 |
INTRODUCTION |
O-Linked glycosylation of mucin is initiated by the
transfer of N-acetylgalactosamine with an
-linkage to a
serine or threonine residue in protein. The GalNAc residue attached to
the peptide is usually extended to form more complex
O-glycan structures by the action of multiple
glycosyltransferases. The addition of GalNAc is controlled by multiple
members of the pp-GalNAc-T1
(EC 2.4.1.41) family. To date, 10 distinct members have been identified
in human (pp-GalNAc-T1, -T2, -T3, -T4, -T6 to -T9, -T11, and -T12)
(1-10) and 7 in rodent (ppGaNTase-T1, -T2, -T3, -T4, -T5, -T7,
-T102) (11-17). All share a
highly homologous primary sequence, 40-60% homology at the amino acid
level, to each other particularly in the predicted catalytic domain.
Each member exhibits different substrate specificity toward peptide
sequences. Thus, the positions of O-glycan in proteins are
determined by the substrate specificity of each pp-GalNAc-T. The genes
encoding these enzymes are distributed at different genomic
localizations on chromosomes and have distinct genomic structures
(4).
pp-GalNAc-T1, which was the first pp-GalNAc-T to be cloned
from bovine tissue (1), is the best characterized of the members. It
shows activity toward Muc1, Muc2, Muc5Ac, and Muc7 peptides (4, 18).
Peptide sequences derived from these mucins were used to determine the
site of the O-glycosylation of the Muc2 and Muc5Ac mucin
tandem repeat region by pp-GalNAc-T1 (19-22).
Many pp-GalNAc-Ts, including pp-GalNAc-T1, were found to be
distributed in digestive organs, lymphatic organs, and peripheral blood
cells (3-5) that produce various species of O-glycosylated protein. pp-GalNAc-T9 is an exception in that it is mainly expressed in
the brain; however, its activity has yet to be examined (8). Very
recently, it was reported that certain proteins in neurons, such as a
neurite outgrowth receptor, human
-synuclein related to Parkinson's
disease, and human syndecan-3, are modified by O-linked
glycosylation (23, 24). It is of interest to identify the
pp-GalNAc-T(s) responsible for the O-linked glycosylation of
proteins in neurons.
The shortest sequence motif, XTPXP, required for
high level mucin-type O-glycosylation, was discovered using
semi-purified pp-GalNAc-T from bovine colostrum (25). However, it has
not been determined whether this motif is suitable for all
pp-GalNAc-Ts, some of which were not cloned until the motif was found.
Thus, it is now important to determine the peptide motif specifically recognized by each pp-GalNAc-T.
pp-GalNAc-T13 has a very high level of sequence identity to
pp-GalNAc-T1. This resulted previously in the establishment
of mice lacking an intact gene for pp-GalNAc-T13 by using
the pp-GalNAc-T1 gene as a probe for cloning, and prior to
evidence for multiple pp-GalNAc-T isozymes (26, 27). In the previous
study (27), the complete gene encoding pp-GalNAc-T13, which
was partially identified and tentatively designated mouse
pp-GalNAc-T8, was never cloned and characterized. In this
report, we cloned and characterized a pp-GalNAc-T13 that is
expressed exclusively in neuronal cells. We examined the substrate
specificities of both enzymes, pp-GalNAc-T13 and -T1, toward peptides
encoded in the sequences of O-glycosylated proteins in
digestive organs and neuronal cells.
 |
EXPERIMENTAL PROCEDURES |
Tumor Cell Lines--
The tumor cell lines were cultured in RPMI
1640 medium (Invitrogen) supplemented with 10% fetal bovine serum
(FBS). The cell lines were donated or else purchased from American
Tissue Culture Collection, Riken Cell Bank, Japan Cell Research Bank,
Immunobiological Laboratory, or Dai-Nippon Pharmaceutical Co., Ltd.
Isolation of Human pp-GalNAc-T13 cDNA and Mouse pp-GalNAc-T13
cDNA--
In the data base of the full-length human cDNA
sequencing project supported by the New Energy and Industrial
Technology Development Organization, we found a cDNA encoding a
full-length sequence of pp-GalNAc-T13, which is highly
homologous to human pp-GalNAc-T1 (2). In the
full-length human cDNA sequence project, an oligo-capped, full-length enriched cDNA library of human NT2RI cells was
constructed using an expression vector pME18SFL3 according to the
oligo-capping method (28). This novel sequence (2428 bp) of
pp-GalNAc-T13 encoded a full open reading frame from bp 527 to 2198. The full-length sequence of pp-GalNAc-T13 was
deposited into GenBankTM/EBI Data Bank with the accession
number AB078142.
In a mouse EST data base, we found four EST sequences
(GenBankTM accession numbers BF467081, BE859530, BB623792,
and BB304998) being highly homologous (92.5% homology at the nucleic acid level and 99.3% at the amino acid sequence level) to human pp-GalNAc-T13. In this study, the full-length sequence of mouse pp-GalNAc-T13 was registered in the
GenBankTM/EBI Data Bank with the accession number
AB082928.
Expression and Purification of Recombinant pp-GalNAc-T13
Expressed in Insect Cells--
The method used to express the soluble
form of the enzyme was almost the same as that described in our
previous paper (29). Truncated coding regions of pp-GalNAc-T13 and -T1,
starting at the same amino acid, residue 40, were constructed
downstream of the human immunoglobulin
secretion signal and the
FLAG epitope tag in the vector pFBIF. An expression construct of
pp-GalNAc-T13 was prepared by PCR using primer RO17F
(5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAGATCTCTGCTGCCTGCATTGAGG-3') and O17R (5'-
GGGGACCACTTTGTACAAGAAAGCTGGGTCCTATGTGCCCAAGGTCATGTTCCTTAG-3'). The
amplified fragment was cloned into pFBIF, and the construct was
used to produce recombinant virus, which was in turn used to infect
Sf21 (Pharmingen) or High FiveTM insect cells
(Invitrogen) and amplified. The infected Sf21 or High
FiveTM insect cells were incubated at 27 °C until the
survival rate of the cells was less than 30-50% to yield conditioned
media containing recombinant pp-GalNAc-T13 protein fused with the FLAG
peptide. The recombinant protein was readily purified using anti-FLAG
M1 antibody resin (Sigma) and eluted with a 50 mM
Tris-buffered saline (50 mM Tris-HCl, pH 7.4, 150 mM NaCl) buffer containing 2 mM EDTA. The
FLAG-tagged protein purified from the mock-transfected cells did not
show any activity (data not shown).
