![]()
|
|
||||||||
J. Biol. Chem., Vol. 278, Issue 1, 296-303, January 3, 2003
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
From the Laboratoire de Chimie et Biochimie des Centres Redox
Biologiques, DRDC-CEA/CNRS/ Université Joseph Fourier, 17 Avenue des Martyrs, 38054 Grenoble, Cedex 9, France
Received for publication, September 20, 2002, and in revised form, October 21, 2002
ActVB is the NADH:flavin oxidoreductase
participating in the last step of actinorhodin synthesis in
Streptomyces coelicolor. It is the prototype of a whole
class of flavin reductases with both sequence and functional
similarities. The mechanism of reduction of free flavins by ActVB has
been studied. Although ActVB was isolated with FMN bound, we have
demonstrated that it is not a flavoprotein. Instead, ActVB contains
only one flavin binding site, suitable for the flavin reductase
activity and with a high affinity for FMN. In addition, ActVB proceeds
by an ordered sequential mechanism, where NADH is the first substrate.
Whereas ActVB is highly specific for NADH, it is able to catalyze the
reduction of a great variety of natural and synthetic flavins, but with Km values ranging from 1 µM (FMN) to
69 µM (lumiflavin). We show that both the
ribitol-phosphate chain and the isoalloxazine ring contribute to the
protein-flavin interaction. Such properties are unique and set the
ActVB family apart from the well characterized Fre flavin reductase family.
NAD(P)H:flavin oxidoreductases or flavin reductases are enzymes
defined by their ability to catalyze the reduction of free flavins,
riboflavin, FMN, or FAD, by reduced pyridine nucleotides, NADPH,
or NADH (1). Since flavins do not bind tightly to them, flavin
reductases should not be classified as flavoproteins. What the enzyme
does is to provide an active site that transiently accommodates both
the reduced pyridine nucleotide and the flavin, close to each other, in
such a relative orientation that the direct hydride transfer can be
enormously accelerated (2, 3). The real biological function of the
reduced flavins, the released products of the catalyzed reaction, is
still not well understood. Free reduced flavins have been suggested to
play an important role as redox mediators in iron uptake and metabolism
in prokaryotes (4) or in light emission in bioluminescent bacteria (5, 6). More recently, a group of flavin reductases has been found to be
essential in combination with flavin-dependent oxygenases (7-13), such as those involved in antibiotic biosynthesis, as discussed below (7-9).
Organisms have evolved a great variety of such enzymes, which can thus
be classified within several families or subfamilies according to their
sequence similarities and biochemical properties. Because of their
simplicity and their variety, flavin reductases provide a unique tool
to understand how a polypeptide chain deals with both the isoalloxazine
ring and the ribityl chain of a flavin molecule to modulate its binding
constant, to accelerate its reduction by reduced pyridine nucleotide,
and to use it for a diversity of functions. Surprisingly, our knowledge
of this class of enzymes is very limited so far, and this is the reason
why flavin reductases have been the subject of intensive investigations
in our laboratory in recent years (3, 14-17).
The prototype of one group of flavin reductases is the Fre enzyme found
in Escherichia coli (18) and also in luminescent bacteria
(19). The enzyme from E. coli consists of a single polypeptide chain with a molecular mass of 26 kDa. It uses both NADPH
and NADH as the electron donor and a great variety of flavin analogues
as electron acceptors (14, 17). This clearly demonstrates that the
recognition of the flavin by the polypeptide chain occurs exclusively
through the isoalloxazine ring, with very limited contribution of the
ribityl side chain (3, 14). The crystal structure of Fre (3) reveals
that the general enzyme structure is, despite very low sequence
similarities, similar to the structures of a large family of
flavoenzymes, with spinach ferredoxin-NADP+
reductase as the prototype (20). It provides insights to the understanding of the structural basis for the difference in flavin recognition between a flavoprotein and a flavin reductase.
A second group of flavin reductases, different from the Fre family and
the flavin reductases purified from bioluminescent bacteria, has
recently emerged (7-13). However, very few members of this group were
purified to homogeneity and carefully characterized. These enzymes are
defined on the basis of their amino acid sequence similarities and
their role during biological oxidation reactions. Indeed, some
monooxygenase systems depend on the presence of a reduced flavin,
mainly FMNH2, as a co-substrate rather than a prosthetic
group. The flavin is supposed to react with molecular oxygen in the
active site of the monooxygenase component in order to generate a
flavin hydroperoxide intermediate that serves as the active oxidant for
substrate oxidation. A separate flavin reductase is thus absolutely
required to supply the reduced flavins (with NADPH or NADH as the
reductant) that diffuse to the oxygenase component. In recent years,
the following flavin reductases have been shown to belong to this
family: ActVB (7), SnaC (8), and VlmR (9) for the biosynthesis of the
antibiotics actinorhodin in Streptomyces coelicolor,
pristinamycin in Streptomyces pristinaespiralis, and
valanimycin in Streptomyces viridifaciens; HpaC (10) for the
oxidation of 4-hydroxyphenylacetate in E. coli; DszD (11) for the conversion of sulfides to sulfoxides and sulfones in
Rhodococcus sp., allowing the utilization of these
microorganisms in fossil fuel desulfurization biotechnological
processes; and cB (12) for the degradation of nitrilotriacetate in
Chelatobacter heintzii. It should be noted that a flavin
reductase called FeR (21, 22), with some homology to ActVB and SnaC,
found as a ferric reductase in the hyperthermophilic archaea
Archaeoglobus fulgidus, has been structurally characterized
in complex with FMN (22).
Considering the biological importance of this group of flavin
reductases and the very limited amount of available information regarding their substrate specificity, reaction mechanisms, and three-dimensional structure, we found it worth characterizing these
enzymes in more detail in order to compare them with the Fre enzyme and
get new insights into the protein-flavin interaction. We have
chosen ActVB as a representative of this group of flavin reductase and
report original data showing that ActVB has a unique mode of flavin
binding and operates by a sequential mechanism.
