HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

J. Biol. Chem., Vol. 277, Issue 8, 6422-6427, February 22, 2002

This Article Abstract Full Text (PDF) All Versions of this Article: 277/8/6422    most recent M110612200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ton, V.-K. Articles by Rao, R. Search for Related Content PubMed PubMed Citation Articles by Ton, V.-K. Articles by Rao, R. Social Bookmarking                      What's this?

Functional Expression in Yeast of the Human Secretory Pathway Ca²⁺, Mn²⁺-ATPase Defective in Hailey-Hailey Disease^*

Van-Khue Ton, Debjani Mandal, Cordelia Vahadji, and Rajini Rao^§

From the Department of Physiology, Johns Hopkins University School of Medicine, Baltimore, Maryland 21205

Received for publication, November 5, 2001, and in revised form, November 29, 2001

	ABSTRACT

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The discovery and biochemical characterization of the secretory pathway Ca²⁺-ATPase, PMR1, in Saccharomyces cerevisiae, has paved the way for identification of PMR1 homologues in many species including rat, Caenorhabditis elegans, and Homo sapiens. In yeast, PMR1 has been shown to function as a high affinity Ca²⁺/Mn²⁺ pump and has been localized to the Golgi compartment where it is important for protein sorting, processing, and glycosylation. However, little is known about PMR1 homologues in higher organisms. Loss of one functional allele of the human gene, hSPCA1, has been linked to Hailey-Hailey disease, characterized by skin ulceration and improper keratinocyte adhesion. We demonstrate that expression of hSPCA1 in yeast fully complements pmr1 phenotypes of hypersensitivity to Ca²⁺ chelators and Mn²⁺ toxicity. Similar to PMR1, epitope-tagged hSPCA1 also resides in the Golgi when expressed in yeast or in chinese hamster ovary cells. ⁴⁵Ca²⁺ transport by hSPCA1 into isolated yeast Golgi vesicles shows an apparent Ca²⁺ affinity of 0.26 µM, is inhibitable by Mn²⁺, but is thapsigargin-insensitive. In contrast, heterologous expression of vertebrate sarcoplasmic reticulum and plasma membrane Ca²⁺-ATPases in yeast complement the Ca²⁺- but not Mn²⁺-related phenotypes of the pmr1-null strain, suggesting that high affinity Mn²⁺ transport is a unique feature of the secretory pathway Ca²⁺-ATPases.

	INTRODUCTION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

The best known members of the P-type Ca²⁺-ATPases are those on the plasma membrane (PMCA)¹ and the sarco/endoplasmic reticulum (SERCA). Their functions and structures have been extensively investigated and characterized over the past several decades. The PMCA is known to extrude Ca²⁺ from the cytosol, whereas the SERCA sequesters Ca²⁺ into the endoplasmic reticulum (reviewed in Refs. 1 and 2). In recent years, a new class of Ca²⁺-ATPases has emerged, the first member of which was found in the yeast Saccharomyces cerevisiae and named PMR1 (for plasma membrane ATPase-related, Ref. 3). PMR1 was localized to the medial-Golgi compartment, a hitherto unusual distribution for a Ca²⁺ pump, where it was found to be important for functioning of the secretory pathway (4-6). These studies showed that cells lacking functional PMR1 exhibit defects in protein glycosylation, processing, sorting, and endoplasmic reticulum-associated protein degradation. In the absence of a SERCA-type Ca²⁺-ATPase in yeast, PMR1 is the major pump that contributes to the steady-state free Ca²⁺ concentration (10 µM) in the endoplasmic reticulum; this level of Ca²⁺ decreases by 50% in pmr1-null mutants (7). Additionally, cytoplasmic Ca²⁺ levels increase up to 16-fold in the pmr1 mutant (8, 9), despite a compensatory increase in the expression of the vacuolar PMC1 Ca²⁺ pump (9, 10). It is now clear that PMR1 couples ATP hydrolysis to Ca²⁺ transport with an apparent K_m of 70 nM (11, 12).

Intriguingly, PMR1 can also transport Mn²⁺. The first evidence for a role for PMR1 in Mn²⁺ transport came from the observation that pmr1 mutants bypass the need for Cu²⁺ superoxide dismutase (SOD1). In a pmr1sod1 double mutant, Mn²⁺ accumulates in the cytosol at levels 4-5-fold higher than normal and can scavenge harmful free radicals (13). As a trace element, Mn²⁺ is an essential cofactor for enzymes in the cytoplasm (14), mitochondria (15), and Golgi (6). In addition, Mn²⁺ can serve as a surrogate for Ca²⁺; thus, in S. cerevisiae, a small amount of Mn²⁺ (130 pM) can replace Ca²⁺ (66 nM) to support cell growth (16). On the other hand, high concentrations of cytoplasmic Mn²⁺ are toxic and can interfere with Mg²⁺ binding sites on proteins. It is well known that high Mn²⁺ concentration can compromise the fidelity of DNA polymerases (17). More recently, defective Ty1 retrotransposition in a pmr1 mutant was shown to be due to Mn²⁺ inhibition of reverse transcriptase.² PMR1 appears to be the principal route for Mn²⁺ detoxification, via the secretory pathway. Maintaining an appropriate level of Mn²⁺ in the Golgi/ER lumen is also equally critical: Mn²⁺ depletion in the pmr1 mutant leads to defective N-linked and O-linked protein glycosylation. Taken together, these studies illustrate the importance of PMR1 in cytosolic and luminal Mn²⁺ homeostasis.

