HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 8, 5891-5901, February 22, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/8/5891    most recent M108398200v1 Alert me when this article is cited Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Miserey-Lenkei, S. Articles by Clauser, E. Search for Related Content PubMed PubMed Citation Articles by Miserey-Lenkei, S. Articles by Clauser, E. Social Bookmarking                      What's this?

Constitutive Internalization of Constitutively Active Angiotensin II AT_1A Receptor Mutants Is Blocked by Inverse Agonists^*

Stéphanie Miserey-Lenkei, Charles Parnot, Sabine Bardin, Pierre Corvol^§, and Eric Clauser^¶

From  INSERM EPI 0103, Institut Cochin, 24 rue du Faubourg Saint-Jacques, 75014 Paris, France and ^§ INSERM U36, Collège de France, 11 place Marcelin Berthelot, 75005 Paris, France

Received for publication, August 30, 2001, and in revised form, November 20, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

As constitutively active mutants (CAMs) mimic an active conformation, they can be used to characterize the process of G protein-coupled receptor activation. Here, we used CAMs to study the link between activation and internalization of the angiotensin II AT_1A receptor. The cellular localization of fluorescently tagged N111A, I245T, and L305Q mutants was determined by confocal microscopy. In the absence of ligand, CAMs were mostly located in intracellular vesicles, whereas the wild-type AT_1A was found at the cell surface. After 2 h incubation with inverse agonist, losartan, CAMs were translocated to the plasma membrane. Similar observations were made in H295, a human adrenocortical cell line which expresses physiologically the AT₁ receptor. This phenomenon, which was not dependent on protein synthesis and the pharmacology and kinetics of which were similar to the recycling of the wild-type receptor, was called "externalization". After externalization and losartan removal, the L305Q CAM underwent rapid ligand-independent endocytocis, with the same kinetics and temperature sensitivity as the angiotensin II-induced internalization of the wild-type AT_1A. Moreover, the addition of a second mutation known to block internalization (329 truncation) prevented intracellular localization of the CAM. These data show that AT_1A CAMs are constitutively and permanently internalized and recycled. This mechanism is different from the down-regulation observed for CAMs of other G protein-coupled receptors and thus defines a new paradigm for the cellular regulation of CAMs.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

G protein-coupled receptors (GPCR)¹ form one of the largest protein families, with several hundred members in humans (1). Despite the wide variety of ligands and physiological roles, these receptors are all structurally characterized by seven-transmembrane domains and most of them are thought to share common activation and desensitization mechanisms. GPCRs are supposed to isomerize spontaneously between an inactive (R) and an active state (R*), the latter being responsible for G protein coupling and subsequent intracellular signaling. This two-state model is probably oversimplified but is helpful for the interpretation of mutagenesis and pharmacological data. It is supported by the existence of constitutively active mutants (CAMs) in the GPCR family. These mutants mimic the active state and therefore present permanent ligand-independent signaling. Ligands able to block this constitutive activity are called inverse agonists. In the two-state model, the inverse agonists have preferential affinity for the inactive state (R). Conversely, "regular" agonists preferentially bind the active state (R*).

Many GPCRs are desensitized after G protein activation, i.e. they become insensitive to agonists. The binding of arrestins to the receptor is known to play a major role in this process and is favored by the phosphorylation of the receptor by specific GPCR kinases. The arrestins prevent further interaction with the G proteins. They also promote internalization via clathrin-coated pit-dependent endocytosis, which results in the disappearance of the receptor from the plasma membrane (2). Finally, they participate in the recycling of the receptor, which can take a few minutes to a few hours, depending on the type of GPCR. In some cases, some of the receptors can also be down-regulated, leading to long-term desensitization. Activation is thus a physiological prerequisite for receptor internalization and these two processes are probably highly dependent on each other. As CAMs mimic the active conformation of the receptor, they should help to elucidate the link between activation and internalization.

In this study, we used the angiotensin II (AngII) type 1 receptor (AT₁) as a model to address this question. The AT₁ receptor regulates the contraction and hypertrophy of vascular smooth muscle cell contraction and the secretion of aldosterone. Thus it plays a critical role in the control of blood pressure and sodium homeostasis. This pivotal physiological role makes the AT₁ receptor an important therapeutic target and numerous antihypertensive and cardioprotector agents have been developed. As a consequence, it is also one of the most studied GPCRs. Its cDNA was first cloned in 1991 (3). The AT₁ receptor (AT_1A and AT_1B in rodents) leads to the G_q/11-mediated activation of phospholipase C-, which generates diacylglycerol and inositol (1,4,5)-trisphosphate. Following the phosphorylation of the intracellular sequences (4, 5), the AT₁ receptor is rapidly internalized (t_1/2 ~ 5 min) (6-10) in clathrin-coated pits after interaction with -arrestin 1 and dynamin 1 and 2 (11). The receptor is then slowly and partly recycled at the plasma membrane (7, 12, 13). We were able to directly visualize the internalization process of an EGFP-tagged AT₁ receptor using confocal microscopy (10).

Only one CAM was identified by site-directed mutagenesis (N111A) (14, 15), but we used a random mutagenesis approach to identify several other CAMs of the AT_1A receptor (16). The ligand-independent activation of the AT₁ signaling pathway induced by these mutants is abolished by the inverse agonists, losartan (14, 16) and irbesartan.² To study the link between activation and internalization/recycling, we analyzed the cellular trafficking of three EGFP-tagged CAMs of the AT_1A receptor (N111A, I245T, and L305Q).