Enzyme Assay--
In the standard aerobic assay, flavin
reductases activities were carried out under aerobic conditions
allowing continuous reoxidation of reduced flavin by oxygen. Flavin
reductase activity was determined at 25 °C from the decrease of
the absorbance at 340 nm (
NAD(P) analogs and flavin concentrations were determined
spectroscopically using the following extinction coefficients: AMP and
ADP-ribose, ActVB Expression Plasmids--
For the production of wild-type
ActVB, pACTVB plasmid was used (7), where the actVB
structural gene was placed under the control of the T7 polymerase
promotor, in the pT7-7 plasmid. For the production of ActVB-His as
C-terminal histidine-tagged fusion protein, the actVB gene
was amplified by PCR from the plasmid pACTVB (7) with the
oligonucleotide primers GGGAATTCCATATGGCTGCTGACCAGG and
CGCGGATCCTCAATGGTGATGGTGATGGTGACCGGCATGCGCGGGCAC,
in order to introduce EcoRI, NdeI, and
BamHI restriction sites (underlined) and the six histidine
codons (in italic type). The 549-base pair PCR product was digested
with EcoRI-BamHI, and the resulting fragment was
ligated in pUC18 (pUC18-ActVB). This plasmid was sequenced to confirm
that no changes had been introduced during PCR amplification. The
NdeI-BamHI fragment from pUC18-ActVB was
subsequently cloned in pT7-7, resulting in the plasmid pACTVB His tag.
Preparation of Soluble Extracts--
E. coli
B834(DE3) pLysS transformed with the appropriate plasmid (pACTVB or
pACTVB His tag) was grown at 37 °C and 220 rpm in a 3-liter
Erlenmeyer flask containing 1 liter of Luria-Bertani medium in the
presence of 200 µg/ml ampicillin and 34 µg/ml chloramphenicol. Growth was monitored by following the absorbance at 600 nm. Expression of ActVB and ActVB-His recombinant proteins was induced by adding isopropyl-1-thio- Purification of ActVB--
The soluble extracts (130 mg) were
loaded onto an ACA54 column (360 ml) previously equilibrated with 10 mM Tris/HCl, pH 7.6, 10% glycerol, 10 mM EDTA.
Proteins were eluted with a flow rate of 0.3 ml/min. Fractions
containing flavin reductase activity were pooled and concentrated to 2 ml using a Diaflo cell equipped with a YM 10 membrane. The concentrated
enzyme solution was loaded onto a Superdex 75 column (120 ml from
Amersham Biosciences) equilibrated with 25 mM
Tris/HCl, pH 7.6, 10% glycerol, 10 mM EDTA (buffer A).
Proteins were eluted with the same buffer at a flow rate of 0.8 ml/min.
Fractions containing flavin reductase activity were pooled and loaded
onto a UNO Q column (6 ml; Bio-Rad), equilibrated with buffer A. A
linear 0-500 mM NaCl gradient in buffer A was applied for
60 ml. ActVB was eluted with 100 mM NaCl.
Purification of ActVB-His--
The soluble extracts (180 mg)
were loaded at 0.5 ml/min onto a 25-ml
Ni2+-nitrilotriacetic acid column (Qiagen) equilibrated
with 50 mM Tris/HCl, pH 7.6 (buffer B). Then the column was
washed with 100 ml of buffer B, and elution was achieved with 100 mM imidazole in the same buffer at 1 ml/min. The proteins
were then immediately loaded onto a UNO Q column (6 ml; Bio-Rad), and
further eluted with a linear 0-500 mM NaCl gradient in
buffer B for 60 ml at 1 ml/min.
Analytical Determination--
SDS-PAGE polyacrylamide gels (15%
polyacrylamide) were done according to Laemmli (23). The gels were
calibrated with the Amersham Biosciences low molecular weight markers.
The native molecular mass of the protein was determined with a Superdex
75 gel filtration column (120 ml; Amersham Biosciences) equilibrated with 25 mM Tris/HCl, pH 7.6, and 150 mM NaCl
using a flow rate of 0.4 ml·min Cofactor Analysis--
A sample of pure ActVB or ActVB-His
protein was boiled for 10 min in the dark, chilled on ice, and then
centrifuged for 10 min at 10,000 × g in order to
pellet the denatured protein. An aliquot of the supernatant was
analyzed both by UV-visible spectroscopy and by thin layer
chromatography on silica gel 60 F254 (Merck) with butanol-1/acetic
acid/water (10/5/5) as the eluant. As a control, pure FMN, FAD, and
riboflavin were run separately or as a mixture under the same conditions.
Kinetic Analysis--
The molar concentration of ActVB was
calculated assuming a molecular mass value of the polypeptide
chain of 18,260 Da (7). Reciprocal initial velocities
(1/vi) were plotted against reciprocal substrate
concentrations (1/[S]) and fitted with a straight line determined by
a linear regression program. In some cases, kinetic parameters
(Vm, Km,
Km(app)) were determined from saturation
curves, fitted with the following equation: vi = (Vm[S])/(Km + [S]), using a
Levenberg-Marquardt algorithm. Inhibition constants
(Ki) for competitive inhibitors were determined
using a secondary plot of the slopes from the double reciprocal plots
against the concentration of the inhibitor [I], corresponding to the
following equation: y = (Km/Vm) (1 + ([I]/Ki)) (25). In the cases of noncompetitive and
uncompetitive inhibitors, the inhibition constant
(Ki) was determined using a secondary plot of the
intercepts from the double reciprocal plot against the concentration of
the inhibitor [I], corresponding to the following equation:
y = (([I]/(Ki
Vm)) + 1/Vm (25). When
applicable, values are shown ± S.D.
Purification of ActVB--
In a first set of experiments, ActVB
was overexpressed in E. coli using the pACTVB plasmid (7).