Research on PMR1 has pioneered the identification of other members of the secretory pathway Ca²⁺-ATPases. PMR1 shares significant sequence homology with orthologues cloned from diverse organisms including other yeast (18), Caenorhabditis elegans (19), and vertebrates, including rat (20), cow (21), and human (22, 23). Recently, heterologous expression of the C. elegans PMR1 homologue, ZK256.1, in cultured COS cells has been reported (19) where it was shown to mediate Ca²⁺ and Mn²⁺ transport.

In humans, there exist two PMR1 homologues (gene names ATP2C1 and ATP2C2, protein names abbreviated hSPCA1 and hSPCA2, respectively, in this study). While the tissue distribution of hSPCA2 is not yet known, hSPCA1 is widespread in many tissues including keratinocytes, skeletal muscle, kidney, and mammary gland (21, 22). hSPCA1 shares 49% amino acid sequence identity to yeast PMR1, with nearly complete conservation in the transmembrane domains known to be important for transport. Nonsense and missense mutations inactivating one allele of hSPCA1 are found in patients with Hailey-Hailey disease (MIM 16960), whose symptoms involve a loss of ketatinocyte cohesion (22, 23). This defect is reminiscent of improper protein glycosylation, sorting, and cell wall morphogenesis in pmr1-null mutants (4, 24, 25).

In this study, we present direct biochemical evidence that hSPCA1 is a bona fide member of the secretory pathway Ca²⁺-ATPases. Expressed in yeast and cultured chinese hamster ovary cells, hSPCA1 localizes exclusively to the Golgi. It complements the pmr1-null mutation and transports Ca²⁺ and Mn²⁺ with a high affinity similar to PMR1.

	EXPERIMENTAL PROCEDURES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

Media, Strains, and Plasmids-- Yeast strains were grown in yeast nitrogen base (6.7 g/liter; Difco) supplemented with 2% glucose and necessary amino acids. We used the strain K616 (pmr1pmc1cnb1), in which both PMR1 and PMC1, encoding endogenous yeast Ca²⁺- ATPases, have been disrupted (11, 26). Wild type PMR1 was reintroduced into this strain as a His-tagged protein expressed from the 2 µ plasmid YEpHis-PMR1, which has been described elsewhere (27). A similar cloning strategy was employed to insert cDNA of human SPCA1 (KIAA1347; Kazusa Research Institute, Japan) into the expression plasmid pSM1052 (gift of Susan Michaelis, Johns Hopkins School of Medicine). Briefly, a 2.7-kb hSPCA1 PCR product was amplified from a SalI and NotI insert of KIAA1347 in the plasmid pBluescript II SK⁺ using an MluI-containing sense primer (CATCACCATACGCGTATTCCTGTATTGACATCAA; MluI site underlined) and a SacI-containing antisense primer (GGCGAATTGGAGCTCTCATACTTCAAGAAAAGATGAT; SacI site underlined). The hSPCA1 PCR product was cloned into pSM1052 at MluI and SacI sites, resulting in the introduction of a 9× His tag at the extreme N terminus of the protein. To generate the N-terminal GFP-tagged hSPCA1 protein, we introduced EcoRI and SacII into the hSPCA1 cDNA by a PCR amplification with a sense primer (EcoRI site underlined; CGGCCGGAATTCATGATTCCTGTATTGACA), and an antisense primer (SacII site underlined: CCGGGCCCGCGGTACTTCAAGAAAAGATGATGA). The resulting PCR product was ligated into vector pEGFP-N1 (CLONTECH) at EcoRI and SacII.

cDNA of the human PMCA4b (GenBank^TM accession number AH001521; gift of Adelaida Filoteo and John Penniston, Mayo Clinic, Rochester, MN) was used as a template for PCR with the following sense and antisense primers respectively, GCGCGCACGCGTGGTGATATGACCAACAGC (MluI is underlined), and GCGCGCGCGGCCGCCTAAAGCGACGTCTCCAG (NotI is underlined). The product was cloned into pSM1052 at MluI and NotI sites, resulting in the introduction of the His tag at the extreme N terminus. Plasmid br434 (CEN PMA1::SERCA1A::ADC1) expressing rabbit SERCA1 was a generous gift of Dr. Hans Rudolph (University of Stuttgart, Germany) and has been previously described (6).

Phenotype Screens-- Growth of K616 yeast cells transformed with plasmids expressing (His)₉-PMR1, (His)₉-hSPCA1, GFP-hSPCA1, rbSERCA1, or (His)₉-hPMCA4b, was monitored in media supplemented with increasing concentrations of BAPTA and MnCl₂ as in Wei et al. (27), with some alterations. BAPTA-supplemented medium was buffered with MES/KOH (final concentration 100 mM) at pH 6.0. 200 µl of growth medium was inoculated with 0.009 A₆₀₀ units of cells in a 96-well plate and incubated at room temperature for 2-3 days. The cultures were then mixed by gentle vortexing, and growth was measured by determining the absorbance at 600 nm in a SPECTRAmax 340 microplate reader (Molecular Devices). Relative growth was expressed as a fraction of A₆₀₀ of the control culture (no BAPTA or Mn²⁺).

