|
Originally published In Press as doi:10.1074/jbc.M206267200 on October 28, 2002
J. Biol. Chem., Vol. 278, Issue 1, 139-146, January 3, 2003
Differential Expression of Tapasin and Immunoproteasome Subunits
in Adenovirus Type 5- Versus Type 12-transformed Cells*
Alfred C. O.
Vertegaal ,
H. Bea
Kuiperij,
Ada
Houweling,
Matty
Verlaan,
Alex J.
van der Eb, and
Alt
Zantema§
From the Medical Genetic Centre-Department of Molecular Cell
Biology, Leiden University Medical Center, Wassenaarseweg 72, 2333 AL
Leiden, The Netherlands
Received for publication, June 24, 2002, and in revised form, October 18, 2002
 |
ABSTRACT |
Adenovirus type 12 (Ad12)-transformed baby
rat kidney (BRK) cells are oncogenic in syngeneic immunocompetent rats
in contrast to adenovirus type 5 (Ad5)-transformed BRK cells, which are
not oncogenic in these animals. A significant factor contributing to
the difference in oncogenicity may be the low levels of major histocompatibility complex (MHC) class I membrane expression in Ad12-transformed BRK cells as compared with those in Ad5-transformed BRK cells, which presumably results in escape from killing by cytotoxic
T lymphocytes. Here we show that, in addition to the decreased
levels of expression of the MHC class I heavy chain and the peptide
transporter Tap-2, the expression levels of the chaperone Tapasin and
the immunoproteasome components MECL-1, PA28- , and PA28- also are
much lower in Ad12- than in Ad5-transformed BRK cells. The low
expression levels of these proteins may contribute to the escape from
killing by cytotoxic T lymphocytes, because the generation of optimal
peptides and loading of these peptides on MHC class I require these
components. Increased levels of phosphorylated signal transducer and
activator of transcription-1 protein and expression of IFN regulatory
factor-7 were found in Ad5- versus Ad12-transformed BRK
cells. Therefore, the critical alteration leading to the plethora of
differences may be an interferon (-related) effect.
 |
INTRODUCTION |
Oncogenic transformation of cells involves multiple events,
including activation of oncogenes, inactivation of tumor suppressor genes, and extension of lifespan or immortalization. The lifespan of
primary cells is normally restricted to a defined number of cell
divisions, but after transformation the cells usually become immortal.
Another frequently observed parameter of transformation is the ability
to grow in an unrestricted fashion in a living organism, either in the
absence of the T-cell immune defense (nude mice) or in the presence of
immune defense (immunocompetent animals). Because transformed cells
usually express neoantigens, oncogenicity in immunocompetent organisms
requires escape from the T-cell immune surveillance by cytotoxic T lymphocytes.
A suitable model to study differences in oncogenicity is the adenovirus
transformation system (1). The transforming activity of adenoviruses
(Ad)1 is a function of the
early region 1 (E1) of the viral genome, which encodes the E1A and E1B
proteins (2). Primary baby rat kidney (BRK) cell cultures can be
transformed by most human Ad serotypes, but only cells transformed by
the oncogenic subgroup A adenoviruses are oncogenic in syngeneic
animals. Studies on the differences between cells transformed by the
non-oncogenic Ad5 and oncogenic Ad12 have led to the identification of
a number of differentially expressed cellular genes that could explain the differences in oncogenicity of these cells. Among these are the MHC
class I genes, which are down-regulated in Ad12-transformed cells (3).
Absence of MHC class I antigens might be particularly important with
respect to the escape from the T-cell immune surveillance (4). As a
result of the lack of MHC class I membrane expression, viral peptides
cannot be presented to the immune system, which causes these cells to
escape from elimination by cytotoxic T cells.
Down-regulation of membrane expression of MHC class I protein is caused
in part by decreased levels of transcription of the MHC class I heavy
chain genes (5-7) but is also because of the low expression level of
the Tap protein (8, 9). Low Tap protein levels severely limit the
amount of peptides available for presentation by MHC class I molecules
(10). Because only trimeric complexes consisting of MHC class I heavy
chain, light chain ( 2-microglobulin), and peptide are stable,
limited availability of peptides severely affects the amount of
membrane-expressed MHC class I antigens (10-14). The availability of
optimal peptides might be limited further by the low expression levels
of two -interferon-inducible components of the proteasome, LMP-2 and
LMP-7, in Ad12-transformed cells (15, 9).
In an attempt to restore MHC class I membrane expression in
Ad12-transformed cells, we have generated in the present study Ad12-transformed BRK cells that are stably transfected with a plasmid
encoding RT1-Au, the MHC class I heavy chain of the rat
strain used for these studies, and a plasmid encoding Tap-2. Despite
the fact that the genes were expressed as RNA, these cells did not show
an increase in MHC class I membrane expression. Additional
characterization of Ad5- and Ad12-transformed BRK cells revealed that
the chaperone protein Tapasin, as well as MECL-1 and PA28- and - ,
three proteins involved in the generation of peptides that can be
presented on MHC class I (16), are expressed at higher levels in Ad5-
than in Ad12-transformed BRK cells. We present evidence that
differential expression of this set of genes can be explained by
differences in the activity of STAT-1, a transcription factor involved
in the control of expression of these genes (17-20). STAT-1 has been identified as a downstream component of the interferon signal transduction pathway (21, 22), and its functional activation was
reflected in the expression of IRF-7 in Ad5-transformed BRK cells but
not in Ad12-transformed BRK cells (23).
 |
EXPERIMENTAL PROCEDURES |
Plasmids and Antibodies--
A partial RT1-Au
cDNA, RT16, has been described (24). Cloning of the 5' part was
based on the homology of RT1-A. RT16 lacks only bp 1040-1042 of the
RT1.Al, whereas 17 of 18 bp around the RT1.Al
translational start codon are identical with the corresponding region
of RT1.Aa. Therefore, an upstream oligo, U1, corresponding
to the RT1.Al sequence, and a downstream oligo, D1, derived
from RT16 (24), were used for RT-PCR of total RNA from the
Ad5-transformed BRK cell line BXc22, which expresses high levels of
RT1-Au (see Fig. 1B) (25). The PCR product of
473 bp was subcloned in the AT vector pCR2.1 (Invitrogen),
resulting in PCR2.1-RT1-Au 5'. The sequence of two
independently isolated clones was identical, and this sequence was
submitted to GenBankTM (accession number AF400159).
The 489-bp EcoRI fragment of plasmid
pCR2.1-RT1-Au 5' was inserted in the EcoRI site
of pBluescript (Stratagene, La Jolla, CA), resulting in
pBluescript-RT1-Au 5'. The full-length RT1-Au
cDNA was constructed in a two-step procedure, inserting the 504-bp StyI/PstI fragment of RT16 in the
StyI/PstI sites of pBluescript-RT1-Au
5' and subsequently the 783-bp PstI fragment of RT16. The
pcDNA3.1-RT1-Au expression vector was made by inserting
the HindIII/XbaI fragment of
pBluescript-RT1-Au, which encodes full-length
RT1-Au, in the HindIII and XbaI site
of pcDNA3.1 (Invitrogen). The sequence of
pBluescript-RT1-Au was reconfirmed.
The rat Tap-2 expression plasmid was constructed by cloning the
BamHI-XhoI fragment from pBluescript-rTap-2 (a
kind gift from Dr. F. Momburg, German Cancer Research Center,
Heidelberg, Germany) into the BamHI and XhoI
sites of plasmid pcDNA3.1 (Invitrogen). The mouse Tapasin
expression construct pREP8-mTapasin (26) was a kind gift from Dr. A. Grandea III (Vanderbilt University, Nashville, TN).