To compare the activity of pp-GalNAc-T13 to those of human pp-GalNAc-T1
and -T9, recombinant forms of the latter two were also prepared. For
pp-GalNAc-T1, the sequence was cloned into pFBIF by PCR with the primer
RT1F120
(5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCAGAGGACTTCCTGCTGGAGATGTT-3') and OT1R
(5'-GGGGACCACTTTGTACAAGAAAGCTGGGTCCTAGAATATTTCTGGCAGGGTGACGTT-3') and
then expressed in the High Five insect cells. A soluble form of human
pp-GalNAc-T9 was produced in the same way. The primers used to clone
pp-GalNAc-T9 were RT9F115
(5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCCGCATCGTGAGCGGCGACCGCCGGT-3') and
OT9R
(5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCGAAGGAGATAGAACCATGGCGGTGGCCAGGAAGATCCGA-3'). Recombinant pp-GalNAc-T13, -T1, and -T9 proteins were separated by 10% SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF)
membrane (Bio-Rad). Bands of interest were detected using anti-FLAG
monoclonal antibody with Western blotting to determine the relative
amounts of recombinant enzymes.
Assay of pp-GalNAc-T Activity--
The acceptor peptides Muc1a'
(AHGVTSAPDTR), Muc5AC (GTTPSPVPTTSTTSA), and Muc7
(PTPSATTPAPPSSSAPPETTAA) were derived from the tandem repeat of human
MUC1, MUC5AC, and MUC7, respectively (30-32). The acceptor peptides,
SDC106, SDC155, SDC165, SDC222, SDC238, and SDC284, were derived from
the sequence of human syndecan-3 (33) (their sequences are shown in
Table I). We purchased commercially synthesized peptides with the N-terminal or C-terminal amino acid labeled with 5-carboxyfluorescein succinimidyl ester (5-FAM, SE) (Molecular Probes Inc., Eugene, OR). Muc1a', Muc5Ac, SDC222, and SDC238
peptides were labeled with 5-FAM at their N-terminal amino acid. Muc7,
SDC106, SDC155, SDC165, and SDC284 peptides were synthesized with an
additional lysine residue attached to the C terminus, which was labeled
with 5-FAM.
Standard assays were performed in a 20-µl reaction mixture containing
25 mM Tris-HCl, pH 7.4, 10 mM
Mn2Cl, 0.2% Triton X-100, 250 µM UDP-GalNAc
(Sigma), and 0.01-2 mM of acceptor peptide. The enzyme
reaction was performed for an appropriate period at 37 °C and
terminated by boiling. The reaction mixture was analyzed by HPLC
(Shimadzu, Kyoto, Japan) using a Cosmosil 5C18-AR reverse phase column (4.6 × 250 mm) with a flow rate of 1 ml/min and a linear gradient of 0-50% acetonitrile, 0.05% trifluoroacetic acid in
30 min at 40 °C. FAM-labeled glycopeptides were detected by fluorescence detector (RF-10AXL, Shimadzu) at an emission
wavelength of 520 nm. Km values for acceptor
substrates were calculated using peptides with concentrations from 0.01 to 2 mM in the presence of 0.5-1.0 mM
UDP-GalNAc. The Michaelis-Menten equation was applied to the initial
rate data using a non-linear least square regression program (34).
Quantitative Analysis of pp-GalNAc-T13 and -T1 Transcripts in
Human Tissues and Cell Lines by Real Time PCR--
For the
quantification of pp-GalNAc-T13 and -T1
transcripts, we employed the real time PCR method, as described in
detail previously (29, 35, 36). Marathon ReadyTM cDNAs
derived from various human tissues were purchased from Clontech. cDNAs derived from many different
cells were prepared as in our previous study (37). Standard curves for
the pp-GalNAc-T13 and -T1 genes and the
endogenous control, glyceraldehyde-3-phosphate dehydrogenase
(GAPDH), were generated by the serial dilution of pBluescript II
SK(+) vectors containing the pp-GalNAc-T13 and -T1 genes and a pCR2.1 vector (Invitrogen) containing the
GAPDH cDNA, respectively. The PCR mixture was prepared using a
TaqMan Universal Master Mix (PE Applied Biosystems). Primer sets and probes were as follows: for pp-GalNAc-T13 gene, a forward
primer (T13-F) encoded in exon 6-7, 5'-ATCTTGAAATGTCTTTTAGGATTTGGC-3'; a reverse primer (T13-R) encoded in exon 8-9,
5'-TGGTTTCAACATTTCTTATCTCACCA-3'; and a probe (T13-P) in exon 7, 5'-CCTGGTGGCACTGGTCATGTCATCAACAAG-3' with a minor groove binder (38);
for pp-GalNAc-T1 gene (GenBankTM accession
number X85018), a forward primer (T1-F) in exon 1-2,
5'-GGACTTCCTGCTGGAGATGTTCTA-3'; a reverse primer (T1-R) in exon 3-4,
5'-CTAAAGGCCTTTTCAAAAAGTCTCTTTC-3'; and a probe (T1-P) in exon 3, 5'-CAATGAGGCTTGGAGCACACTTCTG CG-3' with the minor groove binder. Each
real time PCR was performed for 50 cycles (95 °C for 30 s,
60 °C for 40 s, and 72 °C for 30 s) using a real time PCR system (ABI PRISM 7700 Sequence Detection System, Applied Biosystems).
