A
receptor to prevent steric encumbrance of the AngII-binding site.
The EGFP-tagged CAM and WT receptors were stably transfected in HEK-293
cells and their functional properties were analyzed (Table
I). The Kd of
[125I]AngII for the EGFP-AT1A and the
EGFP-L305Q were both similar to the known Kd of the
non-tagged WT receptor (Kd = 0.61 nM for
the AT1A receptor (19)). As evaluated by binding of labeled
AngII, the EGFP-L305Q receptor presents a lower plasma membrane
expression compared with the WT EGFP-AT1A receptor (Table I). We checked the constitutive activity of the EGFP-L305Q receptor by
measuring the agonist-independent production of IP in the stable cell
line, after transient transfection of the G q cDNA to
increase the sensitivity of the assay (16, 23). The results were
normalized with respect to the expression levels of the receptor to
allow accurate comparison (Table I). The basal activity of the cell line expressing the EGFP-L305Q receptor was three times as high as that
of the cells expressing the WT EGFP-AT1A, showing that the
mutant fused to EGFP retained its constitutive activity. Moreover, the
production of IP was increased by AngII treatment (Table I). The
EGFP-N111A and EGFP-I245T receptors have similar Kd (0.76 ± 0.13 and 0.95 ± 0.19 nM, respectively)
to that of the WT receptor and the same basal constitutive activity as
the EGFP-L305Q receptor (EGFP-N111A, 770 ± 107; EGFP-I245T,
203 ± 16). Thus the EGFP-tagged receptors were fully
functional in terms of ligand binding and second messenger
production.
View this table:
[in this window]
[in a new window]
|
Table I
Functional characterization of the WT EGFP-AT1A and
EGFP-L305Q receptors
Results are expressed as mean ± S.E. from three independent
experiments.
|
|
Cellular Localization of the EGFP-tagged WT and CAM
AT1A Receptors--
The EGFP tag enabled the cellular
localization of the WT and CAM receptors to be determined by confocal
microscopy. Interestingly, whereas the WT EGFP-AT1A
receptors were localized at the cell surface, the CAM receptors (N111A,
L305Q, and I245T) were mainly located in intracellular vesicles in the
cytoplasm and some cells expressed low amount on their plasma membrane
(Fig. 1A).

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 1.
Cellular localization and metabolism of
EGFP-AT1A and EGFP-CAMs receptors. A,
confocal images of untreated HEK-EGFP-AT1A, EGFP-N111A,
EGFP-I245T, and EGFP-L305Q transfected cells. Images are representative
of three independent experiments. Scale bar = 5 µm.
B, metabolic labeling of the EGFP-AT1A and the
EGFP-L305Q receptors. Labeling was carried out with 50 µCi/ml
[35S]methionine/cysteine for 5 min and was chased for the
indicated time in complete medium. C, control HEK cells. The
receptors are indicated by arrowheads. C,
sensitivity of EGFP-AT1A and EGFP-L305Q receptors to Endo H
and PNGase F. The glycosylation state was determined by treating the
immunoprecipitated receptors at times 0 and 60 min of the chase with
the indicated enzymes. The receptors before and after
deglycosylation are indicated by arrowheads. Results are
representative of three independent experiments.
|
|
This constitutive intracellular localization of the CAM
receptors was quantified by calculating the ratio of surface and
cytoplasmic fluorescence densities, denoted here as S'/C' (see
"Materials and Methods"). For the WT EGFP-AT1A
receptor, the S'/C' ratio was typically 1.5-2.0 in the absence of the
ligand and decreased to 0.5 after AngII-induced internalization (Table
I, Fig. 2C and Ref. 10). The S'/C'
ratios of the CAM receptors were dramatically lower than those of the
WT receptor (EGFP-N111A, 0.60 ± 0.06; EGFP-I245T, 0.80 ± 0.09; EGFP-L305Q, 0.66 ± 0.04) (Table I and Fig. 2B).
The S'/C' ratios for the WT and L305Q receptors were further reduced by
incubation with AngII, showing that a non-negligible fraction of the
receptors was still at the plasma membrane and was internalized in the
presence of AngII (Fig. 2C). The presence of the EGFP-L305Q
receptor at the cell surface was confirmed by binding experiments
(Table I).

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of losartan on the cellular
localization of EGFP-tagged WT and CAM receptors. A,
cells were examined by confocal microscopy after a 2-h incubation at
37 °C with or without 1 µM losartan. Scale
bar = 5 µm. B, confocal images were quantified
for four cell lines: HEK-EGFP-AT1A, HEK-EGFP-N111A,
HEK-EGFP-I245T, and HEK-EGFP-L305Q, and the corresponding S'/C' ratios
were calculated. S is the mean density of surface
fluorescence; C is the mean density of cytoplasmic
fluorescence; and N is the mean density of nuclear
fluorescence considered to be background. S'/C' = (S-N)/(C-N).
n = 10 for each point. Results are expressed as
mean ± S.E. from three independent experiments. ,
p < 0.01 versus untreated. C,
effect of other pharmacological molecules on the cellular localization
of EGFP-tagged WT and L305Q receptors. Cells were examined by confocal
microscopy after 30 min at 37 °C with 100 nM AngII, 100 nM [Sar1-Ile8]AngII, or 10 µM L162,313, or 2 h at 37 °C with 10 µM irbesartan. Confocal images were quantified.
n = 10 for each point. Results are expressed as
mean ± S.E. from three independent experiments. *,
p < 0.05; , p < 0.01; §,
p < 0.001 versus untreated.
|
|
We assessed whether these differences in basal S'/C' ratios of WT and
CAM receptors were due to differences in the total number of receptors.
We used FACS to quantify the total fluorescence per cell on
10,000 cells stably expressing the EGFP-L305Q and the WT receptors
(Table I). The two other CAMs presented comparable total fluorescence
(data not shown). We also excluded the possibility that plasma membrane
targeting was altered due to the presence of EGFP at the N terminus,
because the WT or L305Q receptors with a C-terminal EGFP tag presented
the same cellular distribution as their N-terminal-tagged counterparts
(data not shown).
Metabolic labeling experiments were performed to identify differences
in the maturation of the WT and L305Q receptors. The WT
EGFP-AT1A and the EGFP-L305Q receptors both corresponded to ~80-kDa bands and the maximal intensity was reached after a 5-min pulse and progressively decreasing after a 60-min chase (Fig. 1B). The maturation of the proteins was studied by their
sensitivity to Endo H and PNGase F (Fig. 1C). After a 5-min
pulse without chase, both of the receptor types were sensitive to both
enzymes, as indicated by the increase in their electrophoretic
mobility. Surprisingly, after a 60-min chase both receptors were
sensitive to Endo H. This migration profile, i.e.
sensitivity to both enzymes, was also observed on a total cell extract
after deglycosylation. In addition to the ~80-kDa band, the WT
EGFP-AT1A receptor was also represented by a 65-kDa band,
which is not the consequence of EGFP-tag cleavage (data not shown). In
conclusion, the WT EGFP-AT1A and the EGFP-L305Q receptors
present similar maturation/degradation and glycosylation profiles and
the intracellular localization of the CAMs is therefore an intrinsic
property of the constitutive activity and not due to the intracellular
accumulation of the receptor during biosynthesis.