Membrane Preparation, Gel Electrophoresis, and Antibodies-- Sucrose gradient fractionation of yeast cell lysates and total membrane preparation were as described earlier (11), but without the 2-h heat shock. We determined protein concentration with a modified Lowry method (28) after precipitating the protein samples in 10% cold trichloroacetic acid; bovine serum albumin was used as standard (Sigma). Samples were subjected to SDS-PAGE and Western blotting as described (11). His-tagged PMR1, hSPCA1, and hPMCA4b were detected on a Western blot by anti-His₆ antibody (1:5000 dilution; CLONTECH), and anti-rabbit SERCA1 antibody (1:10,000 dilution; Affinity Bioreagent) was used to detect rabbit SERCA1. Horseradish peroxidase-coupled anti-mouse secondary antibody (Amersham Biosciences, Inc.) was used in conjunction with ECL reagents (Amersham Biosciences, Inc.) to visualize protein bands.

Cell Culture, Transfection, and Confocal Microscopy-- Chinese hamster ovary cells were cultured in Ham's F12 medium (Mediatech; Herndon, VA) containing 10% fetal bovine serum (Invitrogen). Cells were grown on 8 chamber glass slides and transiently transfected with either pEGFP-hSPCA1 using LipofectAmine 2000 (Invitrogen) according to the manufacturer's instructions and grown to 70-80% confluency.

For microscopy, GFP-tagged hSPCA1 was visualized in live yeast cells and in transiently transfected CHO cells. Prior to staining with anti-mannosidase antibody, CHO cells were fixed in 2% paraformaldehyde in PBS for 30 min, rinsed with PBS 3 times to remove residual fixative and then permeablized with 0.5% Triton X-100 in PBS for 15 min. Fixation, permeablization and all subsequent incubations were at room temperature. Cells were rinsed with PBS three times prior to incubation with 0.1% bovine serum albumin in PBS for 1 h. Next, the permeablized cells were incubated for 1 h with the primary antibody diluted in PBS containing 0.1% bovine serum albumin at a dilution of 1:1000. The cells were then washed with PBS three times over 30 min and then incubated for 1 h with AlexaFluor 568-labeled goat anti-rabbit antibodies diluted 1:500 in PBS containing 0.1% bovine serum albumin. Finally, cells were again washed with PBS three times over 30 min and then mounted with Prolong antifade mounting medium (Molecular Probes Inc., Eugene, OR). Rabbit anti-mannosidase II antibody was purchased from Dr. Kelley Moremen (University of Georgia; Athens, GA).

⁴⁵Ca²⁺ Transport Assays-- The transport assay was done as described (11), with modifications. Transport buffer contained 10 mM Hepes/NaOH, pH 6.7, 0.15 M KCl, 5 mM MgCl₂, 0.5 mM ATP, 5 mM NaN₃, 500 nM concanamycin A (Sigma), and 10 µM CCCP (Sigma); ⁴⁵CaCl₂ (22 Ci/g; ICN) was added to 1.7 µCi/ml. In ⁴⁵Ca²⁺ titration assay, the buffer contained 20 µM CCCP, as well as 15 µM CaCl₂ and ⁴⁵CaCl₂; EGTA was added in different amounts to titrate free Ca²⁺ concentrations as in Wei et al. (29). H₂O used in the buffer was treated with Chelex resin (Sigma) to prevent Ca²⁺ contamination. For other assays, Mn²⁺ or thapsigargin were added to the transport buffer, and the extent of ⁴⁵Ca²⁺ accumulation in vesicles was measured by liquid scintillation.

	RESULTS

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

hSPCA1 Complements the Phenotype of a Yeast Null Mutant Lacking Known Ca²⁺ Pumps-- Phenotype complementation is the first step in establishing that the hitherto uncharacterized human cDNA KIAA1347, defective in Hailey-Hailey disease, is a functional homologue of PMR1. A characteristic phenotype of pmr1-null mutants is their dependence on external Ca²⁺ or Mn²⁺ for growth (3). Thus, growth of the host strain K616 (pmr1pmc1cnb1) is hypersensitive to divalent cation chelators such as BAPTA or EGTA. Because standard yeast minimal media contain ~100-fold more Ca²⁺ than Mn²⁺, and the latter is efficiently removed at low chelator concentrations, the observed growth inhibition by BAPTA correlates with Ca²⁺ starvation. Heterologous expression of a high affinity Ca²⁺ pump allows Ca²⁺ to be efficiently scavenged for delivery into the secretory pathway where it is required for protein sorting and modification. Fig. 1 shows that like PMR1, expression of epitope-tagged hSPCA1 can effectively restore BAPTA tolerance to the yeast mutant lacking endogenous Ca²⁺ pumps. Similarly, Mn²⁺ toxicity in K616 is indicative of loss of Mn²⁺ transport. A critical route for Mn²⁺ detoxification is delivery into the secretory pathway via PMR1, and subsequent exit from the cell. Fig. 1 also shows that the hypersensitivity of the pmr1-null mutant to Mn²⁺ toxicity can be rescued by introduction of hSPCA1. Strikingly, hSPCA1 confers significantly higher levels of tolerance to Mn²⁺ when compared with PMR1, while BAPTA tolerance typically remained lower. In previous studies we have established that differential sensitivity to BAPTA and Mn²⁺ in PMR1 mutants correlates with altered ion selectivity. The data in Fig. 1 are consistent with the possibility that hSPCA1 is more selective for Mn²⁺ transport, relative to PMR1.