Measurement of pp-GalNAc-T13 and -T1 Transcripts by
Semi-quantitative RT-PCR in Primary Cultured Neurons and Astrocytes
from Mouse Brain--
cDNAs derived from primary cultured neurons
and astrocytes from mouse were prepared as follows: E17 and P0
wild-type mouse brain was used for the primary culture of neurons and
astrocytes, respectively, according to the method described previously
(39). For the neuron culture, the cells were seeded to the
poly-L-lysine-coated wells of 24-well plates at a density
of 5 × 105 cells/well in minimum essential medium
(Invitrogen) containing 2% FBS. The neurons were cultured for 5 days
at 37 °C in 5% CO2. For the astrocyte culture, the
cells were seeded to 75-cm2 flasks at a density of 2.0 × 107 cells/bottle in Dulbecco's modified essential
medium containing 10% FBS and cultured at 37 °C in 5%
CO2 with a change of medium twice a week. After 1 week,
non-astrocytes were removed by shaking (40). The resultant astrocytic
monolayer was removed and dissociated by trypsin treatment. The cell
suspension was seeded onto 24-well plates at a density of 2 × 105/well or onto 75-cm2 culture flasks at a
density of 2 × 107 cells. The astrocytes were
cultured for a further 5 days.
The purity of the neurons and the astrocytes in each
primary culture was ~97 and over 98%, respectively, as determined by immunostaining with anti-neurofilament antibody (Dako, A/S, Denmark) for neurons and with anti-glial fibrillary acidic protein antibody (Dako) for astrocytes.
We designed primer sets for the measurement of the transcripts for
mouse pp-GalNAc-T13, -T1, and
-actin genes by RT-PCR. Primer sets were as follows: for
mouse pp-GalNAc-T13, a forward primer (mT13-F),
5'-ATCCCTGCTGCCTGCGCTGAGG-3', and a reverse primer (mT13-R),
5'-TGTCCCCAAGGTCATGTTCCTCAG-3'; for mouse pp-GalNAc-T1, a
forward primer (mT1-F), 5'- ATGAGAAAATTTGCATATTGCAAG-3', and a
reverse primer (mT1-R), 5'-TCAGAATATTTCTGGAAGGGTGACATT-3'; for mouse
-actin, a forward primer,
5'-ATATCGCTGCGCTGGTCGTCGAC-3', and a reverse primer,
5'-CAAGAAGGAAGGCTGGAAAAGAG-3'.
Matrix-assisted Laser Desorption/Ionization-Time of
Flight Mass Spectrometry (MALDI-TOF-MS) and Amino Acid Sequencing of
Glycopeptide Products--
In order to determine the glycosylation
sites of products of the pp-GalNAc-T13 and -T1 reactions, glycopeptides
isolated by HPLC were subjected to MALDI-TOF-MS using
REFLEXTM IV (Bruker Daltonics, Tsukuba, Japan) and Edman
degradation on a protein sequencer PPSQ-23A (Shimadzu, Kyoto, Japan).
Mass spectra were externally calibrated unless otherwise stated. The
glycopeptides to be examined were dissolved in 0.1% trifluoroacetic
acid to a concentration of 2 pmol/µl. One microliter of the sample
solution was mixed with 1 µl of the matrix solution
(2,5-dihydroxybenzoic acid, 10 mg/ml in 30% acetonitrile containing
0.1% trifluoroacetic acid) and then applied directly to the target.
Simultaneously, 50-100 pmol of the same sample was dried on PVDF
membrane with Prosorb Sample Preparation Cartridge (Applied Biosystems)
and spotted on BioBrene Plus (Applied Biosystems). Phenylhydantoin (PTH)-amino acid mixed standard (Wako, Osaka, Japan) was
chromatographed using the isocratic program and monitored for
absorbance at 269 nm. The PTH-Thr-O-GalNAc diastereomers
were detected in two peaks at 3.07 and 3.25 min, which were near the
position of dithiothreitol. The PTH derivative of
Ser-O-GalNAc (Calbiochem) was identified as a peak at 2.96 min the same as the retention time of PTH-Glu.
Immunohistochemistry with HB-Tn1 Antibody--
Brain tissues
from pp-GalNAc-T13 null-mice and wild-type mice described in
a previous study (26) were fixed in 10% buffered formalin for 24 h and transferred to 70% ethanol for the subsequent dehydration and
paraffin-embedding process. Paraffin sections were prepared with a
5-µm thickness, then deparaffinized, and rehydrated. After the
blocking of endogenous peroxidase activity with 0.3% hydrogen peroxide
for 30 min, the serial tissue sections were incubated overnight at
4 °C with HB-Tn1 (1:50) antibody (Dako). After being rinsed with
Tris-buffered saline, the tissue sections were incubated with Envision+
(Dako) for 30 min at room temperature. After another rinse, the
peroxidase activity was visualized with the aid of a
diaminobenzidine/hydrogen peroxide solution. Counterstaining was
carried out with hematoxylin. Anti-mouse IgM (Dako) was used for
control experiments; no specific staining was found (data not shown).
Dot Western Blotting Analysis to Detect Tn Antigen on
Glycopeptide--
Glycopeptides, including mono-GalNAc/T-SDC106,
di-GalNAcs/TT-SDC106, and tri-GalNAcs/STT-SDC, were produced by
pp-GalNAc-T13 with FAM-SDC106 as an acceptor substrate.
Mono-GalNAc-Muc1a' was prepared with pp-GalNAc-T6. Approximately 100 pmol of naked peptides (FAM-Muc1a' and FAM-SDC106) and glycosylated
peptides were dissolved in 50% 2-propanol and dot-blotted on the PVDF
membrane (Atto, Tokyo, Japan). After peptide thermal blotting using the
TCL Thermal Blotter (Atto) at 180 °C, 0.08 kg/cm2 for
30 s, the membrane was blocked with phosphate-buffered saline containing 2% bovine serum albumin at 4 °C overnight and subjected to Western blotting analysis. The primary antibody, HB-Tn1 (Dako), and
a secondary antibody, horseradish peroxidase-conjugated donkey anti-mouse-IgM (Jackson ImmunoResearch, Pennsylvania), was diluted 1:100- and 2500-fold in phosphate-buffered saline, respectively. The
positive dots were detected using the ECL plus system (Amersham Biosciences). The FAM-labeled glycopeptides were detected by
FluorImagerTM 959 (Amersham Biosciences) at the 488 nm
laser line. LSC cell lysates (100 ng protein) were used as a positive
control of Tn antigen (41).
 |
RESULTS |
cDNA Cloning and Sequence Analysis of Human and Mouse
pp-GalNAc-T13--
The alignment of the nucleotide sequence of human
pp-GalNAc-T13 and mouse pp-GalNAc-T13 is shown in
Fig. 1. The open reading frame sequences
of pp-GalNAc-T13 in human and mouse exhibit 92.5% homologies. Both encode proteins of 556 amino acids, respectively, and
only 4 amino acids are different from each other. This indicates that
mouse pp-GalNAc-T13 (formerly designated mouse
pp-GalNAc-T8) is the orthologous gene of human
pp-GalNAc-T13.