These results provide strong evidence for the constitutive
intracellular localization of three different ATA CAMs
(N111A, I245T, and L305Q). The CAM receptors remaining at the plasma
membrane were fully functional, displaying AngII binding, as well as
AngII-induced signaling and internalization comparable to the WT receptor.
Effect of an Inverse Agonist, Losartan, on the Cellular
Localization of the AT1A CAMs--
The inverse agonist,
losartan, is known to inhibit the constitutive signaling activity of
the AT1A CAMs (14, 16). We hypothesized that this compound
would also affect the cellular localization of the CAMs. Our results
(Fig. 2A) confirmed previous findings (8, 10) that losartan
does not modify the membrane localization of the WT
EGFP-AT1A receptor. The fluorescence of untreated CAM cells
was mainly intracellular, whereas the treatment with losartan resulted
in the appearance of plasma membrane fluorescence. This was clearly
visible on confocal images (Fig. 2A) and resulted in a
50-100% increase in the basal S'/C' ratio of these receptors (Fig.
2B). This plasma membrane translocation resulted in a 29% increase in the number of cell surface-binding sites on the L305Q mutant, as measured by [125I]AngII binding after losartan
wash-away (data not shown). We called this phenomenon
"externalization."
We used the L305Q mutant to determine whether CAM externalization was
specific to inverse agonists or could be observed with other
pharmacological molecules. We tested the peptide antagonist, [Sar1-Ile8]AngII, the non-peptide agonist,
L162,313, and the non-peptide antagonist, irbesartan, which has similar
inverse agonist properties to losartan (data not shown).
[Sar1-Ile8]AngII induced similar levels of
internalization of the WT and L305Q receptors as AngII. L162,313
induced a slight internalization of both WT and L305Q receptors (Fig.
2C). Interestingly, irbesartan had a very similar effect to
losartan. It did not modify the localization of the WT receptor,
whereas it induced a membrane translocation of the EGFP-L305Q receptors
as shown by a ~100% increase in the S'/C' ratio (Fig.
2C). Therefore, only the inverse agonists induced the
externalization of the EGFP-L305Q receptor.
Cellular Localization of the WT and L305Q Receptors in H295
Cells--
H295 is a human adrenocortical carcinoma cell line (24)
which is a model for AngII-responsive aldosterone secretion via activation of endogenous AT1 receptors (25). In this
physiological model of AngII action, the cellular distribution of
transiently transfected EGFP-tagged WT AT1A and L305Q
receptors was studied in basal conditions or after treatment with
losartan. According to efficiency of transfection and binding
experiments, the transfected H295 cells expressed an equivalent number
or a maximum of twice the amount of recombinant (WT or mutated)
AT1 receptors as compared with the amount of endogenous
receptors. This allowed to follow the cellular localization of the WT
and mutated AT1 receptor at a physiological level of
expression and in a physiologically relevant cell.
In these cells, AngII induced internalization of both EGFP-tagged
receptors (data not shown). Whereas the WT receptor was almost
exclusively localized at the plasma membrane, the L305Q receptor
presented a plasma membrane and a diffuse cytoplasmic localization
(Fig. 3A). The S'/C' ratio for the
WT receptor was 8.90 ± 1.24 and was dramatically reduced in the
case of the L305Q receptor (2.30 ± 0.26) (Fig. 3B).
Treatment with losartan had little effect on the cellular localization
and the S'/C' ratio (13.03 ± 3.17) of the WT receptor, whereas it
induced a disappearance of the cytoplasmic fluorescence and a major
increase in the S'/C' ratio (9.80 ± 2.07) for the L305Q receptor
(Fig. 3B). Thus, the intracellular localization and
losartan-induced externalization of the L305Q receptor were also
observed in a different and more physiological cellular model (H295
cells).

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 3.
Cellular localization of the EGFP-tagged WT
AT1A and L305Q receptors in H295 cells. A,
H295 transfected cells were examined by confocal microscopy after a 2-h
incubation at 37 °C with or without 1 µM losartan.
Scale bar = 5 µm. B, confocal images were
quantified on 8-28 cells and the corresponding S'/C' ratios were
calculated in each case. Results are expressed as mean ± S.E.
from three independent experiments. §, p < 0.001 versus WT; , p < 0.01 versus
untreated.
|
|
The Externalization Induced by Inverse Agonists Is Dependent on
Recycling Mechanisms--
Externalization experiments were performed
on cells treated with cycloheximide prior to and during the experiment.
This treatment prevented de novo biosynthesis, thus removing
all receptors from the biosynthesis/secretion pathway, as indicated by
the disappearance of fluorescence in the corresponding structures.
Thus, externalization could not be explained by the arrival of newly
synthesized receptors at the plasma membrane. We hypothesized that
externalization is due to a recycling mechanism.
The classical AngII-induced internalization/recycling mechanisms were
first characterized by a biochemical procedure on EGFP-AT1A and EGFP-L305Q receptors. The WT EGFP-AT1A and EGFP-L305Q
receptors were quickly internalized (t1/2 ~ 5 min)
after the addition of 100 nM AngII and this process is maximum at 30 min (Ref. 8, and data not shown). At this time, acid
washing of the surface AngII allowed to follow receptor recycling by
[125I]AngII binding. The recycling of the EGFP-L305Q
receptor was maximal 2 h after maximal internalization (Fig.
4A). The EGFP-AT1A receptors presented the same recycling properties as the EGFP-L305Q receptors (data not shown). This phenomenon was blocked when the cells
were treated with 10 µM monensin, which is known to
inhibit recycling (Fig. 4B). These results show that: 1) the
EGFP-tagged receptors recycle equally as well as the untagged
receptors, and 2) that the L305Q CAM retains normal recycling
properties.

View larger version (17K):
[in this window]
[in a new window]
|
Fig. 4.
Losartan-induced externalization is dependent
on recycling mechanisms. A, recycling of the EGFP-L305Q
receptor after AngII-induced internalization using the biochemical
internalization and recycling assay. B, effect of monensin
on recycling of the EGFP-L305Q receptor. Cell surface receptors were
measured by [125I]AngII binding after 30 min
internalization and a 3-h recycling period. C, time course
of losartan-induced externalization for the EGFP-L305Q receptor:
HEK-EGFP-L305Q cells were examined by confocal microscopy after being
incubated for various periods of time at 37 °C with 1 µM losartan (1 h, n = 27; 1.3 h,
n = 15; 1.6 h, n = 17; 2 h,
n = 25; 3 h, n = 10). Confocal
images were quantified on three independent experiments. D,
monensin pretreated HEK-EGFP-L305Q cells (n = 22) and
untreated cells (n = 10) were incubated for 2 h at
37 °C with 1 µM losartan with or without monensin.