Using the purification procedure described under "Experimental
Procedures," a low yield (6-7%) of purified ActVB could be obtained
(Table I, top). This was then explained
by the great instability of the flavin reductase activity in the
soluble extracts. The activity, routinely assayed from the oxidation of
NADH by an excess of FMN monitored spectrophotometrically, was found to
decrease by 50% when the protein was left in buffer for 3 h at
4 °C. The addition of 10% glycerol, 10 mM EDTA, and CompleteTM buffer solution to the soluble extracts provided
a significant stabilization of the activity (data not shown). However,
even under these conditions, more than 90% of the flavin reductase activity was lost during the first two chromatographic steps (Table I,
top). After the UNO Q column, activity remained stable, suggesting that
instability of ActVB activity in soluble extracts arose from reactions
with some cellular components. SDS-PAGE analysis after the UNO Q
purification step revealed the presence of two polypeptide bands at
18,000 and 17,000 Da (data not shown), with the same AADQGMLRDA
N-terminal sequence corresponding to the ActVB protein (7). This
suggested a partial C-terminal proteolysis of ActVB when expressed in
E. coli, as described previously (7). In contrast,
overexpression of ActVB as a C-terminal His-tagged fusion protein
(ActVB-His) allowed a more efficient purification of the enzyme (Table
I, bottom). SDS-PAGE analysis after the UNO Q column revealed the
presence of only one polypeptide chain at 18,000, without evidence for
partial proteolysis (data not shown).
Gel filtration experiments on a Superdex 75 column with ActVB and
ActVB-His gave an apparent molecular mass of 36,000 Da for both
proteins, confirming the homodimeric structure for ActVB (7).
Flavin reductase specific activities of both ActVB and ActVB-His
proteins were found to be comparable (Table I), indicating that the
C-terminal part of the protein lost during proteolysis was not
important for activity and that the presence of the His tag was neutral
with regard to the enzyme activity. However, it should be noted that
from one preparation to another, we obtained purified proteins with
slightly different specific flavin reductase activities.
In the following experiments presented here, we report data obtained
with ActVB. In the case of the kinetic experiments, the same enzyme
preparation was used, allowing a direct comparison of the parameters
obtained under different kinetic conditions.
Flavin Content of ActVB--
Purified ActVB was yellow, with
absorption spectra typical for a flavin-containing protein, with maxima
at 378 and 455 nm (Fig. 1). After
denaturation of the protein by boiling for 10 min and centrifugation,
the chromophore contained in the supernatant was analyzed by thin layer
chromatography with FMN, riboflavin, and FAD as standards. The
chromophore was identified as FMN (data not shown). Quantification of
the free FMN released in the supernatant by UV-visible spectroscopy
demonstrated that the amount of FMN in purified ActVB varied from one
preparation to another from 0.1 to 0.6 mol of FMN/mol of polypeptide
chain. An extinction coefficient of 13,640 M
Reconstitution experiments of ActVB with FMN or riboflavin gave the
following results. A preparation of ActVB (50 µM)
containing little FMN (0.1 mol of FMN/mol of protein) was incubated
with 1 mM FMN or 400 µM riboflavin for 1 h in 50 mM Tris/HCl buffer, pH 7.6, and then
chromatographed on an NAP10TM column (Amersham Biosciences) in order to
remove unbound flavin. The protein was then analyzed both by UV-visible
spectroscopy and thin layer chromatography, as previously described, in
order to identify and quantify the bound flavin in the reconstituted
ActVB. Reconstitution with FMN resulted in a 6-7-fold increase of the
amount of protein-bound FMN and a protein containing 0.6-0.7 mol of
FMN/mol of protein (data not shown). In contrast, reconstitution with
riboflavin failed to increase the amount of protein-bound flavin and
did not result in the removal of FMN initially bound to ActVB (data not shown).
Titration of the ActVB FMN Bound by NADH--
In order to verify
that the FMN bound to the isolated ActVB protein was correctly located
at the flavin reductase active site, reductive titration of FMN was
carried out with NADH, under anaerobic conditions. A preparation of
ActVB containing 0.5 mol of FMN/mol of ActVB polypeptide chain (18,260 Da) was used for that experiment. As shown in Fig.
2, the addition of NADH caused a decrease
in the absorbance at 455 nm, reflecting a reduction of FMN. An
isosbestic point at 510 nm was observed for substoichiometric
concentrations of NADH. In the inset of Fig. 2, a plot of
the fractional absorbance changes at 445 nm as a function of the
[NADH]/[FMN] ratio showed that 1 mol of NADH was sufficient to
reduce 1 mol of bound FMN. In addition, during the NADH titration, a
broad absorption band above 550 nm developed (Fig. 2). Such a band is
tentatively assigned to a charge transfer complex of reduced FMN with
NAD+ within the active site of ActVB rather than to a
flavin-neutral semiquinone species (26, 27), as confirmed by the
following experiment (Fig. 3). An
anaerobic solution of ActVB, containing 0.5 mol of bound FMN/mol of
polypeptide chain, EDTA, and a catalytic amount of deazaflavin was
photoreduced and then titrated with increasing amounts of
NAD+. As shown in Fig. 3, irradiation resulted in the
decrease of the absorbance at 455 nm, consistent with reduction of FMN
by photoreduced deazaflavin. When NAD+ was added, a broad
band developed at wavelengths greater than 520 nm, which was similar to
that observed during reaction of ActVB-bound FMN with NADH. In
addition, no significant increase in absorbance at 340 nm was observed,
indicating that no NADH was formed during incubation of reduced FMN
with NAD+. This shows that the reduction of FMN by NADH at
the active site of ActVB is irreversible.
Flavin Reductase Activity Is Not Dependent on the Bound
FMN--
The previous experiments have shown that the purified protein
contains various amounts of FMN bound at its active site, depending on
the enzyme preparation. In order to investigate the dependence of the
flavin reductase activity of ActVB on the amount of protein-bound FMN,
different preparations containing various amounts of FMN were assayed
either with FMN or riboflavin as a substrate and with NADH as the
electron donor (Table II). In the absence
of exogenous flavins, only a very weak activity could be detected (data
not shown), excluding an NADH oxidase function for ActVB. With either
FMN or riboflavin as a substrate, the flavin reductase activity of
ActVB was found to be independent on the FMN content of the polypeptide
chain (Table II). Since riboflavin does not bind to ActVB (see above),
reconstitution for a flavin site during the enzymatic test is excluded.