View larger version (77K):
[in this window]
[in a new window]
|
Fig. 1.
Comparison of human and mouse
pp-GalNAc-T13 nucleotide sequences. Multiple
alignments of the two genes were performed by GENETYX.
Asterisks indicate the nucleotides identical between the two
genes. The codons that encode different amino acid residues between two
genes are indicated by boxes. The upper sequence
is human pp-GalNAc-T13 gene. The lower sequence
is mouse pp-GalNac-T13 gene.
|
|
The alignment of the amino acid sequences of human pp-GalNAc-T13 and
-T1 using ClustalW is shown in Fig.
2A. The putative amino acid sequence of human pp-GalNAc-T13 encoded a 556-amino acid
protein, which is predicted to be a type II membrane protein. The
protein consists of an 8-amino acid N-terminal cytoplasmic region and a
20-amino acid transmembrane segment, followed by a stem region, a
putative catalytic region, and a C-terminal region that possesses
structural homology to the plant lectin ricin (42). As shown in Fig.
2A, pp-GalNAc-T13 has high sequence identity to
pp-GalNAc-T1, 84.3% at the amino acid level, and retained both the
DXH motif (position 209-211), probably essential for
divalent cation binding, and the
DXXXXXWGGENXE motif (position 310-322) in
the catalytic domain. Both motifs are conserved in the other pp-GalNAc-T members. Three possible N-glycosylation sites
were found in the primary sequence of pp-GalNAc-T13, two of which were also conserved at the same positions of pp-GalNAc-T1.

View larger version (44K):
[in this window]
[in a new window]
|
Fig. 2.
Comparison of human pp-GalNAc-T13 and
pp-GalNAc-T1 in amino acid sequence and genomic structure.
A, multiple sequence alignment (ClustalW) of human
pp-GalNAc-T1 and -T13. The matching amino acid residues in the two
enzymes are indicated by asterisks. Positions of introns,
the putative transmembrane regions, and potential
N-glycosylation sites are indicated by arrows,
underlines, and square boxes, respectively. The
positions of primers used for the recombinant enzyme construction
(RT13F and RT1F120) are indicated by horizontal arrows.
B, genomic structure of human pp-GalNAc-T13 gene
localized on chromosome 2 and pp-GalNAc-T1 gene localized on
chromosome 18. Exons are indicated by numbers.
|
|
We compared the genome structures of two genes,
pp-GalNAc-T13 and -T1 (Fig. 2B). The
cDNA sequence of pp-GalNAc-T13 was compared with a draft
genome sequence (GenBankTM accession number NT_005311),
which is localized on chromosome 2, encoding its genome sequence. Both
genes contain at least 11 exons, the lengths of which were exactly the
same between the genes. The pp-GalNAc-T13 gene spanned over
506 kb in the NT_005311 clone and is almost 10 times longer than the
pp-GalNAc-T1 gene spanning about 49 kb in the NT_011029
clone which is localized to chromosome 18. For chromosome locations,
mouse pp-GalNAc-T13 and -T1 are also localized to
chromosomes 2 and 18, respectively.
Expression Levels of pp-GalNAc-T13 and -T1 Transcripts in Various
Human Tissues and Cell Lines--
The expression levels of
pp-GalNAc-T13 and -T1 transcripts in various
adult and fetal human tissues and tumor cell lines were determined by
the real time PCR method. The pp-GalNAc-T1 transcripts were
ubiquitously expressed in all tissues examined as reported previously
(3) (Fig. 3). It was notable that it was
almost 10 times more abundant than the pp-GalNAc-T13
transcript (the scale bar of the transversal axis indicates a 10-fold
difference). However, the expression level of pp-GalNAc-T13
was highest in the fetal brain, followed by the adult cerebellum,
cerebral cortex, and whole brain. The transcript was negligibly
expressed or undetectable in the other tissues (Fig. 3).
pp-GalNAc-T1 was also ubiquitously expressed in all human
cell lines examined, whereas pp-GalNAc-T13 was expressed
exclusively in neuroblastoma cells being undetectable in all other cell
lines including glioblastoma cells (Fig.
4).

View larger version (23K):
[in this window]
[in a new window]
|
Fig. 3.
Quantitative analysis of the
pp-GalNAc-T13 and -T1 transcripts in
human tissues by real time PCR. The expression level of
pp-GalNAc-T13 or -T1 transcript was normalized to
that of GAPDH transcript measured in the same cDNAs. Values are
expressed as copy numbers of the target gene in 1 µg of total RNA.
Asterisks indicate that the transcripts were not
detected.
|
|

View larger version (27K):
[in this window]
[in a new window]
|
Fig. 4.
Quantitative analysis of the
pp-GalNAc-T13 and -T1 transcripts in
human tumor cell lines by real time PCR. The expression levels of
pp-GalNAc-T13 or -T1 transcript were normalized
to the GAPDH transcript measured in the same cDNAs. Values are
expressed as copy numbers of the target gene in 1 µg of total RNA.