Cells were examined by confocal microscopy and the confocal images were
quantified. Results are expressed as mean ± S.E. from three
independent experiments. *, p < 0.05 versus
untreated; , p < 0.01 versus untreated;
§, p < 0.001 versus losartan.
|
|
Interestingly, the time dependence of losartan-induced externalization
of the L305Q CAM resembled the kinetics of the recycling process.
Indeed, after treatment of the HEK-EGFP-L305Q cells with losartan, the
S'/C' ratio progressively increased until it reached a plateau at
2 h (Fig. 4C). In addition, when EGFP-L305Q cells were
pretreated with monensin, losartan was no longer able to promote the
externalization of the receptor, as the S'/C' ratio did not increase
compared with untreated cells and even decreased slightly (Fig.
4D). Thus, the externalization process observed upon
incubation with losartan was comparable to a recycling mechanism, recycled receptors being blocked at the cell surface by losartan.
Cytoplasmic Translocation of the EGFP-L305Q Receptor after the
Withdrawal of Losartan Is Dependent on Internalization
Mechanisms--
We questioned what would happen to the externalized
receptors after the removal of losartan. Would they permanently remain at the plasma membrane, suggesting that the distribution of CAM receptors is static? Or would they go back into the cells, as would be
expected if the observed distribution of CAM receptors is the result of
a dynamic cycling process?
To answer these questions, we took advantage of the fact that losartan
can be rapidly dissociated from the receptor by rinsing at 4 °C and
the sensitivity of the internalization process to temperature. After
maximal externalization of the L305Q receptor with losartan, the
inverse agonist was removed by rinsing at 4 °C and the kinetic of
reinternalization process was then observed at 37 °C, by the
microscopy re-internalization assay (see "Materials and Methods").
The plasma membrane fluorescence disappeared from HEK-EGFP-L305Q cells
after 2.5 min at 37 °C and the effect was maximal at 5 min (Fig.
5A). This was comparable to the
kinetics of the WT receptor internalization (t1/2 = 2.7 min (10)). In addition, the reinternalization of the L305Q receptor
was abolished when the assay was performed at 16 °C (instead of
37 °C) (Fig. 5B), a temperature that also blocks the
AngII-induced internalization of the WT receptor (Fig. 5C)
and which blocks the clathrin-dependent internalization of
other receptors (26).

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 5.
Cytoplasmic translocation of the EGFP-L305Q
receptor after losartan withdrawal is dependent on internalization
mechanisms. A, HEK-EGFP-L305Q cells were treated with 1 µM losartan for 2 h at 37 °C, rinsed at 4 °C
to remove losartan and then incubated at 37 °C for various periods
of time. n = 10 for each point. B,
HEK-EGFP-L305Q cells were incubated for 2 h at 37 °C with 1 µM losartan, rinsed to remove losartan, and then
incubated for 15 min at 37 or 16 °C. Cells were examined by confocal
microscopy and the confocal images were quantified. n = 16 for each point. *a, p < 0.05 versus losartan, *b, p < 0.05 versus losartan, wash, 37 °C. C,
HEK-EGFP-AT1A cells were examined by confocal microscopy
after 15 min at 37 °C or at 16 °C with 10 nM AngII.
n = 10 for each point. , p < 0.01 versus untreated; §, p < 0.001 versus AngII 37 °C. Results are expressed as mean ± S.E. from three independent experiments.
|
|
These results show that losartan-induced externalization is a highly
transient process, dependent on the presence of inverse agonists.
Moreover, the removal of losartan results in the cytoplasmic translocation of the EGFP-L305Q receptor dependent on internalization mechanisms.
The Double Mutant, EGFP-L305Q/ 329, Is Localized at the
Plasma Membrane--
To confirm the role of internalization in the
cellular localization of the CAM AT1A receptors, we used a
AT1A receptor mutant truncated at residue 329, which
presents a default of internalization (19). Both EGFP- 329 and
EGFP-L305Q/ 329 mutants present the same binding and signaling
properties as the corresponding untagged receptors (data not shown).
The basal IP production of EGFP-L305Q/ 329 was four times higher than
that of the WT and EGFP- 329 receptors (data not shown), showing that
its constitutive activity had been conserved.
Both cells transfected with EGFP- 329 and with EGFP-L305Q/ 329 show
a fluorescence localized at the plasma membrane (Fig. 6A) and a similar S'/C' ratio to
the WT receptor (Fig. 6B) in basal condition. In the double
mutant, EGFP-L305Q/ 329, the phenotypic trait of EGFP-L305Q
(i.e. constitutive intracellular localization) was abolished
by the 329 truncation. These data strongly suggest that the CAMs of
the AngII AT1A receptor are constitutively
internalized.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 6.
The double mutant,
EGFP-L305Q/ 329, is localized at the plasma
membrane. A, untreated HEK-EGFP-L305Q, HEK-EGFP- 329,
and HEK-EGFP-L305Q 329 cells were examined by confocal microscopy.
Images are representative of three independent experiments. Scale
bar = 5 µm. B, confocal images were quantified
and the S'/C' ratio was calculated for each cell line.
n = 9 for each point. Results are expressed as
mean ± S.E. from three independent experiments. ,
p < 0.01 versus EGFP-L305Q.
|
|
Functional Consequences of Constitutive Internalization and
Externalization of CAM AT1A Receptors--
As the
physiological response is quantitatively dependent on the number of
binding sites at the cell surface, we questioned whether the
constitutive internalization and losartan-induced externalization of
the CAM receptors modulates their signaling properties. Instantaneous
AngII-induced Ca2+ mobilization was measured using an
aequorin test on HEK-EGFP-AT1A and HEK-EGFP-L305Q cells
that had either been pretreated with losartan or left untreated.
Losartan pretreatment induced a decrease of 30% in the calcium
response to AngII for both the EGFP-AT1A and the EGFP-L305Q
receptors (Fig. 7A). Analysis of
the accumulation of IP over a 30-min period in the same experimental
conditions show that losartan pretreatment did not have a major effect
on the EGFP-AT1A and the EGFP-L305Q receptors (Fig.