	MATERIALS AND METHODS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Construction of the EGFP-tagged CAM and WT Receptors-- The EGFP-AT_1A receptor was constructed in three steps: 1) the nucleotide sequence of the insulin receptor signal peptide (sp) was amplified from the pET vector (17) with the following primers: 5' (ACCGGTCGCCACCATGGGCACCGGGGG) and 3' (ACCGGTAGGTGGCCCGCGGCGC), which inserted an AgeI site at both ends of the sp. The PCR fragment was digested with AgeI and inserted into the AgeI site of pEGFP-C3 (CLONTECH), this construct was called ps-EGFP. 2) A linker, consisting of six copies of the myc epitope with the following amino acid sequence: Glu-Gln-Lys-Leu-Ile-Ser-Glu-Glu-Asp-Leu-Gly-Arg-Phe (Glu-Gln-Lys-Leu-Ile-Ser-Glu-Glu-Asp-Leu)₅, was inserted into the EagI site of pEAT_1A (18). This construct was called 6mycs-AT_1A. 3) The 6mycs-AT_1A vector was digested with HindIII and XmaI and inserted into the HindIII and XmaI site of ps-EGFP. The construct was called ps-EGFP-6mycs-AT_1A and the corresponding receptor was called EGFP-AT_1A.

The EGFP-tagged CAMs were constructed as follows: the BamHI fragment (corresponding to the fragment from amino acid 15 to the stop codon) of ps-EGFP-6mycs-AT_1A cDNA was replaced with the corresponding BamHI fragment of pTREC-N111A, pTREC-I245T, or pTREC-L305Q (16). The corresponding receptors were called: EGFP-N111A, EGFP-I245T, and EGFP-L305Q, respectively. The L305Q-EGFP mutant was constructed as follows: after a BstBI digestion, pTREC-L305Q was blunt ended using the large kleenow fragment and then digested by HindIII. This fragment was inserted into the HindIII and SmaI sites of pEGFP-N1 (CLONTECH). The truncated mutants were constructed as follows: for the EGFP-329, the BamHI fragment from ps-EGFP-6mycs-AT_1A cDNA was replaced with the corresponding BamHI fragment from pE329 (19); for EGFP-L305Q-329, the SpeI-XbaI fragment of ps-EGFP-6mycs-AT_1A329 (EGFP-329) was replaced with the corresponding SpeI-XbaI fragment of pTREC-L305Q containing the L305Q mutation.

Cell Culture and Transfection-- HEK-293 cells were obtained from the ATCC (F-14742, 1573-CRL) and were grown in Dulbecco's modified Eagle's medium supplemented with 7.5% fetal calf serum (FCS), 0.5 mM glutamine, 100 units/ml penicillin, and 100 µg/ml streptomycin (all from Invitrogen). H295 cells were grown in Dulbecco's modified Eagle's medium-Ham's F-12 (Sigma) supplemented with 2% Utroser G, 0.5 mM glutamine, 50 units/ml penicillin, 50 mg/ml streptomycin (Invitrogen), 5 µg/ml insulin, 5 µg/ml transferrin, and 5 ng/ml selenium (Sigma).

For stable expression, HEK-293 cells were transfected with 1 µg/500,000 cells of the plasmid of interest, by use of a liposomal transfection reagent (Dosper, Roche Molecular Diagnosis). Cell lines stably expressing the EGFP-AT_1A, EGFP-N111A, EGFP-I245T, EGFP-L305Q, EGFP-329, and EGFP-L305Q-329 receptors were selected for resistance to 750 µg/ml G418 (Invitrogen) and cloned by limiting dilution.

For transient aequorin transfection, the day before transfection, HEK-EGFP-AT_1A or HEK-EGFP-L305Q cells were plated in polyallylamine (Sigma-Aldrich)-treated white opaque 96-well plates (Culturplate, Packard) at a density of 50,000 cells/well. Cells were then transfected with 0.1 µg/50,000 cells of the aequorin plasmid (gift from R. Rizzuto, University of Ferrara, Ferrara, Italy, (20)), using a liposomal transfection reagent (Dosper).

For transient H295 cell transfection, cells were plated in polyallylamine-treated 6- or 24-well plates at 50-70% confluence the day before transfection. Cells were then transfected with 0.35 µg/well for 24-well plates or 0.7 µg/well for 6-well plates of AT_1A-EGFP or L305Q-EGFP plasmids, using a liposomal transfection reagent (LipofectAMINE Plus, Invitrogen). FACS analysis indicated that ~15% of the cells were transfected.

Pharmacological and Signaling Properties of the EGFP-AT_1A, EGFP-N111A, EGFP-I245T, EGFP-L305Q, EGFP-329, and EGFP-L305Q-329 Receptors in HEK-293 Cells or in H295 Cells-- 1) Binding experiments with [¹²⁵I]labeled Ang II were performed on intact cells, as previously described (21) except that the incubations with [¹²⁵I]AngII were performed for 3 h at 4 °C. Binding data were analyzed by linear regression using the Microsoft Excel 5 program.

2) To measure inositol phosphate (IP) production, cells were transfected with 0.5 µg/200,000 cells of G_q cDNA (a gift from B. Conklin, Departments of Medicine and Pharmacology, University of California, San Francisco, CA). The cells were metabolically labeled with myo-[³H]inositol as previously described (21) and then the IP content was determined by methanol extraction and separation on a Dowex AG1-X8 (Bio-Rad) column. To determine the functional consequences of losartan-induced externalization, cells were pretreated with LiCl at 16 °C instead of 37 °C.

3) The aequorin assay was performed as previously described (16) on stable HEK-EGFP-AT_1A or HEK-EGFP-L305Q cell lines, transiently transfected with the plasmid encoding the bioluminescent calcium-sensitive protein, aequorin, in 96-well plates. 48 h after transfection, the cells were incubated for 2 h at 37 °C in the presence or absence of 1 µM losartan in medium supplemented with 0.5 µM clenterazine and 1% FCS. The cells were subsequently washed twice with aequorin buffer and incubated for 30 min at 16 °C in 50 µl of aequorin buffer (16). Cells were stimulated by adding 50 µl of increasing concentrations of AngII and the luminescence was measured 30 s later in a TopCount counter (Packard).

Fluorescence-activated Cell Sorting (FACS)-- Cells expressing EGFP-tagged receptors were prepared and analyzed by FACS as previously described (22).