Asterisks indicate that the transcripts were not
detected.
|
|
Exclusive Expression of Mouse pp-GalNAc-T13 Transcripts in
Neurons--
As same as the expression pattern in human, the mouse
pp-GalNAc-T13 transcript was expressed only in brain, which
was determined by the Northern blot analysis with total RNA from
various mouse tissues (data not shown). To confirm that
pp-GalNAc-T13 is expressed exclusively in neuronal cells, we
employed a primary culture system of mouse neurons and astrocytes.
Expression levels of mouse pp-GalNAc-T13 and -T1
in primary cultured neurons and astrocytes were determined semi-quantitatively by RT-PCR. As seen in Fig.
5, the amount of pp-GalNAc-T13
expressed in neurons was less than that of pp-GalNAc-T1 consistent with the results in the previous experiments. The
pp-GalNAc-T13 transcript was not detected in astrocytes,
whereas pp-GalNAc-T1 was abundantly expressed in both
neurons and astrocytes.

View larger version (33K):
[in this window]
[in a new window]
|
Fig. 5.
Semi-quantitative measurement of the
pp-GalNAc-T13 and -T1
transcripts in primary cultured neurons and astrocytes from mouse
brain. The expression levels of mouse pp-GalNAc-T13 and
-T1 transcripts in primary cultured neurons and astrocytes
were determined by RT-PCR. The template cDNAs were amplified by 20, 30, and 40 cycles.
|
|
These results suggested that the expression of pp-GalNAc-T13
is limited to neuronal cells and not to glial cells in the brain.
Difference of Substrate Specificity between pp-GalNAc-T13 and
-T1--
As shown in Fig. 6A,
the FLAG-fused truncated forms of both pp-GalNAc-T13 and -T1 were
detected by Western blotting with anti-FLAG antibody. The intensity of
the bands corresponding to a molecular mass of 64.4 kDa was
measured by densitometer to determine the relative amounts of each
enzyme. The amounts of each enzyme were made equal for assaying the
pp-GalNAc-T activity. To compare the substrate specificity and the
kinetic properties of pp-GalNAc-T13 and -T1 for the GalNAc-transfer, we
first employed a FAM-labeled Muc5Ac peptide (FAM-GTTPSPVPTTSTTSA) as an
acceptor substrate. This substrate contains 9 threonine and serine
residues, which are potential sites for the GalNAc transfer. The
reaction products were analyzed by HPLC at different time points during
the 24-h reaction. The HPLC patterns of reaction products with a 50%
amount of substrate remaining in each enzyme reaction were compared and shown in Fig. 6B. pp-GalNAc-T13 and -T1 produced a peak (P1)
as the first product at the same retention time (20.98 min).
Subsequently, pp-GalNAc-T13 and -T1 produced second peaks, P2 and P2',
which showed different retention times, 20.53 and 20.28 min,
respectively. Although we could not determine the GalNAc positions by
peptide sequencer because of N-terminal block by FAM, peaks were
determined as a mono-glycosylated Muc5Ac (P1) and as di-glycosylated
Muc5Ac peptides (P2 and P2') by MALDI-TOF MS (data not shown). These results demonstrate that two highly homologous enzymes, pp-GalNAc-T13 and -T1, show the different substrate specificities for GalNAc transfers to Muc5Ac.

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 6.
HPLC analysis of in vitro
O-glycosylation of Muc5AC peptide by purified recombinant
pp-GalNAc-T13 and pp-GalNAc-T1. A, measurement of each
recombinant enzyme probed with anti-FLAG antibody by Western blotting.
B, HPLC elution profiles of FAM-Muc5Ac peptides glycosylated
by pp-GalNAc-T13 and -T1, whereas 50% of the original substrate
remained. Peaks are numbered in the order of appearance during the
reaction. P1 has the same retention time both in the pp-GalNAc-T13 and
-T1 reactions. However, P2 in the pp-GalNAc-T13 reaction has a
different retention time from P2' in the pp-GalNAc-T1 reaction.
|
|
A significant difference between the activities of the two enzymes was
found when a FAM-labeled Muc7 peptide (PTPSATTPAPPSSSAPPETTAAK-FAM) was
used as an acceptor substrate (Fig.
7A). pp-GalNAc-T1 produced the
first distinct peak (P1) at around 0.5 h of incubation but no
additional peaks even after 96 h, whereas pp-GalNAc-T13 showed activity to produce P1 which appeared after 10 min of incubation, followed by the production of additional peaks. The P1 peaks of both
the pp-GalNAc-T1 and -T13 products were isolated by HPLC. Each P1 peak
was subjected to mass spectrometry and protein sequencing analyses and
was determined to have a single GalNAc residue at the 7th threonine of
the peptide, i.e. mono-GalNAc/T7th-Muc7 (Table
II). To ascertain the secondary activity
of both enzymes, the mono-GalNAc/T7th-Muc7 (P1) produced by
pp-GalNAc-T1 was isolated and used as the acceptor substrate for fresh
enzyme reaction again. When fresh enzyme was added, pp-GalNAc-T1 did
not produce any new peaks even after prolonged incubations (Fig.
7B). However, pp-GalNAc-T13 exhibited apparent and strong
secondary and tertiary activities producing multiple new peaks. In
addition, the activities of both enzymes remaining after 96 h of
incubation were examined by the addition of fresh acceptor and donor
substrates. As the substrate peak area decreased with the concomitant
increase of the product peak area during 24 h of incubation, the
enzymes were proved to be still active even after the first 96 h
of incubation (data not shown). These results indicated that
pp-GalNAc-T1 exhibits the primary activity to transfer GalNAc to the
7th threonine but not secondary activity for additional GalNAc
transfers. In contrast, pp-GalNAc-T13 exhibits apparent secondary and
tertiary activities to produce multiple peaks following the primary
GalNAc transfer to the 7th threonine.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 7.
HPLC analysis of in vitro
O-glycosylation on Muc7 peptide using purified recombinant
pp-GalNAc-T1 and -T13. A, the elution profiles of
glycosylated FAM-Muc7 peptide using pp-GalNAc-T1 and -T13. Peaks are
numbered in the order of appearance during the reaction. Peak
S corresponds to the original substrate, non-glycosylated peptide.
P1-5 correspond to the products of the enzyme reaction.
