JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

Originally published In Press as doi:10.1074/jbc.M110267200 on December 11, 2001

J. Biol. Chem., Vol. 277, Issue 8, 6303-6310, February 22, 2002
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
277/8/6303    most recent
M110267200v1
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ostrowski, J.
Right arrow Articles by Bomsztyk, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ostrowski, J.
Right arrow Articles by Bomsztyk, K.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Heterogeneous Nuclear Ribonucleoprotein K Protein Associates with Multiple Mitochondrial Transcripts within the Organelle*

Jerzy OstrowskiDagger §, Lucjan Wyrwicz||, Leszek Rychlewski**, and Karol BomsztykDagger Dagger

From the Dagger  Department of Gastroenterology, Medical Center for Postgraduate Education, Maria Sklodowska-Curie Memorial Cancer Center, and the Institute of Oncology, 02-781 Warsaw, Poland, the  Bioinformatics Unit, International Institute of Molecular and Cell Biology, 02-102 Warsaw, Poland, the || Department of Informatics and Biocybernetics, Pomeranian Medical Academy, 70-204 Szczecin, Poland, the ** BioInfoBank Institute, 60-744 Poznan, Poland, and the Dagger Dagger  Division of Nephrology, Department of Medicine, University of Washington, Seattle, Washington 98195

Received for publication, October 25, 2001, and in revised form, December 5, 2001

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Heterogeneous nuclear ribonucleoprotein K (hnRNP K) protein interacts with a subset of cellular RNAs. We used K protein as a bait in the yeast three-hybrid screen to identify RNAs that bind K protein in vivo. A large number of K protein-binding RNA clones were identified from a human hybrid RNA library. These sequences consisted of C-rich patches and were G-poor. Unexpectedly, several of the RNA clones were encoded by the mitochondrial genome. In a subsequent three-hybrid screen of a hybrid RNA library generated from a mouse liver mitochondrial genome, K protein bound RNA sequences encoded by different loci spanning nearly the entire mitochondrial genome. Western blot analysis of extracts from mitochondria and mitochondrial fractions showed that K protein is localized within mitoplasts. Reverse transcriptase PCR of RNA co-immunoprecipitated with K protein from lysates of isolated mitochondria showed that K protein is associated with several processed mitochondrial transcripts. In contrast, in the same assay, the polycistronic nascent mtRNA bound K protein weakly or not at all. Results of this study suggest that K protein acts within functional modules that are responsible for expression of genes in mitochondria.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Heterogeneous nuclear ribonucleoprotein K is a nucleic acid-binding protein that interacts with proteins involved in signal transduction (1-3), chromatin remodeling (4, 5), transcription (6-8), RNA processing (9), and translation (10). K protein interaction with both nucleic acid and protein partners is regulated by extracellular signal-induced phosphorylation cascades (2, 3). A host of studies provide evidence for K protein involvement in cellular processes such as proliferation (11, 12) and apoptosis (11, 13), observations that likely reflect the role of K protein in nucleic acid-directed processes. K protein has also been shown to interact with viral proteins (14, 15) and to regulate expression of viral genes (16). Thus, the diversity of K protein-dependent cellular and viral processes could be attributed to the diversity of its molecular interactions.

K protein interacts with a large repertoire of mRNAs (3, 17). K protein also binds DNA (6, 18) and is likely to be recruited directly or indirectly to just as many gene loci.1 RNA and DNA binding of K protein is mediated by one or more of its three KH2 domains (19). K protein also contains several different protein-protein interaction domains that are responsible for the recruitment of factors involved in signal transduction and gene expression (20).

A model for K protein function is emerging in which K protein could serve to link signaling cascades to nucleic acid-directed processes within multiple functional modules responsible for expression of many genes (17, 21, 22). This general model for K protein action is likely shared by signal transduction-responsive nucleic acid-binding factors such as YB-1 (9, 23) and others (24).

To define the spectrum of genes whose expression is K protein-dependent, we used the yeast three-hybrid screen (25) to identify RNA sequences that bind K protein in vivo. Computer-based analysis of the strongest K protein-binding RNA clones defined a consensus sequence composed of three C-rich patches. A number of RNAs isolated in the screen were encoded by mitochondrial genes. K protein co-immunoprecipitated several transcripts from lysates of purified mitochondria, providing evidence for intramitochondrial K protein-RNA interactions.

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Materials-- The yeast three-hybrid system pOAA and pIIIMS2-2 plasmids and Saccharomyces cerevisiae L40 strain were a gift from Dr. Stanley Fields (Department of Medicine, University of Washington, Seattle, WA) (25).

Construction of Hybrid RNA Libraries for the Yeast Three-hybrid Screens-- To construct human hybrid RNA libraries, total cellular RNA was isolated from human gastric carcinoma AGS cells using TRIzol reagent (Invitrogen) following the manufacturer's protocol. Random hexamer-primed cDNAs were synthesized using the cDNA synthesis system (Invitrogen). Double-stranded cDNA was digested with AluI, HaeIII, PvuII, and SspI and then fractionated on 2% agarose gel. Fragments ranging from 50 to 150 bp were purified from the gel and ligated to SmaI-digested and dephosphorylated pIIIMS2-2 plasmid.

To construct a mouse mtRNA library, mitochondria isolated from mouse livers were used to purify mtDNA. mtDNA was cut with AluI, HaeIII, and SspI, and 50-150-bp fragments were purified and ligated into SmaI-digested and dephosphorylated pIIIMS2-2 plasmid. The ligation mixture was used to transform competent DH5alpha cells.

Screening of RNA Libraries-- The K protein-activation domain hybrid was constructed by insertion of the full-length K protein cDNA (18) into the pOAA plasmid. Yeast L40 cells were transformed with the K protein hybrid and the library plasmids using the LiAc/polyethylene glycol method (26). Cells were grown on synthetic medium lacking leucine, histidine, uracil, tryptophan, and adenine. Colonies were picked after 4-5 days and plated onto fresh selective plates containing 2.5 mM 3-aminotriazole; and when the cells had grown, beta -galactosidase activity was tested by X-gal filter assay. To eliminate false positives, the K protein hybrid plasmid was purged from the colonies by growing cells in liquid medium without uracil but containing 2× concentration of adenine and leucine. Cells without the K protein-activation domain construct were then tested for beta -galactosidase activity. The true positive plasmids were isolated from yeast cells, and DNA inserts were sequenced.