7B). These data suggest a dual effect of the inverse
agonist, losartan, which increases the number of CAM receptors at the
cell surface and also stabilizes them in an inactive state.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
Coupling state of the EGFP-AT1A
and the EGFP-L305Q receptors after losartan-induced
externalization. A, aequorin assay:
HEK-EGFP-AT1A and HEK-EGFP-L305Q cells were transfected
with 100 ng/96-well of expression plasmid for mt-aequorin, a
bioluminescent protein sensitive to calcium. Two days after
transfection, cells were preincubated with coelanterazine either with
(gray) or without (black) 1 µM
losartan for 2 h at 37 °C and rinsed twice in aequorin buffer
at 16 °C. AngII (100 nM) was added and the luminescent
signal was measured. B, IP accumulation assay: cells that
had been pretreated with 1 µM losartan (gray)
and untreated cells (black) were stimulated for 30 min with
100 nM AngII. Results are expressed as mean ± S.E.
from three independent experiments. *, p < 0.05 versus untreated; , p < 0.01 versus untreated.
|
|
 |
DISCUSSION |
In the present study, we investigated the links between activation
and the cellular localization of the EGFP-tagged CAMs (N111A, I245T,
and L305Q) of the AngII AT1A receptor. We observed that the
CAMs were mostly localized in intracellular compartments and that
inverse agonists, but not agonists or neutral antagonists, induced
their translocation to the plasma membrane. A cytoplasmic localization
and a losartan-induced externalization of the mutant L305Q receptor was
also observed in another more physiological cellular model (H295),
which expresses endogenous AT1 receptors. Its intracellular
localization is less pronounced than that observed in transfected
HEK-293 cells, probably due to differences in the kinetics and
efficiency of internalization and recycling of the AT1
receptor between the two cell types. These observations are not due to
the impaired folding of the CAMs, which would prevent them from exiting
the biosynthetic pathway. We showed indeed that the biosynthesis of the
L305Q CAM and WT AT1A are identical. Imidazole-like inverse
agonists cannot cross the plasma membrane and therefore cannot
stabilize the unfolded receptor intracellularly, as shown for a
misfolded V2 vasopressin mutant (27). Several pieces of evidence
suggest that it is more likely that the CAMs of the AT1A receptor are permanently internalized and recycled: first, the plasma
membrane translocation of the L305Q CAM, or externalization, induced by inverse agonist has the same kinetics and pharmacology as
the recycling mechanism. Second, after externalization by the inverse
agonists, L305Q CAM is quickly and spontaneously re-addressed to the
cytoplasm upon ligand removal by a mechanism comparable to
internalization. Third, the double mutant, EGFP-L305Q/ 329, which is
constitutively active but lacks a domain required for internalization,
is localized at the plasma membrane. Altogether, these data indicate
that the CAMs of the AngII AT1A receptor are constitutively
and permanently internalized and recycled. Inverse agonists block the
CAM in an inactive state when the recycled receptor reaches the plasma
membrane, thus preventing the rapid re-internalization and resulting in
the accumulation of the receptor at the membrane (Fig.
8).

View larger version (61K):
[in this window]
[in a new window]
|
Fig. 8.
Model of the cellular distribution of
AT1A receptor CAMs. In the basal state the wild-type
AT1A receptor was mostly localized at the cell surface.
Inverse agonists (such as losartan and irbesartan) had no effect on the
cellular localization, whereas AngII induced the rapid internalization
(i) of the receptor in intracellular vesicles. The receptor
was then slowly and partly recycled (r) at the plasma
membrane. In the basal state the CAMs of the AT1A receptor
were mostly localized in intracellular vesicles. Losartan induced the
plasma membrane translocation of the CAMs. In the basal state or after
losartan-induced externalization, AngII induced the internalization of
the receptor in intracellular vesicles.
|
|
Although the spontaneous internalization of the CAMs of the GPCR family
has long been considered as a likely possibility, no direct evidence is
available yet. Several CAMs are present within intracellular
compartments, such as mutants of the PTH receptor (28),
1B adrenergic receptor (AR) (29), and the yeast
pheromone receptors, Ste2p and Ste3p (30). Other studies have shown
that CAMs can be spontaneously phosphorylated, desensitized, and/or
down-regulated, but they have not provided evidence for constitutive
internalization (31). Basal phosphorylation is enhanced for two CAMs of
the human LH receptor (32, 33) and for the CAMs of the
1B (34) and 2-AR (35). The
2-AR CAM is also constitutively desensitized and
constitutively down-regulated and both phenomena are reversed by
overnight treatment with the inverse agonist, betaxolol (35).
Constitutive down-regulation reversed by inverse agonists was later
observed for several other CAMs, including mutants of the TRH receptor
(36) and the 1B AR (29, 37), and also for the WT
histamine receptor H2, which exhibits natural constitutive activity
(38). In all cases, the effects of the inverse agonists are only
observed after a long period of treatment, consistent with the
stabilization of newly synthesized receptors. For example, the levels
of CAM 2-AR are increased 4-7-fold after 24 h
treatment, through a protein synthesis-dependent process
that does not change the subcellular distribution of the receptor (39).
This is thus believed to result from the constitutive addressing of the
mutants to degradation pathways. In some cases, inherent instability
and/or folding defects of the CAMs are involved in this down-regulation
process. This is clearly the case for the CAMs of the yeast receptors,
Ste2p and Ste3p, which remain stuck in the biosynthesis pathway because
of impaired folding (30). Stabilizing effects explain how both inverse
agonists and agonists can up-regulate the levels of Step2 and Step3
CAMs, but also of an 2A CAM (40) and a 2
CAM in Sf9 cells (41) or even in vivo (42).
Conversely, the phenomenon observed here is not linked to
the down-regulation or instability of the CAMs of the AT1A
receptor. It is independent of protein synthesis, as all assays were
done on cells treated with cycloheximide. It does not result from the instability of the CAMs, as their metabolism was similar to the WT
receptor. It does not involve protein stabilization as other peptide or
non-peptide ligands, which all differ from inverse agonists by their
ability to induce internalization, were unable to relocalize the
receptor to the plasma membrane. Our results suggest a very different
mechanism and strongly suggest that AT1A CAMs are
constitutively and permanently internalized and are then recycled. It
is not clear whether the same behavior occurs for other CAMs in the
GPCR family, but there are several reasons why this phenomenon has
never been reported before. First, due to the difficulty in obtaining
antibodies and the recent introduction of epitope fluorescent tagging,
the cellular distribution of GPCR has only been studied morphologically
in a limited number of GPCR. Second, the internalization/recycling
kinetics of the AT1A receptor differ from those of other
classical GPCR because it is rapidly internalized (within minutes) and
slowly recycled (within hours), whereas other GPCR are either rapidly
internalized and recycled ( 2-AR) or not recycled but
degraded (LH receptor). The peculiar kinetic of the AT1A
receptor may favor the intracellular accumulation of the receptor.
Some examples in the literature are partially reminiscent of our
observations, suggesting that the phenomenon described here may be
relevant to other CAMs. Although the kinetics are different, two WT
GPCRs have been shown to be constitutively internalized: the thrombin
receptor (43) and the cholecystokinin receptor type A (44). The WT
1D AR is naturally constitutively active and mostly
localized in intracellular compartments, whereas 24 h in the
presence of prazosin causes redistribution of the receptor from
intracellular sites to cellular periphery (45). Finally, other examples
include a deletion mutant of the µ-opioid receptor (46), which is
constitutively internalized and recycled, and an inactive mutant of the
human vasopressin receptor, which is constitutively sequestered in
arrestin-associated intracellular vesicles (47). These mutants are not
constitutively active, but demonstrate that GPCRs can be constitutively
desensitized by mechanisms distinct from constitutive
down-regulation.