The mouse monoclonal antibody U9F4 raised against rat MHC class I was
described previously (27). The rabbit polyclonal antibodies against
PA28- and - , MECL-1, and MC-3 (28) were kind gifts of Dr. A. Sijts (Humboldt University, Berlin, Germany). The rabbit polyclonal
antibodies against Tapasin (29), Tap-2 (14), NF- B1-p50/p105 (30),
and IFN- (31) were kind gifts of Dr. D. Williams (University of
Toronto, Toronto, Ontario, Canada), Dr. J. Howard (University of
Cologne, Cologne, Germany), Dr. N. Rice (Frederick Cancer Research and
Development Center, Frederick, MD), and Dr. P. van der Meide (Utrecht University, Utrecht, The Netherlands), respectively. Antibodies against total STAT-1 (9172) and phosphorylated STAT-1 (9171)
were obtained from Cell Signaling Technology, Inc. (Beverly, MA).
Cell Culture, DNA Transfection, and Generation of Stably
Transfected Cell Lines--
BRK cells transformed with the
early region 1 of Ad5 or Ad12 were described elsewhere (25). Monoclonal
cell lines 33RT60 and 33RT61 were established by transfection of
Ad12E1-transformed BRK cell line RICc33 with plasmid
pcDNA3.1-RT1-Au and subsequent selection for G418
resistance. Polyclonal cell lines expressing Tapasin, Tap-2, or both
proteins and control lines were established by transfection of 33RT60
with the empty expression vector pcDNA3.1, the plasmid
pREP8-mTapasin, or the plasmid pcDNA3.1-Tap-2 or co-transfected
with both expression plasmids. The pECV5 plasmid, which encodes the
Hygromycin resistance gene, was included in all these transfections,
and subsequently cells were selected for hygromycin resistance.
AdE1-transformed cells were cultured in minimum Eagle's medium,
supplemented with 10% newborn calf serum and antibiotics. U2OS cells
were cultured in Dulbecco's modified Eagle's medium, supplemented
with 10% fetal-calf serum and antibiotics. Tissue culture media and
sera were purchased from Invitrogen. All tissue culture plastics
were obtained from Greiner. Treatment with 100 units/ml IFN-
(Invitrogen) or 1000 units/ml TNF- (Sigma) was performed for the
indicated periods of time. Transfections were performed using the
TFX-50 transfection protocol according to the instructions of the
manufacturer (Promega) or using the calcium-phosphate protocol as
described previously (32).
Western Blot Analysis--
Total cell extracts were fractionated
by SDS/PAGE on 10% or 12.6% gels. Proteins were transferred onto
Immobilon-P membranes (Millipore) and incubated with specific primary
antibodies as indicated. As secondary antibodies
horseradish-peroxidase-coupled goat anti-rabbit and rabbit anti-mouse
IgG (Jackson) were used. The bound antibodies were visualized with the
ECL detection system according to the manufacturer's protocol
(Amersham Biosciences).
Metabolic Labeling and Immunoprecipitations--
Exponentially
growing cells were labeled for 1-6 h with
[35S]methionine and lysed in IPB.14 as described
previously (33). MHC class I proteins were immunoprecipitated with the
mouse monoclonal antibody U9F4 (27), and Tapasin was immunoprecipitated
with a rabbit polyclonal antibody raised against mouse Tapasin (29). Immunoprecipitated proteins were fractionated by SDS-PAGE on 10% gels
(Tapasin) or 12.6% gels (MHC class I). Proteins were visualized by autoradiography.
Northern Blot Analysis and RT-PCR--
Total RNA was isolated
from exponentially growing cells as described previously (34).
poly(A)+ enrichment was performed using the mRNA
isolation kit according to the instructions of the manufacturer (Roche
Molecular Biochemicals). 10 µg of total RNA or 5 µg of
poly(A)+ enriched RNA was size fractionated on a 1%
agarose/2.2 M formaldehyde gel by electrophoresis and
transferred to Hybond filters (Amersham Biosciences). Filters were
hybridized for RT1-Au with the 0.9-kb
PvuII/EcoRI fragment of the
pcDNA3.1-RT1-Au expression vector, with the 0.8-kb
KpnI/SacI fragment of pBluescript-rTap-2 for
Tap-2, with the 1.3-kb HindIII/EcoRI fragment of
pREP8-mTapasin for Tapasin, and with the PstI fragment of
the rat GAPDH cDNA for GAPDH. For RT-PCR RNA isolation and cDNA
preparation were as described previously by Martens et al.
(35). The primers used were as follows: as control rat
elongation factor 1, AAGCTGAGCGTGAGCGTG and CGGGTGACTTTCCATCCC (464 bp); rat IRF-7, GCAGCAGTGGTTCTGAAC and GGCGACAAGGATCACCAC (293 bp); rat
IFN- , GTGACGGGTGCATCACCTCC and CCACTGCCCTCTCCATCGAC (153 bp);
IFN- (consensus primers annealing with all mouse IFN subtypes),
AGGGCTCTCCAGAYTTCTGCTCTG and ATGGCTAGRCTCTGTGCTTTCCT (524 bp)
(36).
Cell Surface Protein Expression--
Exponentially growing cells
were harvested by mild trypsinization. Approximately 2 × 105 cells were incubated for 30 min on ice with 30 µl of
U9F4 hybridoma tissue culture supernatant 1:1 diluted with PBA
(phosphate-buffered saline containing 0.5% bovine serum albumin). The
cells were washed twice with PBA and incubated with fluorescein
isothiocyanate-conjugated goat-anti-mouse antibody (Jackson) for 30 min
on ice. Controls were stained with fluorescein
isothiocyanate-conjugated goat-anti-mouse antibody only. Subsequently,
the cells were washed twice with PBA, and the fluorescence intensity
was analyzed by the FACSCalibur (BD Biosciences).
 |
RESULTS |
Overexpression of RT1-Au Heavy Chain mRNA in
Ad12-transformed BRK Cells Is Not Sufficient to Restore
Expression--
The rat MHC class I protein RT1-Au is
strongly down-regulated in Ad12-transformed BRK cells, which is assumed
to contribute to the oncogenicity of these cells in syngeneic Wag-Rij
rats (3). In an attempt to functionally restore RT1 membrane
expression, we have cloned the cDNA encoding the major RT1 allele
expressed in this rat strain, RT1-Au. The
RT1-Au expression construct was sequence-verified, and the
protein could be detected after transient transfection in U2OS cells
(Fig. 1A). Contrary to the
result in U2OS cells, stable overexpression of RT1-Au
mRNA in Ad12-transformed BRK cells (Fig. 1B) does not
lead to high protein levels (Fig. 1C). In 23 independent
monoclonal cell lines, no increase in RT1-Au protein levels
was observed. This result suggests that in these Ad12-transformed cells
additional alterations impair the formation of stable MHC class I
molecules presenting peptides at the cell surface.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 1.