To test the K protein-binding affinity of the isolated RNA clones, hybrid RNA-expressing plasmids were re-transformed into L40 cells containing the pOAA-K protein plasmid, and the transformants were tested again by X-gal filter assay. Selected yeast clones were then grown in liquid culture until mid-log phase (A600 = 0.5-0.6). Cells were lysed, and direct quantitative measurements of beta -galactosidase activity assays were carried out as previously described (9). Enzymatic assays represent the average of at least three independent colonies for each hybrid RNA-expressing plasmid.

Computational Analysis of RNA Sequences-- The sequences of all RNA fragments were identified using blastn.3 Similarity searches were conducted in the nr data base (non-redundant data base of sequences deposited in the DDBJ/GenBankTM/EMI Data Bank and the Protein Data Bank) and in the dbEST data base (expressed sequence tags in the DDBJ/GenBankTM/EBI Data Bank) to identify the RNA. RNA secondary structures were predicted using the mfold Version 3.1 server (27).4 The ClustalW program (28) was used for multiple alignment of the RNA fragments. Graphs were generated using Excel programs (Microsoft). Statistical analysis was conducted using Statistica PL.

Isolation of Mitochondria-- Anesthetized mice were killed; and the livers were resected, cut into small pieces with scissors, and homogenized in a Potter-Elvehjem (Teflon-glass) homogenizer with 10 volumes of cold homogenization buffer (225 mM mannitol, 75 mM sucrose, 0.5 mM EGTA, 10 mM Tris-HCl (pH 7.4), 10 µg/ml leupeptin, 0.5 mM dithiothreitol, and 0.5 mM phenylmethylsulfonyl fluoride). The homogenate was centrifuged at 650 × g for 10 min, and the supernatant containing the post-nuclear fraction was centrifuged again at 650 × g for 10 min. The post-nuclear supernatant was centrifuged at 11,000 × g for 10 min in a swing-out rotor. The mitochondrial pellet was resuspended carefully in homogenization buffer and centrifuged again at 11,000 × g for 10 min. The crude mitochondrial fraction suspended in an isotonic sucrose buffer (0.25 M sucrose, 1 mM EGTA, 10 mM Tris-HCl (pH 7.4), 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 10 µg/ml leupeptin) was layered on a 1.0/1.5 M discontinuous sucrose gradient and then centrifuged at 80,000 × g for 1 h. Mitochondria were collected from the phase between 1.5 and 1.0 M sucrose and washed several times with the isotonic sucrose buffer.

Subfractionation of Mitochondria-- Mouse mitochondria were subfractionated as previously described (29). Briefly, mitochondria suspended in an isotonic sucrose buffer (0.25 M sucrose, 1 mM EDTA, 10 mM Tris-HCl (pH 7.4), 0.5 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, and 10 µg/ml leupeptin) were sonicated and then centrifuged at 320,000 × g for 1 h at 4 °C. The soluble mitochondrial fraction was recovered from the supernatant. The mitochondrial membrane fraction was obtained by homogenization of the pellet in immunoprecipitation buffer (150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 5 mM EGTA, 1% Triton X-100, and 0.5% Nonidet P-40).

To obtain mitoplasts (29), freshly prepared mitochondria were diluted 10-fold with hypotonic buffer (5 mM Tris-HCl (pH 7.4) and 1 mM EDTA) and centrifuged at 14,000 × g for 20 min at 4 °C. The pellet was washed four times with hypotonic buffer, and proteins from mitoplasts were extracted using immunoprecipitation buffer. The protein concentration was measured using the protein assay (Pierce), and K protein content in mitochondrial protein fractions was analyzed by Western blotting.

Western Blotting-- Equal amounts of sample protein (100 µg) were boiled in 2× loading buffer (125 mM Tris-HCl (pH 6.8), 4% SDS, 20% glycerol, and 10% beta -mercaptoethanol) for 5 min. Proteins were separated by 10% SDS-PAGE and electroblotted onto polyvinylidene difluoride membranes. The membranes were blocked with 5% nonfat dry milk in Tris-buffered saline containing 0.05% Tween 20 for 1 h at room temperature. The membranes were then probed for 1 h at room temperature with rabbit anti-K protein antibodies. After washing, the membranes were incubated for 60 min at room temperature with secondary antibodies conjugated with alkaline phosphatase, and immunoreactions were detected using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium phosphatase substrate.

Isolation of Total Cellular and Mitochondrial RNAs-- Total cellular RNA was prepared as previously described (17). Total mtRNA was prepared from mitochondria that were isolated from livers of anesthetized mice using TRIzol reagent following the manufacturer's protocol. RNase inhibitor (0.1 unit/µl) was used in all procedures involving RNA.

Co-immunoprecipitation of RNA with K Protein-- Frozen hepatic tissue or isolated mitochondria were pulverized under liquid nitrogen, and the powders were homogenized using immunoprecipitation buffer. In addition to dithiothreitol (0.5 mM), phenylmethylsulfonyl fluoride (0.5 mM), and leupeptin (10 µg/ml), the lysis buffer contained the following phosphatase inhibitors: 30 mM p-nitrophenyl phosphate, 10 mM sodium fluoride, 0.1 mM sodium orthovanadate, 0.1 mM sodium molybdate, and 10 mM beta -glycerophosphate.

To co-immunoprecipitate RNA with K protein, we used a previously described procedure (17). Briefly, hepatic or mitochondrial lysates were first precleared with 50 µg of rabbit IgG (Bio-Rad) by bath-sonicating for 15 min at 4 °C, followed by binding to 20 µl of protein A beads for 45 min at 4 °C. Beads were spun down, and the supernatant was bath-sonicated with 20 µl of affinity-purified anti-K protein antibody 54 for 15 min at 4 °C. The complexes were pulled down by adding protein A beads (20 µl) and rotating the slurry for 45 min at 4 °C. Beads were washed four times with 1 ml of immunoprecipitation buffer, and RNA was eluted from the beads with 100 mM NaCl and 1% SDS at 65 °C for 10 min in an Eppendorf Thermomixer. RNA was phenol/chloroform-deproteinized and then ethanol-precipitated. RNA pellets were resuspended in water and stored at -70 °C.