B, Mono-GalNAc-T7th-Muc7 produced by
pp-GalNAc-T1 was isolated and used as the acceptor substrate for the
secondary activity of GalNAc-T13 and -T1. C, schematic
representation of the predicted order of GalNAc transfer to Muc7 by
pp-GalNAc-T13. The GalNAc transfer order predicted from MS and peptide
sequence analysis are described in Table II. The order of GalNAc
transfers to the Muc7 peptide was indicated by circled
numbers.
|
|
We isolated each peak of the pp-GalNAc-T13 products and determined the
number and positions of GalNAc residues transferred on the peptide by
mass spectrometry and protein sequencing, respectively (Table II). Mass
spectrometric analysis revealed that P1, P2, P3, P4, and P5 possess
one, two, three, four, and five GalNAc residues on the peptide,
respectively. The order in which GalNAc was added to the Muc7 peptide
by pp-GalNAc-T13 is summarized in Fig. 7C based on the
results of the protein sequencing of each peak. The GalNAc residue was
first transferred to the 7th threonine showing P1. P2 was determined to
have two GalNAc residues at the 7th threonine and the 13th serine and
was followed by the appearance of P3, which possess three GalNAc
residues at the 2nd threonine in addition to the two GalNAcs of P2. P4
has four GalNAc residues and the new GalNAc addition was determined to
be at the 14th serine. Finally, GalNAc was added to the 19th threonine
resulting in the appearance of P5.
Comparison of Kinetic Properties of Enzymic Activity between
pp-GalNAc-T13 and -T1--
To investigate the effects of the
concentration of the acceptor peptide, we determined several
kinetic parameters of pp-GalNAc-T13, -T1, and -T9. As summarized in
Table I, the Km value of purified recombinant
pp-GalNAc-T13 was found to be slightly lower than that of
pp-GalNAc-T1 for Muc1a' and similar for Muc7, but the
Vmax values of pp-GalNAc-T13 for both acceptor
peptides were found to be much higher than those of pp-GalNAc-T1. These results demonstrated that pp-GalNAc-T13 has stronger activity toward
Muc1a' and Muc7 than pp-GalNAc-T1. The kinetic parameters of
pp-GalNAc-T1, such as Km values for Muc1a' and Muc7, were similar to those in previous reports (4, 18). The subtle difference in Km values for Muc1a' between our experiments (0.23 mM shown in Table I) and theirs (0.66 mM,
(18)) may be due to the sequence of the peptide or FAM modification.
However, the Vmax of pp-GalNAc-T1 was slightly
lower than that of a previous report (maximum 20%), which should be
caused by the different expression and assay systems. In contrast, the
Km and Vmax values of
pp-GalNAc-T9 for either Muc1a' or Muc7 were lower than those of
pp-GalNAc-T13 and -T1.
Ability of pp-GalNAc-T13 to Transfer GalNAcs at Three Consecutive
Amino Acid Positions on Human Syndecan-3--
Human syndecan-3 is an
integral membrane proteoglycan associated largely with epithelial cells
and also known to be mostly expressed in the nervous system (43). As
described in the previous section, the expression of pp-GalNAc-T13 is
restricted to neurons. In this sense, syndecan-3 may be a natural
substrate for pp-GalNAc-T13. It has been reported that syndecan-3
carries an antigenic epitope that reacts with an anti-Tn antibody,
MLS128, and the reactivity is regulated during development in the mouse
brain (24, 44, 45). The epitope structure recognized by MLS128 has also
been reported to compose three or four consecutive sequences of
GalNAc-Ser/Thr (46, 47). It is of interest to determine which
pp-GalNAc-T is responsible for the synthesis of the MLS128 epitope,
comprising the clustered GalNAc residues, on syndecan-3. A search for
potential O-glycosylation sites in the human syndecan-3
amino acid sequence (GenBankTM accession number AF248634)
was made in the NetOGlyc 2.0 data base. This search identified three
potential sites for the consecutive GalNAc attachment and additional
O-glycosylated sites having the mucin box motif (25). Three
peptides that contain the potential sites for the consecutive GalNAc
attachment were prepared as acceptor substrates and named SDC106,
SDC155, and SDC165 in which numbers indicate the position of the
N-terminal amino acid of the peptide in human syndecan-3. One peptide,
SDC284, having a typical T1 mucin box (XTPXP),
and two peptides, SDC222 and SDC238, having neither a mucin box nor
potential triplet-Tn epitope sites, were also prepared for controls.
pp-GalNAc-T13 was incubated for 24 h with SDC106 having a triplet
of STT. As seen in Fig. 8A,
pp-GalNAc-T13 gave three peaks of the reaction products, P1, P2, and
P3. Each peak was isolated and subjected to MALDI-TOF MS and protein
sequencing. P1, P2, and P3 were identified to have a molecular mass of
1546.3, 1749.3, and 1952.3 m/z, respectively,
which indicated that they were mono-, di-, and tri-glycosylated SDC106
peptides, respectively (Fig. 8B).

View larger version (22K):
[in this window]
[in a new window]
|
Fig. 8.
HPLC and MALDI-TOF mass analysis on the
pp-GalNAc-T13 reaction product derived from SDC106 peptide.
A, the elution position of FAM-labeled SDC106 peptide
(S), and three reaction products, P1,
P2, and P3, directed by pp-GalNAc-T13. The reaction was
run for 24 h. Each peak in A was isolated and subjected
to MALDI-TOF mass analysis as shown in B.
|
|
As seen in Fig. 9, the amino acid
sequencing demonstrated that P1 had a GalNAc residue at the 5th
threonine, P2 had two GalNAc residues at the 5th and 4th threonines,
and P3 had three GalNAc residues at the 5th and 4th threonine and the
3rd serine. The above results strongly demonstrated that pp-GalNAc-T13
is able to synthesize the triplet cluster of GalNAcs on syndecan-3, and the order in which GalNAc is transferred first at the 5th threonine, then at the 4th threonine, and finally at the 3rd serine. pp-GalNAc-T13 also synthesized a triplet cluster of GalNAcs on SDC155
(QRATTVS*T*T*MAK-FAM; asterisks indicates the positions of GalNAc
transferred) and SDC165 (ATTAAT*S*T*GDPTVAK-FAM) as well as on SDC106
(data not shown).

