|
Originally published In Press as doi:10.1074/jbc.M106387200 on December 14, 2001
J. Biol. Chem., Vol. 277, Issue 8, 6240-6246, February 22, 2002
Geranyl Diphosphate:4-Hydroxybenzoate Geranyltransferase from
Lithospermum erythrorhizon
CLONING AND CHARACTERIZATION OF A KEY ENZYME IN SHIKONIN
BIOSYNTHESIS*
Kazufumi
Yazaki ,
Miyuki
Kunihisa,
Takahiro
Fujisaki, and
Fumihiko
Sato
From the Molecular & Cellular Biology of Totipotency, Division of
Integrated Life Science, Graduate School of Biostudies, Kyoto
University, Kitashirakawa, Kyoto 606-8502, Japan
Received for publication, July 9, 2001, and in revised form, December 10, 2001
 |
ABSTRACT |
Two cDNAs encoding geranyl
diphosphate:4-hy- droxybenzoate 3-geranyltransferase were isolated from
Lithospermum erythrorhizon by nested PCR using the
conserved amino acid sequences among polyprenyl- transferases for
ubiquinone biosynthesis. They were functionally expressed in yeast
COQ2 disruptant and showed a strict substrate specificity
for geranyl diphosphate as the prenyl donor, in contrast to ubiquinone
biosynthetic enzymes, suggesting that they are involved in the
biosynthesis of shikonin, a naphthoquinone secondary metabolite. Regulation of their expression by various culture conditions coincided with that of geranyltransferase activity and the secondary metabolites biosynthesized via this enzyme. This is the first established plant
prenyltransferase that transfers the prenyl chain to an aromatic substrate.
 |
INTRODUCTION |
The prenylation reaction of aromatic substrates is involved in the
biosynthesis of diverse molecules that play important roles in various
biological activities in bacteria to mammals, e.g. electron
transport via ubiquinone and plastoquinone (1). In higher plants, such
prenylation largely contributes to the diversification of aromatic
secondary metabolites, with regard to both their chemical structures
and biological activities. For instance, some prenylated flavonoids act
as phytoalexins that are involved in plant defense mechanisms (2, 3),
and have also been reported to be potential natural medicines (4-6).
Due to these interesting properties, intensive biochemical studies have
been conducted to identify plant prenyltransferases which catalyze the
transfer of prenyl diphosphate to an aromatic ring to generate a
prenylated derivative, such as flavones (7, 8), isoflavones (9-12),
coumarins (13, 14), olivetolate (15), and 4-hydroxybenzoate (16).
However, there has been no report on the identification of the genes
that encode such prenyltransferases involved in the biosynthesis of these secondary metabolites.
Shikonin, a red naphthoquinone derivative, is a secondary metabolite
that specifically occurs in boraginaceous plants, and is the active
principle of the medicinal plant Lithospermum erythrorhizon (17). Since this compound and its derivatives exhibit antibacterial activity, their functions as phytoalexins have also been reported (18).
The biosynthesis of shikonin includes a key prenylation step catalyzed
by geranyl diphosphate
(GPP)1:4-hydroxybenzoate
(4HB) 3-geranyltransferase; i.e. coupling of the shikimate
and mevalonate pathways (17, 19, 20). This enzyme plays a critical role
in the regulation of shikonin biosynthesis in cell cultures of L. erythrorhizon, i.e. up- and down-regulation of this
enzyme activity directly affects the production of shikonin (21, 22).
The enzyme activity is strongly suppressed by light irradiation,
ammonium ion, and the synthetic auxin 2,4-dichlorophenoxyacetic acid
(2,4-D) (23), whereas this activity is enhanced with the addition of
oligogalacturonide (OG) (24) and methyl jasmonate (MJ) (25) to the
medium. It has also been reported using a partially purified enzyme
that this protein is ER membrane-bound and shows strict substrate
specificity for geranyl (C10) diphosphate for the chain
length of the prenyl donor (16), which is in clear contrast to the
mitochondrial polyprenyltransferase for ubiquinone biosynthesis (26).
We attempted to isolate the cDNA of geranyltransferase from
L. erythrorhizon as a model, since these characteristic
properties should be advantageous for identifying the gene product.
In this report, we describe the isolation of two cDNAs for the
prenyltransferase, designated LePGT-1 and -2 (L.
erythrorhizon p-hydroxybenzoate:geranyltransferase)
from L. erythrorhizon cultured cells, and functional
expression of the gene products in yeast. A direct correlation between
this gene expression and shikonin accumulation shows that they are
involved in the secondary metabolism.
 |
EXPERIMENTAL PROCEDURES |
Plant Material, Reagents--
Cell suspension cultures (strain
M18) (27) were maintained in Linsmaier and Skoogs (LS) medium (28).
They produced shikonin derivatives when cultured in M9 medium (29) in
darkness (20-23). In the present study, 4.5 ml of liquid paraffin was
placed over 30 ml of M9 medium to extract shikonin derivatives produced
by the cells (24), which interfere with the measurement of enzyme activity. GPP and dimethylallyl diphosphate were synthesized
as previously described (30). Other chemical reagents were purchased from Wako Pure Chemicals (Japan), Nacalai (Japan), and Sigma.
