|
Originally published In Press as doi:10.1074/jbc.M107206200 on December 20, 2001
J. Biol. Chem., Vol. 277, Issue 9, 7099-7107, March 1, 2002
Comparative Study of DNA Enzymes and Ribozymes against the Same
Full-length Messenger RNA of the Vanilloid Receptor Subtype I*
Jens
Kurreck,
Birgit
Bieber,
Ricarda
Jahnel, and
Volker A.
Erdmann
From the Free University Berlin, Institute of Biochemistry,
Thielallee 63, 14195 Berlin, Germany
Received for publication, July 30, 2001, and in revised form, December 19, 2001
 |
ABSTRACT |
The efficiencies of 32 antisense
oligodeoxynucleotides, 35 DNA enzymes and 6 ribozymes to bind and
cleave the full-length messenger RNA of the vanilloid receptor subtype
I were analyzed. Systematic screening of the mRNA revealed that
good accessibility of a putative cleavage site for antisense
oligodeoxynucleotides is a necessary but not a sufficient prerequisite
for efficient DNA enzymes. Comparison of DNA enzymes and ribozymes
against the same target sites revealed: 1) DNA enzymes were more active
with longer recognition arms (9 nucleotides on either side), whereas ribozymes revealed higher activities with shorter recognition arms (7 nucleotides on either side). 2) It does not only depend on the target
site but also on the enzyme sequence, whether a DNA enzyme or a
ribozyme is more active. 3) The most efficient DNA enzyme found in this
study had an ~15-fold higher reaction rate,
kreact, and a 100-fold higher
kreact/Km under single turnover conditions compared with the fastest ribozyme. DNA enzymes as
well as ribozymes showed significant activity under multiple turnover conditions, the DNA enzymes again being more active. We
therefore conclude that DNA enzymes are an inexpensive, very stable and
active alternative to ribozymes for the specific cleavage of long RNA molecules.
 |
INTRODUCTION |
DNA enzymes and ribozymes are catalytic nucleic acids that
recognize and cleave a target RNA in a highly sequence-specific manner.
They can therefore be used as therapeutic agents to inhibit the
expression of deleterious genes. DNA enzymes and ribozymes bind to the
target RNA by Watson-Crick base pairing and subsequently catalyze the
cleavage of a phosphodiester bond.
The hammerhead ribozyme has been known for many years and is therefore
well characterized. It consists of two hybridizing arms, which are
complementary to the target RNA, a catalytic core and a helix. The
crystal structure of the hammerhead ribozyme has been solved and
revealed a Y-shaped form of the enzyme-substrate complex (1-3).
Hammerhead ribozymes are suitable for specific down-regulation of gene
expression, because they can cleave any RNA containing a NUH triplet
(N: any nucleotide; H: A, C, or U), the sequence GUC being cleaved most efficiently.
Ribozymes have been used for specific gene inhibition to overcome drug
resistance, cancer growth, viral diseases, and arthritis (for reviews,
see Refs. 4-8). For investigations in cell culture or in animal model
systems the ribozymes can be delivered in two ways: exogenous delivery
of preformed ribozymes or endogenous delivery by transfection of the
cells with the ribozyme genes (gene therapy). Exogenously delivered
ribozymes have to be stabilized by introduction of modified nucleotides
(e.g. 2'-fluoro, 2'-NH2, or
2'-O-methyl modifications). For the endogenous delivery the choice of the promotor is important.
RNA-cleaving DNA enzymes have been isolated by in vitro
selection using a combinatorial DNA library (9). The most efficient DNA
enzyme, named "10-23" consists of two hybridizing arms and a highly
conserved catalytic core of 15 nucleotides. It can cleave any junction
between a purine and a pyrimidine. Catalytic efficiency of DNA enzymes
is comparable with that of ribozymes. A crystal structure of the DNA
enzyme in the catalytically active conformation is not known yet.
In a growing number of reports DNA enzymes are used to
inhibit gene expression in various cell types (for reviews, see Refs. 7
and 8). Targets comprise virus RNAs (9-12) as well as mRNAs of
oncogenes (10, 13), receptors (14), and further deleterious genes like
BCR-ABL fusion (15-17) and Huntingtin (18). A DNA enzyme against the
early growth response factor-1 (Egr-1) was used in an animal model. It
could inhibit neointima formation after balloon injury to the rat
carotid artery wall (19).
However, systematic studies comparing ribozymes and DNA enzymes against
the same full-length target mRNA are rare. In many cases only one
type of RNA-cleaving nucleic acid was used and very often kinetic
experiments were only performed with short synthetic substrates. Our
aim was to develop a strategy to find optimal DNA enzymes and ribozymes
against the same mRNA target and to compare their activities.
Thus, we chose the mRNA of the vanilloid receptor subtype 1 (VR1),1 also known as the
Capsaicin receptor, as a target for the development of DNA enzymes and
hammerhead ribozymes. The receptor is a cation channel, which is
predominantly expressed by primary sensory neurons (20). It can be
activated by capsaicin, the pungent component of hot chili peppers,
protons, and heat (>43 °C). Therefore, the Capsaicin receptor is
thought to be a new target for pain therapy. VR1 knockout mice did not
develop thermal hyperalgesia after inflammation (21, 22).
The first step for DNA enzyme and ribozyme strategies is to identify
accessible sites of the mRNA for the binding of oligonucleotides. We therefore characterized the VR1 mRNA (2614 nt) in an RNase H
assay with 32 antisense oligodeoxynucleotides (ODN) against all
putative GUC cleavage sites for DNA enzymes and ribozymes. Subsequent
systematic screening of DNA enzymes revealed that they can only cleave
sites which are accessible for the antisense ODNs. Ribozymes were
directed against sites with high accessibility for antisense ODNs. The
influences of the number of nucleotides in the substrate recognition
arms on the activity of DNA enzymes and ribozymes were also
investigated. Kinetic analysis showed that the most efficient DNA
enzyme has a 15-fold higher reaction rate under single turnover
conditions compared with the fastest ribozyme.
 |
EXPERIMENTAL PROCEDURES |
In Vitro Transcription of Substrate RNA--
Rat VR1 was
cloned from total RNA prepared from L4-L6 dorsal root ganglia
taken from adult rats. Total RNA (2.5 µg) was reverse transcribed
using oligo(dT) and Superscript reverse transcriptase (Invitrogen,
Paisley, UK). Subsequent polymerase chain reaction was carried out with
specific VR1 forward and reverse primers designed using the
GenBankTM sequence AF029310. Primers corresponding to
nucleotides 73-91 and 2578-2597 were rVR1F-EcoRI
(5'-GCGCGAATTCTGGAAAGGATGGAACAACG-3') and
rVR1-XbaI (5'-GCGCTCTAGATTATTTCTCCCCTGGGACC-3').