RT-PCR-- RT reactions were carried out using SuperScript II RT (Invitrogen) and random primers in a 20-µl volume following the manufacturer's protocol. RT reactions were diluted 1:10 with water, and cDNAs were used in PCR.

    RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

Identification of K Protein-binding RNAs Using the Yeast Three-hybrid Screen-- To identify the spectrum of K protein-binding RNAs, we used full-length K protein as a bait in the yeast three-hybrid screen (25). In this screen, protein-RNA interaction is detected by the reconstitution of a transcriptional activator using two-hybrid proteins and RNA from a hybrid RNA library. The hybrid RNA molecule is recruited to the promoter of a reporter gene by binding to a hybrid protein consisting of the bacteriophage MS2 coat protein fused to the DNA-binding protein LexA. The hybrid RNA, in turn, recruits the hybrid RNA-binding protein of interest. The hybrid RNA consists of binding sites for the MS2 coat protein and the RNA sequence that binds the protein of interest. The RNA-binding protein is generated by fusing it to the transcriptional activation domain of the yeast Gal4 protein (25, 30).

Transformants were selected on yeast synthetic medium lacking leucine, histidine, uracil, tryptophan, and adenine. The His-deficient medium selected clones that expressed the HIS3 reporter gene driven by LexA DNA-binding elements. These clones were then tested by beta -galactosidase assay for lacZ reporter gene expression also driven by LexA DNA-binding sites. The putative positive clones that failed to activate the lacZ reporter gene in the L40 cells in the absence of the pOAA-K protein plasmid were considered to be true positives.

Five to ten million independent human RNA clones generated from total cellular RNA were screened. Forty-three true positive clones were identified. Unexpectedly, several positive clones represented mtRNAs (see Fig. 2B). Sequencing of 20 randomly chosen plasmids from the hybrid cDNA library revealed no mtRNA sequences. This suggests that the cloning of mtRNA by K protein in the yeast three-hybrid system does not reflect overrepresentation of mitochondrial sequences in the cDNA library. Instead, these results suggest preferential K protein binding to mitochondrial transcripts in the yeast three-hybrid system.

Computational Analysis of RNA Sequences Cloned in the Yeast Three-hybrid Screen-- Computer-generated predictions of secondary structures of the RNAs (mfold)4 were used to determine any similar secondary structure among positive clones. The temperature was set at 37 °C, and 1 M NaCl was used during the calculation (27, 31). This computer-based analysis did not identify shared secondary structure among the isolated RNA clones.

To define the consensus K protein-binding motif, the primary RNA sequences of the positive clones were compared using the ClustalW program (28) for multiple alignment of the RNA fragments. All positive clones exhibited a strong blue color in the presence of X-gal. We used liquid assay for beta -galactosidase activity to estimate the efficiency of interactions. The beta -galactosidase activities ranged between 0.5 and 663 units and were compared with the results of alignments. A preliminary alignment was conducted only with those RNA sequences that exhibited beta -galactosidase activity 25 units and above. The remaining sequences were added to the alignment manually using the BIOEdit program.5 Analysis of the alignment revealed a tandem array of three C-rich patches with the following sequence: (C/U)(C/U)AUCN2-5C(C/U)ACC(C/A)N11-17UCA(C/U).

The frequency of ribonucleotides at all positions of the 50-base alignment is shown in Fig. 1. The three C-rich patches (left, middle, and right) are shown. The high frequency of the single A and U in the left and right patches is easily seen. The frequency of a single A and a single U in the middle patch is lower. Mean cytosine content of the aligned regions was significantly higher than the mean cytosine content of the clones as a whole (p < 0.05). Cytosine content was 39.8%, adenine 25.4%, uracil 24.4%, and guanine 10.3% of the total. Thus, the overall K protein-binding RNAs are C-rich and G-poor. This is consistent with the observation that K protein strongly binds poly(C) RNA, but not poly(G) RNA (17, 32). There was a strong correlation between K protein-binding affinities of the cloned RNAs and the number of sequence regions containing the three C-rich boxes of the predicted binding motif (Table I). This is not unexpected because RNA clones containing multiple copies of the consensus sequence would be expected to recruit multiple K protein molecules, resulting in proportionally stronger activation of the lacZ reporter gene.


View larger version (31K):
[in this window]
[in a new window]
  		Fig. 1.   Frequency of ribonucleotides at the 50 bases in the aligned K protein-binding RNA sequences isolated in the yeast three-hybrid screen. The horizontal line designates the mean frequency. Color designation of the triangles is as follows: red, C; yellow, A; black, U; and white, G. Position indicates bases.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Sequences of the RNA clones isolated from the yeast three-hybrid system that exhibited the highest beta -galactosidase (beta -gal) activity of the lacZ reporter gene

To test the utility of the computationally derived K protein-binding motif, we carried out analysis of the 15-lipoxygenase (33) and human papilloma virus type 16 L2 (16) mRNAs, two transcripts known to be regulated by K protein. The rabbit 15-lipoxygenase transcript contains three C-rich stretches in the regulatory region that agree well with the derived consensus sequence (Table II). The human papilloma virus type 16 L2 mRNA contains five such tandem sequences (Table III). Three of these elements are located within the region known to be important in translational regulation of this viral transcript (16).

                              
View this table:
[in this window]
[in a new window]
 
Table II
Sequence of the 3'-untranslated rabbit reticulocyte (RBC) 15-lipoxygenase (15-LOX) mRNA regulatory region

                              
View this table:
[in this window]
[in a new window]
 
Table III
Sequences in the proximal regulatory regions of the human papilloma virus type 16 L2 gene (human papilloma virus type 16 complete genome, 7904 bp; strain 16W12E, GenBankTM/EBI accession number AF125673)
Gene L2 is located between bp 4235 and 5656.