Overexpression of RT1-Au heavy
chain in Ad12-transformed BRK cells. A, autoradiogram
of immunoprecipitated RT1-Au from
[35S]methionine-labeled Ad5-transformed cells (clone
BXc22), Ad12-transformed cells (clone RICc33), and U2OS cells
transfected with pcDNA3.1-RT1-Au. B,
Northern blot of RT1-Au mRNA in Ad5-transformed cells
(clone BXc22), Ad12-transformed cells (clone RICc33), and two
monoclonal cell lines (33RT60 and 33RT61) of the Ad12-transformed cells
transfected with pcDNA3.1-RT1-Au. As a loading control,
GAPDH expression was determined. C, overexpression of
RT1-Au in Ad12-transformed BRK cells is not sufficient to
restore MHC class I protein levels. Shown is an autoradiogram of
immunoprecipitated RT1-Au from
[35S]methionine-labeled Ad5-transformed cells (clone
BXc22), Ad12-transformed cells (clone RICc33), and two monoclonal cell
lines (33RT60 and 33RT61) of the Ad12-transformed cells transfected
with pcDNA3.1-RT1-Au.
|
|
Tap-2 and Tapasin Are Expressed Differentially in Ad5- and
Ad12-transformed Cells--
Stable MHC class I protein expression
requires the availability of small peptides that can be presented by
the heavy chain molecule (12, 13, 37). Peptide loading is a function of the Tap proteins, which are known to be hardly expressed in
Ad12-transformed mouse cells (8). Restoring Tap-2, but not Tap-1,
partially restored MHC class I membrane expression in the published
mouse model. Fig. 2A shows
that the Tap-2 protein levels in Ad5-transformed BRK cells are also
much higher than in Ad12-transformed BRK cells. As a control, we
identified the levels of NF- B1-p105 (Fig. 2A), which, as
we showed previously, are identical in Ad5- and
Ad12-transformed BRK cells (25). The difference in Tap-2
level is in line with the difference in Tap-2 mRNA expression (Fig.
2C).

View larger version (69K):
[in this window]
[in a new window]
|
Fig. 2.
Tap-2 and Tapasin are expressed
differentially in Ad5- and Ad12-transformed BRK cells.
A, Western blot of total cell lysates of the indicated Ad5-
and Ad12-transformed BRK cells stained for NF- B1-p105, as a control,
and Tap-2. B, Tapasin was immunoprecipitated from the
cleared lysates of exponentially growing Ad5- and Ad12-transformed BRK
cells labeled with [35S]methionine, and the
immunoprecipitates were size-fractionated by SDS-PAGE.
n.s., non-specific. C, Northern blots of
poly(A)+-enriched RNA from Ad5-transformed cells (clone
BXc22) and Ad12-transformed cells (clone RICc33) hybridized for Tap-2
or for Tapasin. As a loading control, GAPDH expression was
determined.
|
|
Another protein involved in MHC class I membrane expression (38) is
Tapasin, a chaperone protein in the endoplasmic reticulum (39).
Therefore, this protein is a candidate that might be involved in
differential MHC class I membrane expression in Ad-transformed cells.
Hence, we determined the Tapasin protein levels in Ad5- and
Ad12-transformed BRK cells. As shown in Fig. 2B, Tapasin is expressed to a higher level in Ad5- than in Ad12-transformed BRK cells.
This is probably because of the difference in Tapasin mRNA expression (Fig. 2C).
To test whether Tap-2 and Tapasin might be sufficient to restore MHC
class I membrane expression, polyclonal cell lines that stably
overexpress Tap-2, Tapasin, or both proteins were established using
33RT60, the Ad12-transformed BRK cell line stably overexpressing the
RT1-Au mRNA, as the parental cell line. Tapasin protein
levels in these stable cell lines (Fig.
3A, lanes 4 and
5) were somewhat higher than the endogenous Tapasin protein
levels in Ad5-transformed cells (lane 1). Tap-2 protein
levels (lanes 3 and 5) were not as high as in
Ad5-transformed cells but were strongly increased compared with the
level in the parental cell line transfected with the empty expression
construct (lane 2). However, no increase in MHC class I
membrane expression was observed in any of these polyclonal cell lines,
compared with that in the parental control line (Fig. 3B).
Similar results were found in a second set of polyclonal cell lines
(data not shown). Therefore, RT1-Au, Tap-2, and Tapasin are
not sufficient to restore MHC class I membrane expression in
Ad12-transformed cells. The capacity of these cells to express
RT1-Au was demonstrated by the stimulation of the
expression by IFN- (Fig. 3B, B4).

View larger version (26K):
[in this window]
[in a new window]
|
Fig. 3.
Restoring expression of RT1-Au,
Tapasin, and Tap-2 is not sufficient to restore cell surface expression
of MHC class I in Ad12-transformed BRK cells. A,
Western blots for NF- B1-p105, as a control, Tap-2, and Tapasin of
total cell lysates of Ad5-transformed cells (clone BXc22) and
polyclonal cell lines obtained by transfection of 33RT60, the
Ad12-transformed cell line stably expressing RT1-Au
mRNA, with an expression vector encoding Tap-2 (lanes 3 and 5) and/or an expression vector encoding Tapasin
(lanes 4 and 5) or an empty expression vector
(lane 2). B, FACS analysis of the
RT1-Au cell surface expression in Ad12-transformed BRK
cells stably expressing Tap-2 (B1, dotted line),
Tapasin (B2, dotted line), or both proteins
(B3, dotted line). B4, cell surface
RT1-Au levels of the stable polyclonal cell line expressing
RT1-Au mRNA and Tap-2 and Tapasin proteins
(unbroken line) is induced by IFN- treatment
(dotted line). Filled histograms represent only
secondary antibody.
|
|
Induction of MHC Class I in Ad12-transformed Cells--
It is well
established that many genes encoding antigen presentation factors are
targets for IFN- . As expected, IFN- treatment could restore MHC
class I membrane expression in Ad12-transformed cells (Fig.
4, A1), to a level comparable
with the MHC class I expression in Ad5-transformed cells (Fig. 4,
A2). A possible explanation for the difference between Ad5-
and Ad12-transformed cells could be that Ad5-transformed cells produce
interferon. Therefore we tested whether the conditioned medium from
Ad5-transformed BRK cells could induce MHC class I membrane expression
in Ad12-transformed cells. As shown in Fig. 4B induction was
always observed although the magnitude of the effect depends on the
conditioned medium used. Some conditioned medium led to an
induction comparable with the effect of IFN- . Analysis of media from
Ad5-transformed mouse cells showed that these cells do not produce
mouse IFN- (data not shown). Previously, it has been shown that
Ad5-transformed cloned rat embryo fibroblasts, in contrast to
Ad12-transformed fibroblasts, express IFN- mRNA (40, 41).
Therefore, we tested our panel of Ad-transformed BRK clones for
expression of IFN- by quantitative RT-PCR (Fig. 4C).
Expression of IFN- could be demonstrated in two of the three
Ad5-transformed BRK cells but not in the Ad12-transformed BRK cells.
Analysis of the expression of IFN- is hampered as for rat IFN-
only a single cDNA has been published (42) whereas IFN- consists
of a large family of closely related members in mice (23). A comparable
intensity was found for all cell lines tested with the strongest signal
with a degenerate primer set for mice IFN- (36) (Fig.
4C). These results suggest that IFN- could be responsible
for the conditioned medium effect. To determine whether the amounts of
IFN- present in the conditioned medium of Ad5-transformed BRK cells
are indeed responsible for the induction of MHC class I in
Ad12-transformed BRK cells, an IFN- neutralizing antibody (31) was
added to the conditioned medium. The neutralizing antibody reduced the
conditioned medium effect to 57% (data not shown). Interestingly, this
was found for the conditioned medium from the Ad5-transformed BRK clone 22. This indicates that although we fail to detect IFN- expression by quantitative RT-PCR, the amount of IFN- produced by this cell line is still of significant biological relevance. The inability to
observe an effective block by anti IFN- of MHC class I membrane expression in Ad5 cells (data not shown) might imply that
Ad5-transformed cells produce other MHC class I inducing cytokines.