EcoRI and XbaI restriction sites were introduced
as indicated. A 2.5-kb fragment was amplified using Pfu DNA
Polymerase (Stratagene, La Jolla, CA) and cloned into the
EcoRI-XbaI sites of pcDNA3.1(+) (Invitrogen,
Groningen, The Netherlands).
Sequence analysis revealed three single nucleotide differences compared
with the sequence published by Caterina et al. (20). One of
the mutations transforms a GUC triplet into GUU. The deviations were
found in several clones and are also published in GenBankTM
as vanilloid receptor type 1 like protein 1 (VR1L1) by Tsutsumi et al. (accession number AB040873). The differences might
either be due to single nucleotide polymorphisms or sequencing errors of the originally published clone. The plasmid was linearized with XbaI before in vitro transcription with T7
RNA polymerase, which was performed with the RiboMAX Large Scale
RNA Production System from Promega (Madison, WI).
Ribozymes and DNA Enzymes--
Antisense oligodeoxynucleotides
and DNA enzymes were obtained from MWG Biotech AG, Ebersberg,
Germany. Ribozymes were synthesized by solid-phase chemistry
on a PCR-MATE EP model 391 DNA synthesizer (Applied Biosystems) in a
1-µmol scale with standard phosphoramidites from Proligo Biochemie,
Hamburg, Germany. Oligonucleotides were synthesized following standard
procedures and purified by high performance liquid chromatography.
Large amounts of ribozyme 16 (7/7) were obtained from IBA-NAPS
Göttingen, Germany.
Messenger Walk Screening--
Messenger walk screening was
performed to identify accessible sites for antisense
oligodeoxynucleotides. Therefore, 100 nM VR1 mRNA were
incubated with a 5-fold excess of an antisense oligodeoxynucleotide in
a total volume of 10 µl in 40 mM Tris/HCl, pH 7.2, 4 mM MgCl2, 1 mM dithiothreitol, and
150 mM NaCl for 7.5 min at 37 °C in the presence of 0.4 units of RNase H (Promega, Madison, WI). The reaction was stopped by
addition of EDTA (final concentration: 83 mM). Uncleaved
substrate and digestion products were separated on a 1.5% agarose gel
and stained with ethidium bromide. Agarose gels were preferred instead
of polyacrylamide gels due to the well known difficulties to separate
long RNAs (>2000 bases) with the latter. The signals of ethidium
bromide-stained RNAs were found to be linear with the concentration and
the ratio of uncleaved substrate and digestion products was independent
from the signal intensity. The gels were photographed with the Gel Doc
2000 Gel Documentation System and quantitatively evaluated with the
program Quantity One (Bio-Rad, Munich, Germany). All values given are the average and standard deviation of at least three independent experiments.
Ribozyme and DNA Enzyme Kinetics--
Kinetics of DNA enzymes
and ribozymes were investigated under single and multiple turnover
conditions. Experiments were performed in 50 mM Tris/HCl,
pH 7.5, and 10 mM MgCl2 at 37 °C. 1.25 units/µl RNasin were added to prevent degradation of the
mRNA. Ribozymes and DNA enzymes were denatured at 65 °C for 3 min and subsequently cooled down to 37 °C. Reactions were started by
addition of the enzymes to the substrate mRNA (final concentration:
100 nM). The ribozymes and DNA enzymes were used to give a
final concentration of 1, 5, and 10 µM for single
turnover experiments and 10 nM for multiple turnover
experiments. Aliquots were removed at different time points and the
reactions were stopped by the addition of 83 mM EDTA and
subsequent snap-cooling on ice. The cleavage reactions were analyzed on
agarose gels as described above.
For single turnover experiments the time-dependent decrease
of the uncleaved fraction was fitted with a monoexponential decay function by Origin (Microcal Software, Northampton, MA). Kinetics for
DNA enzyme 15 (9/9) under single turnover conditions could only be
fitted with a biexponential decay function. Further kinetic evaluation
of the data followed standard procedures described in the literature
(23, 24) with some modifications, since an exhaustive kinetic
characterization is impossible for long substrate RNA molecules like
full-length mRNAs due to limitations of material. Therefore, only
experiments with 10-, 50-, and 100-fold enzyme excess were performed
and reaction rates, kobs, were determined. All
kobs values used are the average including
standard deviation of three independent experiments. Maximal reaction
rates, kreact, and Km values
were estimated by hyperbolic fitting of kobs
values, which were plotted as a function of the enzyme concentration. Again, all values are the average including standard deviation of three
independent sets of experiments.
For multiple turnover experiments the initial reaction velocity was
calculated by linear fitting of data points obtained in the first 15 min of the experiment. All values given are the average including
standard deviation of at least three independent experiments.
 |
RESULTS |
Site Selection--
The first step for the development of
ribozymes and DNA enzymes is the selection of a suitable cleavage site.
GUC triplets in the target RNA are most efficiently cleaved by
hammerhead ribozymes, and since any junction of a purin and a pyrimidin
can be cleaved by a 10-23 DNA enzyme, the GU(C) sequences can also be
used as target site for DNA enzymes. Therefore, all 32 GUC triplets in the translated region of the VR1 mRNA were analyzed as putative target sites. Messenger walk screening with antisense ODN complementary to the GUC triplets was used to identify sites of the mRNA, which are accessible to oligonucleotides. The antisense ODNs were 18-mers with a GAC triplet in the center and the general sequence:
NNNNNNNNGACNNNNNNN. As an example, antisense ODN against GUC site 15 is
shown in Fig. 1. A 5-fold excess of the
antisense ODNs was added to the mRNA in the presence of RNase H,
which cleaves DNA/RNA duplexes that were formed, wherever an ODN can
bind to the mRNA.