Protein Metabolic Labeling and Immunoprecipitation-- Stable HEK-EGFP-AT_1A or HEK-EGFP-L305Q cells were starved for 1 h in methionine- and cysteine-free Ham's F-12 (Invitrogen). The starved cells were labeled for 5 min with 50 µCi/ml of [³⁵S]Redivue Promix (Amersham Pharmacia Biotech) in the same medium. Cells were then rinsed twice in PBS and incubated for various time in Dulbecco's modified Eagle's medium supplemented with 7.5% FCS at 37 °C. Cells were then processed for immunoprecipitation as previously described (10), except that 1 µg of a monoclonal anti-myc antibody (9E10) was used for the immunoprecipitation (Santa Cruz Biotechnology). Some immunoprecipitated samples were treated with Endo H and PNGase F enzymes (both from Biolabs) according to the manufacturers recommendations.

Biochemical Measurement of Internalization and Recycling-- Cells were either pretreated with 10 µM monensin (Sigma) for 1 h at 37 °C or left untreated. These cells were incubated with 100 nM AngII for 30 min at 4 °C and then incubated at 37 °C for 30 min to allow internalization. At this point an acid wash (0.2 M acetic acid, 0.5 M NaCl in binding buffer, 5 min at 4 °C) was performed to remove surface bound AngII. For the recycling studies, cells were additionally incubated in Dulbecco's modified Eagle's medium supplemented with 1% FCS in the presence or absence of 10 µM monensin for various periods of time at 37 °C. To determine the rates of internalization and recycling, binding experiments with [¹²⁵I]labeled AngII were carried out on intact cells for 3 h at 4 °C as previously described (21).

Measurement of Internalization, Externalization, and Re-internalization by Confocal Microscopy-- Confocal microscopy was also used to analyze receptor trafficking as described previously (10). Cells (50,000 cells/well) were seeded on polyallylamine-treated chambered coverglass 8 wells (Nunc) and treated for 1 h at 37 °C with 70 µM cycloheximide (Sigma). Cells were then incubated for 30 min at 4 °C with various ligands in Earle's buffer (10). Internalization was promoted by incubating the cells in Earle's complete buffer (10) at 37 or at 16 °C for various periods of time: 30 min with 100 nM (or 10 nM in Fig. 5C) AngII, 100 nM [Sar¹-Ile⁸]AngII, 10 µM L162,313, or for 2 h with 1 µM losartan and 10 µM irbesartan. For the re-internalization study, after losartan treatment, cells were washed for 30 min at 4 °C in Earle's complete buffer and then incubated at 37 °C or 16 °C. When required cells were treated with 10 µM monensin for the entire assay. After the incubation periods, the cells were rinsed in ice-cold Earle's buffer and fixed by incubating them for 10 min in 100% methanol at 4 °C.

Cells were examined with a Leica TCS NT confocal laser scanning microscope configured with a Leica DM IRBE inverted microscope equipped with an argon/helium/neon laser. EGFP fluorescence was detected following 100% excitation at 488 nm by use of a spectrophotometer set with a window between 530 and 600 nm. Images of individual cells (1024 × 1024 pixels) were obtained by use of a ×63 oil-immersion objective. Each image was done on a cross-section through the cells.

Quantification of the Subcellular Distribution of the Fluorescence-- Digital image analysis using a specific macro software (10, 22) derived from the public domain NIH Image software (developed by the U.S. National Institutes of Health and available on the Internet at rsb.info.nih.gov/nih-image/) was used to measure the subcellular distribution of the EGFP-tagged receptors. This software allowed to measure the S, C, and N values, which correspond to the mean density of the surface, cytoplasm, and nucleus fluorescence. The background fluorescence (N) was subtracted from the S and C values to give the S' and C' values. The S'/C' ratio provides reliable information about the level of cell surface expression and the internalization state of the fluorescent receptor.

Statistics-- Results are expressed as mean ± S.E. Statistical significance was assessed by the Student's t test.

	RESULTS

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

Characterization of the EGFP-tagged CAMs of the AngII AT_1A Receptor-- The CAM N111A, I245T, L305Q, and the wild-type (WT) AT_1A receptors were tagged at the N terminus with EGFP to determine their subcellular localization and trafficking. A signal peptide was fused to the N terminus of EGFP to allow the correct exportation of the chimeric protein to the plasma membrane. A spacer, consisting of a tandem repeat of the myc epitope (63 amino acids), was inserted between EGFP and the AT_1A receptor to prevent steric encumbrance of the AngII-binding site.

The EGFP-tagged CAM and WT receptors were stably transfected in HEK-293 cells and their functional properties were analyzed (Table I). The K_d of [¹²⁵I]AngII for the EGFP-AT_1A and the EGFP-L305Q were both similar to the known K_d of the non-tagged WT receptor (K_d = 0.61 nM for the AT_1A receptor (19)). As evaluated by binding of labeled AngII, the EGFP-L305Q receptor presents a lower plasma membrane expression compared with the WT EGFP-AT_1A receptor (Table I). We checked the constitutive activity of the EGFP-L305Q receptor by measuring the agonist-independent production of IP in the stable cell line, after transient transfection of the G_q cDNA to increase the sensitivity of the assay (16, 23). The results were normalized with respect to the expression levels of the receptor to allow accurate comparison (Table I). The basal activity of the cell line expressing the EGFP-L305Q receptor was three times as high as that of the cells expressing the WT EGFP-AT_1A, showing that the mutant fused to EGFP retained its constitutive activity. Moreover, the production of IP was increased by AngII treatment (Table I). The EGFP-N111A and EGFP-I245T receptors have similar K_d (0.76 ± 0.13 and 0.95 ± 0.19 nM, respectively) to that of the WT receptor and the same basal constitutive activity as the EGFP-L305Q receptor (EGFP-N111A, 770 ± 107; EGFP-I245T, 203 ± 16). Thus the EGFP-tagged receptors were fully functional in terms of ligand binding and second messenger production.

Cellular Localization of the EGFP-tagged WT and CAM AT_1A Receptors-- The EGFP tag enabled the cellular localization of the WT and CAM receptors to be determined by confocal microscopy. Interestingly, whereas the WT EGFP-AT_1A receptors were localized at the cell surface, the CAM receptors (N111A, L305Q, and I245T) were mainly located in intracellular vesicles in the cytoplasm and some cells expressed low amount on their plasma membrane (Fig. 1A).