Nested PCR and Rapid Amplification of cDNA Ends--
A
double-stranded cDNA library with an adapter sequence at both ends
was synthesized from poly(A)+ RNA, which was prepared from
the cells cultured in M9 medium for 4 days in the dark, with Marathon
cDNA Amplification Kit (CLONTECH). In the first
PCR, AP-1 from the kit and a degenerate primer (Rv-1) designed from the
conserved sequences among coq2 and its orthologs were used
as forward and reverse primers, respectively. The latter sequence,
5'-GCIGTDSWYTTVATICC-3', corresponded to the amino acid sequence
n-GIKSTA-c. The reaction mixture (0.3 µl) was further used as the
template for the second PCR, using AP-2 from the kit and another
degenerate nucleotide (Rv-2), 5'-TCYTGRTGDGCRTADATDGTRTC-3' (n-DTIYAHQD-c), as primers. The smear PCR products at about 800 bp were
subcloned in pT7-blue (Amersham Biosciences Inc.) and randomly
sequenced. Nine clones showed significant similarity with yeast
4HB:hexaprenyltransferase (4HPT), and could be separated into two
independent groups. Both full-length clones were obtained by a 3'-rapid
amplification of cDNA ends using a common forward primer
5'-CCCTTTGTGTTTGCTTA(C/T)CCTCTC-3'. Finally, using the 5' and 3'
sequences as specific primers, the full-length cDNA clones were
amplified with Pfu DNA polymerase (Promega) to prevent an error in the
former PCR with Taq DNA polymerase. The sequences of the
cDNAs are in the DDBJ/GenBankTM DNA data bases under
accession numbers AB055078 for LePGT-1 and AB055079 for LePGT-2, respectively.
Gene Disruption of Yeast--
The COQ2 gene in
yeast was disrupted by gene replacement with the homologous DNA (31).
Using pUG6 plasmid as a template, the geneticin (G418) resistance gene
was amplified by PCR, in which the forward primer
5'-GTAAGGTTATCAGAAGGGCGGAGTATACTATAGATTACAGTAGAA CAGCTGAAGCTTCGTACGC-3' and the reverse primer 5'-
GCACGCTATATCTACAAGAATCCAAACAGTCTCAAGATGTAGTCG GCATAGGCCACTAGTGGATCTG-3' were used. In these sequences,
the annealing sites to pUG6 are un- derlined, and the roman letters are
the parts that are homologous to the yeast COQ2 gene. The
PCR product was introduced into yeast strain W303-1A(a), and the
disruption of COQ2 in G418-resistant clone was confirmed by
genomic PCR. The disruptant coq2 showed the typical
phenotype of a ubiquinone-defective mutant, in which it was capable of
growing on minimal glucose medium but not on glycerol as the sole
carbon source (26).
Heterologous Expression in Yeast--
Full-length LePGT-1 and
LePGT-2 cDNAs were subcloned into yeast expression vector pDR196
(32), which was kindly provided by Dr. W. Frommer (University of
Tübingen), at EcoRI (5') and XhoI (3')
sites. The sequences of the resulting plasmids, pDR-PGT1 and pDR-PGT2,
were used to transform W303 coq2, which were selected by
SD medium ( uracil), by the lithium acetate method (33). For the
expression of recombinant proteins, the yeast transformants cultured in
200 ml of YPAD medium were re-suspended in 10 ml of 20 mM
KPi buffer (pH 7.4) containing 1.2 M sorbitol,
and treated with Zymolyase (Seikagaku Kogyo, Japan) for 60 min. After
homogenization with a Downs glass homogenizer in 20 mM
Tris-HCl buffer (pH 7.5) containing 0.6 M sorbitol, 1 mM phenylmethylsulfonyl fluoride, and 10 mM
dithiothreitol, the mixture was centrifuged at 10,000 × g (5 min) and at 100,000 × g (1 h) to
pellet the microsome fraction. After washing, the membrane fraction was
resuspended with 200-500 µl of 0.1 M Tris-HCl buffer (pH
7.5), which was used as an enzyme solution for the geranyltransferase
assay described below. The reaction product was detected with high
performance liquid chromatography when cold substrates were used.
Substrate specificity for prenyl donor was examined using a radioactive assay.
Geranyltransferase Assay--
Enzyme assay was carried out as
described elsewhere (21). The reaction product,
3-geranyl-4-hydroxybenzoic acid (34), was quantitatively detected by
high performance liquid chromatography with a Shimadzu LC-10A system:
column, LiChrosphere 100RP-18 (Merck) 4 × 250 mm; solvent system,
methanol/H2O/acetic acid (80:20:0.3); flow rate, 1 ml/min;
detection, 230-320 nm with a SPD6A photodiode array detector. The
reaction product was identified by direct comparison with a standard
sample. The microsomal fraction from the cultured cells of L. erythrorhizon was prepared as described previously (16). The
values are the means of two replicates for each assay, and the assay
was repeated more than three times. As marker enzymes for
mitochondria and microsome, activities of cytochrome c
oxidase and antimycin A insensitive NADPH-cytochrome c
reductase were measured, respectively (35).
Radioactive Assay of Prenyltransferase by TLC--
The enzyme
assay mixture was the same as described above except that 24.2 µM [universal-14C]4HB (specific activity
1.22 MBq/µmol, Sigma) instead of cold 4HB and 400 µM
dimethylallyl diphosphate, GPP, farnesyl diphosphate, or geranylgeranyl
diphosphate were used. Incubation was carried out in the same way as
above, and the ethyl acetate-soluble portion was dissolved in 10 µl
of methanol, which was then loaded on a silica gel TLC plate (20 × 20 cm). TLC was developed with benzene/ethyl acetate (8:2), and
subjected to autoradiography to detect the reaction products. Their
RF values are geranyl-4HB, 0.22; farnesyl-4HB, 0.28;
geranylgeranyl-4HB, 0.34. These products were quantified with BAS2000
(Fuji film).
Northern Analyses of LePGT Expression--
L.
erythrorhizon cell cultures in M9 medium were agitated either in
the dark or under continuous light (80 µE/m2 · s) with
fluorescent lamps. Northern blot hybridization was carried out
according to the standard protocol. The fragments to the 5'-flanking
region, 680 bp for LePGT-1 and 756 bp for LePGT-2, were used as probes
for the specific detection of each molecular species. The -subunit
of ATP-synthase was used as a control (36).