K Protein Binds Several Mouse mtRNA Sequences in the Yeast Three-hybrid System-- The yeast three-hybrid screen of total cellular RNA identified several human mtRNAs that bound K protein (Fig. 2B). The mitochondrial genome is a double-stranded circular DNA. The human and mouse mitochondrial genomes are 16,598 and 16,295 bp long, respectively. Mitochondrial genomes are transcribed as polycistronic transcripts that are cleaved to generate 37 transcripts that encode 2 rRNAs, 22 tRNAs, and 13 mRNAs (34). The small mitochondrial genome does not contain introns, making it possible to generate a complete mtRNA library directly from DNA. To identify the full spectrum of mtRNA sequences that bind K protein, we constructed such an RNA library in the pIIIMS2-2 plasmid using restriction fragments of the entire mouse mitochondrial genome. Using K protein as the RNA bait, we isolated 28 clones that activated both the His3 and lacZ reporter genes. As illustrated in Fig. 2C, the isolated sequences span nearly the entire mouse mitochondrial genome, including both of the rRNAs and most of the protein genes.


View larger version (20K):
[in this window]
[in a new window]
  		Fig. 2.   Position within mitochondrial genome of the human and mouse RNA clones identified in the yeast three-hybrid screen using K protein as the bait. A, list of the 13 proteins and two rRNAs encoded by the human and mouse mitochondrial genes. B and C, arrangement of human and mouse mitochondrial (mt) genes transcribed from the heavy strand is shown by the white boxes, and the protein transcribed from the light strand is shown by the hatched boxes. The rulers below represents the entire human (16,568 bp; NCBI accession number NC_001807) and mouse (16,295 bp; NCBI accession number NC001569) mitochondrial genomes. The positions of the arrowheads corresponds to the 5'-ends of the isolated clones.

K Protein Is Present in Mitochondria-- Mitochondria contain several hundred different proteins (35). The vast majority of mitochondrial proteins are encoded by the nuclear genes; these proteins are imported into mitochondria by specialized protein import pathways (35). Only 13 mitochondrial proteins are encoded by the mitochondrial genome and are synthesized in the organelle matrix (34). K protein is found in the cytoplasm and the nucleus (18), but, until now, has not been reported in mitochondria. The observation that K protein binds many mtRNAs suggests that it may play a role in mitochondrial processes. To begin to test such a possibility, we next investigated whether K protein is present within the organelle. Western blot analysis revealed that the total mitochondrial lysates contained K protein (Fig. 3A, lane 1). Mitochondria are surrounded by an outer and inner membrane (36). The inner membrane surrounds the mitoplast, where nucleic acid-directed processes such as transcription, translation, and RNA processing take place (34). We prepared mitoplasts from liver and tested whether they contain K protein. Western blotting of protein extracts from the mitoplast preparation revealed K protein (Fig. 3A, lane 2), providing evidence that K protein is localized within the mitochondrial compartment where RNA-dependent processes take place. Mitoplasts are prepared by disrupting the outer membrane of the isolated mitochondria (37). The finding that K protein was in mitoplast protein extracts provides strong evidence against cytoplasmic contamination of the mitochondrial preparation.


View larger version (11K):
[in this window]
[in a new window]
  		Fig. 3.   Intramitochondrial localization of K protein. A, mitochondria were isolated from livers of anesthetized mice, and whole mitochondria and mitochondrial fractions were prepared as described under "Experimental Procedures." Proteins from whole mitochondria (lane 1), mitoplasts (lane 2), soluble mitochondrial fractions (lane 3), and mitochondrial membrane fractions (lane 4) were separated by SDS-PAGE and immunostained (IS) on polyvinylidene difluoride membrane using anti-K protein antibody (alpha K). B, RT reaction was performed using random primer on total mitochondrial (mt) RNA (lane 2), mtRNA immunoprecipitated (IP) with K protein (lane 3), and RNA immunoprecipitated with K protein from total cell lysates (lane 4). PCR was done using primers to actin cDNA. After agarose gel electrophoresis, PCR products were visualized by ethidium bromide. A DNA ladder (GeneRuler, 100 bp, MBI Fermentas) is shown in lane 1.

We have previously used a highly specific RNA co-immunoprecipitation/RT-PCR-based assay to study nuclear derived transcripts that are associated with K protein in vivo (17). K protein binds in vivo the abundant actin message (17). To further rule out cytoplasmic contamination, we immunoprecipitated K protein with associated RNAs from both whole cell and mitochondrial lysates (Fig. 3B). RT reactions were carried out with total mtRNA (Fig. 3B, lane 2), mtRNA precipitated with K protein (lane 3), and RNA precipitated with K protein from total cell lysates (lane 4). PCR using primers to actin cDNA revealed the predicted size product in RT from RNA immunoprecipitated with K protein from total cell lysates (Fig. 3B, lane 4), but not in RT from RNA from total mitochondrial lysates (lane 2) or in RT from RNA co-immunoprecipitated with K protein from mitochondria (lane 3). This result provides further proof that the mitochondrial fraction was not contaminated with cytosol.

Within mitoplasts, proteins involved in RNA-directed processes can be associated with the inner membrane, the soluble fractions, or both (38). We used anti-K protein antibody in Western blotting to assay for the presence of K protein in these submitochondrial fractions. Western blotting revealed that K protein copurified with the membrane fraction (Fig. 3A, lane 4), but was not found in the soluble fraction (lane 3). These results suggest that K protein is associated with the mitochondrial inner membrane.

K Protein Coprecipitates Processed Mitochondrial Transcripts-- The yeast three-hybrid screen showed that K protein bound many RNA sequences encoded by the mitochondrial genome (Fig. 2). We next used RNA immunoprecipitation assay to test whether K protein associates with mitochondrial transcripts in vivo. Mitochondria were isolated, and lysates were prepared using immunoprecipitation buffer. After immunoprecipitation with anti-K protein antibody, eluted RNA was used as a template in the RT reaction (Fig. 4). As a control, total mtRNA was used in the RT reaction. Pairs of oligonucleotide primers covering loci encoding several mitochondrial enzymes were used in PCR. PCR fragments of the predicted size were obtained for sequences corresponding to ATP synthase subunit 6, NADH dehydrogenase subunits 4 and 5, and cytochrome b with either mtDNA template (Fig. 4B, lane 2) or RT template from either total (lane 3) or immunoprecipitated (lane 4) RNA. Reaction without RT yielded no PCR products (lanes 5 and 6), indicating no DNA contamination. The results of RT-PCR analysis suggest that K protein binds these mitochondrial protein-encoding transcripts in vivo. The NADH dehydrogenase 4L and 4 subunits are encoded by a bicistronic transcript (34). Using a set of primers encompassing sequences that encode portions of both enzymes yielded the predicted size PCR fragment, suggesting that K protein binds in vivo this bicistronic mRNA as well.