View larger version (71K): [in this window] [in a new window]   Fig. 1.   Cellular localization and metabolism of EGFP-AT1A and EGFP-CAMs receptors. A, confocal images of untreated HEK-EGFP-AT1A, EGFP-N111A, EGFP-I245T, and EGFP-L305Q transfected cells. Images are representative of three independent experiments. Scale bar = 5 µm. B, metabolic labeling of the EGFP-AT1A and the EGFP-L305Q receptors. Labeling was carried out with 50 µCi/ml [35S]methionine/cysteine for 5 min and was chased for the indicated time in complete medium. C, control HEK cells. The receptors are indicated by arrowheads. C, sensitivity of EGFP-AT1A and EGFP-L305Q receptors to Endo H and PNGase F. The glycosylation state was determined by treating the immunoprecipitated receptors at times 0 and 60 min of the chase with the indicated enzymes. The receptors before and after deglycosylation are indicated by arrowheads. Results are representative of three independent experiments.

This constitutive intracellular localization of the CAM receptors was quantified by calculating the ratio of surface and cytoplasmic fluorescence densities, denoted here as S'/C' (see "Materials and Methods"). For the WT EGFP-AT_1A receptor, the S'/C' ratio was typically 1.5-2.0 in the absence of the ligand and decreased to 0.5 after AngII-induced internalization (Table I, Fig. 2C and Ref. 10). The S'/C' ratios of the CAM receptors were dramatically lower than those of the WT receptor (EGFP-N111A, 0.60 ± 0.06; EGFP-I245T, 0.80 ± 0.09; EGFP-L305Q, 0.66 ± 0.04) (Table I and Fig. 2B). The S'/C' ratios for the WT and L305Q receptors were further reduced by incubation with AngII, showing that a non-negligible fraction of the receptors was still at the plasma membrane and was internalized in the presence of AngII (Fig. 2C). The presence of the EGFP-L305Q receptor at the cell surface was confirmed by binding experiments (Table I).

View larger version (44K): [in this window] [in a new window]   Fig. 2.   Effect of losartan on the cellular localization of EGFP-tagged WT and CAM receptors. A, cells were examined by confocal microscopy after a 2-h incubation at 37 °C with or without 1 µM losartan. Scale bar = 5 µm. B, confocal images were quantified for four cell lines: HEK-EGFP-AT1A, HEK-EGFP-N111A, HEK-EGFP-I245T, and HEK-EGFP-L305Q, and the corresponding S'/C' ratios were calculated. S is the mean density of surface fluorescence; C is the mean density of cytoplasmic fluorescence; and N is the mean density of nuclear fluorescence considered to be background. S'/C' = (S-N)/(C-N). n = 10 for each point. Results are expressed as mean ± S.E. from three independent experiments. , p < 0.01 versus untreated. C, effect of other pharmacological molecules on the cellular localization of EGFP-tagged WT and L305Q receptors. Cells were examined by confocal microscopy after 30 min at 37 °C with 100 nM AngII, 100 nM [Sar1-Ile8]AngII, or 10 µM L162,313, or 2 h at 37 °C with 10 µM irbesartan. Confocal images were quantified. n = 10 for each point. Results are expressed as mean ± S.E. from three independent experiments. *, p < 0.05; , p < 0.01; §, p < 0.001 versus untreated.

We assessed whether these differences in basal S'/C' ratios of WT and CAM receptors were due to differences in the total number of receptors. We used FACS to quantify the total fluorescence per cell on 10,000 cells stably expressing the EGFP-L305Q and the WT receptors (Table I). The two other CAMs presented comparable total fluorescence (data not shown). We also excluded the possibility that plasma membrane targeting was altered due to the presence of EGFP at the N terminus, because the WT or L305Q receptors with a C-terminal EGFP tag presented the same cellular distribution as their N-terminal-tagged counterparts (data not shown).

Metabolic labeling experiments were performed to identify differences in the maturation of the WT and L305Q receptors. The WT EGFP-AT_1A and the EGFP-L305Q receptors both corresponded to ~80-kDa bands and the maximal intensity was reached after a 5-min pulse and progressively decreasing after a 60-min chase (Fig. 1B). The maturation of the proteins was studied by their sensitivity to Endo H and PNGase F (Fig. 1C). After a 5-min pulse without chase, both of the receptor types were sensitive to both enzymes, as indicated by the increase in their electrophoretic mobility. Surprisingly, after a 60-min chase both receptors were sensitive to Endo H. This migration profile, i.e. sensitivity to both enzymes, was also observed on a total cell extract after deglycosylation. In addition to the ~80-kDa band, the WT EGFP-AT_1A receptor was also represented by a 65-kDa band, which is not the consequence of EGFP-tag cleavage (data not shown). In conclusion, the WT EGFP-AT_1A and the EGFP-L305Q receptors present similar maturation/degradation and glycosylation profiles and the intracellular localization of the CAMs is therefore an intrinsic property of the constitutive activity and not due to the intracellular accumulation of the receptor during biosynthesis.

These results provide strong evidence for the constitutive intracellular localization of three different AT_A CAMs (N111A, I245T, and L305Q). The CAM receptors remaining at the plasma membrane were fully functional, displaying AngII binding, as well as AngII-induced signaling and internalization comparable to the WT receptor.

Effect of an Inverse Agonist, Losartan, on the Cellular Localization of the AT_1A CAMs-- The inverse agonist, losartan, is known to inhibit the constitutive signaling activity of the AT_1A CAMs (14, 16). We hypothesized that this compound would also affect the cellular localization of the CAMs. Our results (Fig. 2A) confirmed previous findings (8, 10) that losartan does not modify the membrane localization of the WT EGFP-AT_1A receptor. The fluorescence of untreated CAM cells was mainly intracellular, whereas the treatment with losartan resulted in the appearance of plasma membrane fluorescence. This was clearly visible on confocal images (Fig. 2A) and resulted in a 50-100% increase in the basal S'/C' ratio of these receptors (Fig. 2B). This plasma membrane translocation resulted in a 29% increase in the number of cell surface-binding sites on the L305Q mutant, as measured by [¹²⁵I]AngII binding after losartan wash-away (data not shown). We called this phenomenon "externalization."