View larger version (12K):
[in this window]
[in a new window]
|
Fig. 1.
Part of the VR1 sequence with the GUC
cleavage site 15 in the translated region (black
box). Sequences of an 18-mer antisense
oligodeoxynucleotide and DNA enzyme with 9-nt recognition arms are
given below and the sequence of the hammerhead ribozyme with
7-nt recognition arms is given above the mRNA.
|
|
Fig. 2 (black bars) shows that
mRNA cleavage of more than 90% could be achieved with the most
efficient antisense ODN (number 29) in the presence of RNase H under
conditions described above. Five further antisense ODNs (numbers 2, 15, 16, 25, and 27) led to a cleavage of more than 70% of the mRNA.
The sequences of the two most efficient antisense ODNs are: ODN number
15, CATGTCATGACGGTTAGG and number 29, ATCTTGTTGACGGTCTCA.

View larger version (24K):
[in this window]
[in a new window]
|
Fig. 2.
Messenger walk and DNA enzyme screening for
VR1 mRNA. The fraction of cleaved mRNA by RNase H is shown
for each of the 32 antisense oligonucleotides directed against all
putative hammerhead cleavage sites GUC (black bars). The
antisense ODNs were added to the mRNA in 5-fold excess, followed by
a 7.5-min incubation at 37 °C. Cleavage of the mRNA by DNA
enzymes (10-fold excess to the mRNA) against the same sites after
20 min incubation at 37 °C is show with gray bars. All
values are averages of at least three independent experiments.
|
|
DNA enzymes were designed against the 32 GUC triplets analyzed by
messenger walk screening. The general sequence for a 10-23 DNA
enzyme with two recognition arms of nine nucleotides on either side is:
NNNNNNNNNGGCTAGCTACAACGANNNNNNNNN. The DNA enzyme against GUC site
number 15 is shown in Fig. 1.
Cleavage of mRNA by DNA enzymes under single turnover conditions
(10-fold excess of DNA enzymes over the substrate RNA) after 20 min
incubation at 37 °C is shown in Fig. 2 (gray bars). All DNA enzymes were denatured prior to the assay. More than half of the
DNA enzymes were completely inactive and only four DNA enzymes (13%)
cleaved more than 20% of the mRNA.
A comparison of the activity of the DNA enzymes with the results
obtained by messenger walk screening revealed that highly efficient DNA
enzymes were only obtained for sites which are well accessible to
antisense ODNs. However, accessibility of the site is only a necessary
but not a sufficient prerequisite for good DNA enzymes. Many DNA
enzymes were totally inactive even though the site was accessible for
oligonucleotides. Obviously, the accessibility of a site is not the
only crucial factor for the activity of a DNA enzyme. The formation of
internal secondary structures of the enzyme may lead to inactive conformations.
Comparison of DNA Enzymes and Ribozymes under Single
Turnover Conditions--
Due to the relative expensive RNA
synthesis, we refrained from a systematic screening of ribozymes
against all GUC sites. Therefore, hammerhead ribozymes
against three of the sites with highest accessibility for
oligonucleotides (numbers 15, 16, and 29) in the messenger walk
screening were synthesized. The general sequence of a hammerhead
ribozyme against a GUC site with 7-nt antisense arms is:
NNNNNNNCUGAUGAGGCCGAAAGGCCGAAACNNNNN. The hammerhead ribozyme cleaving
GUC site number 15 is shown in Fig. 1.
Results for ribozymes and DNA enzymes against site numbers 15, 16, and
29 are shown in Fig. 3 (top). To analyze
the influence of the length of the substrate recognition arms on the
cleavage activity, ribozymes and DNA enzymes with 7 and 9 nucleotides
in each binding arm were compared.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 3.
VR1 mRNA cleavage by ribozymes and DNA
enzymes against sites 15, 16, and 29 under single turnover conditions
(10-fold enzyme excess, 20 min at 37 °C). The length of the
recognition arms (RA) was 7 and 9 nucleotides as indicated
in the figure. Top, ethidium bromide-stained agarose gel.
Bottom, quantitative evaluation of the gel. All values are
averages of at least three independent experiments.
|
|
Quantitative evaluation of the gel (Fig. 3, bottom) reveals
three interesting features. 1) DNA enzymes are more efficient with
longer antisense arms whereas ribozymes have a higher activity with
shorter arms. 2) It does not only depend on the target site, but also
on the enzyme sequence, whether a ribozyme or a DNA enzyme is more
active. For sites 15 and 29 DNA enzymes had a higher cleavage activity,
whereas the ribozyme against site number 16 was more efficient than the
DNA enzyme against the same target site. 3) The most efficient DNA
enzyme found cleaves the full-length target mRNA more efficiently
than the most active ribozyme.
To further characterize the DNA enzymes and ribozymes with high
cleavage activity kinetic experiments under single turnover conditions
were performed. The sequences of these ribozymes and DNA enzymes, which
were named after the sites they are targeted against and the length of
the substrate recognition arms in parentheses, are: Ribozyme 15 (7/7):
AUGUCAUCUGAUGAGGCCGAAAGGCCGAAACGGUUA; Ribozyme 16 (7/7):
UGCGCUUCUGAUGAGGCCGAAAGGCCGAAACAAAUC; DNA enzyme 15 (9/9):
ATGTCATGAGGCTAGCTACAACGAGGTTAGGGG; and DNA enzyme 29 (9/9): TCTTGTTGAGGCTAGCTACAACGAGGTCTCACC.
Fig. 4 (top) is an example of
mRNA cleavage by a 100-fold excess of DNA enzyme 15 (9/9) at
different time points. This DNA enzyme cuts the substrate (S) into two
product fragments (P1 and P2) of equal length, and therefore only one
product band is observed. In Fig. 4 (bottom) the fraction of
uncleaved mRNA in the presence of DNA enzymes and ribozymes
(100-fold excess) is shown as a function of time. The kinetics of
mRNA cleavage for the DNA enzyme 15 (9/9) are biphasic. Data for
all other enzymes can be described by monoexponential decay kinetics.
The observed cleavage rates and corresponding amplitudes at 100-fold
enzyme excess are summarized in Table I. For the most active DNA, enzyme 15 (9/9), approximately half of the
reaction takes place with a fast phase of 2.8 min 1.