View larger version (17K): [in this window] [in a new window]   Fig. 1.   hSPCA1 complements pmr1. Yeast strain K616, carrying the pmr1 mutation, was transformed with plasmid expressing epitope-tagged PMR1 or hSPCA1 and grown in medium supplemented with BAPTA (buffered with 100 mM MES/KOH at pH 6.0), or MnCl2 at the indicated concentrations. Growth (A600) was measured after 48 h at 25 °C and is plotted as percentage of growth in control cultures, unsupplemented with BAPTA or Mn2+. Data are averaged from duplicates, which varied by less than 10%. Similar results were obtained with His-tagged hSPCA1.

hSPCA1 Localizes to the Golgi in Yeast and in Cultured Mammalian Cells-- Yeast strains expressing (His)₉-tagged hSPCA1 were grown in 500 ml cultures, lysed gently, and fractionated on a 10-step sucrose gradient. Using an array of organellar markers, we have previously showed that (His)₉-Pmr1 localizes discretely to Golgi fractions, which are separate from endoplasmic reticulum, plasma membrane, and vacuoles (11, 29). Fig. 2A shows that histidine-tagged hSPCA1 localizes to the same fractions as histidine-tagged PMR1, as indicated by the appearance of ATP-driven ⁴⁵Ca transport activity in fractions corresponding to the Golgi (26 to 30-34% sucrose). The equivalent fractions derived from the vector-transformed host strain were virtually devoid of Ca²⁺ pumping activity. Western analysis of the fractions confirms that hSPCA1 has a distribution similar to that of PMR1 (Fig. 2B).

View larger version (58K): [in this window] [in a new window]   Fig. 2.   Subcellular fractionation of yeast strains expressing Ca2+-ATPases. A, Ca2+ transport activity. K616 yeast expressing His-tagged PMR1, hSPCA1, hPMCA4, or untagged rbSERCA1, respectively, were lysed and fractionated on a 10-step sucrose gradient (18-54% w/w, represented by the numbers 18-54; L, load). All transformed strains exhibited 45Ca transport activity that was clearly distinguishable from the host strain. 45Ca2+ transport corresponding to the activity of PMR1 and hSPCA1 peaks at 26-34% sucrose, which contain Golgi membranes (11). In contrast, 45Ca2+ transport activity of hPMCA4 and rbSERCA1 peaks between 38 and 54% sucrose, which contain ER and plasma membranes. B, Western blot. 100 µg of each sucrose gradient fraction from the experiment shown in panel A was separated by SDS-PAGE, transferred to nitrocellulose membranes, and probed with monoclonal anti-His6 antibody, or, in the case of rbSERCA1, with anti-rbSERCA1 antibody. Fractions showing immunoreactive bands can be seen to correspond with 45Ca transport activity shown in Panel A.

To determine whether Golgi localization was specific to the secretory pathway Ca²⁺-ATPases, we examined the distribution of representative members of the SERCA and PMCA subtypes expressed in yeast. Fig. 2 also shows ⁴⁵Ca transport activity and Western analysis of fractions derived from K616 yeast transformed with plasmid expressing (His)₉-human PMCA4b and untagged rabbit SERCA1. These two Ca²⁺- ATPases are distributed in the denser half of the sucrose gradient, which has previously been shown to contain both endoplasmic reticulum and plasma membrane fractions (11). Clearly, the Golgi localization and ⁴⁵Ca²⁺ transport activity of hSPCA1 expressed in yeast mirrors that of PMR1, and not those of the PMCA or SERCA pumps.

Live yeast cells transformed with GFP-tagged hSPCA1 were examined by confocal microscopy. Fig. 3 shows that GFP fluorescence resides in scattered, punctate structures characteristic of the appearance of Golgi bodies in yeast, and similar to the previously reported distribution of PMR1 (4). Fig. 4A is a confocal image of a field of live chinese ovary cells transiently transfected with GFP-hSPCA1. The majority of fluorescence has a juxtanuclear distribution, similar to the recently reported distribution of the C. elegans PMR1 homologue expressed in COS cells (30). To verify the identity of this compartment, the cells were stained with antibody to the Golgi resident protein, mannosidase II. Fig. 4B shows that GFP fluorescence is essentially superimposable with the signal from mannosidase II, confirming the Golgi localization. These microscopy data, together with subcellular fractionation of yeast membranes, establish that hSPCA1 is a resident Golgi protein, and provide further evidence for classification as a member of the secretory pathway Ca²⁺-ATPases.