These observations thus rule out the possibility that the protein-bound
FMN was involved in the flavin reductase activity and are consistent
with ActVB being a flavin reductase accepting both FMN and riboflavin
as substrates. It is likely that, under the assay conditions, the
protein-bound FMN can be displaced by the large excess of
riboflavin.
Kinetic Analysis of ActVB--
The dependence of the reaction
catalyzed by ActVB on the concentration of both substrates, flavin and
reduced pyridine nucleotide, was investigated by kinetic experiments
under steady-state conditions. For all of the following kinetic
experiments, the same homogeneous enzyme preparation was used. For such
a bisubstrate-biproduct reaction, kinetic analysis provides insights
into the mechanism. Double reciprocal plots of initial velocities
versus substrate concentrations show intersecting patterns
in the case of a sequential mechanism and parallel patterns for a
ping-pong mechanism (25). Flavin reductase activity was determined as a
function of NADH concentration at several levels of FMN (Fig.
4A) and as a function of FMN
concentration at several levels of NADH (Fig. 4B). Initial velocities followed typical Michaelis-Menten kinetics, since double reciprocal plots of the data showed a series of lines. Moreover, a
ping-pong mechanism could be excluded, since the lines were intersecting each other at the same point at the left of the vertical axis. A sequential mechanism for ActVB is thus indicated (25). However,
whether it is an ordered or a random sequential mechanism cannot be
concluded from such an experiment. It may be experimentally deduced
from the inhibition studies described below (28).
When the enzyme activity was determined as a function of NADH
concentration in the absence or in the presence of three concentrations of AMP (Scheme 1), a dead end inhibitor,
double reciprocal plots revealed typical competitive inhibition
kinetics (Fig. 5A). A Ki value of 3 ± 0.5 mM was
obtained for AMP. On the other hand, a pattern of noncompetitive
inhibition was observed for AMP with respect to the FMN substrate, with
a Ki value of 7.7 ± 0.4 mM (Fig.
5B).1 Furthermore,
lumichrome, a flavin analogue (Scheme 1) with no redox activity,
was a competitive inhibitor with respect to FMN with a
Ki value of 104 ± 17 µM (Fig.
6A) and an uncompetitive inhibitor with respect to NADH, with a Ki value of
91 ± 1 µM (Fig. 6B). All of these data
support the conclusion that the flavin reductase has an ordered
mechanism with NADH binding first and FMN being the second substrate
(28).
The kinetic mechanism of product release has been determined by
studying inhibition by products (25). When NADH concentration was
varied with a fixed concentration of FMN, inhibition by
NAD+ was found to be noncompetitive with respect to NADH
(data not shown). When FMN was varied at a fixed NADH concentration,
NAD+ appeared to inhibit noncompetitively (data not shown).
This now suggests that the first product to be released is
NAD+, followed by the reduced flavin.
Flavin Substrate Specificity--
Scheme 1 shows the structures of
the various flavin analogs used as substrates or inhibitors. Table
III reports the kinetic parameters for
each substrate obtained during enzymatic reduction by NADH under
steady-state conditions. The apparent Km values were
determined in experiments where flavin reductase activities were
measured as a function of the concentration of a given substrate in the
presence of saturating concentrations of the other substrate. In
addition, the Km and kcat
values for the FMN substrate were determined from the data shown in
Fig. 4, A and B, using the Dalziel treatment,
which is well adapted for a sequential bireactant mechanism (16, 17,
29). The latter were found to be 0.78 ± 0.10 µM and
8.9 ± 0.3 s
As shown in Table III, Vmax values (reported as
kcat values) were only slightly sensitive to
modifications of the flavin moiety both at the isoalloxazine ring and
the ribityl side chain. On the contrary, Km values
for the flavin substrate strongly depended on the nature of the
substituent at the N-10 position of the isoalloxazine ring. As
previously reported in (7), FMN was found to be the best substrate,
with a Km value of 1 µM. Riboflavin
and FAD exhibited a 8-fold larger Km value,
suggesting that the terminal phosphate group on the ribityl chain of
the FMN molecule provided significant stabilization of the
flavin-protein complex. Lumiflavin, with a methyl group at the N-10
position, was also a substrate of ActVB, although its Km value was much larger than that for FMN, FAD, or
riboflavin. This shows the importance of the isoalloxazine ring for the
flavin-protein recognition, in agreement with lumichrome and alloxazine
being competitive inhibitors of FMN, with Ki values
of 104 and 93 µM, respectively (Fig. 6A and
Table III).
In the case of a sequential ordered mechanism, the
Kd value for a competitive inhibitor with respect to
the second substrate can be calculated from its Ki
value according to the following equation: Kd = Ki/(1 + Kd(NADH)/[NADH]) (30), where
Kd(NADH) represents the dissociation
constant for the first substrate NADH, and [NADH] is the
concentration of NADH used to determine the Ki
value. Using Kd(NADH) = 7.8 ± 0.7 µM (see below), Kd values for
lumichrome and alloxazine of 87 ± 14 and 78 ± 18 µM, respectively, could be obtained. The
Kd value for lumichrome value is comparable with the
Km value for lumiflavin (69 ± 8 µM), its closest flavin substrate analogue. This suggests
that Km values for the flavin substrates represent
good approximations for the corresponding Kd values
during catalysis.