Although they do not rule out the permanent cycling of CAMs, recent
results on the phosphorylation of the N111A and N111G mutants of the
AT1A receptor raise the question of the molecular mechanisms regulating this constitutive internalization. Unexpectedly, the phosphorylation of N111A and N111G mutants was not elevated in
basal conditions and, unlike the WT receptor, it was not increased by
AngII treatment (48). However, the CAMs are normally internalized in
response to AngII (Fig. 2C and Ref. 48). The phosphorylation status of the two other mutants studied here (I245T and L305Q) is not
known, but the study by Thomas et al. (48) suggests that the
AngII-induced phosphorylation of the AT1A receptor is not mandatory for internalization and more generally, that phosphorylation and internalization can be dissociated. This is also in agreement with
the fact that phosphorylation is not mandatory for arrestin binding
(49, 50).
Another major difference between our study and previous reports on the
regulation of CAMs is the functional consequence of treatment with
inverse agonists. In the case of CAMs of the 1B AR (37),
the TRH receptor (36), and the 2 AR (35), the up-regulation of receptor levels induced by inverse agonists was accompanied by highly enhanced signaling responses. Conversely, after
losartan-induced externalization of the AT1A CAM, we
observed a reduced AngII-induced calcium mobilization and no
significant change in IP turnover. Unfortunately, pretreatment with
losartan does not only block the receptor at the membrane, but also
partly desensitizes it, as shown by the calcium signaling of the WT
receptor. Therefore, the unchanged or even reduced signaling efficiency of the CAM after losartan treatment is probably due to the small positive effect of the increased number of receptors at the cell surface, which is counterbalanced by partial inactivation. Another possible explanation is that, as previously discussed by Milligan and
Bond (51), the signaling efficiency is dependent on the levels of
expression of G proteins and second messenger generating enzymes. For
example, treatment with inverse agonists did not enhance signaling for
the 2 CAM when the mutant was expressed in NG108-15
cells (52).
The initial purpose of this study was to gain insight into
the link between the activation and internalization of the
AT1A receptor. We wanted to determine whether the receptor
is inexorably targeted for internalization by the cell machinery when
the receptor is in the active conformation and whether activation
necessarily results in internalization. The C-terminal deletion mutant,
329, couples to the G protein but does not become internalized (19, 53), suggesting that activation can be dissociated from
internalization. However, this is due to the absence of a large domain
necessary for the interaction with internalization machinery rather
than a difference in the overall conformation of the receptor. More interestingly, the peptide ligand
[Sar1,Ile4,Ile8]AngII has been
reported to activate the N111A and N111G mutants without inducing their
internalization (data not shown in Ref. 48). In contrast, the results
presented here suggest that the active conformation of the
AT1A receptor is an "internalization-sensitive" conformation. The three CAMs studied carry mutations at different positions in the transmembrane domains but present similar patterns of
cellular distribution. This suggests that the active conformation of
the WT receptor cannot avoid internalization.
Conversely, the AT1A receptor can quite easily
adopt conformations that do not activate signaling but are recognized
for internalization. Non-signaling mutants of the AT1A
receptor (54, 55) are internalized in response to AngII to the same
degree as the WT receptor (8, 55). AngII peptide antagonists are able
to induce internalization of the receptor (8, 10). This
activation-independent internalization also takes place for other
GPCRs, and is also supported by the fact that mutants of the µ-opioid
and vasopressin receptors are constitutively internalized without being
constitutively active (46, 47). These results suggest that the
activation of the signaling pathways by a GPCR requires a much more
specific conformation that the conformation required to trigger
internalization. As arrestin binding is mandatory and is the first step
for the internalization of these GPCRs, arrestin probably recognizes a
broader spectrum of conformations that the G proteins.
In conclusion, this study shows that the CAMs of the AngII
AT1A receptor are constitutively and permanently
internalized and recycled. The externalization phenomenon described
here should define a new paradigm for agonist-independent CAM
regulation, distinct from the strong down-regulation observed for a
number of other CAMs in the GPCR family and first exemplified for the 2-AR (35). Furthermore, this study provides important
insights on the molecular determinants of activation and internalization.
 |
ACKNOWLEDGEMENTS |
We are grateful to Colette Auzan for
methodological assistance and Drs. Sophie Conchon, Bruno Goud, Zsolt
Lenkei, and Laurent Muller for helpful discussions. We thank Drs.
Jérôme Bertherat and Lionel Groussin for the gift of H295 cells.
 |
FOOTNOTES |
*
This work was supported by Grant 98126 from H scht Marion
Roussel and the Institut National Pour la Santé and la Recherche Médicale (INSERM).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed: INSERM EPI
0103-ICGM, Faculté de Médecine Cochin, Port Royal, 24 rue
du Fg St Jacques, 75014 Paris, France. Tel.: 33-1-53-73-27-50; Fax:
33-1-53-73-27-51; E-mail: clauser@cochin.inserm.fr.
Published, JBC Papers in Press, November 29, 2001, DOI 10.1074/jbc.M108398200
2
C. Parnot, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
GPCR, G
protein-coupled receptor;
AngII, angiotensin II;
AT1, angiotensin II type 1 receptor;
IP, inositol phosphate;
EGFP, enhanced
green fluorescent protein;
WT, wild-type;
FACS, fluorescence-activated
cell sorting;
Endo H, endoglycosidase H;
AR, adrenergic receptor;
FCS, fetal calf serum;
CAN, constitutive active mutant.
 |
REFERENCES |
| 1.
|
Venter, J. C.,
Adams, M. D.,
Myers, E. W., Li, P. W.,
Mural, R. J.,
Sutton, G. G.,
Smith, H. O.,
Yandell, M.,
Evans, C. A.,
Holt, R. A.,
Gocayne, J. D.,
Amanatides, P.,
Ballew, R. M.,
Huson, D. H.,
Wortman, J. R.,
Zhang, Q.,
Kodira, C. D.,
Zheng, X. H.,
Chen, L.,
Skupski, M.,
Subramanian, G.,
Thomas, P. D.,
Zhang, J.,
Gabor Miklos, G. L.,
Nelson, C.,
Broder, S.,
Clark, A. G.,
Nadeau, J.,
McKusick, V. A.,
Zinder, N.,
Levine, A. J.,
Roberts, R. J.,
Simon, M.,
Slayman, C.,
Hunkapiller, M.,
Bolanos, R.,
Delcher, A.,
Dew, I.,
Fasulo, D.,
Flanigan, M.,
Florea, L.,
Halpern, A.,
Hannenhalli, S.,
Kravitz, S.,
Levy, S.,
Mobarry, C.,
Reinert, K.,
Remington, K.,
Abu-Threideh, J.,
Beasley, E.,
Biddick, K.,
Bonazzi, V.,
Brandon, R.,
Cargill, M.,
Chandramouliswaran, I.,
Charlab, R.,
Chaturvedi, K.,
Deng, Z., Di,
Francesco, V.,
Dunn, P.,
Eilbeck, K.,
Evangelista, C.,
Gabrielian, A. E.,
Gan, W., Ge, W.,
Gong, F., Gu, Z.,
Guan, P.,
Heiman, T. J.,
Higgins, M. E., Ji, R. R., Ke, Z.,
Ketchum, K. A.,
Lai, Z.,
Lei, Y., Li, Z., Li, J.,
Liang, Y.,
Lin, X., Lu, F.,
Merkulov, G. V.,
Milshina, N.,
Moore, H. M.,
Naik, A. K.,
Narayan, V. A.,
Neelam, B.,
Nusskern, D.,
Rusch, D. B.,
Salzberg, S.,
Shao, W.,
Shue, B.,
Sun, J.,
Wang, Z.,
Wang, A.,
Wang, X.,
Wang, J.,
Wei, M.,
Wides, R.,
Xiao, C.,
Yan, C.,
et al..