We used the L305Q mutant to determine whether CAM externalization was specific to inverse agonists or could be observed with other pharmacological molecules. We tested the peptide antagonist, [Sar¹-Ile⁸]AngII, the non-peptide agonist, L162,313, and the non-peptide antagonist, irbesartan, which has similar inverse agonist properties to losartan (data not shown). [Sar¹-Ile⁸]AngII induced similar levels of internalization of the WT and L305Q receptors as AngII. L162,313 induced a slight internalization of both WT and L305Q receptors (Fig. 2C). Interestingly, irbesartan had a very similar effect to losartan. It did not modify the localization of the WT receptor, whereas it induced a membrane translocation of the EGFP-L305Q receptors as shown by a ~100% increase in the S'/C' ratio (Fig. 2C). Therefore, only the inverse agonists induced the externalization of the EGFP-L305Q receptor.

Cellular Localization of the WT and L305Q Receptors in H295 Cells-- H295 is a human adrenocortical carcinoma cell line (24) which is a model for AngII-responsive aldosterone secretion via activation of endogenous AT₁ receptors (25). In this physiological model of AngII action, the cellular distribution of transiently transfected EGFP-tagged WT AT_1A and L305Q receptors was studied in basal conditions or after treatment with losartan. According to efficiency of transfection and binding experiments, the transfected H295 cells expressed an equivalent number or a maximum of twice the amount of recombinant (WT or mutated) AT₁ receptors as compared with the amount of endogenous receptors. This allowed to follow the cellular localization of the WT and mutated AT₁ receptor at a physiological level of expression and in a physiologically relevant cell.

In these cells, AngII induced internalization of both EGFP-tagged receptors (data not shown). Whereas the WT receptor was almost exclusively localized at the plasma membrane, the L305Q receptor presented a plasma membrane and a diffuse cytoplasmic localization (Fig. 3A). The S'/C' ratio for the WT receptor was 8.90 ± 1.24 and was dramatically reduced in the case of the L305Q receptor (2.30 ± 0.26) (Fig. 3B). Treatment with losartan had little effect on the cellular localization and the S'/C' ratio (13.03 ± 3.17) of the WT receptor, whereas it induced a disappearance of the cytoplasmic fluorescence and a major increase in the S'/C' ratio (9.80 ± 2.07) for the L305Q receptor (Fig. 3B). Thus, the intracellular localization and losartan-induced externalization of the L305Q receptor were also observed in a different and more physiological cellular model (H295 cells).

View larger version (33K): [in this window] [in a new window]   Fig. 3.   Cellular localization of the EGFP-tagged WT AT1A and L305Q receptors in H295 cells. A, H295 transfected cells were examined by confocal microscopy after a 2-h incubation at 37 °C with or without 1 µM losartan. Scale bar = 5 µm. B, confocal images were quantified on 8-28 cells and the corresponding S'/C' ratios were calculated in each case. Results are expressed as mean ± S.E. from three independent experiments. §, p < 0.001 versus WT; , p < 0.01 versus untreated.

The Externalization Induced by Inverse Agonists Is Dependent on Recycling Mechanisms-- Externalization experiments were performed on cells treated with cycloheximide prior to and during the experiment. This treatment prevented de novo biosynthesis, thus removing all receptors from the biosynthesis/secretion pathway, as indicated by the disappearance of fluorescence in the corresponding structures. Thus, externalization could not be explained by the arrival of newly synthesized receptors at the plasma membrane. We hypothesized that externalization is due to a recycling mechanism.

The classical AngII-induced internalization/recycling mechanisms were first characterized by a biochemical procedure on EGFP-AT_1A and EGFP-L305Q receptors. The WT EGFP-AT_1A and EGFP-L305Q receptors were quickly internalized (t_1/2 ~ 5 min) after the addition of 100 nM AngII and this process is maximum at 30 min (Ref. 8, and data not shown). At this time, acid washing of the surface AngII allowed to follow receptor recycling by [¹²⁵I]AngII binding. The recycling of the EGFP-L305Q receptor was maximal 2 h after maximal internalization (Fig. 4A). The EGFP-AT_1A receptors presented the same recycling properties as the EGFP-L305Q receptors (data not shown). This phenomenon was blocked when the cells were treated with 10 µM monensin, which is known to inhibit recycling (Fig. 4B). These results show that: 1) the EGFP-tagged receptors recycle equally as well as the untagged receptors, and 2) that the L305Q CAM retains normal recycling properties.

View larger version (17K): [in this window] [in a new window]   Fig. 4.   Losartan-induced externalization is dependent on recycling mechanisms. A, recycling of the EGFP-L305Q receptor after AngII-induced internalization using the biochemical internalization and recycling assay. B, effect of monensin on recycling of the EGFP-L305Q receptor. Cell surface receptors were measured by [125I]AngII binding after 30 min internalization and a 3-h recycling period. C, time course of losartan-induced externalization for the EGFP-L305Q receptor: HEK-EGFP-L305Q cells were examined by confocal microscopy after being incubated for various periods of time at 37 °C with 1 µM losartan (1 h, n = 27; 1.3 h, n = 15; 1.6 h, n = 17; 2 h, n = 25; 3 h, n = 10). Confocal images were quantified on three independent experiments. D, monensin pretreated HEK-EGFP-L305Q cells (n = 22) and untreated cells (n = 10) were incubated for 2 h at 37 °C with 1 µM losartan with or without monensin. Cells were examined by confocal microscopy and the confocal images were quantified. Results are expressed as mean ± S.E. from three independent experiments. *, p < 0.05 versus untreated; , p < 0.01 versus untreated; §, p < 0.001 versus losartan.

Interestingly, the time dependence of losartan-induced externalization of the L305Q CAM resembled the kinetics of the recycling process. Indeed, after treatment of the HEK-EGFP-L305Q cells with losartan, the S'/C' ratio progressively increased until it reached a plateau at 2 h (Fig. 4C). In addition, when EGFP-L305Q cells were pretreated with monensin, losartan was no longer able to promote the externalization of the receptor, as the S'/C' ratio did not increase compared with untreated cells and even decreased slightly (Fig. 4D). Thus, the externalization process observed upon incubation with losartan was comparable to a recycling mechanism, recycled receptors being blocked at the cell surface by losartan.