View larger version (35K):
[in this window]
[in a new window]
|
Fig. 4.
IFN- and conditioned
media of Ad5-transformed BRK cells can induce MHC class I cell surface
expression of Ad12-transformed cells. A, FACS analysis
of cell surface expression of RT1-Au of (A1)
Ad12-transformed BRK cells (clone RICc35) and its induction after
growth for 3 days with 100 units/ml IFN- and for comparison
(A2) analysis of the expression of Ad5-transformed cells
(clone BXc23). Control staining with secondary antibody only is shown
as filled black graphs. B, cell surface
expression of RT1-Au of Ad12-transformed BRK cells (clone
RICc35) (B1, B2) and its induction after growth
for 3 days on 50% conditioned medium from Ad5-transformed BRK cells
clone BXc22 (B1) or clone BXc23 (B2).
Filled black graphs are control staining with secondary
antibody only. C, RT-PCR for the mRNA expression of
elongation factor 1 (EF1), IFN- , and IFN- in Ad5- and
Ad12-transformed BRK cells.
|
|
Differential Expression of IFN- Target Genes--
The ability
of interferons to induce MHC class I antigen suggests that IFN-target
genes might be expressed differentially in Ad5- and Ad12-transformed
BRK cells. Known IFN- target genes involved in antigen presentation
are the immunoproteasome subunit MECL-1 (43) and the proteasome
activator subunits PA28- and - (44-48). These proteins were
found to be expressed to a much higher level in Ad5- than in
Ad12-transformed BRK cells (Fig. 5).
Previous studies already demonstrated that LMP-2 and -7, two IFN- -inducible proteasome subunits, are also expressed at much higher levels in Ad5- than in Ad12-transformed cells (15). Differential regulation of LMP-2 and -7, MECL-1, and PA28- and - could imply that Ad5-transformed BRK cells have higher proteasome levels than Ad12-transformed BRK cells. However, this is not the case, because the
constitutive proteasome subunit MC-3 is expressed somewhat higher in
Ad12- than in Ad5-transformed BRK cells (Fig. 5).

View larger version (94K):
[in this window]
[in a new window]
|
Fig. 5.
Differences of IFN-
inducible genes in Ad5- and Ad12-transformed BRK cells.
Western blot of total cell lysates of Ad5- (lanes 1-3) and
Ad12-transformed BRK cells (lanes 4-6) for MECL-1, PA28-
and - , MC-3, and NF- B1-p105 protein levels.
|
|
IFN- , but Not TNF , Restores Tap-2, MECL-1, and PA28- and
- Expression in Ad12-transformed BRK Cells--
Constitutive
activation of IFN-inducible genes in Ad5-transformed cells suggests a
difference in the activity of IFN signaling pathways between Ad5- and
Ad12-transformed cells. Hence, we studied whether IFN- treatment
could enhance the protein levels of Tap-2, MECL-1, and PA28- and
- in Ad5- and Ad12-transformed BRK cell lines. Cells were treated
with IFN- for 7 h (Fig.
6A, lanes 2 and
8), 24 h (lanes 5 and 11), or
48 h (lanes 6 and 12) or were left untreated
(lanes 1 and 7). As expected, IFN- could
indeed induce Tap-2, MECL-1, and PA28- and - expression in the
Ad12-transformed cells (Fig. 6A) (data not shown). After
48 h of IFN- treatment, protein levels of these antigen
presentation components in Ad12-transformed cells were comparable with
the protein levels in untreated Ad5-transformed cells. In contrast to
the strong IFN- protein induction in Ad12-transformed BRK cells,
IFN- hardly affected MECL-1 and PA28- and - expression levels
in Ad5-transformed cells although Tap-2 expression was enhanced.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 6.
IFN- but not
TNF- restores Tap-2, MECL-1, and
PA28- and -
expression in Ad12-transformed BRK cells. A,
exponentially growing Ad5- (lanes 1-6) and Ad12-transformed
BRK cells (lanes 7-12) were treated for the indicated
periods of time with IFN- , TNF- , or with both cytokines. Western
blots of total cell lysates were analyzed for Tap-2, MECL-1, and
PA28- and as a loading control for NF- B1-p105. B,
Western blots for TNF- -mediated (30 min) I B processing in
Ad12-transformed BRK cells (clone RICc33). NF- B1-p105 was determined
as a control. C, up-regulation of PA28- and Tap-2 protein
levels in Ad12-transformed BRK cells by conditioned medium from
Ad5-transformed BRK cells. Exponentially growing RICc35 cells
(lanes 1-3) and RICc33 cells (lanes 4-6) were
grown for 3 days on fresh cell culture medium (lanes 1 and
4) or on fresh cell culture medium diluted 1:1 with cell
culture medium conditioned by BXc22 cells (lanes 2 and
5) or BXc23 cells (lanes 3 and 6).
Western analysis blots of total lysates were stained for Tap-2,
PA28- , and NF- B1-p105. As a control, Ad5-transformed BRK cell
lines BXc22 (lane 7) and BXc23 (lane 8) were
included.
|
|
Previously we and others have shown that Ad5- and Ad12-transformed BRK
cells differ in their basal NF- B activity, which could partially
explain the differences in MHC class I heavy chain expression between
these cells (25, 40, 49). In addition, we have shown that TNF- is a
strong NF- B inducer in Ad5- and Ad12-transformed BRK cells (50),
confirmed in Ad12-transformed cells by the induction of the degradation
of I B (Fig. 6B). Interestingly, several of the
differentially expressed genes have established (51, 52) or putative
NF- B binding sites. Therefore, we studied the effect of TNF- on
the expression of antigen presentation machinery components but did not
find any alteration (Fig. 6A) (data not shown).
The differences in the expression levels of antigen presentation
machinery components between Ad5- and Ad12-transformed BRK cells and
the expression of IFN- by Ad5-transformed BRK cells indicate a
difference in activity of the IFN signal transduction pathway between
these cells. The transcription factor STAT-1 mediates the induction of
MHC class I in response to interferons (21). We have examined the total
protein levels of this transcription factor and found that
Ad5-transformed cells contain more STAT-1 than Ad12-transformed cells
(Fig. 7A). Activation of
STAT-1 occurs via phosphorylation of tyrosine 701 (53). Consistent with
the hypothesis of active interferon signaling in Ad5-transformed cells, STAT-1 is phosphorylated on Tyr-701 in Ad5-transformed cells but not in Ad12-transformed cells. STAT-1 is part of the heterotrimeric transcription factor ISGF3, which regulates IRF-7 expression as part of
the multistage IFN response (23). Using quantitative RT-PCR, we found
that IRF-7 was expressed in Ad5-transformed BRK cells but not in
Ad12-transformed BRK cells (Fig. 7B). Ad12-transformed cells
are still able to activate the interferon signal transduction pathway,
because IFN- treatment caused phosphorylation of STAT-1 (Fig. 7,
lanes 7 and 8)

View larger version (71K):
[in this window]
[in a new window]
|
Fig. 7.
Active STAT-1 in Ad5-transformed BRK
cells. A, Western blot for NF- B1-p105, as a control,
STAT-1, and phosphorylated STAT-1 of total cell lysates of Ad5-
(lanes 1-3) and Ad12-transformed BRK cells (lanes
4-8) and an Ad12-transformed BRK cell line treated for the
indicated periods of time with IFN- (lanes 7 and
8). B, RT-PCR for the mRNA expression of
elongation factor 1 (EF1) and IRF-7 in Ad5- and
Ad12-transformed BRK cells.
|
|
In conclusion, the increased expression of genes involved in antigen
presentation in Ad5-transformed cells can be induced in
Ad12-transformed cells by IFN- and also by the conditioned media of
Ad5-transformed cells, as shown for Tap-2 and PA28 in Fig.