Interestingly, for DNA enzyme 29 (9/9) which is slower than DNA enzyme
15 (9/9) and ribozyme 16 (7/7) the smallest fraction of substrate
mRNA remains uncleaved when the reaction reaches completion.

View larger version (43K):
[in this window]
[in a new window]
|
Fig. 4.
Top, cleavage of the full-length VR1
mRNA by DNA enzyme 15 (9/9) under single turnover conditions. The
gel shows electrophoretically separated digestion products
(P1 and P2) derived from the full-length mRNA
substrate (S) after incubation at 37 °C for various time
points ranging from 0 to 60 min. Bottom, kinetics of
cleavage of full-length VR1 mRNA under single turnover conditions
by ribozymes 15 (7/7) ( ) and 16 (7/7) ( ) and DNA enzymes 15 (9/9)
( ) and 29 (9/9) ( ). Enzymes were added at 100-fold excess to the
mRNA followed by incubation at 37 °C. At appropriate times,
aliquots were removed from the reaction. Substrate and digestion
products were separated electrophoretically and the ethidium
bromide-stained gel was quantitatively evaluated to give the fraction
of uncleaved mRNA at each time point.
|
|
Due to limitations of material an exhaustive kinetic characterization
is not possible for the cleavage of long substrate molecules. The
kinetic characterization method frequently used for long substrate molecule, in which only one time point is measured for each enzyme concentration (24) could also not be applied because of the biphasic
behavior of DNA enzyme 15 (9/9). We therefore determined kobs for different enzyme excess (10-, 50-, and
100-fold) as described above and plotted the observed cleavage rate
kobs against the enzyme concentration.
Hyperbolic fits were used to estimate kinetic parameters, which are
summarized in Table II. The maximal
reaction rate for the most active DNA enzyme is ~15-fold higher than
the rate for the most efficient ribozyme 16 (7/7).
Km values are lower for DNA enzymes than for
ribozymes. As a consequence kreact/kM for DNA enzyme 15 (9/9) is ~100-fold higher than for ribozyme 15 (7/7).
Comparison of DNA Enzymes and Ribozymes under Multiple Turnover
Conditions--
The DNA enzymes and ribozymes were further
characterized under multiple turnover conditions, i.e. with
an enzyme to substrate ratio of 1:10. Ribozymes against site 29 and DNA
enzymes against site 16 did not have significant cleavage activity
under these conditions (data not shown). Fig.
5 (top) shows the results of mRNA cleavage by the remaining enzymes after 2 h at 37 °C.
Quantitative evaluation of the gel (Fig. 5, bottom) confirms
the results, which were already obtained under single turnover
conditions: 1) DNA enzymes are more efficient with substrate
recognition arms of 9 nucleotides whereas ribozymes have a higher
activity with shorter arms. 2) The fastest DNA enzyme cleaves the VR1
mRNA more efficiently than the most active ribozyme.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 5.
VR1 mRNA cleavage by ribozymes against
sites 15 and 16 and by DNA enzymes against sites 15 and 29 under
multiple turnover conditions (10-fold substrate excess, 2 h at
37 °C). The length of the recognition arms (RA) was
7 and 9 nucleotides as indicated in the figure. Top,
ethidium bromide-stained agarose gel. Bottom, quantitative
evaluation of the gel. All values are averages of at least three
independent experiments.
|
|
It is well known that it is difficult to observe the cleavage of long
target RNAs under multiple turnover conditions (25). However, for
ribozyme 16 (7/7) and DNA enzyme 15 (9/9) significant multiple turnover
activity with the full-length mRNA could be detected (Fig.
6).

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 6.
Cleavage of full-length VR1 mRNA under
multiple turnover conditions by ribozyme 16 (7/7) ( ) and DNA enzyme
15 (9/9) ( ). Enzymes were added to give a 10-fold excess of the
mRNA followed by incubation at 37 °C. At appropriate times,
aliquots were removed from the reaction. Substrate and digestion
products were separated electrophoretically and the ethidium
bromide-stained gel was quantitatively evaluated to give the fraction
of uncleaved mRNA at each time point.
|
|
The initial reaction velocity was calculated by linear fitting of data
points obtained in the first 15 min of the experiment (Table
III). Values of 0.29 ± 0.07 nM/min and 0.8 ± 0.1 nM/min were obtained
for ribozyme 16 (7/7) and DNA enzyme 15 (9/9), respectively, i.e. the initial reaction velocity at 10-fold substrate
excess is 2.8-fold higher for the DNA enzyme.
 |
DISCUSSION |
The aim of the present study was the development of a strategy for
the design of highly efficient ribozymes and DNA enzymes for the
cleavage of long RNA transcripts and comparison of their activities
against the same sites in the full-length target mRNA of the
vanilloid receptor subtype 1. We first characterized the structure of
the mRNA by messenger walk screening. For this purpose, antisense
oligodeoxynucleotides against all 32 GUC triplets in the translated
region, which are putative cleavage sites for hammerhead ribozymes,
were added to the mRNA. RNase H should cleave the RNA at those
positions at which an antisense ODN has been bound. Several antisense
ODNs were found to mediate substantial cleavage of the mRNA by
RNase H. These oligodeoxynucleotides can now be used to investigate
pain perception in animal models. In a recent study, carrageenan
treatment was shown to induce axonal transport of the VR1 mRNA from
the dorsal root ganglia to central and peripheral axon terminals (26).
The level of VR1 mRNA in the lumbar dorsal horn could be almost
abolished by intrathecal injection of an antisense ODN complementary to
the first 20 nucleotides of the translated region.
DNA enzymes which cleave any purin/pyrimidin junction were also
directed against the 32 GU(C) sites within the translated region of the
VR1 mRNA. Comparison of their ability to digest the mRNA with
the antisense ODN-mediated mRNA cleavage by RNase H revealed that
good accessibility of a putative cleavage site for an antisense ODN is
an essential but not sufficient prerequisite for an efficient DNA
enzyme, since some DNA enzymes were completely inactive although the
antisense ODN could bind to the mRNA. This result was confirmed for
other target mRNAs as
well.2 The finding, that more
than half of the DNA enzymes tested in this study were inactive, is
also in agreement with results from a systematic screening of 80 DNA
enzymes against the HPV16 E6 transcript, where even 90% of the
deoxyribozymes did not show substantial cleavage activity (10).