(2001)
Science
291,
1304-1351[Abstract/Free Full Text]
|
| 2.
|
Ferguson, S. S.
(2001)
Pharmacol. Rev.
53,
1-24[Abstract/Free Full Text]
|
| 3.
|
Murphy, T. J.,
Alexander, R. W.,
Griendling, K. K.,
Runge, M. S.,
and Bernstein, K. E.
(1991)
Nature
351,
233-236[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Smith, R. D.,
Hunyady, L.,
Olivares-Reyes, J. A.,
Mihalik, B.,
Jayadev, S.,
and Catt, K. J.
(1998)
Mol. Pharmacol.
54,
935-941[Abstract/Free Full Text]
|
| 5.
|
Oppermann, M.,
Freedman, N. J.,
Alexander, R. W.,
and Lefkowitz, R. J.
(1996)
J. Biol. Chem.
271,
13266-13272[Abstract/Free Full Text]
|
| 6.
|
Hunyady, L.,
Bor, M.,
Balla, T.,
and Catt, K. J.
(1994)
J. Biol. Chem.
269,
31378-31382[Abstract/Free Full Text]
|
| 7.
|
Hein, L.,
Meinel, L.,
Pratt, R. E.,
Dzau, V. J.,
and Kobilka, B. K.
(1997)
Mol. Endocrinol.
11,
1266-1277[Abstract/Free Full Text]
|
| 8.
|
Conchon, S.,
Monnot, C.,
Teutsch, B.,
Corvol, P.,
and Clauser, E.
(1994)
FEBS Lett.
349,
365-370[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Chaki, S.,
Guo, D. F.,
Yamano, Y.,
Ohyama, K.,
Tani, M.,
Mizukoshi, M.,
Shirai, H.,
and Inagami, T.
(1994)
Kidney Int.
46,
1492-1495[Medline]
[Order article via Infotrieve]
|
| 10.
|
Miserey-Lenkei, S.,
Lenkei, Z.,
Parnot, C.,
Corvol, P.,
and Clauser, E.
(2001)
Mol. Endocrinol.
15,
294-307[Abstract/Free Full Text]
|
| 11.
|
Gaborik, Z.,
Szaszak, M.,
Szidonya, L.,
Balla, B.,
Paku, S.,
Catt, K. J.,
Clark, A. J.,
and Hunyady, L.
(2001)
Mol. Pharmacol.
59,
239-247[Abstract/Free Full Text]
|
| 12.
|
Boulay, G.,
Chretien, L.,
Richard, D. E.,
and Guillemette, G.
(1994)
Endocrinology
135,
2130-2136[Abstract]
|
| 13.
|
Anborgh, P. H.,
Seachrist, J. L.,
Dale, L. B.,
and Ferguson, S. S.
(2000)
Mol. Endocrinol.
14,
2040-2053[Abstract/Free Full Text]
|
| 14.
|
Groblewski, T.,
Maigret, B.,
Larguier, R.,
Lombard, C.,
Bonnafous, J. C.,
and Marie, J.
(1997)
J. Biol. Chem.
272,
1822-1826[Abstract/Free Full Text]
|
| 15.
|
Balmforth, A. J.,
Lee, A. J.,
Warburton, P.,
Donnelly, D.,
and Ball, S. G.
(1997)
J. Biol. Chem.
272,
4245-4251[Abstract/Free Full Text]
|
| 16.
|
Parnot, C.,
Bardin, S.,
Miserey-Lenkei, S.,
Guedin, D.,
Corvol, P.,
and Clauser, E.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
7615-7620[Abstract/Free Full Text]
|
| 17.
|
Ellis, L.,
Clauser, E.,
Morgan, D. O.,
Edery, M.,
Roth, R. A.,
and Rutter, W. J.
(1986)
Cell
45,
721-732[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Conchon, S.,
Monnot, C.,
Sirieix, M. E.,
Bihoreau, C.,
Corvol, P.,
and Clauser, E.
(1994)
Biochem. Biophys. Res. Commun.
199,
1347-1354[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Conchon, S.,
Peltier, N.,
Corvol, P.,
and Clauser, E.
(1998)
Am. J. Physiol.
274,
E336-345[Abstract/Free Full Text]
|
| 20.
|
Rizzuto, R.,
Simpson, A. W.,
Brini, M.,
and Pozzan, T.
(1992)
Nature
358,
325-327[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Conchon, S.,
Barrault, M. B.,
Miserey, S.,
Corvol, P.,
and Clauser, E.
(1997)
J. Biol. Chem.
272,
25566-25572[Abstract/Free Full Text]
|
| 22.
|
Lenkei, Z.,
Beaudet, A.,
Chartrel, N., De,
Mota, N.,
Irinopoulou, T.,
Braun, B.,
Vaudry, H.,
and Llorens-Cortes, C.
(2000)
J. Histochem. Cytochem.
48,
1553-1564[Abstract/Free Full Text]
|
| 23.
|
Burstein, E. S.,
Spalding, T. A.,
Brauner-Osborne, H.,
and Brann, M. R.
(1995)
FEBS Lett.
363,
261-263[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Gazdar, A. F.,
Oie, H. K.,
Shackleton, C. H.,
Chen, T. R.,
Triche, T. J.,
Myers, C. E.,
Chrousos, G. P.,
Brennan, M. F.,
Stein, C. A.,
and La Rocca, R. V.
(1990)
Cancer Res.
50,
5488-5496[Abstract/Free Full Text]
|
| 25.
|
Bird, I. M.,
Hanley, N. A.,
Word, R. A.,
Mathis, J. M.,
McCarthy, J. L.,
Mason, J. I.,
and Rainey, W. E.
(1993)
Endocrinology
133,
1555-1561[Abstract/Free Full Text]
|
| 26.
|
Cao, T. T.,
Mays, R. W.,
and von Zastrow, M.