View larger version (130K): [in this window] [in a new window]   Fig. 3.   Fluorescence microscopy of GFP-tagged hSPCA1 in live yeast cells. Yeast strain K616, transformed with plasmid expressing GFP-tagged hSPCA1, was examined by confocal microscopy as described under "Experimental Procedures." Panels A and B are phase-contrast images (DIC) of live cells and Panels C and D show GFP fluorescence. GFP-hSPCA1 appears as punctate vesicular structures scattered in the cytosol.

View larger version (49K): [in this window] [in a new window]   Fig. 4.   Fluorescence microscopy of GFP-tagged hSPCA1 in CHO cells. Panel A is a field of live CHO cells, transiently transfected with GFP-tagged hSPCA1, showing GFP fluorescence with a juxtanuclear concentration characteristic of Golgi. In Panels B-D, cells were fixed, permeabilized, and treated with antibody against mannosidase II, a resident Golgi marker. GFP fluorescence (Panel B) is superimposable with indirect immunofluorescence from mannosidase II (Panel C), as seen in the merged image (Panel D).

hSPCA1 Transports Ca²⁺ and Mn²⁺-- Vesicles pooled from Golgi-enriched fractions of cells expressing His-hSPCA1 were assayed for ⁴⁵Ca²⁺ transport activity under conditions that inhibit H⁺/Ca²⁺ exchange (see "Experimental Procedures"). ⁴⁵Ca²⁺ transport displayed simple Michaelis-Menten kinetics and was dependent on free Ca²⁺ with an estimated K_m of 260 nM (Fig. 5A). The data are consistent with a single high affinity site for Ca²⁺, similar to a recently reported value of 250 nM for the PMR1 homologue from C. elegans (19). In earlier studies of ⁴⁵Ca transport and Ca²⁺-dependent ATPase activity, we have observed a K_m of 70 nM for S. cerevisiae PMR1 (11, 29).

View larger version (16K): [in this window] [in a new window]   Fig. 5.   Ion transport activity of hSPCA1. A, 45Ca2+ transport. Golgi membranes were pooled from sucrose density gradients of yeast cells expressing His-tagged hSPCA1 and ATP-driven 45Ca2+ transport measured as described under "Experimental Procedures." 45Ca2+ (15 µM) was buffered by EGTA and free concentrations calculated according to the MaxChelator software. The data points are averages of duplicate measurements and represent one of two closely similar independent experiments. The line is a best fit to the Michaelis-Menten equation, with an apparent Km for Ca2+ of 260 nM, and an R2 value of 0.994. B, Mn2+ inhibition. 45Ca2+ transport activity of hSPCA1 was measured as described in A, except that the total free 45Ca2+ concentration was 2 µM, and MnCl2 was added at the concentrations shown. Data for hSPCA1 were fit to a K0.5 of 340 µM. The inset shows inhibition at 0.9 µM 45Ca2+ in the presence of 2 mM of MnCl2. Peak sucrose density gradient fractions derived from yeast expressing each of the various Ca2+-ATPases indicated were assayed.

The ability of hSPCA1 to bind Mn²⁺ was assessed indirectly by inhibition of ⁴⁵Ca²⁺ transport, as shown in Fig. 5B. Mn²⁺ inhibition of ⁴⁵Ca²⁺ accumulation in vesicles decreased with increasing Ca²⁺ concentration, suggesting that the two ions compete for the same sites (not shown). Mn²⁺ inhibition of Ca²⁺ transport activity was significantly greater for the secretory pathway pumps (75-90%) than for human PMCA4 and rabbit SERCA1 (~30%; Fig. 5B, inset).

Thapsigargin, a potent inhibitor of the SERCA pumps, was ineffective in inhibiting Ca²⁺ transport activity of hSPCA1, at concentrations up to 5 µM (not shown). This insensitivity is also exhibited by yeast PMR1 (11) and its C. elegans homologue, ZK256.1 (30).

High Affinity Mn²⁺ Transport May be a Unique Property of the Secretory Pathway Ca²⁺ ATPases-- To date, there is little evidence that the other P-type Ca²⁺-ATPases, PMCA and SERCA, can transport Mn²⁺ as effectively as Ca²⁺. In 1980, Chiesi and Inesi (31) reported a slow accumulation of ⁵⁴Mn²⁺ in sarcoplasmic reticulum-derived vesicles from rabbit skeletal muscle when Ca²⁺ was absent. In contrast, numerous independent experimental observations have indicated that the secretory pathway homologues of PMR1 from yeast and C. elegans can transport Mn²⁺ with high affinity (12, 19, 27, 29). Here, we evaluate Mn²⁺ sequestering activity in vivo by comparing phenotypes of yeast strains transformed with plasmids encoding rbSERCA1, hPMCA4 and hSPCA1, respectively. Heterologous expression of all Ca²⁺-ATPases in the pmr1-null mutant restores BAPTA tolerance to levels similar to endogenous yeast PMR1, indicating that all of these pumps share the ability to transport Ca²⁺ (Fig. 6A). In contrast, only the secretory pathway Ca²⁺-ATPases, hSPCA1 and PMR1, confer tolerance to high levels of extracellular Mn²⁺ (Fig. 6B). The inability of SERCA and PMCA to confer Mn²⁺ tolerance, taken together with significantly weaker Mn²⁺ inhibition of ⁴⁵Ca transport (Fig. 5B, inset) suggests a lack of high affinity Mn²⁺ transport activity in these pumps. At this time, however, we cannot exclude the possibility that Golgi localization is somehow critical for effective in vivo Mn²⁺ sequestration. Additional evaluation of Mn²⁺-dependent ATPase activity and phosphoenzyme formation may clarify this issue in the future.