6C. The transcription factor that mediates the interferon response, STAT-1, is active in Ad5-transformed cells but not in Ad12-transformed cells, indicating that the difference in antigen presentation between Ad5- and Ad12-transformed cells is partly determined by the production of an IFN (-like) activity in
Ad5-transformed cells, most likely IFN- .
 |
DISCUSSION |
Differential membrane expression of MHC class I antigens in Ad5-
and Ad12-transformed cells most likely contributes to the observed
differences in oncogenicity between these cells in immunocompetent animals. Here we show that the Tapasin protein, a chaperone that is
part of the MHC class I peptide loading complex, and several components
of the peptide generating machinery, MECL-1 and PA28- and - , are
also expressed at much lower levels in Ad12- than in Ad5-transformed
BRK cells. Furthermore, we confirm a very striking difference in
expression of the peptide transporter Tap-2 at the protein level
between these cells.
The down-regulation of several gene products involved in the generation
and presentation of peptides in the context of MHC class I antigens
implies that several genes may have to be re-expressed in
Ad12-transformed cells to attain higher levels of surface MHC class I
antigens. Indeed, we found that overexpression of the RT1-Au class I MHC heavy chain cDNA in Ad12-transformed
BRK cells did not lead to increased protein expression. This is
possibly because of the fact that the U9F4 antibody recognizes only
properly folded trimeric MHC class I complexes consisting of one heavy
chain, one light chain ( 2-microglobulin), and a peptide (12) and not free heavy chain protein (13, 37). Formation of the trimeric complex is
impaired because of limited availability of suitable peptides in the
endoplasmic reticulum as a result of the low levels of Tap-1 and -2, Tapasin, LMP-2 and -7, MECL-1, and PA28- and - in the
Ad12-transformed cells (8, 9, 15).
For proper loading of peptides on the MHC class I chains the Tap and
Tapasin proteins are required. The heterodimeric Tap complex functions
by transporting peptides from the cytosol to the endoplasmic reticulum
(reviewed in Refs. 54-56). Mice lacking Tap-1 (10) and mutant cell
lines lacking one or both Tap subunits (14, 57-59) fail to express MHC
class I complexes on their cell membranes, thus demonstrating that Tap
is an essential component of the antigen presentation machinery. In
agreement with a previous report (8), we found a strikingly decreased
level of Tap-2 in Ad12-transformed cells.
The role of Tapasin in the formation of MHC class I antigens is
illustrated by the fact that Tapasin-deficient mice show a 10-fold
decreased MHC class I cell surface expression (38, 39). Tapasin
functions in the MHC class I peptide loading complex by binding
independently to Tap and the MHC class I heavy chain, thus enhancing
the loading of peptides (29, 55, 60, 61). Tapasin binding stabilizes
Tap, resulting in increased Tap protein levels (62), which is also
apparent in our experiments (Fig. 3). In view of the significant
contribution of Tapasin to antigen presentation, it seems likely that
reduced Tapasin expression in Ad12-transformed BRK cells also plays a
role in the low MHC class I cell surface expression. However, restoring
Tapasin expression, even in combination with RT1-Au and
Tap-2, is not sufficient to restore MHC class I cell surface expression
(Fig. 3). Possibly, in contrast to results of a previous report (8),
Tap-1 overexpression is required in these Ad12-transformed BRK cells.
Alternatively, insufficient availability of optimal peptides could be
responsible for the effect, although low expression levels of the
immunoproteasome subunits do not necessarily result in generation of
low levels of peptides (14, 59, 63). However, the peptides generated in
Ad12-transformed cells compared with those in Ad5-transformed cells may
be less optimal for presentation as a result of low MECL-1 and PA28-
and - levels (Fig. 5) and the low LMP-2 and -7 levels reported
previously (15). MECL-1, LMP-2, and LMP-7 are IFN- -responsive genes
and functionally replace the constitutive 20 S catalytic proteasome
-subunits X, Y, and Z (16, 44, 64-66). These replacements enhance
cleavage after hydrophobic and basic residues, which improves the
generation of some but not all peptides presented by MHC class I
molecules. In addition, the proteasome activator PA28 complex, which is
also induced by IFN- , enhances optimal peptide formation by keeping the proteasome exit open, thus reducing the processivity that supposedly results in increased average length of the generated peptides (44, 48, 64).
Differential expression in Ad5- and Ad12-transformed cells of several
components of the antigen presenting machinery suggests a common
regulatory mechanism. We have shown previously that transcriptional down-regulation of MHC class I genes can be attributed to the H2TF1
element in the mhcI promoter (25, 49, 67), which is regulated by NF- B family members (68, 69). Consistently, basal
NF- B activity is very low in Ad12-transformed cells, and ectopic
expression of NF- B1 partially restores MHC class I protein expression (25, 40, 49). The precise mechanism of NF- B down-regulation is not clear. Previous experiments indicated that the
levels of NF- B1-p50 are low in Ad12-transformed cells compared with
those in Ad5-transformed cells (25), whereas expression levels of the
precursor protein NF- B1-p105 were comparable. Surprisingly, we now
also find equal expression levels of NF- B1-p50 in Ad5- and
Ad12-transformed cells using a more potent
antibody.2 The specificity of
the antibody used in the latter study has been verified by Pereira
et al. (30) using cells from NF- B1-deficient mice. Hence,
the reason for the low activity of NF- B in Ad12-transformed cells is
still unclear. It has recently been shown that NF- B1-p50 is
hypophosphorylated in Ad12- compared with Ad5-transformed cells, and
this has been proposed to be the reason for the difference in NF- B
activity in these cells (70).
It is tempting to speculate that the large difference in NF- B DNA
binding activity between Ad5- and Ad12-transformed cells could possibly
be responsible for the various differences in gene expression. The
promoter of the PA28- gene (51) and the promoter of the human
Tapasin gene (71) indeed contain an NF- B binding site (52). However
TNF- , which is a very strong activator of NF- B in
Ad12-transformed BRK cells (50), does not directly induce PA28- and
Tapasin, nor Tap-2, MECL-1, and PA28- in Ad-transformed cells (Fig.
6A) (data not shown). Nevertheless, the TNF- pathway is
clearly functional in these Ad12-transformed cells as an
NF- B-dependent luciferase construct is induced 10-fold
upon treatment with TNF- (data not shown). However, these
experiments do not rule out a delayed NF- B effect, because NF- B
directly up-regulates IFN- (72-74), which in turn lead to induction
of MHC class I cell surface expression (75). To study the long term
effect of NF- B on MHC class I cell surface expression,
Ad12-transformed BRK cells were treated in the present study with
TNF- for 3 days and subjected to FACS analysis. No increase in MHC
class I cell surface expression of two independent Ad12-transformed BRK
cell lines was found (data not shown), making it unlikely that the
differences in NF- B activity in Ad5- and Ad12-transformed BRK cells
explain the difference in MHC class I cell surface expression.
In the present study, we present evidence that IFN-inducible genes may
be involved in the differential gene expression. We found that STAT-1
expression is higher and is phosphorylated on the activating Tyr in
Ad5-transformed cells but not in Ad12-transformed cells. It has been
demonstrated that even the presence of non-phosphorylated STAT-1 can
maintain basal MHC class I, 2-microglobulin, and LMP2 expression
relative to cells with no STAT-1 expression (20). Therefore, the
constitutively active STAT-1 in Ad5-transformed cells can explain why
these cells have high MHC class I cell surface expression whereas lower
expression and lack of activation of STAT-1 in Ad12-transformed cells
may explain down-modulation of class I in Ad12-transformed cells.