(1998)
J. Biol. Chem.
273,
24592-24602[Abstract/Free Full Text]
|
| 27.
|
Morello, J. P.,
Salahpour, A.,
Laperriere, A.,
Bernier, V.,
Arthus, M. F.,
Lonergan, M.,
Petaja-Repo, U.,
Angers, S.,
Morin, D.,
Bichet, D. G.,
and Bouvier, M.
(2000)
J. Clin. Invest.
105,
887-895[Medline]
[Order article via Infotrieve]
|
| 28.
|
Ferrari, S. L.,
and Bisello, A.
(2001)
Mol. Endocrinol.
15,
149-163[Abstract/Free Full Text]
|
| 29.
|
Stevens, P. A.,
Bevan, N.,
Rees, S.,
and Milligan, G.
(2000)
Mol. Pharmacol.
58,
438-448[Abstract/Free Full Text]
|
| 30.
|
Stefan, C. J.,
Overton, M. C.,
and Blumer, K. J.
(1998)
Mol. Biol. Cell
9,
885-899[Abstract/Free Full Text]
|
| 31.
|
Leurs, R.,
Smit, M. J.,
Alewijnse, A. E.,
and Timmerman, H.
(1998)
Trends Biochem. Sci
23,
418-422[CrossRef][Medline]
[Order article via Infotrieve]
|
| 32.
|
Min, K. S.,
Liu, X.,
Fabritz, J.,
Jaquette, J.,
Abell, A. N.,
and Ascoli, M.
(1998)
J. Biol. Chem.
273,
34911-34919[Abstract/Free Full Text]
|
| 33.
|
Min, L.,
and Ascoli, M.
(2000)
Mol. Endocrinol.
14,
1797-1810[Abstract/Free Full Text]
|
| 34.
|
Mhaouty-Kodja, S.,
Barak, L. S.,
Scheer, A.,
Abuin, L.,
Diviani, D.,
Caron, M. G.,
and Cotecchia, S.
(1999)
Mol. Pharmacol.
55,
339-347[Abstract/Free Full Text]
|
| 35.
|
Pei, G.,
Samama, P.,
Lohse, M.,
Wang, M.,
Codina, J.,
and Lefkowitz, R. J.
(1994)
Proc. Natl. Acad. Sci. U. S. A.
91,
2699-2702[Abstract/Free Full Text]
|
| 36.
|
Heinflink, M.,
Nussenzveig, D. R.,
Grimberg, H.,
Lupu-Meiri, M.,
Oron, Y.,
and Gershengorn, M. C.
(1995)
Mol. Endocrinol.
9,
1455-1460[Abstract/Free Full Text]
|
| 37.
|
Lee, T. W.,
Cotecchia, S.,
and Milligan, G.
(1997)
Biochem. J.
325,
733-739
|
| 38.
|
Smit, M. J.,
Leurs, R.,
Alewijnse, A. E.,
Blauw, J.,
Van Nieuw Amerongen, G. P.,
Van De Vrede, Y.,
Roovers, E.,
and Timmerman, H.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
6802-6807[Abstract/Free Full Text]
|
| 39.
|
MacEwan, D. J.,
and Milligan, G.
(1996)
FEBS Lett.
399,
108-112[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Betuing, S.,
Valet, P.,
Lapalu, S.,
Peyroulan, D.,
Hickson, G.,
Daviaud, D.,
Lafontan, M.,
and Saulnier-Blache, J. S.
(1997)
Biochem. Biophys. Res. Commun.
235,
765-773[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Gether, U.,
Ballesteros, J. A.,
Seifert, R.,
Sanders-Bush, E.,
Weinstein, H.,
and Kobilka, B. K.
(1997)
J. Biol. Chem.
272,
2587-2590[Abstract/Free Full Text]
|
| 42.
|
Samama, P.,
Bond, R. A.,
Rockman, H. A.,
Milano, C. A.,
and Lefkowitz, R. J.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
137-141[Abstract/Free Full Text]
|
| 43.
|
Shapiro, M. J.,
Trejo, J.,
Zeng, D.,
and Coughlin, S. R.
(1996)
J. Biol. Chem.
271,
32874-32880[Abstract/Free Full Text]
|
| 44.
|
Tarasova, N. I.,
Stauber, R. H.,
Choi, J. K.,
Hudson, E. A.,
Czerwinski, G.,
Miller, J. L.,
Pavlakis, G. N.,
Michejda, C. J.,
and Wank, S. A.
(1997)
J. Biol. Chem.
272,
14817-14824[Abstract/Free Full Text]
|
| 45.
|
McCune, D. F.,
Edelmann, S. E.,
Olges, J. R.,
Post, G. R.,
Waldrop, B. A.,
Waugh, D. J.,
Perez, D. M.,
and Piascik, M. T.
(2000)
Mol. Pharmacol.
57,
659-666[Abstract/Free Full Text]
|
| 46.
|
Segredo, V.,
Burford, N. T.,
Lameh, J.,
and Sadee, W.
(1997)
J. Neurochem.
68,
2395-2404[Medline]
[Order article via Infotrieve]
|
| 47.
|
Barak, L. S.,
Oakley, R. H.,
Laporte, S. A.,
and Caron, M. G.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
93-98[Abstract/Free Full Text]
|
| 48.
|
Thomas, W. G.,
Qian, H.,
Chang, C. S.,
and Karnik, S.
(2000)
J. Biol. Chem.
275,
2893-2900[Abstract/Free Full Text]
|
| 49.
|
Bouvier, M.,
Hausdorff, W. P., De,
Blasi, A.,
O'Dowd, B. F.,
Kobilka, B. K.,
Caron, M. G.,
and Lefkowitz, R. J.
(1988)
Nature
333,
370-373[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Hausdorff, W. P.,
Bouvier, M.,
O'Dowd, B. F.,
Irons, G. P.,
Caron, M. G.,
and Lefkowitz, R. J.
(1989)
J. Biol. Chem.
264,
12657-12665[Abstract/Free Full Text]
|
| 51.
|
Milligan, G.,
and Bond, R. A.
(1997)
Trends Pharmacol. Sci.
18,
468-474[Medline]
[Order article via Infotrieve]
|
| 52.
|
MacEwan, D. J.,
and Milligan, G.
(1996)
Mol. Pharmacol.
50,
1479-1486[Abstract]
|
| 53.
|
Thomas, W. G.,
Thekkumkara, T. J.,
Motel, T. J.,
and Baker, K. M.
(1995)
J. Biol. Chem.
270,
207-213[Abstract/Free Full Text]
|
| 54.
|
Bihoreau, C.,
Monnot, C.,
Davies, E.,
Teutsch, B.,
Bernstein, K. E.,
Corvol, P.,
and Clauser, E.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
5133-5137[Abstract/Free Full Text]
|
| 55.
|
Hunyady, L.,
Baukal, A. J.,
Balla, T.,
and Catt, K. J.