The role of the ribityl chain in the flavin-protein interaction was
further investigated with flavin analogs carrying different substituents at the N-10 position (Scheme 1 and Table III). Since binding of the flavin molecule seems to involve the ribityl-phosphate chain as well, we have examined the role of the OH ribityl groups in
that recognition (Table III). Km values for flavins were in the following order: derivative 1 < riboflavin < derivative 3 < derivative 2 < lumiflavin. Furthermore, in the case of compound 2, the
kcat value was significantly decreased with
regard to kcat values with derivative 3 and
riboflavin. Those data suggest that the 2'-OH contributes to the
protein-flavin recognition, whereas the 3'-OH plays a minor role. It
should be noted that ribitol, up to 10 mM, is not an
inhibitor (data not shown).
Reduced Pyridine Nucleotide Substrate Specificity--
Table
IV shows the kinetic and
thermodynamic parameters for various NAD(P)H analogs (Scheme 1)
obtained during enzyme reaction under steady-state conditions. The
Km value for the NADH substrate was also determined
from the data shown in Fig. 4, A and B, using the
Dalziel treatment (16, 17, 29), and found to be 9.7 ± 0.4 µM, which is comparable with the value reported in Table
IV. As previously reported in Ref. 7, ActVB is strictly specific for
NADH. NADPH cannot be used as a substrate, even at very high
concentrations (up to 0.8 mM). The Km
value for NADH (6.6 ± 0.5 µM) (Table IV) was
comparable with its Kd value (7.8 ± 0.7 µM) determined from the Dalziel mathematical treatment of
the initial velocities data reported in Fig. 4, A and
B (16, 17, 29). Ki values for AMP and
ADP-ribose, which are competitive inhibitors with respect to NADH (Fig.
5A and data not shown, respectively), were very large (3 and
17.4 mM, respectively) (Table IV). In the case of a
sequential ordered mechanism, the inhibition constant
Ki for a competitive inhibitor with respect to the
first substrate is equal to the dissociation constant of the
enzyme-inhibitor complex (30). Comparison of the Ki
values for AMP and ADP-ribose with the Kd value for
NADH thus indicates that the nicotinamide ring plays a major role in
the binding of the NADH molecule to ActVB. On the other hand, NMNH, the
NADH analog lacking the AMP part of the molecule (Scheme 1), was
neither a substrate nor an inhibitor, up to a concentration of 1 mM (Table IV). This now indicates that the nicotinamide
ribose phosphate part of the NADH is not recognized by itself either.
Taken together, these data suggest that the NADH molecule is recognized
by ActVB as a whole and that individual contributions of the different
parts of the molecule cannot provide enough interactions unless they
are associated with the other parts of the NADH molecule.
The enzyme named Fre can be considered as a prototype of a whole
class of flavin reductases, the enzymes catalyzing the reduction of
riboflavin, FMN, and FAD by NADPH and NADH (14). This is the most
extensively characterized flavin reductase so far (2, 3, 14, 16-18).
Kinetic analysis and structural characterization in our laboratory have
shown that this enzyme binds the flavin, with a preference for
riboflavin, almost exclusively through interactions with the
isoalloxazine ring (14) and reduced pyridine nucleotides, preferably
NADPH, mainly through interactions with the nicotinamide moiety (17).
These are unique binding modes. The enzyme proceeds by a sequential
ordered mechanism, binding the NADPH first and providing a site that
accommodates both substrates in a ternary complex from which the
optimized hydride transfer occurs (2, 14).
ActVB belongs to a different and much less well characterized group of
flavin reductases. These enzymes are generally associated with
flavin-dependent monooxygenases and have no sequence
homology with the Fre family (7-13). Here we report a detailed study
of ActVB that allows comparison with Fre. As discussed below, we show
that ActVB is different from Fre also with respect to substrate specificities and recognition.
The first question we have addressed is whether or not ActVB is a
flavoprotein. Previous reports had not provided a clear answer to that
question, and furthermore in our hands preparations of ActVB had highly
variable amounts of protein-bound FMN. Furthermore, whereas some
members of the ActVB family, such as HpaC (10), were isolated without
bound cofactors, others, such as SnaC (8), were shown to contain
significant amounts of flavin bound to the polypeptide chain after
purification. The presence of FMN in ActVB could be explained either by
a tight interaction between ActVB and FMN, allowing isolation of the
flavin reductase with its substrate, or by a loss of a prosthetic FMN
group from a flavoprotein during purification. It should be noted that
some flavoproteins, such as sulfite reductase, may display some flavin
reductase activity (15). However, in this case, the internal flavin
cofactor mediates an unspecific electron transfer from NAD(P)H to the
exogenous flavin substrate as well as other acceptors (quinones, ferric iron, cytochrome c, etc.) and thus proceeds through a
ping-pong mechanism (15).
The results presented here unambiguously demonstrate that ActVB is not
a flavoprotein but a flavin reductase displaying a low
Kd value for FMN. First, with all substrates, FMN, riboflavin, and FAD, the kinetic data fit nicely with a sequential and
not with a ping-pong mechanism (Fig. 4). Second, FMN and riboflavin reductase activities do not depend on the amount of FMN bound to the
protein used for the assay (Table II). Third, ActVB cannot bind more
than one equivalent of FMN as shown by reconstitution experiments, in
agreement with the presence of only one FMN binding site. Furthermore,
this site is directly accessible to NADH, where electron transfer can
occur as shown from the formation of a charge transfer complex (Fig.
2).
Kinetic analysis of ActVB with a variety of flavin and NAD(P)H analogs
allows the first detailed understanding of the protein-substrate interaction with this class of flavin reductases. Clearly, the isoalloxazine ring provides a major site of interaction with the polypeptide chain. Lumiflavin, lacking a lateral chain, is a substrate, and lumichrome and alloxazine are competitive inhibitors with respect
to FMN, with Kd values comparable with the
Km value for lumiflavin (70-80 µM).
In addition, the fact that Kd values for lumichrome
and alloxazine are comparable shows that the methyl groups of the
isoalloxazine ring at positions 7 and 8 are not important for the
protein-flavin interaction. On the other hand, the
Km values for the natural substrates, riboflavin and
FMN, are much lower (8 and 1 µM) (Table III). Thus, the
ribityl chain also contributes to the binding. The catalytic efficiency
of the enzyme with compound 1 and with FMN as substrates suggest that
the 2'-OH of the sugar chain and the phosphate group play significant
roles in the interaction of the substrate with the polypeptide chain.