View larger version (23K):
[in this window]
[in a new window]
  		Fig. 4.   K protein co-immunoprecipitates several protein-coding mitochondrial transcripts. A, arrangement of mouse mitochondrial protein-coding genes is shown as in Fig. 2C. The pair of arrows designates the location of the pair of primers used in PCR that is shown in the adjacent gel stained with ethidium bromide shown in B. The distance between the arrowheads corresponds to the size of the predicted PCR product. The ruler below represents the entire mouse mitochondrial genome in kb. B, mitochondria isolated from mouse livers were used to prepare mitochondrial (mt) DNA, total RNA, and RNA immunoprecipitated (IP) with K protein (see "Experimental Procedures"). Total mtRNA and RNA pulled down with K protein were used in the RT reaction with random primers. PCRs (30 cycles) were carried out with the following primer pairs: mt.1S (CTCCTAGGCCTTTTACCACATACA) and mt.1AS (GAGGGTGAATACGTAGGCTTGAA), mt.3S (TAGCATACCCCTTCATCCTTCTC) and mt.3AS (ATCATGTGGCTATAAGTGGGAAGA), mt.4S (AACTTCCCACTGTACACCACCAC) and mt.4AS (GTCTGTTCGTCCGTA CCATCATC), mt.6S (GGAGACCCAGACAACTACATACCA) and mt.6AS (ATAAATGGGTGTTCTACTGGTTGG), and mt.2S (AGGGACACTTATATTTCGCTCTCA) and mt.2AS (GTTTAGGCGTTCAGTTTGGTTCC). The templates used were mtDNA (lane 2) and RT from total (lane 3) and immunoprecipitated (lane 4) RNAs. Total RNA (lane 5) and immunoprecipitated RNA (lane 6) are shown without RT. After agarose gel electrophoresis, PCR products were visualized by ethidium bromide. A DNA ladder (GeneRuler, 100 bp) is shown in lane 1. ND, NADH dehydrogenase.

The mitochondrial genome is transcribed from both the heavy and light strands of the circular DNA, generating two long polycistronic RNAs. Nearly every protein gene and the two rRNA genes are flanked by tRNA-encoding sequences. The precise endonucleolytic excision of tRNAs from the polycistronic transcript is thought to generate not only the correct tRNAs, but also the two rRNAs and the 13 mRNAs (34). To test whether K protein binds the long polycistronic nascent transcripts, we tested RT products from total mitochondrial and co-immunoprecipitated RNAs in PCR using several pairs of oligonucleotide primers encompassing two or more genes (Fig. 5). With each set of primers, there was a predicted size fragment using mtDNA (Fig. 5B, lanes 2, 6, and 10) and RT products from total mtRNA (lanes 4, 8, and 12). In contrast, when RT from RNAs that co-immunoprecipitated with K protein was used as a template, no PCR products were seen (lanes 3, 7, and 11). This result suggests that K protein binds the polycistronic nascent mitochondrial transcripts weakly or not at all.


View larger version (34K):
[in this window]
[in a new window]
  		Fig. 5.   K protein does not precipitate the unprocessed polycistronic mitochondrial mRNA. A, arrangement of mouse mitochondrial protein-coding genes is shown as in Fig. 2C. The pair of arrows designate the location of the pair of primers (I, II, and III) used in PCR shown in B. The distance between the arrowheads corresponds to the size of the predicted PCR product. The ruler below represents the entire mouse mitochondrial genome in kb. B, PCRs (30 cycles) were carried out with following pairs of primers: mt.1S (CTCCTAGGCCTTTTACCACATACA) and mt.2AS (GTTTAGGCGTTCAGTTTGGTTCC), mt.3S (TAGCATACCCCTTCATCCTTCTC) and mt.4AS (GTCTGTTCGTCCGTACCATCATC), and mt.5S (GATTCCACCCCCTCACGACTAA) and mt.6AS (ATAAATGGGTGTTCTACTGGTTGG). The templates used were mitochondrial (mt) DNA (lanes 2, 6, and 10), RT from RNA immunoprecipitated (IP) with K protein (lanes 3, 7, and 11), and RT from total RNA (lanes 4, 8, and 12). After agarose gel electrophoresis, PCR products were visualized by ethidium bromide. A DNA ladder is shown in lane 1.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

K protein contains three KH domains that bind RNA (39). We used K protein as a bait in the yeast three-hybrid screen (25) to identify RNAs that bind this factor. Computational analysis allowed us to define a consensus sequence for K protein binding that consists of three tandem C-rich patches. This result is not unexpected because the K protein KH domains bind C-rich sequences (40). The fact that this consensus sequence contains three tandem short C-rich domains may mean that the strong binding of these RNAs is mediated by simultaneous three-way KH domain-C cluster interactions. A similar mode of binding has been suggested for heterogeneous nuclear ribonucleoprotein E, which like K protein, contains three KH domains and binds a consensus sequence consisting of three tandem C-rich patches (41).

Using the SELEX method, Thisted et al. (41) identified a short K protein-binding RNA sequence consisting of a single C-rich cluster, UC3-4(U/A)(U/A). Although this empirically derived sequence is also C-rich, a single rather than tandem motif was sufficient to mediate strong protein binding. The short length of this motif suggests a single KH domain engagement. There are several possibilities to explain the apparent discrepancy between the consensus sequence derived in this study and the sequence obtained through SELEX (41). (i) The SELEX method uses sequences that are only 20 bases long and therefore cannot detect long RNA-binding sequences. (ii) The yeast three-hybrid screen might pick up only the strongest binding RNAs. (iii) The yeast three-hybrid screen is an in vivo approach, whereas the SELEX method is an in vitro strategy. We have previously shown that nearly the entire cellular repertoire of deproteinized mRNA binds K protein in vitro (3). In contrast, only a subset of mRNAs bind to K protein in vivo (17). This suggests that, in vivo, the structure of RNA is not dependent only on nucleic acid sequences, but also on other determinants, including proteins that may compose the target ribonucleoprotein complex. (iv) The apparent discrepancy between SELEX and the yeast three-hybrid screen may simply reflect the fact that there are different classes of K protein RNA targets. The class of the RNA targets may be defined by the number and/or the combination of the three KH domains that participate in the binding. For example, there may be a class of RNA targets that engage only one or two of the three KH domains, e.g. concurrent RNA binding involving the KH1 and KH3 domains or just RNA binding of a single KH domain. Because the KH3 domain is sufficient to mediate strong K protein-poly(C) binding in vitro (42), engagement of a single KH domain is a plausible explanation for the SELEX-derived sequence (41).