Inhibitors of geranyltransferase expression, NH4Cl (1 mM) and 2,4-D (1 µM), were added to M9 medium
and cells were harvested 7 days after inoculation, whereas positive
regulators of shikonin production, MJ (10 µM) (25) and OG
(100 µg/ml) (24), were added to LS medium supplemented with 1.2 µM CuSO4. From intact plants of L. erythrorhizon, which had been cultivated in pots for 2 years, each
organ was excised and RNA samples were prepared for Northern analyses.
Quantitative Analysis of Secondary Metabolites--
Nearly all
of the shikonin derivatives and dihydroechinofuran produced by the
cells were secreted into the medium, and were then trapped with the
paraffin layer. The amounts of these secondary metabolites in paraffin
were estimated according to the standard method (24, 37).
 |
RESULTS |
Cloning and Sequence Analysis of LePGT cDNAs--
We attempted
to isolate a cDNA encoding 4HB:geranyltransferase which is involved
in the secondary metabolism of L. erythrorhizon by a
molecular biological approach, since purification of this membrane-bound enzyme to homogeneity was unsuccessful (16). The
enzymatic reaction of the geranyltransferase is functionally analogous
to that of the prenyltransferase in ubiquinone biosynthesis, i.e. 4HB:polyprenyltransferase (Fig.
1A). Three genes for such prenyltransferases that accept 4HB and polyprenyl diphosphate as a
prenyl acceptor and donor have been reported; 4HPT is the gene product
of COQ2 of yeast (26), 4HB:polyprenyl diphosphate transferase (ppt1) of fission yeast (38), and
4HB:octaprenyltransferase (the gene product of ubiA) of
Escherichia coli (39). Based on multiple alignment with
these polyprenyltransferases and other eukaryotic orthologs in protein
data bases, two degenerate PCR primers were designed from the conserved
amino acid sequences. A library of cDNAs with adopter sequences was
prepared from L. erythrorhizon cells cultured in M9 medium
in the dark, in which the geranyltransferase was highly expressed. By
nested PCR, a smear band was amplified, which was then subcloned and
randomly sequenced. Nine DNA fragments that were significantly similar to yeast 4HPT were isolated and classified into two groups. Full-length clones corresponding to both groups were isolated by 3'-rapid amplification of cDNA ends, and were designated LePGT-1 and -2.

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 1.
A, enzymatic reaction of two
prenyltransferases. LePGT is a specific prenyltransferase for geranyl
diphosphate leading to shikonin or dihydroechinofuran in L. erythrorhizon, whereas the gene product of COQ2,
hexaprenyltransferase, is responsible for ubiquinone biosynthesis in
yeast. G-4HB, geranyl- 4-HB; HP-4HB,
hexaprenyl-4HB; HPP, hexaprenyl diphosphate.
B, multiple alignment of eukaryotic orthologs of
4HB:prenyltransferases. Ce, C. elegans
(U13876-5); At, Arabidopsis thaliana
(AC004521-32); Sp, Schizosaccharomyces pombe
(Z69728-4); Sc, Saccharomyces cerevisiae (M81698,
COQ2). The putative prenyl diphosphate binding motif
NDXXD and the GX(K/Y)STAL motif are highlighted
with solid underlines. Annealing sites of degenerate primers
(Rv-1 and -2) and a specific 3'-rapid amplification of cDNA ends
primer (Fw-1) are indicated with arrows below the sequences.
Potential transmembrane domains for LePGTs are depicted by
hatched bars above the corresponding regions of the
protein.
|
|
LePGT-1 (1,153 nucleotides) encodes an open reading frame corresponding
to a protein of 307 amino acids, whereas LePGT-2 (1,240 nucleotides)
has an open reading frame for 306 amino acids. The sequence identity
between them was 76 and 93% on a nucleotide and amino acid basis,
respectively. The amino acid sequence similarity to yeast 4HPT was only
35% for the full-length and 53% for the conserved region.
A multiple alignment among eukaryotic orthologs in the data bases is
shown in Fig. 1B. Both LePGT clones possess the motif NDXXD for putative prenyl diphosphate binding (40), and a
GX(K/Y)STAL sequence which seemed to be specifically
conserved in this subfamily of 4HB:prenyltransferase, although the
function of this domain is not yet known (Fig. 1B). Another
highly conserved sequence, YDTIYAHQDK, is observed in the alignment
among eukaryotic orthologs, but is not apparent in prokaryotic members.
The polypeptide sequence of Arabidopsis has an extended
leader peptide, which may be a mitochondrial signal according to the
TargetP and ChloroP programs on CBS servers (www.cbs.dtu.dk/). LePGT-1
and -2 do not possess such a signal peptide for mitochondrial sorting,
but are presumed to be sorted to the ER (41), which coincided the
subcellular localization of native 4HB:geranyltransferase in L. erythrorhizon (42). Hydropathy analyses of LePGT polypeptides
revealed that they are membrane-bound proteins, and the putative
transmembrane domains are also depicted in Fig. 1B.
Functional Expression of LePGTs in a Yeast COQ2 Disruptant--
To
demonstrate the enzymatic activity of LePGT gene products, yeast was
used for heterologous expression because of their high hydrophobicity.
Wild type yeast (strain W303-1A), however, possesses 4HPT for
ubiquinone biosynthesis localized in the mitochondria, which may raise
the background level in the control experiment because of its broad
substrate specificity for prenyl donor (43). Thus, the gene
COQ2 was disrupted according to the method of Güldener et al. (31), and the disruptant W303 coq2, which is unable
to use the nonfermentable carbon source glycerol, was used as a
heterologous host to express LePGT cDNAs (Fig.
2). The growth defect of W303 coq2 on
glycerol plate was complemented by re-introduction of COQ2 gene subcloned into a shuttle vector, pDR196, which had a PMA1 promoter
to drive the heterologous gene in yeast cells. Full-length LePGT-1 and
-2 subcloned into pDR196 were also introduced into W303 coq2, but
they did not complement the growth on the glycerol medium.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 2.