An analogous comparison of the accessibility of sites in a messenger
RNA for antisense oligodeoxynucleotides and their cleavage by
hammerhead ribozymes was performed for the proto-oncogene
c-myb (27). The results obtained for hammerhead ribozymes
were similar to the finding of the present study for DNA enzymes. In
general, the sites that were accessible to antisense oligonucleotides
were also susceptible for cleavage by ribozymes. However, some
exceptions were found, accessible sites for antisense ODNs which were
not cleaved by ribozymes as well as efficiently cleaved sites which were poorly accessible in the RNase H assay. In addition to the accessibility of a cleavage site, formation of internal secondary structures, steric hindrance due to the catalytic center, inability of
formation of the active conformation, and thermodynamics of enzyme-substrate interactions might be important factors for the catalytic activity of DNA enzymes and ribozymes.
The accessibility of cleavage sites for hammerhead ribozymes was
further investigated by chemical modification mapping of the HIV-1
vif-vpr transcript (28). These experiments revealed that
availability of nucleotides close to the cleavage site for base pairing
with the ribozyme is important for efficient cleavage of a long RNA,
whereas steric hindrance from target RNA structures is unlikely to
affect hammerhead ribozyme cleavage.
A variety of strategies has previously been used to screen RNA targets
for accessible sites (for a review, see Ref. 29). An oligonucleotide
array was designed to map an RNA for hybridization sites for antisense
oligodeoxynucleotides (30). An alternative approach was the use of
random or semirandom ODN libraries and RNase H followed by primer
extension (31, 32). In a nonrandom variation of this strategy
target-specific oligonucleotides were generated by digestion of the
template DNA (33). All of these methods are labor intensive and
expensive due to the primer extension analysis and do not reveal
further information to the rather simple messenger walk screening
presented in this study. Therefore, this method seems to be a fast,
cheap, and easy alternative way to identify suitable cleavage sites for
DNA enzymes and ribozymes.
Since DNA enzymes and ribozymes can still be completely inactive even
if the binding region of the mRNA is accessible for antisense ODNs
site selection with the catalytic nucleic acids themselves might be
advantageous. Efficient cleavage sites for ribozymes were found by the
use of libraries with randomized (34, 35) or sequence-specific (36)
substrate recognition arms. Highly active DNA enzymes against the HIV
gag transcript were isolated from combinatorial libraries of randomized
or partially randomized DNA enzymes (37). To find the optimal DNA
enzyme against the human papilloma virus HPV 16 E6 transcript the
cleavage pattern of a mixture of 80 specific deoxyribozymes was
analyzed by primer extension (10). Again, these methods are more labor intensive than the screening with single DNA enzymes we performed and
the best DNA enzyme found for the HPV RNA was less active than the
fastest DNA enzyme identified by our method (see below).
Due to high costs, the activity of hammerhead ribozymes were not
screened systematically for all putative cleavage sites. Therefore, we
only designed ribozymes to cleave three of the sites with highest
accessibility for antisense ODNs. Interestingly, ribozymes were more
active with substrate recognition arms of 7 nucleotides on either side,
whereas DNA enzymes cleaved the mRNA more efficiently with longer
arms of 9 nucleotides on either side. This result is in agreement with
findings for hammerhead ribozymes against the c-myb mRNA
(27). Symmetric ribozymes with arm lengths ranging from 5 to 12 nucleotides were tested and the 7/7-nt arm ribozymes were found to be
most efficient. However, it cannot be generalized that ribozymes are
more active with shorter arms. Hammerhead ribozymes against the
full-length interleukin-2 RNA were more effective with longer antisense
arms although a short synthetic substrate could be cleaved with highest
efficiency by a ribozyme with short recognition arms (38). A computer
predicted secondary structure of the long interleukin-2 target RNA
revealed a single stranded loop region in the vicinity to the cleavage site, which can only be used for hybridization by ribozymes with longer
recognition arms. In the case of DNA enzymes, our results are in
agreement with a study demonstrating that deoxyribozymes cleaved the
full-length c-myc mRNA more efficiently with longer than
with shorter antisense arms (13). However, no general conclusion can be
drawn whether symmetric or asymmetric substrate recognition arms are
superior. For a target sequence derived from HPV16 E7 a DNA enzyme with
symmetric arms of 10 nucleotides on each side showed the highest
activity, whereas DNA enzymes with asymmetric arms were more efficient
to cleave a c-myc target sequence (39).
Under multiple turnover conditions identical results were obtained for
the variation of the arm length as under single turnover conditions.
Ribozymes were more efficient with 7 nucleotides and DNA enzymes with 9 nucleotides on either side. Long substrate recognition arms can
drastically reduce activities of ribozymes due to slow product release.
However, the DNA enzymes used in this study were more active with
longer than with shorter antisense arms even under multiple turnover
conditions. In contrast to our results obtained with a long RNA
transcript as a target, kcat was found to be
similar for substrate recognition domains from 7 to 9 nucleotides on
either side of DNA enzymes against short RNA targets (40).
To our knowledge, our study is the first comparison of DNA enzymes and
ribozymes not only against the same long RNA, but also against the same
target sites within the mRNA. Our results show, that it is not
possible to draw a general conclusion, whether the hammerhead ribozyme
or the DNA enzyme has a higher activity. In two cases (sites 15 and 29)
the DNA enzyme was superior and in one case (site 16) the hammerhead
ribozyme was more efficient. Cleavage activity obviously not only
depends on the accessibility of the target site, but also on the
sequence of the catalytic nucleic acid and the formation of favorable
internal structures.
Kuwabara et al. (15) directed hammerhead ribozymes and DNA
enzymes against the mRNA of the BCR-ABL fusion gene, which causes chronic myelongenous leukemia, and found the ribozyme being more active
than the DNA enzymes. In contrast, Goila and Banerjea (14) found a DNA
enzyme being more effective in cleaving the chemokinin receptor CCR5
transcript than a hammerhead ribozyme. However, in both studies, the
DNA enzymes and ribozymes were directed against different target sites
and their activities can therefore not be compared. To be able to make
a comparison we used the same target sites for both kinds of RNA
cleaving nucleic acids and found that either the DNA enzyme or the
hammerhead ribozyme may be superior.