View larger version (20K):
[in this window]
[in a new window]
|
Fig. 9.
Peptide sequence analysis of SDC106
glycopeptide products. The glycosylated products,
P1, P2, and P3, in Fig. 8 were
sequenced by Edman degradation. The spectral chromatograph shows the
different elution position of Ser/Thr having GalNAc from that of
Ser/Thr. S* and T* denote the position of
PTH-Ser-O-GalNAc diastereomers and
PTH-Thr-O-GalNAc diastereomers, respectively. Labels used in
this figure are as follow; V, valine; S, serine;
T, threonine; P, proline; A, alanine;
L, leucine; 1, dithiothreitol (DTT);
2, dimethylphenylthiourea (DMPTU); 3,
diphenylthiourea (DPTU).
|
|
As shown in Table I, the Km and
Vmax values of pp-GalNAc-T13 for transferring
the first GalNAc, i.e. producing the P1 peak (Fig.
8A), to SDC106, SDC155, and SDC165 were determined. pp-GalNAc-T13 exhibited strong activity for the transfer of GalNAc to
SDC106, -155 and -165, and quite strong activity toward SDC284 but not
toward SDC222 and SDC238. In contrast, pp-GalNAc-T1 did not transfer
GalNAc to any peptides except for SDC284. pp-GalNAc-T9, which has been
reported to be expressed in neuron (8), was examined for activity to
synthesize the Tn epitope, because pp-GalNAc-T9 is also probably
co-localized with syndecan-3 in neuronal cells. However, pp-GalNAc-T9
had no activity for the transfer of GalNAc to SDC106, -155, and -165. It showed positive activity only toward SDC284. Neither pp-GalNAc-T1
nor -T9 produced the triplet cluster of GalNAc.
Immunohistochemical Detection of Tn Antigen in Brain Tissue of
pp-GalNAc-T13 Null Mouse--
In a previous study performed prior to
direct evidence of multiple pp-GalNAc-T isozymes, mice lacking an
intact pp-GalNAc-T13 gene, subsequently termed
pp-GalNAc-T8, were established using the bovine
pp-GalNAc-T1 gene as a probe during genomic cloning in the
mouse. The high level of sequence identity between the two clones
suggested an orthologous relationship (26, 27). In this paper, however,
the tentative mouse pp-GalNAc-T8 gene was revealed as the
orthologous gene of human pp-GalNAc-T13. To investigate the
ability of pp-GalNAc-T13 to synthesize Tn antigen in the brain, we
performed an immunohistochemical study on the brain of
pp-GalNAc-T13 null mice using HB-Tn1 antibody.
So far, the expression of Tn antigen on syndecan-3 had been
investigated in the developing mouse brain using MLS128 antibody (24,
44). It was reported that the triplet Tn antigen is present in late embryonic brain with an expression peak in the early postnatal brain
(postnatal 3-7 days, P3-P7), and immunoreactivity for MLS128 was
restricted to the cell bodies of Purkinje cells in the P7 mouse brain
(44). P7 mouse cerebellum and HB-Tn1 antibody were employed for
immunohistochemical analysis in this experiment. As seen in Fig.
10A, the immunoreactivity of
HB-Tn1 was detected in Purkinje cells of the P7 wild-type mouse,
consistent with a previous report (44). In addition, cell bodies of
neuronal cells in the internal granular layer also exhibited positive
reactivity. According to the previous studies (24, 44), internal
granular layer cells were not likely stained with MLS128, and this was different from our present results using HB-Tn1. In contrast, the
pp-GalNAc-T13 null mouse showed a remarkable decrease in
HB-Tn1 reactivity both in Purkinje cells and in internal granular layer cells (Fig. 10B).

View larger version (91K):
[in this window]
[in a new window]
|
Fig. 10.
Immunohistochemical staining of P7
mouse cerebellum cortex with HB-Tn1 monoclonal antibody (×400).
In the wild-type mouse brain, the Tn immunoreactivity was observed in
the Purkinje cell (PC) bodies and internal granular layer
(IGL) cells of the cerebellum cortex (A).
B, decrease in Tn immunoreactivity in the
pp-GalNAc-T13 null mouse.
|
|
HB-Tn1 is commercially available, but the epitope recognized by HB-Tn1
has not been determined. To explain the above immunohistochemical results, the reactivity of HB-Tn1 against glycopeptides was examined. As shown in Fig. 11A,
mono-GalNAc/T-Muc1a', mono-GalNAc/T-SDC106, di-GalNAcs/TT-SDC106, and
tri-GalNAcs/STT-SDC106 were isolated by HPLC and used as antigens. The
amount of each glycopeptide was made equal by monitoring the amount of
FAM. As seen in Fig. 11B, HB-Tn1 positively reacted with all
glycopeptides examined and LSC cell homogenates as a positive control.
It did not react to the peptides without GalNAc residues. This
demonstrated that HB-Tn1 can recognize not only Tn antigen of the
mono-GalNAc structure but also multi-GalNAc Tn antigen including a
di-GalNAcs/TT or tri-GalNAcs/STT structure.

View larger version (40K):
[in this window]
[in a new window]
|
Fig. 11.
Antigen recognition of HB-Tn1 with Western
dot blotting. A, estimations of the relative quantity
of a naked and several FAM-labeled glycopeptides were carried out by
FluorImagerTM 595 at 488 nm. B, Western blot
analysis of glycopeptides with HB-Tn1. N.C., 50% 2-propanol
solution was used as the negative control. LSC, the lysate
of colon carcinoma LSC cells was used as the positive control.
|
|
 |
DISCUSSION |
The initiation of O-glycosylation is catalyzed by a
family of pp-GalNAc-Ts. Studies over the past decade have found a
family of pp-GalNAc-Ts that display differences in both their substrate specificity and their patterns of tissue distribution. In the present
study, we found a novel isoform of the pp-GalNAc-T family, designated
pp-GalNAc-T13. The pp-GalNAc-T13 sequence has very high similarity to
the pp-GalNAc-T1 sequence, both at the nucleic acid and the amino acid
level throughout the coding region. A comparison of gene structure
revealed that both genes compose at least 11 exons, and the length of
each exon is the same between the genes. However, the total length of
the pp-GalNAc-T13 gene, which is located on chromosome 2, is
almost 10 times that of the pp-GalNAc-T1 gene which is on
chromosome 18. The longer intron lengths of pp-GalNAc-T13
may reflect different evolutionary rates between the two genes after
they diverged.