Phenotype of yeast Coq2
disruptant (W303 coq2) and
complimentation with 4HB:prenyltransferase genes. A,
yeast strains plated on SD-medium containing glucose or glycerol as a
carbon source. W303-1A, wild type; coq2,
W303 coq2; pDRCoq2, transformant expressing full-length
Coq2 gene; pDR196, control of empty vector;
pDRPgt1 or -2, transformant expressing
full-length cDNA of LePGT-1 or -2. B, growth of yeast
transformants on glucose medium. C, growth of yeast
transformants on glycerol medium.
|
|
The enzymatic activities of 4HB:prenyltransferase was measured with
these yeast transformants. As expected, the wild type yeast showed
apparent 4HB:geranyltransferase activity in the mitochondrial fraction
due to the COQ2 gene (Fig.
3A), but the same fraction of
disruptant did not show this enzyme activity. W303 coq2 transformed with full-length LePGT-1 and -2 were grown in YPAD medium and the
enzyme activity was measured. The empty vector was used as a negative
control. As depicted in Fig. 3A, both LePGT-1 and -2 showed
an apparent activity of 4HB:geranyltransferase in the microsomal fraction using 4HB and GPP as the substrates, whereas the transformant of the empty vector gave almost no detectable activity. The activities of marker enzymes for mitochondria (cytochrome c oxidase)
and ER (NADPH-cytochrome c reductase) in these fractions are
also shown. Although the mitochondrial fraction contains ER membrane, the contamination of mitochondria in the microsomal fraction is very
low. Geranyltransferase activity was undetectable in the supernatant
(centrifugation at 100,000 × g) of these two LePGT transformants. Using the method of Lineweaver and Burk (44), Km values of recombinant LePGT-1 and -2 for 4HB were determined as 10.3 and 53.8 µM, whereas those for GPP
were 5.1 and 45.9 µM, respectively.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 3.
Enzyme activity of recombinant LePGT-1 and -2 expressed in yeast COQ2 disruptant
(W303 coq2). A, enzyme activity
of native 4HB:hexaprenyltransferase in the crude mitochondrial fraction
of wild (W303-1A) and COQ2-disrupted yeast
(left). The substrates are 4HB and GPP as the prenyl
acceptor and donor, respectively. Geranyltransferase activity in the
microsomal fraction of LePGT-1 and LePGT-2 transformants of
W303 coq2, as well as that of the empty vector control are shown
(left). Activities of marker enzymes for mitochondria
(cytochrome c oxidase) and for ER (NADPH-cytochrome
c reductase) in these fractions are also shown
(right). B, relative enzyme activities of
prenyltransferase with prenyl diphosphate of different chain lengths,
i.e. dimethylallyl diphosphate (DMAPP), GPP, farnesyl
diphosphate (FPP), and geranylgeranyl diphosphate (GGPP) are shown with
the microsomal fraction of LePGT-1 and LePGT-2 transformants. Substrate
specificity of 4HB:hexaprenyltransferase is also shown for comparison.
The broken line indicates the activity level with GPP as the
substrate (100%).
|
|
The most important criterion for determining whether the LePGTs are
involved in shikonin biosynthesis is substrate specificity for the
prenyl donor, since the geranyltransferase in the biosynthesis of
shikonin and dihydroechinofuran is exclusively specific for GPP,
whereas 4HPT for ubiquinone shows a broad substrate specificity regarding the chain length of prenyl diphosphate. Fig. 3B
shows the substrate specificity of recombinant proteins of LePGT-1 and -2 in comparison with that of native mitochondrial 4HPT of wild type
yeast. The yeast 4HPT has a wide preference for prenyl diphosphate of
different chain lengths, e.g. it showed higher activity with geranylgeranyl diphosphate than with GPP as the substrate. In contrast,
both gene products derived from L. erythrorhizon could accept only GPP and not dimethylallyl diphosphate, farnesyl
diphosphate, or geranylgeranyl diphosphate as the substrate. This clear
substrate specificity indicates that both LePGT-1 and LePGT-2 encode
the geranyltransferases for secondary metabolism in this plant.
Expression of LePGT Genes in L. erythrorhizon--
The activity of
4HB:geranyltransferase in L. erythrorhizon is dramatically
induced when the cells are cultured in M9 medium in the dark, but not
under light irradiation (21). In accordance with this enzyme activity,
Northern analyses showed that both mRNAs were strongly induced in
the dark whereas they were dramatically suppressed under illumination
(Fig. 4A). These mRNA
levels relative to those at day 0 are also shown in Fig. 4B,
and are consistent with the accumulation pattern of shikonin
derivatives in M9 medium (Fig. 4C).

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 4.
A, Northern blot hybridization of
LePGT-1 and LePGT-2. Their mRNAs were detected with each
sequence-specific probe. Cultured cells were agitated either in the
dark or under continuous white light in M9 medium. ATP synthase
-subunit was used as the load control. B, relative
mRNA levels of LePGT-1 and LePGT-2 are normalized using the ATP
synthase -subunit expression level as the internal standard. The
relative mRNA level is calculated with the level at day 0 as one.
C, time course of shikonin productivity either in darkness
or under continuous illumination.
|
|
Geranyltransferase also plays a critical role in the chemical
regulation of shikonin production, i.e. this activity is
up-regulated with MJ (25) as well as OG (24), whereas its expression is down-regulated by NH and the auxin, 2,4-D (23). The effects of these chemical regulators on LePGT gene
expression were analyzed by Northern hybridization. The effects of MJ
and OG were investigated in LS medium in which geranyltransferase activity remained very low, but with the addition of both regulators, the LePGT mRNA levels clearly increased (Fig.