FMN is the better substrate in agreement with the finding that the
purified preparations of ActVB contained FMN exclusively. This property
represents a clear difference between the ActVB and the Fre flavin
reductase families. Indeed, in the case of Fre, the recognition of the
flavins occurs almost exclusively at the level of the isoalloxazine
ring, with Km values for riboflavin and FMN
comparable with that for lumiflavin and with the Kd
value for the inhibitor lumichrome, in the 0.5-2 µM
range (14).
The first and only available structural information on the ActVB family
comes from the three-dimensional structure of the FeR protein, from
A. fulgidus, in complex with the FMN substrate (22). Since
ActVB displays significant sequence homology with FeR (22% identity
and 34% similarity; data not shown), it should be possible to identify
some key residues for flavin binding in ActVB. However, this approach
proved to be rather limited, since the great majority of the residues
involved in FMN binding in the FeR structure are not conserved in
sequences of FeR homologs, and many of these residues interact with FMN
through main chain nitrogen and oxygen atoms (22). Nevertheless, it is
likely that ActVB should display structural similarities with FeR, with
a FMN binding site that provides hydrogen bonds, ion pair interactions, and electrostatic dipole interactions to the various parts of the
substrate, the isoalloxazine ring, the OH groups of the ribitol chain,
and the phosphate group. In contrast, the structure of Fre, in complex
with riboflavin, shows interactions of the polypeptide chain mainly
with the isoalloxazine ring. All of these results are consistent with
the kinetic analysis reported here.
As far as the binding of reduced pyridine nucleotides is concerned,
again large differences between the ActVB and the Fre families are
observed. Whereas Fre recognizes NAD(P)H mainly through the
nicotinamide ring, allowing NMNH to be a good substrate (17), ActVB
interacts with the various parts of the molecule. This is shown from
the drastic increase of the Kd value for both inhibitors AMP and ADP-ribose and from the observation that NMNH is
neither an inhibitor nor a substrate. It is also remarkable that ActVB
is highly specific for NADH, whereas Fre can use both NADH and NADPH.
Again we learn very little from the structure of the homolog, the FeR
protein from A. fulgidus, since the residues interacting
with NADP+, in a crystal of the FeR-FMN complex soaked with
NADP+, are not conserved in ActVB (22). However, as
illustrated by the characterization of a strong charge-transfer complex
between reduced flavin and NAD+ in the active site of ActVB
(Figs. 2 and 3), it is likely that, as in FeR, the nicotinamide ring of
the pyridine nucleotide in ActVB packs against the isoalloxazine ring
of the flavin, with the C-4 atom of nicotinamide and the N-5 atom of
the flavin at a few Å from each other in a stacking arrangement
typical for direct hydride transfer in flavoproteins. A specific
structural analysis of ActVB is required to better understand the
various aspects of substrate recognition and mechanism discussed above.
*
This work was supported by an Emergence Région
Rhône-Alpes fellowship.The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
To whom correspondence should be addressed. Tel.: 33-4-38-78-91-09;
Fax: 33-4-38-78-91-24; E-mail: vniviere@cea.fr.
Published, JBC Papers in Press, November 1, 2002, DOI 10.1074/jbc.M209689200
1
For a two-substrate enzyme, the
Ki values for an inhibitor with respect to each
substrate are not necessarily equal.
Mechanism and Substrate Specificity of the Flavin Reductase
ActVB from Streptomyces coelicolor*
, and
![]()
ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
340 nm = 6.22 mM
1 cm
1) due to the oxidation
of NADH, using a Varian Cary 1 Bio spectrophotometer. Under standard
conditions, the spectroscopic cuvette contained, in a final volume of
500 µl, 50 mM Tris/HCl, pH 7.6, 100 µM
NADH, and 50 µM FMN. The reaction was initiated by adding
0.5-1 µg of enzyme. Enzyme activities were determined from the
linear part of the progress curve, with less than 10% of reduced
pyridine nucleotide utilized over the time course of the reaction. One unit of activity is defined as the amount of protein catalyzing the
oxidation of 1 µmol of NADH per min. When high concentrations of
NAD(P)H were investigated, a 0.1-cm path length cuvette was used (final
volume 0.3 ml). The hydrophobic flavin analogues lumichrome, alloxazine, and lumiflavin were dissolved in 100% Me2SO,
and the enzymatic assays thus contained 90 mM
Me2SO, final concentration. Me2SO
concentrations up to 500 mM had no measurable effect on Km and Vm values.
259 nm = 15.4 mM
1
cm
1;
-NAD(P)+,
259 nm = 17.8 mM
1 cm
1; NMNH,
338
nm = 5.72 mM
1 cm
1;
riboflavin and FMN,
450 nm = 12.5 mM
1 cm
1; FAD,
450
nm = 11.3 mM
1 cm
1;
lumichrome,
356 nm = 6.0 mM
1
cm
1.
-D-galactopyranoside to a final
concentration of 250 µM when the optical density of the
culture was about 0.3. To minimize the formation of insoluble protein
aggregates, cultures were cooled to 25 °C after the addition of
isopropyl-1-thio-
-D-galactopyranoside and then further
grown for 5 h. Cells were collected by centrifugation for 10 min
at 6500 × g at 4 °C. Extraction of soluble proteins was performed by lysozyme digestion and freeze-thawing cycles, in the
presence of antiprotease CompleteTM buffer. All of the following operations were performed at 4 °C. After ultracentrifugation at 45,000 rpm during 90 min in a Beckman 60 Ti rotor, the supernatant was
used as soluble extracts for purification.
1. Bovine serum albumin
(66 kDa), ovalbumin (45 kDa), trypsin inhibitor (20.1 kDa), and
cytochrome c (12.4 kDa) were used as the markers for
molecular mass. The void volume was determined with ferritin (450 kDa).