Activation of STAT-1 might imply active ISGF3, and indeed one of its
targets, IRF-7, was demonstrated to be expressed in Ad5- and not in
Ad12-transformed cells. The interferon response is a multistage
process, which requires active IRF-7 to reach the final stage in which
the members of the IFN- family are switched on (23, 36). Our results indicate that both Ad5- and Ad12- transformed cells express low levels
of IFN- , as found frequently in non-infected cells (76). This
indicates that IRF-7 expressed in Ad5-transformed BRK cells is not active.
Despite extensive studies to determine the molecular basis for the
difference in oncogenicity between Ad5- and Ad12-transformed cells no
definitive solution has been found. It is clear that reduced MHC class
I expression is not the only factor responsible for the effect, because
nearly every protein component of the antigen presentation machinery is
down-regulated in Ad12-transformed cells compared with Ad5-transformed
cells, including Tap-1 and -2 (8, 9) and LMP-2 and -7 (9, 15), as well
as Tapasin and the PA28 complex (this study). Attempts to restore the
expression levels of all these proteins in Ad12-transformed cells by
ectopic overexpression are hampered by the large number of factors
involved. It is conceivable that an upstream transcription factor that
co-regulates the expression level of all these genes involved in
antigen presentation is the actual trigger. Although previous data
suggested that reduced NF- B activity might be the factor responsible
for the low MHC class I heavy chain expression (25), our present study
indicates that an interferon-related pathway is a more likely
candidate. We present data indicating that the transcription factor
STAT-1, a key regulator of MHC class I cell surface expression
(19-21), is constitutively activated in Ad5- but not in
Ad12-transformed cells possible because of the differential expression
of IFN- . Future work should focus on the mechanism of differential
expression of STAT1 and IFN- by Ad5 and Ad12. So far the evidence
indicates that the Ad5- and Ad12-E1A proteins behave similarly in their association with cellular proteins, suggesting that subtle structural differences in the resulting protein complexes may be responsible for
the observed effects.
 |
ACKNOWLEDGEMENTS |
We are indebted to Drs. A. Sijts
(anti-MECL-1, anti-PA28- , anti-PA28- , and anti-MC3 antibodies),
D. Williams (anti-Tapasin antibody), J. Howard (anti-Tap-2 antibody),
N. Rice (anti- NF- B1 antibody), P. van der Meide (anti-IFN-
antibody), F. Momburg (Tap-2 cDNA), and A. Grandea III (Tapasin
expression construct) for providing reagents. We thank J. Velthuis for
technical advice and Dr. T. van Hall for critical reading of the manuscript.
 |
FOOTNOTES |
*
This work was supported by the Dutch Cancer Society.The costs of publication of this
article were defrayed in part by the payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
Present address: Gene Regulation & Expression, Wellcome Trust
Biocentre, School of Life Sciences, University of Dundee, Dow St.,
Dundee DD1 5EH, United Kingdom.
§
To whom correspondence should be addressed. Tel.: 31-71-5276113;
Fax: 31-71-5276284; E-mail: zantema@lumc.nl.
Published, JBC Papers in Press, October 28, 2002, DOI 10.1074/jbc.M206267200
2
A. C. O. Vertegaal, A. J. van der
Eb, and A. Zantema, unpublished results.
 |
ABBREVIATIONS |
The abbreviations used are:
Ad, adenoviruses;
Ad12, Adenovirus type 12;
BRK, baby rat kidney;
Ad5, Adenovirus type 5;
E1, early region 1;
IRF-7, IFN regulatory factor-7;
STAT-1, signal transducer and activator of transcription-1;
MHC, major
histocompatibility complex;
RE, reverse transcriptase;
TNF- , tumor
necrosis factor- ;
GAPDH, glyceraldehyde-3-phosphate dehydrogenase;
FACS, fluorescence-activated cell sorter.
 |
REFERENCES |
| 1.
|
Bernards, R.,
and van der Eb, A. J.
(1984)
Biochim. Biophys. Acta
783,
187-204[Medline]
[Order article via Infotrieve]
|
| 2.
|
Graham, F. L.,
van der Eb, A. J.,
and Heijneker, H. L.
(1974)
Nature
251,
687-691[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Schrier, P. I.,
Bernards, R.,
Vaessen, R. T.,
Houweling, A.,
and van der Eb, A. J.
(1983)
Nature
305,
771-775[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Bernards, R.,
Schrier, P. I.,
Houweling, A.,
Bos, J. L.,
van der Eb, A. J.,
Zijlstra, M.,
and Melief, C. J.
(1983)
Nature
305,
776-779[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Ackrill, A. M.,
and Blair, G. E.
(1988)
Oncogene
3,
483-487[Medline]
[Order article via Infotrieve]
|
| 6.
|
Friedman, D. J.,
and Ricciardi, R. P.
(1988)
Virology
165,
303-305[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Meijer, I.,
van Dam, H.,
Boot, A. J.,
Bos, J. L.,
Zantema, A.,
and van der Eb, A. J.
(1991)
Oncogene
6,
911-916[Medline]
[Order article via Infotrieve]
|
| 8.
|
Rotem-Yehudar, R.,
Winograd, S.,
Sela, S.,
Coligan, J. E.,
and Ehrlich, R.
(1994)
J. Exp. Med.
180,
477-488[Abstract/Free Full Text]
|
| 9.
|
Proffitt, J. A.,
and Blair, G. E.
(1997)
FEBS Lett.
400,
141-144[CrossRef][Medline]
[Order article via Infotrieve]
|
| 10.
|
Van Kaer, L.,
Ashton-Rickardt, P. G.,
Ploegh, H. L.,
and Tonegawa, S.
(1992)
Cell
71,
1205-1214[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Townsend, A.,
Ohlen, C.,
Bastin, J.,
Ljunggren, H. G.,
Foster, L.,
and Karre, K.
(1989)
Nature
340,
443-448[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Townsend, A.,
Elliott, T.,
Cerundolo, V.,
Foster, L.,
Barber, B.,
and Tse, A.
(1990)
Cell
62,
285-295[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Schumacher, T. N.,
Heemels, M. T.,
Neefjes, J. J.,
Kast, W. M.,
Melief, C. J.,
and Ploegh, H. L.
(1990)
Cell
62,
563-567[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Momburg, F.,
Ortiz-Navarrete, V.,
Neefjes, J.,
Goulmy, E.,
van de Wal, Y.,
Spits, H.,
Powis, S. J.,
Butcher, G. W.,
Howard, J. C.,
and Walden, P.
(1992)
Nature
360,
174-177[CrossRef][Medline]
[Order article via Infotrieve]
|
| 15.
|
Rotem-Yehudar, R.,
Groettrup, M.,
Soza, A.,
Kloetzel, P. M.,
and Ehrlich, R.
(1996)
J. Exp. Med.
183,
499-514[Abstract/Free Full Text]
|
| 16.
|
Stoltze, L.,
Nussbaum, A. K.,
Sijts, A.,
Emmerich, N. P.,
Kloetzel, P. M.,
and Schild, H.
(2000)
Immunol. Today
21,
317-319[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Chatterjee-Kishore, M.,
Kishore, R.,
Hicklin, D. J.,
Marincola, F. M.,
and Ferrone, S.