5, A and B, left) along with the enzyme activity (Fig. 5C, left). The increase
in geranyltransferase activity reflected the accumulation of
dihydroechinofuran, which is quickly biosynthesized from the enzymatic
reaction product, 3-geranyl-4-hydroxybenzoic acid (Fig. 1A),
and is therefore a more suitable metabolite than shikonin for
monitoring the effect of geranyltransferase induction (24, 45) (Fig.
5D, left). The effects of inhibitors, which were observed in
M9 medium, were also consistent with the mRNA level, enzyme
activity, and secondary product accumulation, i.e. the
accumulation of both LePGT mRNAs as well as the enzyme activity
apparently decreased with NH or 2,4-D,
along with the dihydroechinofuran level (Fig. 5, right panels).

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 5.
Effects of inducers and inhibitors of
shikonin production on the expression level of LePGT-1 and -2, as well
as geranyltransferase activity and secondary metabolite
production. A, Northern blot hybridization of LePGT-1
and LePGT-2 in the presence of regulatory elements. LS,
Linsmaier-Skoog liquid medium; cn, control; MJ,
10 µM; OG, 100 µg/ml;
NH , NH4Cl (1 mM); 2,4-D, 1 µM. rRNA was used as the load
control. B, relative mRNA levels of LePGT-1 and LePGT-2
are shown normalized by the rRNA level and expressed with the level at
day 0 as one. C, enzyme activity of 4HB:geranyltransferase
in cell cultures to which the indicated regulators were added.
D, the production level of dihydroechinofuran in response to
addition of a regulator of geranyltransferase.
|
|
In the intact plant, shikonin is solely accumulated in underground
parts (34), since its biosynthesis is completely inhibited under light
conditions. The mRNAs of both LePGT genes were undetectable in
aerial plant tissues, and were exclusively detected in root tissues,
similar to shikonin accumulation, as shown in Fig.
6. Along with the strict substrate
preference for GPP mentioned above, these expression studies support
the notion that both cDNAs encode the geranyltransferases involved
in shikonin biosynthesis.

View larger version (66K):
[in this window]
[in a new window]
|
Fig. 6.
Organ-specific accumulation of LePGT-1 and
LePGT-2 in the intact plant of L. erythrorhizon.
LR, lateral root; MR, main root; St,
stem; Lf, leaf. The contents of shikonin derivatives
recovered from each plant organ are shown at the
bottom.
|
|
 |
DISCUSSION |
In this study, we cloned and performed structural analyses of two
cDNAs that encode geranyl diphosphate:4-hydroxybenzoate 3-geranyltransferase from cultured L. erythrorhizon cells
(Fig. 1). Heterologous expression in yeast showed that both gene
products exhibit enzyme activity to transfer the geranyl moiety to an
aromatic substrate 4HB, and in particular they show exclusive
specificity for the C10 substrate GPP (Fig. 3), which are
critical points for determining that these enzymes are responsible
for shikonin biosynthesis (16).
Each organism has a specific chain length for prenyl moiety of
ubiquinone molecule, and the side chain is usually penta- to decaprenyl
residue, i.e. ubiqiunone-5 to -10. It is very unlikely that
the diprenyl-4HB, which is the specific product of LePGTs, is converted
to ubiquinone having geranyl residue as the prenyl chain. To exclude
the possibility that LePGTs might be involved in ubiquinone
biosynthesis in vivo, complementation studies were also
done. The yeast COQ2 disruptant was transformed with LePGT-1 or -2, but the transformants failed to grow on glycerol medium, whereas
the COQ2-containing plasmid, as a positive control,
complemented the phenotype of disruptant (Fig. 2). Similarly, the plant
ortholog AtPPT-1 also showed the same complementation in
COQ2-disrupted fission
yeast.2 These results
strongly support our conclusion that the LePGT cDNAs are not
involved in ubiquinone biosynthesis in L. erythrorhizon.
The Km values of LePGT-1 to both substrates are
apparently different from those of LePGT-2. As the
Km values of native LePGT were reported to be 18.4 µM for 4HB and 13.8 µM for GPP (16), which
are similar to those of LePGT-1 (10.3 and 5.1 µM,
respectively), but a direct comparison is not appropriate, because the
Km values of native enzyme were determined with a
partial purified protein, and thus it may be a mixture of LePGT-1 and
-2. It is not clear whether these two gene products play different
roles in vivo, but their expression patterns in L. erythrorhizon are very similar (Figs. 4-6). They might be
expressed in different cell types in root tissue.
LePGT polypeptides are predicted to have 8 or 9 transmembrane domains
based on a hydropathy analysis by Kyte and Doolittle and a program on
CBS servers (www.cbs.dtu.dk/services/TMHMM-1.0/). There are two obvious
hydrophilic loops where the NDXXD motif and
GX(K/Y)STAL motif are localized. They are presumed to be the binding sites for the substrate, i.e. the former is for
prenyl diphosphate as seen in prenyl diphosphate synthases, and the
latter is probably important for the aromatic substrate (39). More detailed analyses are needed to define the differences in the structure
that contribute to the strict substrate specificity of LePGT for
GPP.
The phylogenetic tree is shown in Fig. 7.
Bacterial polyprenyltransferases tend to form a cluster, whereas
eukaryotic polyprenyltransferases do not. This is at least partly
attributable to the divergence of the mitochondrial sorting signal
sequence in each molecular species. In particular, a plant ortholog of
LePGT, Arabidopsis polyprenyltransferase, seems to be more
divergent than those of unicellular eukaryotes and Caenorhabditis
elegans (46). Although the mitochondrial targeting signal is
absent in LePGT polypeptides, they may be derived from such
prenyltransferase for ubiquinone biosynthesis. It is presumed that
during evolution they lost the mitochondrial signal to localize in the
ER membrane, which is advantageous both for the biosynthesis and
secretion of shikonin out of cells, and gained substrate specificity
for GPP. Since most organisms need ubiquinone to survive in the wild,
Lithospermum cells should also have another
4HB:prenyltransferase localized in mitochondria. In fact, four to five
bands were observed in the genomic Southern blot (data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 7.