View larger version (16K): [in this window] [in a new window]   Fig. 6.   Differential tolerance to BAPTA and Mn2+ in cells expressing hSPCA1, PMR1, hPMCA4, and rbSERCA1. A, all Ca2+-ATPases confer BAPTA tolerance. Yeast strains K616 expressing each of the Ca2+-ATPases shown, were grown in 1 ml of minimal media buffered with 100 mM MES/KOH, pH 6.0, and supplemented with a range of BAPTA concentrations shown. Growth (A600) was monitored after saturation and is displayed as a percentage of A600 of the control culture (no BAPTA). B, only the SPCAs confer Mn2+ tolerance. Cells were grown as in A, except that the MES buffer was omitted and MnCl2 was added in place of BAPTA. Only PMR1 and hSPCA1 confer Mn2+ tolerance, whereas hPMCA4- and rbSERCA1-expressing cells exhibit a hypersensitivity to Mn2+ similar to the pmr1-null mutant, Lys-616.

In summary, our current data are consistent with the intriguing possibility that the secretory pathway Ca²⁺-ATPases have evolved to function as major high affinity Mn²⁺ pumps in the Golgi.

	DISCUSSION

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

In this study we have provided biochemical evidence for the subcellular localization and ion transport properties of an uncharacterized human cDNA KIAA1347, which we have termed the secretory pathway Ca²⁺-ATPase (SPCA1), in accordance with an earlier proposal by Shull (32). This nomenclature is consistent with the other two well known subtypes of Ca²⁺ pumps, SERCA and PMCA, and serves to distinguish members of a novel and rapidly expanding subtype. We show here that hSPCA1 localizes to the Golgi and mediates the high affinity, thapsigargin-insensitive transport of Ca²⁺ and Mn²⁺ into the secretory pathway, resulting in full complementation of pmr1-null phenotypes. Phylogenetic analysis of amino acid sequence alignments of representative Ca²⁺-ATPases from diverse species, depicted in Fig. 7, reveal three distinct clusters of SPCA, SERCA, and PMCA, consistent with non-overlapping organellar distributions and cellular functions.

View larger version (22K): [in this window] [in a new window]   Fig. 7.   Phylogenetic analysis of Ca2+-ATPase sequences show clustering of SPCA, SERCA and PMCA subtypes. A selection of Ca2+-ATPase sequences, representing diverse phyla, was aligned using ClustalW 1.5. Phylogenetic analysis was performed using PHYLIP 3.5c and graphic display was done with the DrawTree program. Sequences fall into three distinct clusters representing Ca2+-ATPases of the Golgi/secretory pathway, endoplasmic reticulum, and plasma membrane. PID accession numbers, beginning with S. cerevisiae PMR1, are given in clockwise order as follows: 6321271, 3138890, 6688835, 285369, 12644373, 3327220, 7296577, 3875247, 3878521, 7291680, 3211977, 6967017, 114305, 4185855, 6688833, 14286104, 5714364, 111433, 1083756, 7304318, 3549723.

Haploinsufficiency of hSPCA1, resulting from missense and nonsense mutations in the ATP2C1 gene, was recently identified in patients with Hailey-Hailey disease (22). In that study, keratinocytes from HHD patients were shown to have higher levels of resting Ca²⁺, and were defective in removal of excess cytosolic Ca²⁺ despite having intact thapsigargin-sensitive SERCA activity. More recent studies involving heterologous expression of the C. elegans PMR1 homologue in cultured COS1 cells demonstrate that the SPCA-filled stores, but not the SERCA-filled stores, are capable of setting up Ca²⁺ oscillations upon stimulation of IP3 receptors. Thus, defects in spatio-temporal response to Ca²⁺ in HHD may lead to defective Ca²⁺ signaling, gene expression and keratinocyte differentiation. Alternatively, when Ca²⁺ and Mn²⁺ levels are low in the Golgi, secreted or surface proteins may not be correctly glycosylated and sorted, as demonstrated in yeast (6, 24, 25), and may lead to improper keratinocyte adhesion. Our data support the hypothesis that hSPCA1 might play a pivotal role in maintaining cytosolic as well as organellar (particularly Golgi and the secretory pathway) Ca²⁺ and Mn²⁺ concentrations. At present, it remains an important issue to distinguish whether defective cytosolic Ca²⁺ homeostasis, or a deficiency in Golgi Ca²⁺ and Mn²⁺ concentrations is responsible for abnormal keratinocyte adhesion.