(1994)
J. Biol. Chem.
269,
24798-24804[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Kocan, H. B. See, N. G. Sampaio, K. A. Eidne, B. J. Feldman, and K. D. G. Pfleger
Agonist-Independent Interactions between {beta}-Arrestins and Mutant Vasopressin Type II Receptors Associated with Nephrogenic Syndrome of Inappropriate Antidiuresis
Mol. Endocrinol.,
April 1, 2009;
23(4):
559 - 571.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Thieme, D. M. N. Eguti, M. Mello-Aires, and M. Oliveira-Souza
The effect of angiotensin II on intracellular pH is mediated by AT1 receptor translocation
Am J Physiol Cell Physiol,
July 1, 2008;
295(1):
C138 - C145.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. Walwyn, C. J. Evans, and T. G. Hales
{beta}-Arrestin2 and c-Src Regulate the Constitutive Activity and Recycling of {micro} Opioid Receptors in Dorsal Root Ganglion Neurons
J. Neurosci.,
May 9, 2007;
27(19):
5092 - 5104.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Oliveira, C. M. Costa-Neto, C. R. Nakaie, S. Schreier, S. I. Shimuta, and A. C. M. Paiva
The Angiotensin II AT1 Receptor Structure-Activity Correlations in the Light of Rhodopsin Structure
Physiol Rev,
April 1, 2007;
87(2):
565 - 592.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Cook, S. J. Mills, R. T. Naquin, J. Alam, and R. N. Re
Cleavage of the angiotensin II type 1 receptor and nuclear accumulation of the cytoplasmic carboxy-terminal fragment
Am J Physiol Cell Physiol,
April 1, 2007;
292(4):
C1313 - C1322.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. M. D. Santos, L. A. Gardner, S. W. White, and S. W. Bahouth
Characterization of the Residues in Helix 8 of the Human beta1-Adrenergic Receptor That Are Involved in Coupling the Receptor to G Proteins
J. Biol. Chem.,
May 5, 2006;
281(18):
12896 - 12907.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Billet, S. Bardin, R. Tacine, E. Clauser, and S. Conchon
The AT1A receptor "gain-of-function" mutant N111S/{Delta}329 is both constitutively active and hyperreactive to angiotensin II
Am J Physiol Endocrinol Metab,
May 1, 2006;
290(5):
E840 - E848.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Leterrier, J. Laine, M. Darmon, H. Boudin, J. Rossier, and Z. Lenkei
Constitutive activation drives compartment-selective endocytosis and axonal targeting of type 1 cannabinoid receptors.
J. Neurosci.,
March 22, 2006;
26(12):
3141 - 3153.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Wang, C. G. Radu, L. V. Yang, L. A. Bentolila, M. Riedinger, and O. N. Witte
Lysophosphatidylcholine-induced Surface Redistribution Regulates Signaling of the Murine G Protein-coupled Receptor G2A
Mol. Biol. Cell,
May 1, 2005;
16(5):
2234 - 2247.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Robert, E. Clauser, P. X. Petit, and M. A. Ventura
A Novel C-terminal Motif Is Necessary for the Export of the Vasopressin V1b/V3 Receptor to the Plasma Membrane
J. Biol. Chem.,
January 21, 2005;
280(3):
2300 - 2308.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Holst, N. D. Holliday, A. Bach, C. E. Elling, H. M. Cox, and T. W. Schwartz
Common Structural Basis for Constitutive Activity of the Ghrelin Receptor Family
J. Biol. Chem.,
December 17, 2004;
279(51):
53806 - 53817.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Xia, S. Kjaer, K. Zheng, P.-S. Hu, L. Bai, J.-Y. Jia, R. Rigler, A. Pramanik, T. Xu, T. Hokfelt, et al.
Visualization of a functionally enhanced GFP-tagged galanin R2 receptor in PC12 cells: Constitutive and ligand-induced internalization
PNAS,
October 19, 2004;
101(42):
15207 - 15212.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. P. Morris, R. R. Price, M. P. Smith, B. Lei, and D. A. Schwinn
Cellular Trafficking of Human {alpha}1a-Adrenergic Receptors Is Continuous and Primarily Agonist-Independent
Mol. Pharmacol.,
October 1, 2004;
66(4):
843 - 854.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. R. Santhamma, R. Sadhukhan, M. Kinter, S. Chattopadhyay, B. McCue, and I. Sen
Role of Tyrosine Phosphorylation in the Regulation of Cleavage Secretion of Angiotensin-converting Enzyme
J. Biol. Chem.,
September 17, 2004;
279(38):
40227 - 40236.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Leterrier, D. Bonnard, D. Carrel, J. Rossier, and Z. Lenkei
Constitutive Endocytic Cycle of the CB1 Cannabinoid Receptor
J. Biol. Chem.,
August 20, 2004;
279(34):
36013 - 36021.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Bernier, M. Lagace, M. Lonergan, M.-F. Arthus, D. G. Bichet, and M. Bouvier
Functional Rescue of the Constitutively Internalized V2 Vasopressin Receptor Mutant R137H by the Pharmacological Chaperone Action of SR49059
Mol. Endocrinol.,
August 1, 2004;
18(8):
2074 - 2084.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Takezako, C. Gogonea, Y. Saad, K. Noda, and S. S. Karnik
"Network Leaning" as a Mechanism of Insurmountable Antagonism of the Angiotensin II Type 1 Receptor by Non-peptide Antagonists
J. Biol. Chem.,
April 9, 2004;
279(15):
15248 - 15257.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Milligan
Constitutive Activity and Inverse Agonists of G Protein-Coupled Receptors: a Current Perspective
Mol. Pharmacol.,
December 1, 2003;
64(6):
1271 - 1276.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F.-Y. Zeng, A. J. McLean, G. Milligan, M. Lerner, D. T. Chalmers, and D. P. Behan
Ligand Specific Up-Regulation of a Renilla reniformis Luciferase-Tagged, Structurally Unstable Muscarinic M3 Chimeric G Protein-Coupled Receptor
Mol. Pharmacol.,
December 1, 2003;
64(6):
1474 - 1484.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Auger-Messier, M. Clement, P. M. Lanctot, P. C. Leclerc, R. Leduc, E. Escher, and G. Guillemette
The Constitutively Active N111G-AT1 Receptor for Angiotensin II Maintains a High Affinity Conformation Despite Being Uncoupled from Its Cognate G Protein Gq/11{alpha}
Endocrinology,
December 1, 2003;
144(12):
5277 - 5284.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Waldhoer, P. Casarosa, M. M. Rosenkilde, M. J. Smit, R. Leurs, J. L. Whistler, and T. W. Schwartz
The Carboxyl Terminus of Human Cytomegalovirus-encoded 7 Transmembrane Receptor US28 Camouflages Agonism by Mediating Constitutive Endocytosis
J. Biol. Chem.,
May 23, 2003;
278(21):
19473 - 19482.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. D. Rochdi and J.-L. Parent
Galpha q-coupled Receptor Internalization Specifically Induced by Galpha q Signaling. REGULATION BY EBP50
J. Biol. Chem.,
May 9, 2003;
278(20):
17827 - 17837.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|