(1998)
J. Biol. Chem.
273,
16177-16183[Abstract/Free Full Text]
|
| 18.
|
Lee, C. K.,
Gimeno, R.,
and Levy, D. E.
(1999)
J. Exp. Med.
190,
1451-1464[Abstract/Free Full Text]
|
| 19.
|
Min, W.,
Pober, J. S.,
and Johnson, D. R.
(1996)
J. Immunol.
156,
3174-3183[Abstract]
|
| 20.
|
Chatterjee-Kishore, M.,
Wright, K. L.,
Ting, J. P.,
and Stark, G. R.
(2000)
EMBO J.
19,
4111-4122[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Meraz, M. A.,
White, J. M.,
Sheehan, K. C.,
Bach, E. A.,
Rodig, S. J.,
Dighe, A. S.,
Kaplan, D. H.,
Riley, J. K.,
Greenlund, A. C.,
Campbell, D.,
Carver-Moore, K.,
DuBois, R. N.,
Clark, R.,
Aguet, M.,
and Schreiber, R. D.
(1996)
Cell
84,
431-442[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Durbin, J. E.,
Hackenmiller, R.,
Simon, M. C.,
and Levy, D. E.
(1996)
Cell
84,
443-450[CrossRef][Medline]
[Order article via Infotrieve]
|
| 23.
|
Levy, D. E.,
Marie, I.,
Smith, E.,
and Prakash, A.
(2002)
J. Interferon Cytokine Res.
22,
87-93[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Mauxion, F.,
Sobczak, J.,
and Kress, M.
(1989)
Immunogenetics
29,
397-401[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Schouten, G. J.,
van der Eb, A. J.,
and Zantema, A.
(1995)
EMBO J.
14,
1498-1507[Medline]
[Order article via Infotrieve]
|
| 26.
|
Grandea, A. G., III,
Comber, P. G.,
Wenderfer, S. E.,
Schoenhals, G.,
Fruh, K.,
Monaco, J. J.,
and Spies, T.
(1998)
Immunogenetics
48,
260-265[CrossRef][Medline]
[Order article via Infotrieve]
|
| 27.
|
Stet, R. J. M.,
Zantema, A.,
van Laar, T.,
de Waal, R. M. W.,
Vaessen, L. M. B.,
and Rozing, J.
(1987)
Transplant. Proc.
XIX,
3004-3005
|
| 28.
|
van Hall, T.,
Sijts, A.,
Camps, M.,
Offringa, R.,
Melief, C.,
Kloetzel, P. M.,
and Ossendorp, F.
(2000)
J. Exp. Med.
192,
483-494[Abstract/Free Full Text]
|
| 29.
|
Suh, W. K.,
Derby, M. A.,
Cohen-Doyle, M. F.,
Schoenhals, G. J.,
Fruh, K.,
Berzofsky, J. A.,
and Williams, D. B.
(1999)
J. Immunol.
162,
1530-1540[Abstract/Free Full Text]
|
| 30.
|
Pereira, D. S.,
Kushner, D. B.,
Ricciardi, R. P.,
and Graham, F. L.
(1996)
Oncogene
13,
445-446[Medline]
[Order article via Infotrieve]
|
| 31.
|
Ruuls, S. R.,
de Labie, M. C.,
Weber, K. S.,
Botman, C. A.,
Groenestein, R. J.,
Dijkstra, C. D.,
Olsson, T.,
and van der Meide, P. H.
(1996)
J. Immunol.
157,
5721-5731[Abstract]
|
| 32.
|
van der Eb, A. J.,
and Graham, F. L.
(1980)
Methods Enzymol.
65,
826-839[Medline]
[Order article via Infotrieve]
|
| 33.
|
Schrier, P. I.,
Van Den Elsen, P. J.,
Hertoghs, J. J.,
and van der Eb, A. J.
(1979)
Virology
99,
372-385[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Schreiber, E.,
Matthias, P.,
Muller, M. M.,
and Schaffner, W.
(1989)
Nucleic Acids Res.
17,
6419[Free Full Text]
|
| 35.
|
Martens, J. H.,
Verlaan, M.,
Kalkhoven, E.,
Dorsman, J. C.,
and Zantema, A.
(2002)
Mol. Cell. Biol.
22,
2598-2606[Abstract/Free Full Text]
|
| 36.
|
Marie, I.,
Durbin, J. E.,
and Levy, D. E.
(1998)
EMBO J.
17,
6660-6669[CrossRef][Medline]
[Order article via Infotrieve]
|
| 37.
|
Hughes, E. A.,
Hammond, C.,
and Cresswell, P.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
1896-1901[Abstract/Free Full Text]
|
| 38.
|
Garbi, N.,
Tan, P.,
Diehl, A. D.,
Chambers, B. J.,
Ljunggren, H.-G.,
Momburg, F.,
and Hammerling, G. J.
(2000)
Nat. Immunol.
1,
234-238[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Grandea, A. G., III,
Golovina, T. N.,
Hamilton, S. E.,
Sriram, V.,
Spies, T.,
Brutkiewicz, R. R.,
Harty, J. T.,
Eisenlohr, L. C.,
and Van Kaer, L.
(2000)
Immunity
13,
213-222[CrossRef][Medline]
[Order article via Infotrieve]
|
| 40.
|
Nielsch, U.,
Zimmer, S. G.,
and Babiss, L. E.
(1991)
EMBO J.
10,
4169-4175[Medline]
[Order article via Infotrieve]
|
| 41.
|
Adami, G. R.,
and Babiss, L. E.
(1990)
J. Virol.
64,
3427-3436[Abstract/Free Full Text]
|
| 42.
|
Dijkema, R.,
Pouwels, P.,
de Reus, A.,
and Schellekens, H.
(1984)
Nucleic Acids Res.
12,
1227-1242[Abstract/Free Full Text]
|
| 43.
|
Nandi, D.,
Jiang, H.,
and Monaco, J. J.
(1996)
J. Immunol.
156,
2361-2364[Abstract]
|
| 44.
|
Tanaka, K.,
and Kasahara, M.
(1998)
Immunol. Rev.
163,
161-176[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
Stohwasser, R.,
Standera, S.,
Peters, I.,
Kloetzel, P. M.,
and Groettrup, M.
(1997)
Eur. J. Immunol.
27,
1182-1187[Medline]
[Order article via Infotrieve]
|
| 46.
|
Groettrup, M.,
Kraft, R.,
Kostka, S.,
Standera, S.,
Stohwasser, R.,
and Kloetzel, P. M.
(1996)
Eur. J. Immunol.
26,
863-869[Medline]
[Order article via Infotrieve]
|
| 47.
|
Foss, G. S.,
Larsen, F.,
Solheim, J.,
and Prydz, H.
(1998)
Biochim. Biophys. Acta
1402,
17-28[Medline]
[Order article via Infotrieve]
|
| 48.
|
Whitby, F. G.,
Masters, E. I.,
Kramer, L.,
Knowlton, J. R.,
Yao, Y.,
Wang, C. C.,
and Hill, C. P.
(2000)
Nature
408,
115-120[CrossRef][Medline]
[Order article via Infotrieve]
|
| 49.
|
Liu, X., Ge, R.,
and Ricciardi, R. P.
(1996)
Mol. Cell. Biol.
16,
398-404[Abstract]
|
| 50.
|
Schouten, G. J.,
Vertegaal, A. C.,
Whiteside, S. T.,
Israel, A.,
Toebes, M.,
Dorsman, J. C.,
van der Eb, A. J.,
and Zantema, A.