The effect of Mn²⁺ on SERCA and PMCA pump activity has been investigated in earlier studies. Mn²⁺ was found to effectively replace Mg²⁺ in promoting ATP hydrolysis (31, 33). In the presence of Mg²⁺, excess Mn²⁺ competitively inhibited Ca²⁺ pumping activity of rat synaptic vesicles PMCA although no evidence was obtained for ⁵⁴Mn²⁺ transport (33). Rabbit skeletal muscle SERCA, on the other hand, was shown to bind Mn²⁺, albeit with an affinity about three orders lower than for Ca²⁺, and mediate transport at a very slow rate (31, 34). Our data on Mn²⁺ inhibition of ⁴⁵Ca transport activity of SERCA and PMCA expressed in yeast are consistent with these earlier observations. In contrast, there is a growing body of evidence on SPCA pumps from yeast, worm and human demonstrating Mn²⁺ tolerant phenotype, Mn²⁺ competition of Ca²⁺ transport, direct assay of ⁵⁴Mn transport and Mn²⁺-dependent ATPase activity (12, 19, 27, 29, and this study). Based on these observations, we propose that the SPCA have uniquely evolved as high affinity Mn²⁺ pumps to fulfill physiological roles that are only beginning to be understood.

	ACKNOWLEDGEMENTS

We thank the Kazusa Research Institute (Japan), Susan Michaelis, Kyle Cunningham, Hans Rudolph, John Penniston, and Adelaida Filoteo for generous gifts of plasmids, Kelley Moremen for making available the mannosidase II antibody, and Devrim Pesen for contribution to the sequence alignments.

	FOOTNOTES

^* This work was supported by Grant GM62142 from the National Institutes of Health (to R. R.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Present address: Indian Inst. of Chemical Biology, 4, Raja S. C. Mullick Road, Jadavpur, Calcutta, 700032 West Bengal, India.

^§ To whom correspondence should be addressed. Tel.: 410-955-4732; Fax: 410-955-0461; E-mail: rrao@jhmi.edu.

Published, JBC Papers in Press, December 6, 2001, DOI 10.1074/jbc.M110612200

² E. Bolton and J. Boeke, personal communication.

	ABBREVIATIONS

The abbreviations used are: PMCA, plasma membrane Ca²⁺-ATPase; BAPTA, bis-(O-aminophenoxy)-ethane-N,N,N',N'-tetraacetic acid; CHO, chinese hamster ovary cells; HHD, Hailey-Hailey disease; SPCA, secretory pathway Ca²⁺-ATPase; SERCA, sarco/endoplasmic reticulum Ca²⁺-ATPase; GFP, green fluorescent protein; MES, 4-morpholineethanesulfonic acid; PBS, phosphate-buffered saline; PMR, plasma membrane ATPase-related; ER, endoplasmic reticulum.

	REFERENCES

TOP ABSTRACT INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION REFERENCES

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				X. Li, S. Chanroj, Z. Wu, S. M. Romanowsky, J. F. Harper, and H. Sze A Distinct Endosomal Ca2+/Mn2+ Pump Affects Root Growth through the Secretory Process Plant Physiology, August 1, 2008; 147(4): 1675 - 1689. [Abstract] [Full Text] [PDF]

				C. Lawson, V. Dorval, S. Goupil, and P. Leclerc Identification and localisation of SERCA 2 isoforms in mammalian sperm Mol. Hum. Reprod., May 1, 2007; 13(5): 307 - 316. [Abstract] [Full Text] [PDF]

				J. Yadav, S. Muend, Y. Zhang, and R. Rao A Phenomics Approach in Yeast Links Proton and Calcium Pump Function in the Golgi Mol. Biol. Cell, April 1, 2007; 18(4): 1480 - 1489. [Abstract] [Full Text] [PDF]

				T. D. Southall, S. Terhzaz, P. Cabrero, V. R. Chintapalli, J. M. Evans, J. A. T. Dow, and S.-A. Davies Novel subcellular locations and functions for secretory pathway Ca2+/Mn2+-ATPases Physiol Genomics, September 14, 2006; 26(1): 35 - 45. [Abstract] [Full Text] [PDF]

				L. Foggia, I. Aronchik, K. Aberg, B. Brown, A. Hovnanian, and T. M. Mauro Activity of the hSPCA1 Golgi Ca2+ pump is essential for Ca2+-mediated Ca2+ response and cell viability in Darier disease J. Cell Sci., February 15, 2006; 119(4): 671 - 679. [Abstract] [Full Text] [PDF]

				L. Dode, J. P. Andersen, L. Raeymaekers, L. Missiaen, B. Vilsen, and F. Wuytack Functional Comparison between Secretory Pathway Ca2+/Mn2+-ATPase (SPCA) 1 and Sarcoplasmic Reticulum Ca2+-ATPase (SERCA) 1 Isoforms by Steady-state and Transient Kinetic Analyses J. Biol. Chem., November 25, 2005; 280(47): 39124 - 39134. [Abstract] [Full Text] [PDF]