Still, the study of Kuwabara et al. (15) demonstrated
another advantage of the DNA enzymes. Although they found the ribozyme to be more active in vitro it could not be used for
therapeutic purpose. Due to the lack of suitable hammerhead cleavage
sites close to the BCR-ABL junction it cannot distinguish between the abnormal BCR-ABL mRNA and the normal ABL mRNA. In contrast, DNA enzymes which have less restrictions with regard to the cleavage site
could be directed against the junction and cleavage occurred therefore
only within the chimeric BCR-ABL junction.
In a number of studies, kinetic data for DNA enzymes and ribozymes were
obtained for short substrates only. Hammerhead ribozymes are known to
have cleavage rates of ~1 min 1 (23), the catalytic
activity of DNA enzymes being comparable (9). The rates for the
cleavage of long transcripts by ribozymes and DNA enzymes are only
rarely determined, but it is well known that they are usually several
orders of magnitude lower compared with the rates for the cleavage of
short substrates. We therefore measured and compared kinetics for DNA
enzymes and ribozymes against the VR1 transcript of 2614 nucleotides
under single and multiple turnover conditions.
The first interesting finding was that DNA enzymes showed monophasic as
well as biphasic cleavage kinetics. It was suggested that a biphasic
behavior of ribozymes arises when an alternate inactive conformation of
the enzyme-substrate complex can be formed that is only slowly
exchanged with the active conformation (23). A similar explanation can
be drawn for DNA enzymes.
The second interesting finding was that the most efficient DNA enzyme
15 (9/9) had a 15-fold higher maximal reaction rate compared with the
most effective hammerhead ribozyme. The rate of the DNA enzyme of 2.7 min 1 is even higher than the kcat
of 0.49 min 1 obtained under comparable conditions for a
DNA enzyme with a short substrate (9), demonstrating that there should
be no hindrance due to the long transcript for the site attacked.
The higher Km values which we obtained for ribozymes
may be a consequence of the shorter substrate binding arms of seven
nucleotides needed for maximal cleavage activity compared with nine
nucleotides for DNA enzymes. Therefore, the target RNA is bound less
tightly by ribozymes. As a consequence of the higher kreact and the lower Km for
the DNA enzyme 15 (9/9) the kreact/Km is even ~100-fold
higher than for the ribozyme 16 (7/7). Under multiple turnover
conditions with 10-fold substrate excess the DNA enzyme still compares
favorably with the ribozyme with a 2.8-fold higher initial reaction velocity.
Due to the problems with handling long RNAs and the lack of a standard
method and standard conditions it is difficult to compare reaction
rates obtained for DNA enzymes and ribozymes in different laboratories.
Only a few examples can be used for comparison. The fastest DNA enzyme
against the HPV E6 RNA found in a pool of 80 DNA enzymes had an
observed rate of 0.21 min 1 (10), i.e. 1 order
of magnitude slower than the fastest DNA enzyme
(kreact = 2.7 min 1) found in this
study. Ribozymes described in the literature had even lower rates
against long targets, e.g. Ribozyme 865 had a kreact of 0.0204 min 1 against
luciferase mRNA (41) compared with a kreact
of 0.18 min 1 for Ribozyme 16 (7/7) against the VR1
mRNA. Two interesting features arise from these data. 1) DNA
enzymes compare favorably with hammerhead ribozymes. 2) The two highly
active DNA enzymes were obtained by systematic screening of numerous
DNA enzymes against the same long target RNA. In contrast to ribozymes
oligodeoxynucleotides are relatively inexpensive and can be easily
obtained. Therefore, it seems worth selecting the most efficient DNA
enzyme out of a large number of candidates rather than just testing one
DNA enzyme, e.g. against the start codon AUG.
One important point to be addressed is the question, whether DNA
enzymes and ribozymes optimized under in vitro conditions are also efficient in cleaving the target RNA in cell culture and
in vivo. The sites which were found to be accessible
in vitro might be blocked under in vivo
conditions by the formation of different secondary and tertiary
structures or by proteins bound to the RNA. But several studies
demonstrated that there is a correlation between the in
vitro and intracellular activity. The in vitro efficiency found for hammerhead ribozymes against the interleukin-2 mRNA was confirmed in cell culture (38). Cairns et al.
(10) screened DNA enzymes against the c-myc target and
assessed the relationship between in vitro cleavage activity
and gene suppression in cell culture. They found that efficient
c-myc cleavers in vitro induced the most
substantial suppression of smooth muscle cell proliferation, which
provided an indication of the respective biological response. In
contrast, poor c-myc cleavers had no effect on the level of
the cell proliferation. In vitro optimized ribozymes and DNA
enzymes should therefore be efficient in cell cultures and in
vivo. However, Amarzguioui et al. (42) found
only little predictive power of in vitro accessibility
assays for ribozyme efficiency in cell culture. They preferred
secondary structure prediction of the target RNA by the MFold program
for ribozyme optimization.
 |
CONCLUSION |
We have characterized the VR1 mRNA by messenger walk
screening, i.e. by systematic addition of antisense
oligodeoxynucleotides and RNase H to the target RNA, and found
accessible cleavage sites for hammerhead ribozymes and DNA enzymes. No
general conclusion can be drawn about the predictability whether the
hammerhead ribozyme or the DNA enzyme is superior for a certain target
site. But a kinetic comparison of the two kinds of RNA cleaving nucleic
acids revealed that the most efficient DNA enzyme had a 15-fold higher reaction rate and an ~100-fold higher
kreact/Km than the best
ribozyme. Since DNA enzymes have less restrictions concerning the
cleavage sites than ribozymes and can easily be synthesized, the best
cleaver for a target can be selected by systematic screening. These
advantages together with their applicability in animal models (19)
demonstrate the potential of DNA enzymes as therapeutic agents. The
best antisense oligodeoxynucleotides, ribozymes, and DNA enzymes
identified in this in vitro study will now be tested in
animal models with regard to a modulation of pain perception.
 |
ACKNOWLEDGEMENTS |
We thank to Dr. R. Bald and co-workers for
ribozyme synthesis.
 |
FOOTNOTES |
*
This work was supported by Bundesministerium für
Bildung und Forschung Grant 01GG9818/0 and the Fonds of the Chemische
Industrie e. V.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed. Tel.:
49-30-83-85-60-02; Fax: 49-30-83-85-64-13; E-mail:
erdmann@chemie.fu-berlin.de.