The three-hybrid screen identified many mtRNAs that bound K protein in the yeast system (Fig. 2). This finding does not reflect overrepresentation of mitochondrial sequences in the hybrid library, suggesting preferential K protein binding of mtRNAs in this system. There are at least two possible explanations for this observation. First, of the identified human and mouse mtRNAs, all are C-rich and G-poor and contain >30 copies of the consensus region consisting of the three tandem clusters. Second, as alluded to earlier, the structure of RNA in vivo is governed not only by nucleic acid sequence, but also by other determinants in the in vivo microenvironment such as ionic strength, temperature, and bound proteins that may favor selection of mitochondrial clones. That determinants other than the sequence itself play a key role in K protein-RNA interactions is underscored by the finding that the polycistronic nascent mitochondrial transcripts did not co-immunoprecipitate with K protein (Fig. 5), whereas several of the processed transcripts did (Fig. 4). Regardless of the reason why K protein preferentially binds mtRNA in the yeast three-hybrid screen, this fortuitous observation allowed us to uncover a novel intramitochondrial interaction of a nuclear encoded protein with several mitochondrial transcripts (Figs. 2 and 3).

Mitochondrial protein import is mediated by a complex network of protein translocases in the outer and inner membranes along with a host of chaperones and processing enzymes found in the intermembrane space and in the mitochondrial matrix (43). TOM (translocase of the outer membrane) and TIM (translocase of the inner membrane) mediate both the translocation and the sorting of proteins to the outer membrane, intermembrane space, inner membrane, and mitochondrial matrix. The mitochondrial proteins contain targeting and sorting information consisting of defined amino acid sequences and/or other physiochemical determinants that are recognized by the TOM and TIM machinery (43). The classical mitochondrial targeting and sorting signals consist of N-terminal positively charged, hydrophobic, and hydroxylated amino acids that can form an amphiphilic alpha -helix (44). It has become recently apparent that the mitochondrial targeting and sorting information is more diverse in that the amphipathic alpha -helix can be present not only in the N-terminal presequence, but also at an internal position. Moreover, there can be multiple internal targeting signals of yet to be characterized motifs (43, 45).

Computer-based analysis of K protein amino acid sequence did not identify motifs that form structures resembling known mitochondrial localization signals (TargetP Version 1.01) (46).6 This poses a question of how a fraction of K protein is recognized and directed to the inner membrane by mitochondrial import machinery. K protein, by itself or in a complex with a chaperone, is likely recognized and translocated into intermembrane space by the TOM complex of the outer membrane. In yeast, sorting of protein into the inner membrane is carried out by the TIM22 complex, whereas translocation across it is mediated by the TIM23 complex (43). Thus, once delivered into the intermembrane space, with or without a chaperone, K protein could be recognized by the mammalian machinery similar to the TIM22 complex that would direct it to the matrix side of the inner membrane. Alternatively, and perhaps more likely, K protein could be translocated into the matrix via the mammalian TIM23 system and then could be recruited to the inner membrane by a membrane-anchored protein complex such as Oxa1 (47).

What could be the role of K protein in the mitochondrial processes? One emerging general model of K protein action is that of a transducer linking signal transduction pathways to sites of nucleic acid-directed processes (1, 3, 17, 21). Several studies have shown that K protein regulates mRNA translation (10, 16, 33). With respect to K protein-RNA interaction, K protein may play a similar role in mitochondria. Expression of mitochondrial genes is regulated by extracellular signals, including ligands such as thyroid hormone (36) and insulin (48). In this regard, insulin alters K protein interactions with RNA (17). These studies suggest that K protein could be involved in the transmission of insulin and other signals to target genes and/or transcripts within mitochondria.

Proteome analysis of Jurkat T cells identified 37 proteins modified during apoptosis, including K protein (13). This suggests that K protein might be involved in the apoptotic pro cesses as well. Because mitochondria play a crucial role in the execution of cell death (49), mitochondrial K protein may participate in this process. During phorbol 12-myristate 13-acetate-induced apoptosis, protein kinase Cdelta translocates to the mitochondria (50). Protein kinase Cdelta phosphorylates and binds K protein (2). These observations raise the following questions: does the K protein-protein kinase Cdelta interaction play a role within mitochondria during apoptosis, and is this interaction functionally related to the binding of K protein to mitochondrial transcripts?

In conclusion, we have shown that K protein bound several mitochondrial transcripts in the yeast three-hybrid screen. In this system, strong binding of K protein to its RNA targets was mediated by regions consisting of three tandem C-rich patches. K protein was found within mitochondria and precipitated several mitochondrial transcripts. These results suggest that K protein acts as a transducer of signals within the functional modules that compose gene expression within mitochondria.

    ACKNOWLEDGEMENTS

We thank Anna Andrukiewicz for expert technical assistance and Oleg Denisenko, Daniel Schullery, and Lucas Armstrong for critical reading of the manuscript.

    FOOTNOTES

* This work was supported by Polish Committee for Scientific Research Grant 4 PO5A 084 19 (to J. O.) and the National Institutes of Health (to K. B.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ To whom correspondence should be addressed: Dept. of Gastroenterology, Cancer Center, 02-781 Warszawa, Roentgena 5, Poland. Tel.: 48-22-644-0102; Fax 48-22-644-7601; E-mail: jostrow@warman.com.pl.

Published, JBC Papers in Press, December 11, 2001, DOI 10.1074/jbc.M110267200

1 J. Ostrowski and K. Bomsztyk, unpublished data.

3 www.ncbi.nlm.nih.gov/BLAST.

4 bioinfo.math.rpi.edu/-fold/rna.

5 www.mbio.ncsu.edu/BioEdit/bioedit.html.