Phylogenetic relationship of
4HB:prenyltransferases including LePGT-1 and -2 reported in the present
study. The UPGMA (Unweighted Pair Group Method with Arithmetic
Mean) tree was calculated using GeneWorks software. Scores shown on the
horizontal lines are the number of mismatches divided by the
length of the shorter sequence. Aa, Aquifex
aeolicus; Af, Archaeoglobus fulgidus;
At, A. thaliana; Bf, Bacillus
firmus; Ce, C. elegans; Ct,
Chlamydia trachomatis; Ec, E. coli;
Hp, Helicobacter pylori; Ps,
Providencia stuartii; Rp, Rickettsia
prowazekii; Sc, S. cerevisiae;
Sp, Schizosaccharomyces pombe; Ss,
Synechocystis sp.
|
|
Northern analyses revealed that the modes of regulation of gene
expression were completely consistent with that of geranyltransferase activity using both positive and negative regulators (Figs. 4-6). The
other biosynthetic genes involved in shikonin biosynthesis, such as
phenylalanine ammonia-lyase (45) and 4-coumarate CoA ligase (47) which
may be also involved in lithospermic acid B production in this plant
(48), did not show such a close correlation with shikonin accumulation.
This indicates that LePGTs play a pivotal role in the regulation of
shikonin biosynthesis at the gene expression level. Due to these
attractive properties, LePGTs are suitable for use as model genes to
study the molecular mechanism of dark-inducible secondary metabolism,
and also its regulation by auxins and elicitors in higher plants.
In contrast to prenyltransferases involved in chain elongation of
prenyl diphosphate, those involved in 4HB prenylation have not yet been
subjected to molecular analyses. LePGTs isolated in this study are the
first cDNAs that encode plant prenyltransferases which catalyze the
transfer of the prenyl moiety to an aromatic substrate. They could be
very powerful tools for characterizing prenylation of the aromatic
moiety at a molecular level, e.g. identification of the
4HB-binding site. An interesting feature of these prenyltransferases is
their clear preference for GPP as the substrate; this should be further
characterized using chimeric enzymes with prenyltransferases that show
broad substrate specificity, such as 4HPT. From a biotechnological
point of view, these cDNAs are expected to be useful for genetic
engineering of shikonin production (49), since geranylation is a
"bottle-neck" reaction in shikonin biosynthesis. Furthermore, as
heterologous probes, these cDNAs may lead to breakthroughs in
molecular genetic studies on the secondary metabolism of cannabinoid
and prenylated flavonoids and coumarins, which involve
prenyltransferase reactions.
 |
ACKNOWLEDGEMENTS |
We are grateful to Dr. W. Frommer,
Tübingen University, and Dr. T. Miyakawa, Hiroshima University,
for the gift of pDR196 and yeast strain W303-1A, respectively. We thank
Dr. H. Tamaki and Dr. Y. Sakai, Graduate School of Kyoto University,
for technical suggestions regarding gene disruption in yeast and marker
enzyme measurement, respectively. We also thank Dr. K. Hahlbrock and Dr. J. Gershenzon, Max Planck Institute in Cologne and Jena,
respectively, for a critical reading of the manuscript. Intact L. erythrorhizon plants were a generous gift from the Kyoto Botanical
Garden of Takeda Chemical Industries.
 |
FOOTNOTES |
*
This work was supported in part by a grant-in-aid for
Scientific Research from the Japanese Society for Promotion of Science (to K. Y.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Molecular & Cellular Biology of Totipotency, Div. of Integrated Life Science, Graduate School of Biostudies, Kyoto University, Kitashirakawa, Kyoto
606-8502, Japan. Tel.: 81-75-753-6384; Fax: 81-75-753-6398; E-mail:
yazaki@ kais.kyoto-u.ac.jp.
Published, JBC Papers in Press, December 14, 2001, DOI 10.1074/jbc.M106387200
2
K. Okada, personal communication.
 |
ABBREVIATIONS |
The abbreviations used are:
GPP, geranyl
diphosphate;
4HB, 4-hydroxybenzoate;
2, 4-D, 2,4-dichlorophenoxyacetic
acid;
OG, oligogalacturonide;
MJ, methyl jasmonate;
PGT, p-hydroxybenzoate:geranyltransferase;
LS, Linsmaier and
Skoog;
ER, endoplasmic reticulum;
4HPT, 4HB:hexaprenyltransferase;
PMA1, plasma membrane ATPase 1.
 |
REFERENCES |
| 1.
|
Grunler, J.,
Ericsson, J.,
and Dallner, G.
(1994)
Biochim. Biophys. Acta
1212,
259-277[Medline]
[Order article via Infotrieve]
|
| 2.
|
Tahara, S.,
and Ibrahim, R. K.
(1995)
Phytochemistry
38,
1073-1094[CrossRef]
|
| 3.
|
Morandi, D.
(1996)
Plant Soil
185,
241-251[CrossRef]
|
| 4.
|
Wang, B. H.,
Ternai, B.,
and Polya, G.
(1997)
Phytochemistry
44,
787-796[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Henderson, M. C.,
Miranda, C. L.,
Stevens, J. F.,
Deinzer, M. L.,
and Buhler, D. R.
(2000)
Xenobiotica
30,
235-251[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
Miranda, C. L.,
Stevens, J. F.,
Ivanov, V.,
McCall, M.,
Frei, B.,
Deinzer, M. L.,
and Buhler, D. R.
(2000)
J. Agric. Food Chem.
48,
3876-3884[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Yamamoto, H.,
Kimata, J.,
Senda, M.,
and Inoue, K.