Although pp-GalNAc-T13 and -T1 share highly homologous sequences, they
showed different substrate specificities toward the acceptors examined.
pp-GalNAc-T13 exhibited stronger activity toward all acceptor
substrates examined than pp-GalNAc-T1. When Muc7 peptide was used as a
substrate, a striking difference in substrate specificity was observed
between the two enzymes. Edman degradation revealed that both enzymes
produce P1 as the primary product on Muc7 by transferring GalNAc to the
7th threonine of the peptide. After producing P1, pp-GalNAc-T1 did not
yield any other products even in prolonged reaction. In contrast,
pp-GalNAc-T13 produced P1 more efficiently than did pp-GalNAc-T1 and
catalyzed the conversion of P1 to P2 at a rather high rate, which was
followed by the production of P3, P4, and P5. pp-GalNAc-T1 was
confirmed not to have secondary activity toward Muc7 having a GalNAc
residue by the experiment using the isolated P1 (Fig. 7B) as
a substrate. It was of interest that pp-GalNAc-T1 exerted secondary
activity toward some peptides, such as Muc5Ac as seen in Fig.
6B, and Muc2 (data not shown), but not toward Muc7. The
consensus peptide sequence required for the secondary activity of
pp-GalNAc-T1 will be examined more extensively in the future.
Determining the order in which GalNAc was added by pp-GalNAc-T13 to the
Muc7 peptide revealed two interesting points. First, GalNAc was first
attached to the C-terminal threonine of the TT doublets. The activity
to add GalNAc to the N-terminal threonine of the TT doublets was very
weak. Second, the middle serine of the SSS triplet was the first of the
three serine residues to be glycosylated. This was in contrast to the
order in which GalNAc was added to form the Tn epitope on syndecan-3 by
the same enzyme.
In the present study, we found that pp-GalNAc-T13 is
expressed exclusively in the brain and neurons in human and mouse. To date, 10 human pp-GalNAc-Ts and 5 mouse
pp-GalNAc-Ts have been analyzed as to their tissue
distribution by Northern analysis (3-7, 13, 15-17).
pp-GalNAc-T1 is expressed in all tissues both in human and
rodent (3, 13). The others, human pp-GalNAc-T2, -T4, -T7, -T8, and T12 and rodent
-T7 and -T10 are also known to be expressed
ubiquitously. However, the expression pattern of mouse
pp-GalNAc-T4 is different from humans, and it is
restrictively expressed in the digestive tissues (13). Mouse
pp-GalNAc-T5 is also restrictively expressed in the
digestive tissues (16). Human pp-GalNAc-T3 and
-T6 is highly or restrictively expressed in pancreas and
testis, and in placenta and trachea, respectively (6).
pp-GalNAc-T11 is restrictively expressed in kidney (9). pp-GalNAc-T9 was found to be expressed mostly in brain (8). All of the tissue-specific pp-GalNAc-Ts could be considered to contribute to the O-glycosylation of specific substrates in
certain tissues. However, their functions toward the tissue-specific
substrates have not been identified. In this sense, it is noteworthy
that pp-GalNAc-T13 apparently synthesized the triplet-Tn epitope on syndecan-3, but the other enzymes, pp-GalNAc-T1 and -T9, could not. It
is suggested in the present study that a specific substrate was
modified through GalNAc transfer by a pp-GalNAc-T in neuron. However,
direct and careful elucidation should be required as done by Nehrke
et al. (14).
The Tn antigen was first reported as a tumor-associated carbohydrate
antigen (48-50). The triplet Tn antigen was identified to be expressed
on syndecan-3 spatiotemporally in the developing mouse brain. The
expression patterns of seven pp-GalNAc-T family members,
pp-GalNAc-T1, -T2, -T3,
-T4, -T5, -T7, and
-T10,2 were investigated from gastrulation
through organogenesis in mice (51). Except for -T1 and
-T2, pp-GalNAc-Ts could not be clearly detected
in the central nervous tissue. Although pp-GalNAc-T9 was
identified in human brain tissue (8), it could not synthesize the
triplet Tn antigen as demonstrated in the present study.
HB-Tn1 is a monoclonal antibody, which was raised against asialo-ovine
submaxillary mucin as immunogen. It reacts with most breast, lung,
gastric, and colon carcinomas, which express the Tn antigen (48,
52-54). So far, no one has investigated the epitopic structure of
HB-Tn1 antibody. In the present study, we confirmed that HB-Tn1 reacts
not only to the Tn antigen having a single GalNAc but also to the Tn
antigen having multiple GalNAcs. In light of these results, both the
triplet of GalNAcs on syndecan-3 and a single GalNAc in a mucin box
must be recognized by HB-Tn1. The dramatic decrease in HB-Tn1
reactivity in the cerebellum of the pp-GalNAc-T13 null mouse
indicates that pp-GalNAc-T13 is a major enzyme responsible for the
synthesis of Tn antigen in neuronal cells. The residual faint
reactivity of HB-Tn1 in the knockout mouse cerebellum is probably
directed by the other pp-GalNAc-Ts such as pp-GalNAc-T1 and -T9.
Together with the in vitro data, it is suggested that
expression of Tn antigen having not only single GalNAc but also triplet
GalNAcs may be abolished in knockout mouse.
The pp-GalNAc-T13 null mouse shows a normal outlook, and
their behavior is also normal. However, neurological examination of the
pp-GalNAc-T13 knockout mice would be highly required in the future.