|
Originally published In Press as doi:10.1074/jbc.M209309200 on December 22, 2002
J. Biol. Chem., Vol. 278, Issue 10, 7810-7821, March 7, 2003
Intravacuolar Membrane Lysis in Saccharomyces
cerevisiae
DOES VACUOLAR TARGETING OF Cvt17/Aut5p AFFECT ITS FUNCTION?*
Ulrike D.
Epple ,
Eeva-Liisa
Eskelinen§, and
Michael
Thumm ¶
From the University of Stuttgart, Institute of
Biochemistry, Pfaffenwaldring 55, 70569 Stuttgart, Germany and
§ University of Kiel, Institute of Biochemistry,
Olshausenstrassse 40, 24098 Kiel, Germany
Received for publication, September 11, 2002, and in revised form, December 19, 2002
 |
ABSTRACT |
The integral membrane protein Cvt17/Aut5p is a
putative lipase essential for intravacuolar lysis of autophagic bodies.
It is localized at the endoplasmic reticulum, from which it is targeted via the multivesicular body (MVB) pathway to intravacuolar MVB vesicles. Proteinase protection experiments now demonstrate that the
Aut5 amino terminus is located in the cytosol, and the carboxyl terminus is located inside the ER lumen. In contrast to
procarboxypeptidase S, targeting of Cvt17/Aut5p to MVB vesicles is not
blocked in cells lacking the ubiquitin ligase Tul1p or the
deubiquitinating enzyme Doa4p. Also, truncation of the amino-terminal
cytosolic Cvt17/Aut5p domain does not inhibit its targeting to MVB
vesicles. These findings suggest that similar to Sna3p sorting of
Cvt17/Aut5p to MVB vesicles is independent of ubiquitination. By fusing
the ER retention/retrieval signal HDEL to the carboxyl terminus of Cvt17/Aut5p, we generated a construct that is held back at the ER.
Detailed analysis of this construct suggests an essential role of
vacuolar targeting of Cvt17/Aut5p for its function. Consistently, aut5 cells are found impaired in vacuolar degradation of
autophagocytosed peroxisomes. Importantly, biochemical and
morphological data further suggest involvement of Cvt17/Aut5p in
disintegration of intravacuolar MVB vesicles. This points to a general
function of Cvt17/Aut5p in intravacuolar membrane breakdown.
 |
INTRODUCTION |
Autophagy is a starvation-induced transport pathway delivering
intracellular material for degradation to the lysosome (vacuole) (for
review see Refs. 1 and 2). Three independent approaches in the model
eukaryote Saccharomyces cerevisiae identify numerous autophagic proteins termed Apg (3), Aut (4), and Cvt proteins (5).
In starving cells proaminopeptidase I is specifically targeted to the
vacuole via otherwise unspecific autophagy. Proaminopeptidase I is
proteolytically matured in the vacuole; this opens a convenient way to
monitor autophagy. In non-starved cells proaminopeptidase I transport
is taken over by the Cvt pathway. The Cvt pathway and autophagy are
morphologically very similar and use many common components (5, 6);
however, the Cvt pathway does not transport cytosolic material (7).
Autophagy starts at the preautophagosomal (perivacuolar) structure
(8-10) with the formation of transport vesicles (autophagosomes), which nonspecifically enclose parts of the cytosol. Autophagy differs
from other protein transport pathways by using transport intermediates
(autophagosomes) surrounded by two membrane layers. Consequently, after
fusion with the vacuolar membrane, their cytosolic content is not
released into the vacuole lumen but is instead released as
membrane-enclosed autophagic bodies. Therefore, before vacuolar
breakdown of the autophagocytosed material the membrane of autophagic
bodies has to be lysed. Clearly, this lysis of membranes must be
strictly limited to the membranes of autophagic bodies and must not
affect the integrity of the vacuolar limiting membrane. Specific
intracellular membrane lysis is a fascinating feature of eukaryotic
cells, which is also of medical interest, since it is involved in the
pathogenesis of some microorganisms (11).
In yeast, vacuolar proteinases A (encoded by the PEP4 gene)
and B (PRB1 gene) are required for lysis of autophagic
bodies (12), but their molecular function in disintegrating lipid
membranes remains enigmatic. Further components of the lysis machinery, Aut4p (13) and Cvt17/Aut5p (14, 15), were recently uncovered. Importantly, Cvt17/Aut5p contains a lipase (or esterase) active site
motif, which by site-directed mutagenesis of the active site serine was
shown to be essential for its activity (14, 15). Our previous work
demonstrated that the integral membrane protein Cvt17/Aut5p is targeted
from the ER,1 where a
significant steady state pool is detectable via the multivesicular body
(MVB) pathway to ~50-nm intravacuolar MVB vesicles, which in
wild-type cells are degraded dependent on vacuolar proteinase A (15).
The MVB pathway starts at the prevacuolar compartment (late endosome)
(16, 17). Here, dependent on several Vps class E proteins, some
membrane proteins are sorted to membrane regions of the prevacuolar
compartment, which afterward invaginate and bud off as ~50-nm MVB
vesicles into the interior of the prevacuolar compartment. This process
results in formation of a prevacuolar compartment filled with vesicles,
a structure termed the multivesicular body. After its fusion with the
vacuole the MVB vesicles are released into the vacuolar lumen and
degraded. Two different modes have been described for sorting of
membrane proteins to MVB vesicles. Procarboxypeptidase S sorting
requires ubiquitin conjugation at its lysine residue at position 8 by
the ubiquitin ligase Tul1p and the presence of Doa4p, which releases
ubiquitin from ubiquitin-protein conjugates (16, 18). In contrast,
sorting of Sna3p to MVB vesicles is independent of ubiquitination
(19).