(1997)
Phytochemistry
44,
23-28
|
| 8.
|
Yamamoto, H.,
Senda, M.,
and Inoue, K.
(2000)
Phytochemistry
54,
649-655[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Schröder, G.,
Zähringer, U.,
Heller, W.,
Ebel, J.,
and Grisebach, H.
(1979)
Arch. Biochem. Biophys.
194,
635-636[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Biggs, D. R.,
Welle, R.,
Visser, F. R.,
and Grisebach, H.
(1987)
FEBS Lett.
220,
223-226[CrossRef]
|
| 11.
|
Welle, R.,
and Grisebach, H.
(1991)
Phytochemistry
30,
479-484[CrossRef]
|
| 12.
|
Laflamme, P.,
Khouri, H.,
Gulick, P.,
and Ibrahim, R.
(1993)
Phytochemistry
34,
147-151[CrossRef]
|
| 13.
|
Dhillon, D. S.,
and Brown, S. A.
(1976)
Arch. Biochem. Biophys.
177,
74-83[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Hamerski, D.,
and Matern, U.
(1988)
Eur. J. Biochem.
171,
369-375[Medline]
[Order article via Infotrieve]
|
| 15.
|
Fellermeier, M.,
and Zenk, M. H.
(1998)
FEBS Lett.
427,
283-285[CrossRef][Medline]
[Order article via Infotrieve]
|
| 16.
|
Mühlenweg, A.,
Melzer, M., Li, S-M.,
and Heide, L.
(1998)
Planta
205,
407-413[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Tabata, M.
(1996)
Plant Tissue Culture Lett.
13,
117-125
|
| 18.
|
Brigham, L. A.,
Michaels, P. J.,
and Flores, H. E.
(1999)
Plant Physiol.
119,
417-428[Abstract/Free Full Text]
|
| 19.
|
Inouye, H.,
Ueda, S.,
Inoue, K.,
and Matsumura, H.
(1979)
Phytochemistry
18,
1301-1308[CrossRef]
|
| 20.
|
Yazaki, K.,
Matsuoka, H.,
Ujihara, T.,
and Sato, F.
(1999)
Plant Biotechnol.
16,
335-342
|
| 21.
|
Heide, L.,
Nishioka, N.,
Fukui, H.,
and Tabata, M.
(1989)
Phytochemistry
28,
1873-1877[CrossRef]
|
| 22.
|
Gaisser, S.,
and Heide, L.
(1996)
Phytochemistry
41,
1065-1072[CrossRef]
|
| 23.
|
Yazaki, K.,
Matsuoka, H.,
Shimomura, K.,
Bechthold, A.,
and Sato, F.
(2001)
Plant Physiol.
125,
1831-1841[Abstract/Free Full Text]
|
| 24.
|
Tani, M.,
Takeda, K.,
Yazaki, K.,
and Tabata, M.
(1993)
Phytochemistry
34,
1285-1290[CrossRef]
|
| 25.
|
Yazaki, K.,
Takeda, K.,
and Tabata, M.
(1997)
Plant Cell Physiol.
38,
776-782[Abstract/Free Full Text]
|
| 26.
|
Ashby, M. N.,
Kutsunai, S. Y.,
Ackerman, S.,
Tzagoloff, A.,
and Edwards, P. A.
(1992)
J. Biol. Chem.
267,
4128-4136[Abstract/Free Full Text]
|
| 27.
|
Tabata, M.,
and Fujita, Y.
(1985)
in
Bio/Technology in Plant Science
(Zaitlin, M.
, Day, P.
, and Hollaender, A., eds)
, pp. 207-218, Academic Press, Orlando, FL
|
| 28.
|
Linsmaier, E. M.,
and Skoog, F.
(1965)
Physiol. Plant.
18,
100-127[CrossRef]
|
| 29.
|
Fujita, Y.,
Hara, Y.,
Suga, C.,
and Morimoto, T.
(1981)
Plant Cell Rep.
1,
61-63
|
| 30.
|
Davisson, V. J.,
Woodside, A. B.,
and Poulter, C. D.
(1985)
Methods Enzymol.
110,
130-144[Medline]
[Order article via Infotrieve]
|
| 31.
|
Güldener, U.,
Heck, S.,
Fiedler, T.,
Beinhauer, J.,
and Hegemann, J. H.
(1996)
Nucleic Acids Res.
24,
2519-2524[Abstract/Free Full Text]
|
| 32.
|
Rentsch, D.,
Laloi, M.,
Rouhara, I.,
Schmelzer, E.,
Delrot, S.,
and Frommer, W. B.
(1995)
FEBS Lett.
370,
264-268[CrossRef][Medline]
[Order article via Infotrieve]
|
| 33.
|
Ito, H.,
Fukuda, Y.,
Murata, K.,
and Kimura, A.
(1983)
J. Bacteriol.
153,
163-168[Abstract/Free Full Text]
|
| 34.
|
Yamamoto, H.,
Yazaki, K.,
and Inoue, K.
(2000)
J. Chromatog. B
738,
3-15
|
| 35.
|
Fristedt, U.,
Berhe, A.,
Ensler, K.,
Norling, B.,
and Persson, B. L.
(1996)
Arch. Biochem. Biophys.
330,
133-141[CrossRef][Medline]
[Order article via Infotrieve]
|
| 36.
|
Boutry, M.,
and Chua, N-H.
(1985)
EMBO J.
4,
2159-2165[Medline]
[Order article via Infotrieve]
|
| 37.
|
Okamoto, T.,
Yazaki, K.,
and Tabata, M.
(1995)
Phytochemistry
38,
83-88[CrossRef]
|
| 38.
|
Uchida, N.,
Suzuki, K.,
Saiki, R.,
Kainou, T.,
Tanaka, K.,
Matsuda, H.,
and Kawamukai, M.