Published, JBC Papers in Press, December 20, 2001, DOI 10.1074/jbc.M107206200
2
J. Kurreck, B. Bieber, S. Schubert,
and V. Erdmann, unpublished data.
 |
ABBREVIATIONS |
The abbreviations used are:
VR1, vanilloid
receptor subtype 1;
HPV, human papilloma virus;
nt, nucleotides;
ODN, oligodeoxynucleotide;
VR1L1, vanilloid receptor type 1 like protein
1.
 |
REFERENCES |
| 1.
|
Pley, H. W.,
Flaherty, K. M.,
and McKay, D. B.
(1994)
Nature
372,
68-74[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Scott, W. G.,
Finch, J. T.,
and Klug, A.
(1995)
Cell
81,
991-1002[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Wedekind, J. E.,
and McKay, D. B.
(1998)
Annu. Rev. Biophys. Biomol. Struct.
27,
427-502
|
| 4.
|
Christoffersen, R. E.,
and Marr, J. J.
(1995)
J. Med. Chem.
38,
2023-2037[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Persidis, A.
(1997)
Nat. Biotechnol.
15,
921-922[CrossRef][Medline]
[Order article via Infotrieve]
|
| 6.
|
James, H. A.,
and Gibson, I.
(1998)
Blood
91,
371-382[Abstract/Free Full Text]
|
| 7.
|
Sun, L. Q.,
Cairns, M. J.,
Saravolac, E. G.,
Baker, A.,
and Gerlach, W. L.
(2000)
Pharmacol. Rev.
52,
325-347[Abstract/Free Full Text]
|
| 8.
|
Jen, K.-Y.,
and Gerwirtz, A. M.
(2000)
Stem Cells
18,
307-319[Abstract/Free Full Text]
|
| 9.
|
Santoro, S. W.,
and Joyce, G. F.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
4262-4266[Abstract/Free Full Text]
|
| 10.
|
Cairns, M. J.,
Hopkins, T. M.,
Witherington, C.,
Wang, C.,
and Sun, L.-Q.
(1999)
Nat. Biotechnol.
17,
480-486[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Dash, B. C.,
Harikrishnan, T. A.,
Goila, R.,
Shahi, S.,
Unwalla, H.,
Husain, S.,
and Banerjea, A. C.
(1998)
FEBS Lett.
431,
395-399[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Zhang, X., Xu, Y.,
Ling, H.,
and Hattori, T.
(1999)
FEBS Lett.
458,
151-156[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Sun, L.-Q.,
Cairns, M. J.,
Gerlach, W. L.,
Witherington, C.,
Wang, L.,
and King, A.
(1999)
J. Biol. Chem.
274,
17236-17241[Abstract/Free Full Text]
|
| 14.
|
Goila, R.,
and Banerjea, A.
(1998)
FEBS Lett.
435,
233-238[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Kuwabara, T.,
Warashina, M.,
Tanabe, T.,
Tani, K.,
Asano, S.,
and Taira, K.
(1997)
Nucleic Acids Res.
25,
3074-3081[Abstract/Free Full Text]
|
| 16.
|
Warashina, M.,
Kuwabara, T.,
Nakamatsu, Y.,
and Taira, K.
(1999)
Chem. Biol.
6,
237-250[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Wu, Y., Yu, L.,
McMahon, R.,
Rossi, J. J.,
Forman, S. J.,
and Snyder, D. S.
(1999)
Hum. Gene Ther.
10,
2847-2857[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Yen, L.,
Strittmatter, S. M.,
and Kalb, R. G.
(1999)
Ann. Neurol.
46,
366-373[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Santiago, F. S.,
Lowe, H. C.,
Kavurma, M. M.,
Chesterman, C. N.,
Baker, A.,
Atkins, D. G.,
and Khachigian, L. M
(1999)
Nat. Med.
5,
1264-1269[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Caterina, M. J.,
Schumacher, M. A.,
Tominaga, T. A.,
Rosen, T. A.,
Levine, J. D.,
and Julius, D.
(1997)
Nature
389,
816-824[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Caterina, M. J.,
Leffler, A.,
Malmberg, A. B.,
Martin, W. J.,
Trafton, J.,
Petersen-Zeitz, K. R.,
Koltzenburg, M,
Basbaum, A. I.,
and Julius, D.
(2000)
Science
288,
306-313[Abstract/Free Full Text]
|
| 22.
|
Davis, J. B.,
Gray, J.,
Gunthorpe, M. J.,
Hatcher, J. P.,
Davey, P. T.,
Overend, P.,
Harries, M. H.,
Latcham, J.,
Clapham, C.,
Atkinson, K.,
Hughes, S. A.,
Rance, K.,
Grau, E.,
Harper, A. J.,
Pugh, P. L.,
Rogers, D. C.,
Bingham, S.,
Randall, A.,
and Sheardown, S. A.
(2000)
Nature
405,
183-187[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Stage-Zimmermann, T. K.,
and Uhlenbeck, O. C.
(1998)
RNA
4,
875-889[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Heidenreich, O.,
Benseler, F.,
Fahrenholz, A.,
and Eckstein, F.
(1994)
J. Biol. Chem.
269,
2131-2138[Abstract/Free Full Text]
|
| 25.
|
Thomson, J. B.,
Tuschl, T.,
and Eckstein, F.
(1996)
in
Catalytic RNA
(Eckstein, F.
, and Lilley, D. M. J., eds)
, pp. 173-196, Springer Verlag, Berlin
|
| 26.
|
Tohda, C.,
Sasaki, M.,
Konemura, T.,
Sasamura, T.,
Itoh, M.,
and Karaishi, Y.
(2001)
J. Neurochem.
76,
1628-1635[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Jarvis, T. C.,
Wincott, F. E.,
Alby, L. J.,
McSwiggen, J. A.,
Beigelman, L.,
Gustofson, J.,
DiRenzo, A.,
Levy, K.,
Arthur, M.,
Matulic-Adamic, J.,
Karpeisky, A.,
Gonzalez, C.,
Woolf, T. M.,
Usman, N.,
and Stinchcomb, D. T.