Cytoplasmic Translocation of the EGFP-L305Q Receptor after the Withdrawal of Losartan Is Dependent on Internalization Mechanisms-- We questioned what would happen to the externalized receptors after the removal of losartan. Would they permanently remain at the plasma membrane, suggesting that the distribution of CAM receptors is static? Or would they go back into the cells, as would be expected if the observed distribution of CAM receptors is the result of a dynamic cycling process?

To answer these questions, we took advantage of the fact that losartan can be rapidly dissociated from the receptor by rinsing at 4 °C and the sensitivity of the internalization process to temperature. After maximal externalization of the L305Q receptor with losartan, the inverse agonist was removed by rinsing at 4 °C and the kinetic of reinternalization process was then observed at 37 °C, by the microscopy re-internalization assay (see "Materials and Methods"). The plasma membrane fluorescence disappeared from HEK-EGFP-L305Q cells after 2.5 min at 37 °C and the effect was maximal at 5 min (Fig. 5A). This was comparable to the kinetics of the WT receptor internalization (t_1/2 = 2.7 min (10)). In addition, the reinternalization of the L305Q receptor was abolished when the assay was performed at 16 °C (instead of 37 °C) (Fig. 5B), a temperature that also blocks the AngII-induced internalization of the WT receptor (Fig. 5C) and which blocks the clathrin-dependent internalization of other receptors (26).

View larger version (15K): [in this window] [in a new window]   Fig. 5.   Cytoplasmic translocation of the EGFP-L305Q receptor after losartan withdrawal is dependent on internalization mechanisms. A, HEK-EGFP-L305Q cells were treated with 1 µM losartan for 2 h at 37 °C, rinsed at 4 °C to remove losartan and then incubated at 37 °C for various periods of time. n = 10 for each point. B, HEK-EGFP-L305Q cells were incubated for 2 h at 37 °C with 1 µM losartan, rinsed to remove losartan, and then incubated for 15 min at 37 or 16 °C. Cells were examined by confocal microscopy and the confocal images were quantified. n = 16 for each point. *a, p < 0.05 versus losartan, *b, p < 0.05 versus losartan, wash, 37 °C. C, HEK-EGFP-AT1A cells were examined by confocal microscopy after 15 min at 37 °C or at 16 °C with 10 nM AngII. n = 10 for each point. , p < 0.01 versus untreated; §, p < 0.001 versus AngII 37 °C. Results are expressed as mean ± S.E. from three independent experiments.

These results show that losartan-induced externalization is a highly transient process, dependent on the presence of inverse agonists. Moreover, the removal of losartan results in the cytoplasmic translocation of the EGFP-L305Q receptor dependent on internalization mechanisms.

The Double Mutant, EGFP-L305Q/329, Is Localized at the Plasma Membrane-- To confirm the role of internalization in the cellular localization of the CAM AT_1A receptors, we used a AT_1A receptor mutant truncated at residue 329, which presents a default of internalization (19). Both EGFP-329 and EGFP-L305Q/329 mutants present the same binding and signaling properties as the corresponding untagged receptors (data not shown). The basal IP production of EGFP-L305Q/329 was four times higher than that of the WT and EGFP-329 receptors (data not shown), showing that its constitutive activity had been conserved.

Both cells transfected with EGFP-329 and with EGFP-L305Q/329 show a fluorescence localized at the plasma membrane (Fig. 6A) and a similar S'/C' ratio to the WT receptor (Fig. 6B) in basal condition. In the double mutant, EGFP-L305Q/329, the phenotypic trait of EGFP-L305Q (i.e. constitutive intracellular localization) was abolished by the 329 truncation. These data strongly suggest that the CAMs of the AngII AT_1A receptor are constitutively internalized.

View larger version (21K): [in this window] [in a new window]   Fig. 6.   The double mutant, EGFP-L305Q/329, is localized at the plasma membrane. A, untreated HEK-EGFP-L305Q, HEK-EGFP-329, and HEK-EGFP-L305Q 329 cells were examined by confocal microscopy. Images are representative of three independent experiments. Scale bar = 5 µm. B, confocal images were quantified and the S'/C' ratio was calculated for each cell line. n = 9 for each point. Results are expressed as mean ± S.E. from three independent experiments. , p < 0.01 versus EGFP-L305Q.

Functional Consequences of Constitutive Internalization and Externalization of CAM AT_1A Receptors-- As the physiological response is quantitatively dependent on the number of binding sites at the cell surface, we questioned whether the constitutive internalization and losartan-induced externalization of the CAM receptors modulates their signaling properties. Instantaneous AngII-induced Ca²⁺ mobilization was measured using an aequorin test on HEK-EGFP-AT_1A and HEK-EGFP-L305Q cells that had either been pretreated with losartan or left untreated. Losartan pretreatment induced a decrease of 30% in the calcium response to AngII for both the EGFP-AT_1A and the EGFP-L305Q receptors (Fig. 7A). Analysis of the accumulation of IP over a 30-min period in the same experimental conditions show that losartan pretreatment did not have a major effect on the EGFP-AT_1A and the EGFP-L305Q receptors (Fig. 7B). These data suggest a dual effect of the inverse agonist, losartan, which increases the number of CAM receptors at the cell surface and also stabilizes them in an inactive state.

View larger version (20K): [in this window] [in a new window]   Fig. 7.   Coupling state of the EGFP-AT1A and the EGFP-L305Q receptors after losartan-induced externalization. A, aequorin assay: HEK-EGFP-AT1A and HEK-EGFP-L305Q cells were transfected with 100 ng/96-well of expression plasmid for mt-aequorin, a bioluminescent protein sensitive to calcium. Two days after transfection, cells were preincubated with coelanterazine either with (gray) or without (black) 1 µM losartan for 2 h at 37 °C and rinsed twice in aequorin buffer at 16 °C. AngII (100 nM) was added and the luminescent signal was measured. B, IP accumulation assay: cells that had been pretreated with 1 µM losartan (gray) and untreated cells (black) were stimulated for 30 min with 100 nM AngII. Results are expressed as mean ± S.E. from three independent experiments. *, p < 0.05 versus untreated; , p < 0.01 versus untreated.