Protein concentration was determined using the Bio-Rad protein assay
reagent (24) with bovine serum albumin as a standard. Anaerobic
experiments were carried out in a Jacomex glove box equipped with an HP
8453 diode array spectrophotometer coupled to the measurement cell by
optical fibers (Photonetics system).
![]()
RESULTS
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1
cm
1 at 455 nm for the bound FMN was calculated.

View larger version (11K):
[in a new window]
Fig. 1.
Absorption spectra of the purified ActVB
(60 µM in Tris/HCl 50 mM pH 7.6).

View larger version (32K):
[in a new window]
Fig. 2.
Anaerobic reduction of ActVB (130 µM) containing FMN bound (65 µM) by NADH, in 50 mM
Tris/HCl buffer pH 7.6. Shown, from top to
bottom, are the spectra recorded at 455 nm after the
addition of a 0- (
), 0.2-, 0.4-, 0.6-, 0.8-, 1-, 1.1-, and 1.3-fold
(
) molar excess of NADH with respect to FMN. The inset
shows a plot of fractional absorbance changes observed at 455 nm, as a
function of the [NADH]/[FMN] ratio.

View larger version (21K):
[in a new window]
Fig. 3.
Anaerobic titration of reduced ActVB-bound
FMN with NAD+. Spectra of ActVB (130 µM)
containing oxidized FMN-bound (65 µM) in 50 mM Tris/HCl buffer, pH 7.6, 5 mM EDTA, and 1.4 µM 5-deazaflavin (
). Spectra are shown after
irradiation for 30 min (
) and after irradiation and the anaerobic
addition of 5 µM (
), 20 µM (
), and 70 µM (
) NAD+.
Flavin reductase activity of different ActVB preparations, containing
various amounts of bound FMN, measured in the presence of NADH (200 µM) and FMN (100 µM) or riboflavin (100 µM) as substrates, in 50 mM
Tris/HCl, pH 7.6

View larger version (21K):
[in a new window]
Fig. 4.
A, flavin reductase initial velocity
vi as a function of NADH concentration in the
presence of 11 (
), 3.3 (
), 2.2 (
), 1.1 (
), 0.6 (
), or
0.22 µM (
) FMN. B, flavin reductase initial
velocity vi as a function of FMN concentration in
the presence of 11 (
), 8.2 (
), 6.6 (
), 4 (
), 2 (
), or
1.3 µM (
) NADH. The flavin reductase concentration
(e) used in these assays was 0.0545 µM. The
results are presented in the form of double reciprocal plots.

View larger version (22K):
[in a new window]
Scheme 1.
Structure of the different flavin
(A) and pyridine nucleotide (B)
analogs.

View larger version (27K):
[in a new window]
Fig. 5.
A, AMP as a competitive inhibitor for
NADH. The enzyme initial velocity vi was assayed as
a function of NADH concentrations using 7 µM FMN in the
absence (
) or in the presence of 2 (
), 5 (
), or 7 mM (
) AMP. In the inset is shown a secondary
plot of the slopes derived from Fig. 5A against [AMP],
fitted with a straight line corresponding to the equation,
y = (Km/Vm) (1 + ([I]/Ki)). B, AMP as a noncompetitive
inhibitor for FMN. The enzyme initial velocity vi
was assayed as a function of FMN concentrations using 40 µM NADH in the absence (
) or in the presence of 2 (
), 5 (
), or 7 mM (
) AMP. The inset
shows a secondary plot of the intercepts derived from Fig.
5B against [AMP], fitted with a straight line
corresponding to the equation, y = (([I]/(Ki Vm)) + 1/Vm. The flavin reductase concentration
(e) used in these assays was 0.0545 µM. The
results are presented in the form of double reciprocal plots.

View larger version (27K):
[in a new window]
Fig. 6.
A, lumichrome as a competitive inhibitor
for FMN. The enzyme initial velocity vi was assayed
as a function of FMN concentrations using 40 µM NADH in
the absence (
) or in the presence of 50 (
), 100 (
), 150 (
),
200 (
), or 260 µM (
) lumichrome. The
inset shows a secondary plot of the slopes derived from Fig.
6A against [lumichrome], fitted with a straight
line and corresponding to the equation, y = (Km/Vm) (1 + ([I]/Ki)). B, lumichrome as an
uncompetitive inhibitor for NADH. The enzyme initial velocity
vi was assayed as a function of NADH concentrations
using 7 µM FMN in the absence (
) or in the presence of
50 (
), 100 (
), 150 (
), 200 (
), or 260 µM
(
) lumichrome. The inset shows a secondary plot of the
intercepts derived from Fig. 6B against [lumichrome],
fitted with a straight line corresponding to the equation,
y = (([I]/(Ki
Vm)) + 1/Vm. The flavin reductase
concentration (e) used in these assays was 0.0545 µM.
1, respectively, which are comparable
with those reported in Table III.
Apparent kinetic constants for various flavin derivatives with NADH as
electron donor
Apparent kinetic and thermodynamic constants for NADH derivatives with
FMN as electron acceptor
![]()
DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
![]()
FOOTNOTES
To whom correspondence may be addressed. Tel.: 33-4-38-78-91-03;
Fax: 33-4-38-78-91-24; E-mail: mfontecave@cea.fr.
![]()
REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
REFERENCES
1.
Fontecave, M.,
Covès, J.,
and Pierre, J. L.
(1994)
BioMetals
7,
3-8[Medline]
[Order article via Infotrieve]
2.
Nivière, V.,
Vanoni, M. A.,
Zanetti, G.,
and Fontecave, M.
(1998)
Biochemistry
37,
11879-11887[CrossRef][Medline]
[Order article via Infotrieve]
3.
Ingelman, M.,
Ramaswamy, S.,
Nivière, V.,
Fontecave, M.,
and Eklund, H.
(1999)
Biochemistry
38,
7040-7049[CrossRef][Medline]
[Order article via Infotrieve]
4.