6 www.cbs.dtu.dk/services/TargetP/.

    ABBREVIATIONS

The abbreviations used are: KH, K homology; X-gal, 5-bromo-4-chloro-3-indolyl beta -D-galactopyranoside; RT, reverse transcriptase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES

1. Hobert, O., Jallal, B., Schlessinger, J., and Ullrich, A. (1994) J. Biol. Chem. 269, 20225-20228[Abstract/Free Full Text]
2. Schullery, D. S., Ostrowski, J., Denisenko, O. N., Stempka, L., Shnyreva, M., Suzuki, H., Gschwendt, M., and Bomsztyk, K. (1999) J. Biol. Chem. 274, 15101-15109[Abstract/Free Full Text]
3. Ostrowski, J., Schullery, D. S., Denisenko, O. N., Higaki, Y., Watts, J., Aebersold, R., Stempka, L., Gschwendt, M., and Bomsztyk, K. (2000) J. Biol. Chem. 275, 3619-3628[Abstract/Free Full Text]
4. Denisenko, O. N., and Bomsztyk, K. (2002) Mol. Cell. Biol. 22, 286-297[Abstract/Free Full Text]
5. Denisenko, O. N., and Bomsztyk, K. (1997) Mol. Cell. Biol. 17, 4707-4717[Abstract]
6. Michelotti, E. F., Michelotti, G. A., Aronsohn, A. I., and Levens, D. (1996) Mol. Cell. Biol. 16, 2350-2360[Abstract]
7. Miau, L. H., Chang, C. J., Shen, B. J., Tsai, S. C., and Lee, S. C. (1998) J. Biol. Chem. 273, 10784-10791[Abstract/Free Full Text]
8. Du, Q., Melnikova, I. N., and Gardner, P. D. (1998) J. Biol. Chem. 273, 19877-19883[Abstract/Free Full Text]
9. Shnyreva, M., Schullery, D. S., Suzuki, H., Higaki, Y., and Bomsztyk, K. (2000) J. Biol. Chem. 275, 15498-15503[Abstract/Free Full Text]
10. Ostareck, D., Ostareck-Lederer, A., Shatsky, I., and Hentze, M. (2001) Cell 104, 281-290[CrossRef][Medline] [Order article via Infotrieve]
11. Charroux, B., Angelats, C., Fasano, L., Kerridge, S., and Vola, C. (1999) Mol. Cell. Biol. 19, 7846-7856[Abstract/Free Full Text]
12. Mandal, M., Vadlamudi, R., Nguyen, D., Wang, R., Costa, L., Bagheri-Yarmand, R., Mendelsohn, J., and Kumar, R. (2001) J. Biol. Chem. 276, 9699-9704[Abstract/Free Full Text]
13. Thiede, B., Dimmler, C., Siejak, F., and Rudel, T. (2001) J. Biol. Chem. 276, 26044-26050[Abstract/Free Full Text]
14. Hsieh, T. Y., Matsumoto, M., Chou, H. C., Schneider, R., Hwang, S. B., Lee, A. S., and Lai, M. M. C. (1998) J. Biol. Chem. 273, 17651-17659[Abstract/Free Full Text]
15. Wadd, S., Bryant, H., Filhol, O., Scott, J. E., Hsieh, T. Y., Everett, R. D., and Clements, J. B. (1999) J. Biol. Chem. 274, 28991-28998[Abstract/Free Full Text]
16. Collier, B., Goobar-Larsson, L., Sokolowski, M., and Schwartz, S. (1998) J. Biol. Chem. 273, 22648-22656[Abstract/Free Full Text]
17. Ostrowski, J., Kawata, Y., Schullery, D., Denisenko, O. N., Higaki, Y., Abrass, C. K., and Bomsztyk, K. (2001) Proc. Natl. Acad. Sci. U. S. A. 98, 9044-9049[Abstract/Free Full Text]
18. Ostrowski, J., Van Seuningen, I., Seger, R., Rouch, C. T., Sleath, P. R., McMullen, B. A., and Bomsztyk, K. (1994) J. Biol. Chem. 269, 17626-17634[Abstract/Free Full Text]
19. Ito, K., Sato, K., and Endo, H. (1994) Nucleic Acids Res. 22, 53-58[Abstract/Free Full Text]
20. Bomsztyk, K., Van Seuningen, I., Suzuki, H., Denisenko, O., and Ostrowski, J. (1997) FEBS Lett. 403, 113-115[CrossRef][Medline] [Order article via Infotrieve]
21. Habelhah, H., Shah, K., Huang, L., Ostareck-Lederer, A., Burlingame, A., Shokat, K., Hentz, M., and Ronai, Z. (2001) Nat. Cell Biol. 3, 325-330[CrossRef][Medline] [Order article via Infotrieve]
22. Habelhah, H., Shah, K., Huang, L., Burlingame, A., Shokat, K., and Ronai, Z. (2001) J. Biol. Chem. 276, 18090-18095[Abstract/Free Full Text]
23. Chen, C. Y., Gherzi, R., Andersen, J. S., Gaietta, G., Jurchott, K., Royer, H. D., Mann, M., and Karin, M. (2000) Genes Dev. 14, 1236-1248[Abstract/Free Full Text]
24. Vernet, C., and Artzt, K. (1997) Trends Genet. 13, 479-484[CrossRef][Medline] [Order article via Infotrieve]
25. Sengupta, D. J., Wickens, M., and Fields, S. (1999) RNA 5, 596-601[Abstract]
26. Gietz, D., St., Jean, A., Woods, R. A., and Schiestl, R. H. (1992) Nucleic Acids Res. 20, 1425[Free Full Text]
27. Zuker, M., Mathews, D. H., and Turner, D. H. (1999) in RNA Biochemistry and Biotechnology (Barciszewski, J. , and Clark, B. F. C., eds) , pp. 11-43, NATO ASI Series, Kluwer Academic Publishers, Dordrecht, NL
28. Thompson, J. D., Higgins, D. G., and Gibson, T. J. (1994) Nucleic Acids Res. 22, 4673-4680[Abstract/Free Full Text]
29. Kang, D., Nishida, J., Iyama, A., Nakabeppu, Y., Furuichi, M., Fujiwara, T., Sekiguchi, M., and Takeshige, K. (1995) J. Biol. Chem. 270, 14659-14665[Abstract/Free Full Text]
30. Sengupta, D. J., Zhang, B., Kraemer, B., Pochart, P., Fields, S., and Wickens, M. (1996) Proc. Natl. Acad. Sci. U. S. A. 93, 8496-8501[Abstract/Free Full Text]
31. Mathews, D. H., Sabina, J., Zuker, M., and Turner, D. H. (1999) J. Mol. Biol. 288, 911-940[CrossRef][Medline] [Order article via Infotrieve]
32. Van Seuningen, I., Ostrowski, J., and Bomsztyk, K. (1995) Biochemistry 34, 5644-5650[CrossRef][Medline] [Order article via Infotrieve]
33. Ostareck, D. H., Ostareck-Lederer, A., Wilm, M., Thiele, B. J., Mann, M., and Hentze, M. W. (1997) Cell 89, 597-606[CrossRef][Medline] [Order article via Infotrieve]
34. Taanman, J. W. (1999) Biochim. Biophys. Acta 1410, 103-123[Medline] [Order article via Infotrieve]
35. Rassow, J., and Pfanner, N. (2000) Traffic 1, 457-464[CrossRef][Medline] [Order article via Infotrieve]
36. Garesse, R., and Vallejo, C. G. (2001) Gene (Amst.) 263, 1-16[CrossRef][Medline] [Order article via Infotrieve]
37. Burnette, B., and Batra, P. P. (1985) Anal. Biochem. 145, 80-86[CrossRef][Medline] [Order article via Infotrieve]
38. Cuezva, J. M., Ostronoff, L. K., Ricart, J., Lopez de Heredia, M., Di, Liegro, C. M., and Izquierdo, J. M. (1997) J. Bioenerg. Biomembr. 29, 365-377[CrossRef][Medline] [Order article via Infotrieve]
39. Siomi, H., Matunis, M. J., Michael, W. M., and Dreyfuss, G. (1993) Nucleic Acids Res. 21, 1193-1198[Abstract/Free Full Text]
40. Siomi, H., Choi, M., Siomi, M. C., Nussbaum, R. L., and Dreyfuss, G. (1994) Cell 77, 33-39[CrossRef][Medline] [Order article via Infotrieve]
41. Thisted, T., Lyakhov, D. L., and Liebhaber, S. A. (2001) J. Biol. Chem. 276, 17484-17496[Abstract/Free Full Text]
42. Van Seuningen, I., Ostrowski, J., Bustelo, X., Sleath, P., and Bomsztyk, K. (1995) J. Biol. Chem. 270, 26976-26985[Abstract/Free Full Text]
43. Pfanner, N., and Geissler, A. (2001) Nat. Rev. Mol. Cell. Biol. 2, 339-349[CrossRef][Medline] [Order article via Infotrieve]
44. Roise, D., Theiler, F., Horvath, S. J., Tomich, J. M., Richards, J. H., Allison, D. S., and Schatz, G. (1988) EMBO J. 7, 649-653[Medline] [Order article via Infotrieve]
45. Brix, J., Rudiger, S., Bukau, B., Schneider-Mergener, J., and Pfanner, N. (1999) J. Biol. Chem. 274, 16522-16530[Abstract/Free Full Text]
46. Emanuelsson, O., Nielsen, H., Brunak, S., and von Heijne, G. (2000) J. Mol. Biol. 300, 1005-1016[CrossRef][Medline] [Order article via Infotrieve]
47. Hell, K., Neupert, W., and Stuart, R. A. (2001) EMBO J. 20, 1281-1288[CrossRef][Medline] [Order article via Infotrieve]
48. Huang, X., Eriksson, K. F., Vaag, A., Lehtovirta, M., Hansson, M., Laurila, E., Kanninen, T., Olesen, B. T., Kurucz, I., Koranyi, L., and Groop, L. (1999) Diabetes 48, 1508-1514[Abstract]
49. Zamzami, N., and Kroemer, G. (2001) Nat. Rev. Mol. Cell. Biol. 2, 67-71[CrossRef][Medline] [Order article via Infotrieve]
50. Majumder, P. K., Pandey, P., Sun, X., Cheng, K., Datta, R., Saxena, S., Kharbanda, S., and Kufe, D. (2000) J. Biol. Chem. 275, 21793-21796[Abstract/Free Full Text]

Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
M. Yano, H. J. Okano, and H. Okano
Involvement of Hu and Heterogeneous Nuclear Ribonucleoprotein K in Neuronal Differentiation through p21 mRNA Post-transcriptional Regulation
J. Biol. Chem., April 1, 2005; 280(13): 12690 - 12699.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. ProteomicsHome page
K. Rezaul, L. Wu, V. Mayya, S.-I. Hwang, and D. Han
A Systematic Characterization of Mitochondrial Proteome from Human T Leukemia Cells
Mol. Cell. Proteomics, February 1, 2005; 4(2): 169 - 181.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
J. Ostrowski, K. Klimek-Tomczak, L. S. Wyrwicz, M. Mikula, D. S. Schullery, and K. Bomsztyk
Heterogeneous Nuclear Ribonucleoprotein K Enhances Insulin-induced Expression of Mitochondrial UCP2 Protein
J. Biol. Chem., December 24, 2004; 279(52): 54599 - 54609.
[Abstract] [Full Text] [PDF]

Home page
 Circ. Res.Home page
B.-J. Thiele, A. Doller, T. Kahne, R. Pregla, R. Hetzer, and V. Regitz-Zagrosek
RNA-Binding Proteins Heterogeneous Nuclear Ribonucleoprotein A1, E1, and K Are Involved in Post-Transcriptional Control of Collagen I and III Synthesis
Circ. Res., November 26, 2004; 95(11): 1058 - 1066.
[Abstract] [Full Text] [PDF]

Home page
 Mol. Cell. Biol.Home page
S. Mili and S. Pinol-Roma
LRP130, a Pentatricopeptide Motif Protein with a Noncanonical RNA-Binding Domain, Is Bound In Vivo to Mitochondrial and Nuclear RNAs
Mol. Cell. Biol., July 15, 2003; 23(14): 4972 - 4982.
[Abstract] [Full Text] [PDF]