	DISCUSSION

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES

In the present study, we investigated the links between activation and the cellular localization of the EGFP-tagged CAMs (N111A, I245T, and L305Q) of the AngII AT_1A receptor. We observed that the CAMs were mostly localized in intracellular compartments and that inverse agonists, but not agonists or neutral antagonists, induced their translocation to the plasma membrane. A cytoplasmic localization and a losartan-induced externalization of the mutant L305Q receptor was also observed in another more physiological cellular model (H295), which expresses endogenous AT₁ receptors. Its intracellular localization is less pronounced than that observed in transfected HEK-293 cells, probably due to differences in the kinetics and efficiency of internalization and recycling of the AT₁ receptor between the two cell types. These observations are not due to the impaired folding of the CAMs, which would prevent them from exiting the biosynthetic pathway. We showed indeed that the biosynthesis of the L305Q CAM and WT AT_1A are identical. Imidazole-like inverse agonists cannot cross the plasma membrane and therefore cannot stabilize the unfolded receptor intracellularly, as shown for a misfolded V2 vasopressin mutant (27). Several pieces of evidence suggest that it is more likely that the CAMs of the AT_1A receptor are permanently internalized and recycled: first, the plasma membrane translocation of the L305Q CAM, or externalization, induced by inverse agonist has the same kinetics and pharmacology as the recycling mechanism. Second, after externalization by the inverse agonists, L305Q CAM is quickly and spontaneously re-addressed to the cytoplasm upon ligand removal by a mechanism comparable to internalization. Third, the double mutant, EGFP-L305Q/329, which is constitutively active but lacks a domain required for internalization, is localized at the plasma membrane. Altogether, these data indicate that the CAMs of the AngII AT_1A receptor are constitutively and permanently internalized and recycled. Inverse agonists block the CAM in an inactive state when the recycled receptor reaches the plasma membrane, thus preventing the rapid re-internalization and resulting in the accumulation of the receptor at the membrane (Fig. 8).

View larger version (61K): [in this window] [in a new window]   Fig. 8.   Model of the cellular distribution of AT1A receptor CAMs. In the basal state the wild-type AT1A receptor was mostly localized at the cell surface. Inverse agonists (such as losartan and irbesartan) had no effect on the cellular localization, whereas AngII induced the rapid internalization (i) of the receptor in intracellular vesicles. The receptor was then slowly and partly recycled (r) at the plasma membrane. In the basal state the CAMs of the AT1A receptor were mostly localized in intracellular vesicles. Losartan induced the plasma membrane translocation of the CAMs. In the basal state or after losartan-induced externalization, AngII induced the internalization of the receptor in intracellular vesicles.

Although the spontaneous internalization of the CAMs of the GPCR family has long been considered as a likely possibility, no direct evidence is available yet. Several CAMs are present within intracellular compartments, such as mutants of the PTH receptor (28), _1B adrenergic receptor (AR) (29), and the yeast pheromone receptors, Ste2p and Ste3p (30). Other studies have shown that CAMs can be spontaneously phosphorylated, desensitized, and/or down-regulated, but they have not provided evidence for constitutive internalization (31). Basal phosphorylation is enhanced for two CAMs of the human LH receptor (32, 33) and for the CAMs of the _1B (34) and ₂-AR (35). The ₂-AR CAM is also constitutively desensitized and constitutively down-regulated and both phenomena are reversed by overnight treatment with the inverse agonist, betaxolol (35). Constitutive down-regulation reversed by inverse agonists was later observed for several other CAMs, including mutants of the TRH receptor (36) and the _1B AR (29, 37), and also for the WT histamine receptor H2, which exhibits natural constitutive activity (38). In all cases, the effects of the inverse agonists are only observed after a long period of treatment, consistent with the stabilization of newly synthesized receptors. For example, the levels of CAM ₂-AR are increased 4-7-fold after 24 h treatment, through a protein synthesis-dependent process that does not change the subcellular distribution of the receptor (39). This is thus believed to result from the constitutive addressing of the mutants to degradation pathways. In some cases, inherent instability and/or folding defects of the CAMs are involved in this down-regulation process. This is clearly the case for the CAMs of the yeast receptors, Ste2p and Ste3p, which remain stuck in the biosynthesis pathway because of impaired folding (30). Stabilizing effects explain how both inverse agonists and agonists can up-regulate the levels of Step2 and Step3 CAMs, but also of an _2A CAM (40) and a ₂ CAM in Sf9 cells (41) or even in vivo (42).

Conversely, the phenomenon observed here is not linked to the down-regulation or instability of the CAMs of the AT_1A receptor. It is independent of protein synthesis, as all assays were done on cells treated with cycloheximide. It does not result from the instability of the CAMs, as their metabolism was similar to the WT receptor. It does not involve protein stabilization as other peptide or non-peptide ligands, which all differ from inverse agonists by their ability to induce internalization, were unable to relocalize the receptor to the plasma membrane. Our results suggest a very different mechanism and strongly suggest that AT_1A CAMs are constitutively and permanently internalized and are then recycled. It is not clear whether the same behavior occurs for other CAMs in the GPCR family, but there are several reasons why this phenomenon has never been reported before. First, due to the difficulty in obtaining antibodies and the recent introduction of epitope fluorescent tagging, the cellular distribution of GPCR has only been studied morphologically in a limited number of GPCR. Second, the internalization/recycling kinetics of the AT_1A receptor differ from those of other classical GPCR because it is rapidly internalized (within minutes) and slowly recycled (within hours), whereas other GPCR are either rapidly internalized and recycled (₂-AR) or not recycled but degraded (LH receptor). The peculiar kinetic of the AT_1A receptor may favor the intracellular accumulation of the receptor.