(2000)
J. Bacteriol.
182,
6933-6939[Abstract/Free Full Text]
|
| 39.
|
Melzer, M.,
and Heide, L.
(1994)
Biochim. Biophys. Acta
1212,
93-102[Medline]
[Order article via Infotrieve]
|
| 40.
|
Ashby, M. N.,
and Edwards, P. A.
(1990)
J. Biol. Chem.
265,
13157-13164[Abstract/Free Full Text]
|
| 41.
|
Emanuelsson, O.,
Henrik Nielsen, H.,
Brunak, S.,
and von Heijne, G.
(2000)
J. Mol. Biol.
300,
1005-1016[CrossRef][Medline]
[Order article via Infotrieve]
|
| 42.
|
Yamaga, Y.,
Nakanishi, K.,
Fukui, H.,
and Tabata, M.
(1993)
Phytochemistry
32,
633-636[CrossRef]
|
| 43.
|
Suzuki, K.,
Ueda, M.,
Yasuda, M.,
Nakagawa, T.,
Kawamukai, M.,
and Matsuda, H.
(1994)
Biosci. Biotech. Biochem.
58,
1814-1819[Medline]
[Order article via Infotrieve]
|
| 44.
|
Lineweaver, H.,
and Burk, D.
(1934)
J. Am. Chem. Soc.
56,
658-666[CrossRef]
|
| 45.
|
Yazaki, K.,
Kataoka, M.,
Honda, G.,
Severin, K.,
and Heide, L.
(1997)
Biosci. Biotech. Biochem.
61,
1995-2003[Medline]
[Order article via Infotrieve]
|
| 46.
|
Wilson, R.,
Ainscough, R.,
Anderson, K.,
Baynes, C.,
Berks, M.,
Bonfield, J.,
Burton, J.,
Connell, M.,
Copsey, T.,
Cooper, J.,
et al..
(1994)
Nature
368,
32-38[CrossRef][Medline]
[Order article via Infotrieve]
|
| 47.
|
Yazaki, K.,
Ogawa, A.,
and Tabata, M.
(1995)
Plant Cell Physiol.
36,
1319-1329[Abstract/Free Full Text]
|
| 48.
|
Yamamoto, H.,
Inoue, K.,
and Yazaki, K.
(2000)
Phytochemistry
53,
651-657[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Sommer, S.,
Koehle, A.,
Yazaki, K.,
Shimomura, K.,
Bechthold, A.,
and Heide, L.
(1999)
Plant Mol. Biol.
39,
683-693[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
R. A. Okrent, M. D. Brooks, and M. C. Wildermuth
Arabidopsis GH3.12 (PBS3) Conjugates Amino Acids to 4-Substituted Benzoates and Is Inhibited by Salicylate
J. Biol. Chem.,
April 10, 2009;
284(15):
9742 - 9754.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Akashi, K. Sasaki, T. Aoki, S.-i. Ayabe, and K. Yazaki
Molecular Cloning and Characterization of a cDNA for Pterocarpan 4-Dimethylallyltransferase Catalyzing the Key Prenylation Step in the Biosynthesis of Glyceollin, a Soybean Phytoalexin
Plant Physiology,
February 1, 2009;
149(2):
683 - 693.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-J. Wu, J.-L. Qi, W.-J. Zhang, S.-H. Liu, F.-H. Xiao, M.-S. Zhang, G.-H. Xu, W.-G. Zhao, M.-W. Shi, Y.-J. Pang, et al.
Nitric Oxide Regulates Shikonin Formation in Suspension-Cultured Onosma paniculatum Cells
Plant Cell Physiol.,
January 1, 2009;
50(1):
118 - 128.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. C. Lee, C. Salomon, B. Mijts, and C. Schmidt-Dannert
Biosynthesis of Ubiquinone Compounds with Conjugated Prenyl Side Chains
Appl. Envir. Microbiol.,
November 15, 2008;
74(22):
6908 - 6917.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Sasaki, K. Mito, K. Ohara, H. Yamamoto, and K. Yazaki
Cloning and Characterization of Naringenin 8-Prenyltransferase, a Flavonoid-Specific Prenyltransferase of Sophora flavescens
Plant Physiology,
March 1, 2008;
146(3):
1075 - 1084.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ohara, K. Yamamoto, M. Hamamoto, K. Sasaki, and K. Yazaki
Functional Characterization of OsPPT1, Which Encodes p-Hydroxybenzoate Polyprenyltransferase Involved in Ubiquinone Biosynthesis in Oryza sativa
Plant Cell Physiol.,
May 1, 2006;
47(5):
581 - 590.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Grundmann and S.-M. Li
Overproduction, purification and characterization of FtmPT1, a brevianamide F prenyltransferase from Aspergillus fumigatus
Microbiology,
July 1, 2005;
151(7):
2199 - 2207.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Yamamura, F. P. Sahin, A. Nagatsu, and H. Mizukami
Molecular Cloning and Characterization of a cDNA Encoding a Novel Apoplastic Protein Preferentially Expressed in a Shikonin-Producing Callus Strain of Lithospermum erythrorhizon
Plant Cell Physiol.,
April 15, 2003;
44(4):
437 - 446.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Pojer, E. Wemakor, B. Kammerer, H. Chen, C. T. Walsh, S.-M. Li, and L. Heide
CloQ, a prenyltransferase involved in clorobiocin biosynthesis
PNAS,
March 4, 2003;
100(5):
2316 - 2321.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Shitan, I. Bazin, K. Dan, K. Obata, K. Kigawa, K. Ueda, F. Sato, C. Forestier, and K. Yazaki
Involvement of CjMDR1, a plant multidrug-resistance-type ATP-binding cassette protein, in alkaloid transport in Coptisjaponica
PNAS,
January 21, 2003;
100(2):
751 - 756.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|