				V. C. Culotta, M. Yang, and M. D. Hall Manganese Transport and Trafficking: Lessons Learned from Saccharomyces cerevisiae Eukaryot. Cell, July 1, 2005; 4(7): 1159 - 1165. [Full Text] [PDF]

				J. Vanoevelen, L. Dode, K. Van Baelen, R. J. Fairclough, L. Missiaen, L. Raeymaekers, and F. Wuytack The Secretory Pathway Ca2+/Mn2+-ATPase 2 Is a Golgi-localized Pump with High Affinity for Ca2+ Ions J. Biol. Chem., June 17, 2005; 280(24): 22800 - 22808. [Abstract] [Full Text] [PDF]

				M. Xiang, D. Mohamalawari, and R. Rao A Novel Isoform of the Secretory Pathway Ca2+,Mn2+-ATPase, hSPCA2, Has Unusual Properties and Is Expressed in the Brain J. Biol. Chem., March 25, 2005; 280(12): 11608 - 11614. [Abstract] [Full Text] [PDF]

				J. Ramos-Castaneda, Y.-n. Park, M. Liu, K. Hauser, H. Rudolph, G. E. Shull, M. F. Jonkman, K. Mori, S. Ikeda, H. Ogawa, et al. Deficiency of ATP2C1, a Golgi Ion Pump, Induces Secretory Pathway Defects in Endoplasmic Reticulum (ER)-associated Degradation and Sensitivity to ER Stress J. Biol. Chem., March 11, 2005; 280(10): 9467 - 9473. [Abstract] [Full Text] [PDF]

				V.-K. Ton and R. Rao Functional expression of heterologous proteins in yeast: insights into Ca2+ signaling and Ca2+-transporting ATPases Am J Physiol Cell Physiol, September 1, 2004; 287(3): C580 - C589. [Abstract] [Full Text] [PDF]

				K. J. Mitchell, T. Tsuboi, and G. A. Rutter Role for Plasma Membrane-Related Ca2+-ATPase-1 (ATP2C1) in Pancreatic {beta}-Cell Ca2+ Homeostasis Revealed by RNA Silencing Diabetes, February 1, 2004; 53(2): 393 - 400. [Abstract] [Full Text]

				T. A. Reinhardt, R. L. Horst, and W. R. Waters Characterization of Cos-7 cells overexpressing the rat secretory pathway Ca2+-ATPase Am J Physiol Cell Physiol, January 1, 2004; 286(1): C164 - C169. [Abstract] [Full Text] [PDF]

				D. Blaudez, A. Kohler, F. Martin, D. Sanders, and M. Chalot Poplar Metal Tolerance Protein 1 Confers Zinc Tolerance and Is an Oligomeric Vacuolar Zinc Transporter with an Essential Leucine Zipper Motif PLANT CELL, December 1, 2003; 15(12): 2911 - 2928. [Abstract] [Full Text] [PDF]

				D. Mandal, S. J. Rulli, and R. Rao Packing Interactions between Transmembrane Helices Alter Ion Selectivity of the Yeast Golgi Ca2+/Mn2+-ATPase PMR1 J. Biol. Chem., September 12, 2003; 278(37): 35292 - 35298. [Abstract] [Full Text] [PDF]

				S. S. Gupta, V.-K. Ton, V. Beaudry, S. Rulli, K. Cunningham, and R. Rao Antifungal Activity of Amiodarone Is Mediated by Disruption of Calcium Homeostasis J. Biol. Chem., August 1, 2003; 278(31): 28831 - 28839. [Abstract] [Full Text] [PDF]

				R. J. Fairclough, L. Dode, J. Vanoevelen, J. P. Andersen, L. Missiaen, L. Raeymaekers, F. Wuytack, and A. Hovnanian Effect of Hailey-Hailey Disease Mutations on the Function of a New Variant of Human Secretory Pathway Ca2+/Mn2+-ATPase (hSPCA1) J. Biol. Chem., June 27, 2003; 278(27): 24721 - 24730. [Abstract] [Full Text] [PDF]

				E. Delhaize, T. Kataoka, D. M. Hebb, R. G. White, and P. R. Ryan Genes Encoding Proteins of the Cation Diffusion Facilitator Family That Confer Manganese Tolerance PLANT CELL, May 1, 2003; 15(5): 1131 - 1142. [Abstract] [Full Text]

				T. Suzuki and W. J. Lennarz Glycopeptide export from the endoplasmic reticulum into cytosol is mediated by a mechanism distinct from that for export of misfolded glycoprotein Glycobiology, December 1, 2002; 12(12): 803 - 811. [Abstract] [Full Text] [PDF]

				S. R. Cronin, R. Rao, and R. Y. Hampton Cod1p/Spf1p is a P-type ATPase involved in ER function and Ca2+ homeostasis J. Cell Biol., June 10, 2002; 157(6): 1017 - 1028. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) All Versions of this Article: 277/8/6422    most recent M110612200v1 Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ton, V.-K. Articles by Rao, R. Search for Related Content PubMed PubMed Citation Articles by Ton, V.-K. Articles by Rao, R. Social Bookmarking                      What's this?