Covès, J.,
and Fontecave, M.
(1993)
Eur. J. Biochem.
211,
635-641[Medline]
[Order article via Infotrieve]
5.
Zenno, S.,
Saigo, K.,
Kanoh, H.,
and Inouye, S.
(1994)
J. Bacteriol.
176,
3536-3543 6.
Jeffers, C. E.,
and Tu, S.-C.
(2001)
Biochemistry
40,
1749-1754[CrossRef][Medline]
[Order article via Infotrieve]
7.
Kendrew, S. G.,
Harding, S. E.,
Hopwood, D. A.,
and Marsh, E. N. G.
(1995)
J. Biol. Chem.
270,
17339-17343 8.
Thibaut, D.,
Ratet, N.,
Bish, D.,
Faucher, D.,
Debussche, L.,
and Blanche, F.
(1995)
J. Bacteriol.
177,
5199-5205 9.
Parry, R. J.,
and Li, W.
(1997)
J. Biol. Chem.
272,
23303-23311 10.
Galan, E. D.,
Prieto, M. A.,
and Garcia, J. L.
(2000)
J. Bacteriol.
182,
627-636 11.
Gray, K. A.,
Pogrebinsky, O. S.,
Mrachko, G. T., Xi, L.,
Monticello, D. J.,
and Squires, C. H.
(1996)
Nat. Biotechnol.
14,
1705-1709[CrossRef][Medline]
[Order article via Infotrieve]
12.
Uetz, T.,
Schneider, R.,
Snozzi, M.,
and Egli, T.
(1992)
J. Bacteriol.
174,
1179-1188 13.
Witschel, M.,
Nagel, S.,
and Egli, T.
(1997)
J. Bacteriol.
179,
6937-6943 14.
Fieschi, F.,
Nivière, V.,
Frier, C.,
Décout, J. L.,
and Fontecave, M.
(1995)
J. Biol. Chem.
270,
30392-30400 15.
Eschenbrenner, M.,
Covès, J.,
and Fontecave, M.
(1995)
J. Biol. Chem.
270,
20550-20555 16.
Nivière, V.,
Fieschi, F.,
Décout, J. L.,
and Fontecave, M.
(1996)
J. Biol. Chem.
271,
16656-16661 17.
Nivière, V.,
Fieschi, F.,
Décout, J. L.,
and Fontecave, M.
(1999)
J. Biol. Chem.
274,
18252-18260 18.
Fontecave, M.,
Eliasson, R.,
and Reichard, P.
(1987)
J. Biol. Chem.
262,
12325-12331 19.
Zenno, S.,
and Saigo, K.
(1994)
J. Bacteriol.
176,
3544-3551 20.
Bruns, C. M.,
and Karplus, P. A.
(1995)
J. Mol. Biol.
247,
125-145[CrossRef][Medline]
[Order article via Infotrieve]
21.
Vadas, A.,
Monbouquette, H. G.,
Johnson, E.,
and Schröder, I.
(1999)
J. Biol. Chem.
274,
36715-36721 22.
Chiu, H. J.,
Johnson, E.,
Schröder, I.,
and Rees, D. C.
(2001)
Structure
9,
311-319[Medline]
[Order article via Infotrieve]
23.
Laemmli, U. K.
(1970)
Nature
227,
680-685[CrossRef][Medline]
[Order article via Infotrieve]
24.
Bradford, M. M.
(1976)
Anal. Biochem.
72,
248-254[CrossRef][Medline]
[Order article via Infotrieve]
25.
Segel, I. H.
(1975)
Enzyme Kinetics
, John Wiley & Sons, Inc., New York
26.
Massey, V.,
Matthews, R. G.,
Foust, G. P.,
Howell, L. G.,
Williams, C. H.,
Zanetti, G.,
and Ronchi, S.
(1970)
in
Pyridine Nucleotide-Dependent Dehydrogenases
(Sund, H., ed)
, pp. 393-409, Springer-Verlag, Berlin
27.
Zanetti, G.,
and Aliverti, A.
(1991)
in
Chemistry and Biochemistry of Flavoproteins
(Muller, F., ed), Vol. II
, pp. 306-312, CRC Press, Inc., Boca Raton, FL
28.
Rudolph, F. B.,
and Fromm, H. J.
(1979)
Methods Enzymol.
63,
139-159
29.
Dalziel, K.
(1973)
in
The Enzymes
(Boyer, P. D., ed), 3rd Ed., Vol. XI
, pp. 2-59, Academic Press, Inc., New York
30.
Spector, T.,
and Cleland, W. W.
(1981)
Biochem. Pharmacol.
30,
1-7[CrossRef][Medline]
[Order article via Infotrieve]
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
M. S. Nissen, B. Youn, B. D. Knowles, J. W. Ballinger, S.-Y. Jun, S. M. Belchik, L. Xun, and C. Kang Crystal Structures of NADH:FMN Oxidoreductase (EmoB) at Different Stages of Catalysis J. Biol. Chem., October 17, 2008; 283(42): 28710 - 28720. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Valton, C. Mathevon, M. Fontecave, V. Niviere, and D. P. Ballou Mechanism and Regulation of the Two-component FMN-dependent Monooxygenase ActVA-ActVB from Streptomyces coelicolor J. Biol. Chem., April 18, 2008; 283(16): 10287 - 10296. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-K. Lee and H. Zhao Identification and Characterization of the Flavin:NADH Reductase (PrnF) Involved in a Novel Two-Component Arylamine Oxygenase J. Bacteriol., December 1, 2007; 189(23): 8556 - 8563. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Valton, M. Fontecave, T. Douki, S. G. Kendrew, and V. Niviere An Aromatic Hydroxylation Reaction Catalyzed by a Two-component FMN-dependent Monooxygenase: THE ActVA-ActVB SYSTEM FROM STREPTOMYCES COELICOLOR J. Biol. Chem., January 6, 2006; 281(1): 27 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
|