(1996)
J. Biol. Chem.
271,
29107-29112[Abstract/Free Full Text]
|
| 28.
|
Campbell, T. B.,
McDonald, C. K.,
and Hagen, M.
(1997)
Nucleic Acids Res.
25,
4985-4993[Abstract/Free Full Text]
|
| 29.
|
Sohail, M.,
and Southern, E. M.
(2000)
Adv. Drug Deliv. Rev.
44,
23-34[CrossRef][Medline]
[Order article via Infotrieve]
|
| 30.
|
Milner, N.,
Mir, K. U.,
and Southern, E. M.
(1997)
Nat. Biotechnol.
15,
537-541[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Ho, S. P.,
Britton, D. H. O.,
Stone, B. A.,
Behrens, D. L.,
Leffet, L. M.,
Hobbs, F. W.,
Millaer, J. A.,
and Trainor, G. L.
(1996)
Nucleic Acids Res.
24,
1901-1907[Abstract/Free Full Text]
|
| 32.
|
Ho, S. P.,
Bao, Y.,
Lesher, T.,
Malhorta, R., Ma, L. Y.,
Fluharty, S. J.,
and Sakai, R. R.
(1998)
Nat. Biotechnol.
16,
59-63[Medline]
[Order article via Infotrieve]
|
| 33.
|
Matveeva, O.,
Felden, B.,
Audlin, S.,
Gesteland, R. F.,
and Atkins, J. F.
(1997)
Nucleic Acids Res.
25,
5010-5016[Abstract/Free Full Text]
|
| 34.
|
Lieber, A.,
and Strauss, M.
(1995)
Mol. Cell. Biol.
15,
540-551[Abstract]
|
| 35.
|
Bramlage, B.,
Luzi, E.,
and Eckstein, F.
(2000)
Nucleic Acids Res.
28,
4059-4067[Abstract/Free Full Text]
|
| 36.
|
Pierce, M. L.,
and Ruffner, D. E.
(1998)
Nucleic Acids Res.
26,
5093-5101[Abstract/Free Full Text]
|
| 37.
|
Sriram, B.,
and Benerjea, A. C.
(2000)
Biochem. J.
352,
667-673
|
| 38.
|
Sioud, M.
(1997)
Nucleic Acids Res.
25,
333-338[Abstract/Free Full Text]
|
| 39.
|
Cairns, M. K.,
Hopkins, T. M.,
Witherington, C.,
and Sun, L.-Q.
(2000)
Antisense Nucleic Acid Drug Dev.
10,
323-332[Medline]
[Order article via Infotrieve]
|
| 40.
|
Santoro, S. W.,
and Joyce, G. F.
(1998)
Biochemistry
37,
13330-13342[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Bramlage, B.,
Alefelder, S.,
Marschall, P.,
and Eckstein, F.
(1999)
Nucleic Acids Res.
15,
3159-3167
|
| 42.
|
Amarzguioui, M.,
Brede, G.,
Babaie, E.,
Grøtli, M.,
Sproat, B.,
and Prydz, H.
(2000)
Nucleic Acids Res.
28,
4113-4124[Abstract/Free Full Text]
|
Copyright © 2002 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Donini, M. Clerici, J. Wengel, B. Vester, and A. Peracchi
The Advantages of Being Locked: ASSESSING THE CLEAVAGE OF SHORT AND LONG RNAs BY LOCKED NUCLEIC ACID-CONTAINING 8 17 DEOXYRIBOZYMES
J. Biol. Chem.,
December 7, 2007;
282(49):
35510 - 35518.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. K. Silverman
In vitro selection, characterization, and application of deoxyribozymes that cleave RNA
Nucleic Acids Res.,
November 11, 2005;
33(19):
6151 - 6163.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Suenaga, R. Liu, Y. Shiramasa, and T. Kanagawa
Novel Approach to Quantitative Detection of Specific rRNA in a Microbial Community, Using Catalytic DNA
Appl. Envir. Microbiol.,
August 1, 2005;
71(8):
4879 - 4884.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Chen, R. Wang, Z. Li, B. Liu, X. Wang, Y. Sun, D. Hao, and J. Zhang
A novel replicating circular DNAzyme
Nucleic Acids Res.,
April 28, 2004;
32(8):
2336 - 2341.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. V. Sidorov, J. A. Grasby, and D. M. Williams
Sequence-specific cleavage of RNA in the absence of divalent metal ions by a DNAzyme incorporating imidazolyl and amino functionalities
Nucleic Acids Res.,
March 5, 2004;
32(4):
1591 - 1601.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Bonaccio, A. Credali, and A. Peracchi
Kinetic and thermodynamic characterization of the RNA-cleaving 8-17 deoxyribozyme
Nucleic Acids Res.,
February 12, 2004;
32(3):
916 - 925.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Schubert, D. C. Gul, H.-P. Grunert, H. Zeichhardt, V. A. Erdmann, and J. Kurreck
RNA cleaving '10-23' DNAzymes with enhanced stability and activity
Nucleic Acids Res.,
October 15, 2003;
31(20):
5982 - 5992.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Grunweller, E. Wyszko, B. Bieber, R. Jahnel, V. A. Erdmann, and J. Kurreck
Comparison of different antisense strategies in mammalian cells using locked nucleic acids, 2'-O-methyl RNA, phosphorothioates and small interfering RNA
Nucleic Acids Res.,
June 15, 2003;
31(12):
3185 - 3193.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-A. Langlois, Y. E. Fakhry, and W. Mourad
Zinc-binding Sites in the N Terminus of Mycoplasma arthritidis-derived Mitogen Permit the Dimer Formation Required for High Affinity Binding to HLA-DR and for T Cell Activation
J. Biol. Chem.,
June 13, 2003;
278(25):
22309 - 22315.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Zaborowska, J. P. Furste, V. A. Erdmann, and J. Kurreck
Sequence Requirements in the Catalytic Core of the "10-23" DNA Enzyme
J. Biol. Chem.,
October 18, 2002;
277(43):
40617 - 40622.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Kurreck, E. Wyszko, C. Gillen, and V. A. Erdmann
Design of antisense oligonucleotides stabilized by locked nucleic acids
Nucleic Acids Res.,
May 1, 2002;
30(9):
1911 - 1918.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2002 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|