Some examples in the literature are partially reminiscent of our observations, suggesting that the phenomenon described here may be relevant to other CAMs. Although the kinetics are different, two WT GPCRs have been shown to be constitutively internalized: the thrombin receptor (43) and the cholecystokinin receptor type A (44). The WT _1D AR is naturally constitutively active and mostly localized in intracellular compartments, whereas 24 h in the presence of prazosin causes redistribution of the receptor from intracellular sites to cellular periphery (45). Finally, other examples include a deletion mutant of the µ-opioid receptor (46), which is constitutively internalized and recycled, and an inactive mutant of the human vasopressin receptor, which is constitutively sequestered in arrestin-associated intracellular vesicles (47). These mutants are not constitutively active, but demonstrate that GPCRs can be constitutively desensitized by mechanisms distinct from constitutive down-regulation.

Although they do not rule out the permanent cycling of CAMs, recent results on the phosphorylation of the N111A and N111G mutants of the AT_1A receptor raise the question of the molecular mechanisms regulating this constitutive internalization. Unexpectedly, the phosphorylation of N111A and N111G mutants was not elevated in basal conditions and, unlike the WT receptor, it was not increased by AngII treatment (48). However, the CAMs are normally internalized in response to AngII (Fig. 2C and Ref. 48). The phosphorylation status of the two other mutants studied here (I245T and L305Q) is not known, but the study by Thomas et al. (48) suggests that the AngII-induced phosphorylation of the AT_1A receptor is not mandatory for internalization and more generally, that phosphorylation and internalization can be dissociated. This is also in agreement with the fact that phosphorylation is not mandatory for arrestin binding (49, 50).

Another major difference between our study and previous reports on the regulation of CAMs is the functional consequence of treatment with inverse agonists. In the case of CAMs of the _1B AR (37), the TRH receptor (36), and the ₂ AR (35), the up-regulation of receptor levels induced by inverse agonists was accompanied by highly enhanced signaling responses. Conversely, after losartan-induced externalization of the AT_1A CAM, we observed a reduced AngII-induced calcium mobilization and no significant change in IP turnover. Unfortunately, pretreatment with losartan does not only block the receptor at the membrane, but also partly desensitizes it, as shown by the calcium signaling of the WT receptor. Therefore, the unchanged or even reduced signaling efficiency of the CAM after losartan treatment is probably due to the small positive effect of the increased number of receptors at the cell surface, which is counterbalanced by partial inactivation. Another possible explanation is that, as previously discussed by Milligan and Bond (51), the signaling efficiency is dependent on the levels of expression of G proteins and second messenger generating enzymes. For example, treatment with inverse agonists did not enhance signaling for the ₂ CAM when the mutant was expressed in NG108-15 cells (52).

The initial purpose of this study was to gain insight into the link between the activation and internalization of the AT_1A receptor. We wanted to determine whether the receptor is inexorably targeted for internalization by the cell machinery when the receptor is in the active conformation and whether activation necessarily results in internalization. The C-terminal deletion mutant, 329, couples to the G protein but does not become internalized (19, 53), suggesting that activation can be dissociated from internalization. However, this is due to the absence of a large domain necessary for the interaction with internalization machinery rather than a difference in the overall conformation of the receptor. More interestingly, the peptide ligand [Sar¹,Ile⁴,Ile⁸]AngII has been reported to activate the N111A and N111G mutants without inducing their internalization (data not shown in Ref. 48). In contrast, the results presented here suggest that the active conformation of the AT_1A receptor is an "internalization-sensitive" conformation. The three CAMs studied carry mutations at different positions in the transmembrane domains but present similar patterns of cellular distribution. This suggests that the active conformation of the WT receptor cannot avoid internalization.

Conversely, the AT_1A receptor can quite easily adopt conformations that do not activate signaling but are recognized for internalization. Non-signaling mutants of the AT_1A receptor (54, 55) are internalized in response to AngII to the same degree as the WT receptor (8, 55). AngII peptide antagonists are able to induce internalization of the receptor (8, 10). This activation-independent internalization also takes place for other GPCRs, and is also supported by the fact that mutants of the µ-opioid and vasopressin receptors are constitutively internalized without being constitutively active (46, 47). These results suggest that the activation of the signaling pathways by a GPCR requires a much more specific conformation that the conformation required to trigger internalization. As arrestin binding is mandatory and is the first step for the internalization of these GPCRs, arrestin probably recognizes a broader spectrum of conformations that the G proteins.

In conclusion, this study shows that the CAMs of the AngII AT_1A receptor are constitutively and permanently internalized and recycled. The externalization phenomenon described here should define a new paradigm for agonist-independent CAM regulation, distinct from the strong down-regulation observed for a number of other CAMs in the GPCR family and first exemplified for the ₂-AR (35). Furthermore, this study provides important insights on the molecular determinants of activation and internalization.

	ACKNOWLEDGEMENTS

We are grateful to Colette Auzan for methodological assistance and Drs. Sophie Conchon, Bruno Goud, Zsolt Lenkei, and Laurent Muller for helpful discussions. We thank Drs. Jérôme Bertherat and Lionel Groussin for the gift of H295 cells.

	FOOTNOTES

^* This work was supported by Grant 98126 from Hscht Marion Roussel and the Institut National Pour la Santé and la Recherche Médicale (INSERM).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

^¶ To whom correspondence should be addressed: INSERM EPI 0103-ICGM, Faculté de Médecine Cochin, Port Royal, 24 rue du Fg St Jacques, 75014 Paris, France. Tel.: 33-1-53-73-27-50; Fax: 33-1-53-73-27-51; E-mail: clauser@cochin.inserm.fr.

Published, JBC Papers in Press, November 29, 2001, DOI 10.1074/jbc.M108398200

² C. Parnot, unpublished results.

	ABBREVIATIONS

The abbreviations used are: GPCR, G protein-coupled receptor; AngII, angiotensin II; AT₁, angiotensin II type 1 receptor; IP, inositol phosphate; EGFP, enhanced green fluorescent protein; WT, wild-type; FACS, fluorescence-activated cell sorting; Endo H, endoglycosidase H; AR, adrenergic receptor; FCS, fetal calf serum; CAN, constitutive active mutant.

	REFERENCES

TOP ABSTRACT INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION REFERENCES