(1997)
EMBO J.
16,
3133-3144[CrossRef][Medline]
[Order article via Infotrieve]
|
| 51.
|
Kohda, K.,
Ishibashi, T.,
Shimbara, N.,
Tanaka, K.,
Matsuda, Y.,
and Kasahara, M.
(1998)
J. Immunol.
160,
4923-4935[Abstract/Free Full Text]
|
| 52.
|
Li, Y.,
Chambers, J.,
Pang, J.,
Ngo, K.,
Peterson, P. A.,
Leung, W. P.,
and Yang, Y.
(1999)
Immunogenetics
49,
149-157[CrossRef][Medline]
[Order article via Infotrieve]
|
| 53.
|
Shuai, K.,
Stark, G. R.,
Kerr, I. M.,
and Darnell, J. E., Jr.
(1993)
Science
261,
1744-1746[Abstract/Free Full Text]
|
| 54.
|
Abele, R.,
and Tampe, R.
(1999)
Biochim. Biophys. Acta
1461,
405-419[Medline]
[Order article via Infotrieve]
|
| 55.
|
Cresswell, P.,
Bangia, N.,
Dick, T.,
and Diedrich, G.
(1999)
Immunol. Rev.
172,
21-28[CrossRef][Medline]
[Order article via Infotrieve]
|
| 56.
|
Howard, J. C.
(1995)
Curr. Opin. Immunol.
7,
69-76[CrossRef][Medline]
[Order article via Infotrieve]
|
| 57.
|
Spies, T.,
and DeMars, R.
(1991)
Nature
351,
323-324[CrossRef][Medline]
[Order article via Infotrieve]
|
| 58.
|
Powis, S. J.,
Townsend, A. R.,
Deverson, E. V.,
Bastin, J.,
Butcher, G. W.,
and Howard, J. C.
(1991)
Nature
354,
528-531[CrossRef][Medline]
[Order article via Infotrieve]
|
| 59.
|
Arnold, D.,
Driscoll, J.,
Androlewicz, M.,
Hughes, E.,
Cresswell, P.,
and Spies, T.
(1992)
Nature
360,
171-174[CrossRef][Medline]
[Order article via Infotrieve]
|
| 60.
|
Barnden, M. J.,
Purcell, A. W.,
Gorman, J. J.,
and McCluskey, J.
(2000)
J. Immunol.
165,
322-330[Abstract/Free Full Text]
|
| 61.
|
Solheim, J. C.
(1999)
Immunol. Rev.
172,
11-19[CrossRef][Medline]
[Order article via Infotrieve]
|
| 62.
|
Lehner, P. J.,
Surman, M. J.,
and Cresswell, P.
(1998)
Immunity
8,
221-231[CrossRef][Medline]
[Order article via Infotrieve]
|
| 63.
|
Preckel, T.,
Fung-Leung, W. P.,
Cai, Z.,
Vitiello, A.,
Salter-Cid, L.,
Winqvist, O.,
Wolfe, T. G.,
Von Herrath, M.,
Angulo, A.,
Ghazal, P.,
Lee, J. D.,
Fourie, A. M., Wu, Y.,
Pang, J.,
Ngo, K.,
Peterson, P. A.,
Fruh, K.,
and Yang, Y.
(1999)
Science
286,
2162-2165[Abstract/Free Full Text]
|
| 64.
|
Fruh, K.,
and Yang, Y.
(1999)
Curr. Opin. Immunol.
11,
76-81[CrossRef][Medline]
[Order article via Infotrieve]
|
| 65.
|
York, I. A.,
Goldberg, A. L., Mo, X. Y.,
and Rock, K. L.
(1999)
Immunol. Rev.
172,
49-66[CrossRef][Medline]
[Order article via Infotrieve]
|
| 66.
|
Niedermann, G.,
Geier, E.,
Lucchiari-Hartz, M.,
Hitziger, N.,
Ramsperger, A.,
and Eichmann, K.
(1999)
Immunol. Rev.
172,
29-48[CrossRef][Medline]
[Order article via Infotrieve]
|
| 67.
|
Meijer, I.,
Boot, A. J.,
Mahabir, G.,
Zantema, A.,
and van der Eb, A. J.
(1992)
Cell Immunol.
145,
56-65[CrossRef][Medline]
[Order article via Infotrieve]
|
| 68.
|
Yano, O.,
Kanellopoulos, J.,
Kieran, M., Le,
Bail, O.,
Israel, A.,
and Kourilsky, P.
(1987)
EMBO J.
6,
3317-3324[Medline]
[Order article via Infotrieve]
|
| 69.
|
Israel, A.,
Yano, O.,
Logeat, F.,
Kieran, M.,
and Kourilsky, P.
(1989)
Nucleic Acids Res.
17,
5245-5257[Abstract/Free Full Text]
|
| 70.
|
Kushner, D. B.,
and Ricciardi, R. P.
(1999)
Mol. Cell. Biol.
19,
2169-2179[Abstract/Free Full Text]
|
| 71.
|
Herberg, J. A.,
Sgouros, J.,
Jones, T.,
Copeman, J.,
Humphray, S. J.,
Sheer, D.,
Cresswell, P.,
Beck, S.,
and Trowsdale, J.
(1998)
Eur. J. Immunol.
28,
459-467[CrossRef][Medline]
[Order article via Infotrieve]
|
| 72.
|
Thanos, D.,
and Maniatis, T.
(1995)
Mol. Cell. Biol.
15,
152-164[Abstract]
|
| 73.
|
Lenardo, M. J.,
Fan, C. M.,
Maniatis, T.,
and Baltimore, D.
(1989)
Cell
57,
287-294[CrossRef][Medline]
[Order article via Infotrieve]
|
| 74.
|
Visvanathan, K. V.,
and Goodbourn, S.
(1989)
EMBO J.
8,
1129-1138[Medline]
[Order article via Infotrieve]
|
| 75.
|
Farrar, M. A.,
and Schreiber, R. D.
(1993)
Annu. Rev. Immunol.
11,
571-611[CrossRef][Medline]
[Order article via Infotrieve]
|
| 76.
|
Taniguchi, T.,
and Takaoka, A.
(2001)
Nat. Rev. Mol. Cell. Biol.
2,
378-386[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
H. Guan, J. F. Williams, and R. P. Ricciardi
Induction of Neuronal and Tumor-Related Genes by Adenovirus Type 12 E1A
J. Virol.,
January 15, 2009;
83(2):
651 - 661.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Jiang, M. V. Olson, D. R. Medrano, O.-H. Lee, J. Xu, Y. Piao, M. M. Alonso, C. Gomez-Manzano, M.-C. Hung, W K A. Yung, et al.
A novel CRM1-dependent nuclear export signal in adenoviral E1A protein regulated by phosphorylation
FASEB J,
December 1, 2006;
20(14):
2603 - 2605.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Dorn, H. Zhao, F. Granberg, M. Hosel, D. Webb, C. Svensson, U. Pettersson, and W. Doerfler
Identification of Specific Cellular Genes Up-Regulated Late in Adenovirus Type 12 Infection
J. Virol.,
February 15, 2005;
79(4):
2404 - 2412.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Howarth, A. Williams, A. B. Tolstrup, and T. Elliott
Tapasin enhances MHC class I peptide presentation according to peptide half-life
PNAS,
August 10, 2004;
101(32):
11737 - 11742.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. L. Petersen, C. R. Morris, and J. C. Solheim
Virus Evasion of MHC Class I Molecule Presentation
J. Immunol.,
November 1, 2003;
171(9):
4473 - 4478.
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|