We here show that Cvt17/Aut5p has a membrane topology similar to
procarboxypeptidase S, with its amino terminus located in the cytosol
and the carboxyl terminus in the ER lumen. However, in contrast to
procarboxypeptidase S, the sorting of Cvt17/Aut5p to MVB vesicles takes
place in tul1 and in doa4 cells, and no obvious sorting signal is found in its amino-terminal cytosolic domain.
These findings suggest that Cvt17/Aut5p is sorted to MVB vesicles
independent of ubiquitination, similar to Sna3p.
Furthermore a Aut5-HA-HDEL protein carrying the ER retention/retrieval
signal HDEL at its carboxyl terminus proposes an essential function of
the vacuolar targeting of Aut5p for lysis of autophagic bodies. This
points to a function of Aut5p at or after the prevacuolar compartment.
After this finding, we further tested Aut5p for a function in lysing
other intravacuolar vesicles. Indeed, aut5 cells during
starvation target peroxisomes to their vacuoles but are impaired in
their disintegration. We additionally demonstrate the involvement of
Aut5p in the lysis of intravacuolar MVB vesicles.
 |
EXPERIMENTAL PROCEDURES |
Strains and Growth Media--
Media were prepared according to
Ausubel et al. (20). If not otherwise mentioned cells were
grown in synthetic complete (SC) medium containing 2% glucose. For
induction of the GAL1 promotor cells were grown overnight in
SC medium containing 2% galactose. Starvation was done in 1%
potassium acetate.
Strains are listed in Table I. A PCR
fragment consisting of the kanamycin resistance gene flanked by up- and
downstream sequences of PRB1 was generated using
oligonucleotides Prbkan1
(GGAGTTCTTCCCATACAAACTTAAGAGTCCAATTAGCTTCCAGCTGAAGCTTCGTACGC) and Prbkan2 (ATTAAATAATATTCAATT
TATCAAGAATATCTCTCACTTGCATAGGCCACTAGTGGATCTG) and plasmid pUG6 (21).
Chromosomal replacement of PRB1 in WCG4a with this fragment
yielded YUE59. Strains YUE92 and YUE94 were generated analogously.
Correct gene replacement was confirmed by Southern blotting.
Crossing of YMS30 (22) and YIS4 followed by tetrad dissection yielded
YUE37. YUE40 is an ascospore from a cross of YMS30 and YUE14 (15).
YUE74 and YUE77 were generated by crossing YMS30 with YUE59 and Y05789
with Y12763, respectively, and subsequent tetrad dissection. YUE87 is
an ascospore from a cross of YUE37 and YMTA. YUE90 was generated
using strain Y04883 and the pep4- knockout plasmid
KS-PRA1 -HIS3 (4).
Construction of Plasmids--
The mutations in the cytosolic
domain of AUT5::HA3 (K4R,
K9R, 2-12; pUE26, pUE27, pUE38, respectively) were generated by PCR. For the first PCR the primers MUTup (15) and AUT5K4
(tctttcttgaagggcttCtatgcaacattcaatag), AUT5K9
(ggagaagcaaatctcCttcttgaagggcttttatg), del2-12
(catcctagatgcaaaggagacattcaatagaatatttccc), respectively, were
used with pUE7 as template. The PCR products were used as megaprimers
in a second PCR together with MUTdown (15) and pUE7 as template. The
PCR products were blunt-ligated into pRS426 cut with SmaI.
The constructs were confirmed by sequencing. To introduce HDEL at the
carboxyl terminus of AUT5-HA3 a PCR using the
oligonucleotides MUTup and HDEL (CTATTACAATTCATCATGGCCGGCGTAATCCGGCAC) and pUE7 as template was performed. The PCR product was subcloned into
pRS426 to yield pUE29-1, into pRS316 to yield pUE30, into pRS315 to
yield pUE36, and into pRS425 to yield pUE37. For the construction of
pUE41 a PCR fragment was generated using primers AUT5-R3
(GATGCAAAGGAGAAGCAAATCTCTTTCTTGAAGGGCTTTTATGCAAGCACTGAGCGCGTAATCTG) and MCS-F4
(TGTAATACGACTCACTATAGGGCGAATTGGAGCTCCACCGCGGTGGAATTCGAGCTCGTTTAAAC) and
plasmid pFA6a-His3MX6-PGAL1-3HA (23) as template. This PCR product
was inserted by homologous recombination within YIS4 cells into plasmid
pUE5 and cut with NotI, AatII, and
HpaI. For this the PCR fragment together with the cut vector
were transformed into YIS4, and transformants were selected on SC
medium lacking uracil and then replica-plated on SC medium lacking
histidine (SC-his). The recombinant plasmid was rescued from
transformants able to grow on SC-his, and the correct recombination was
confirmed. The plasmids are listed in Table
II.
Materials--
DNA-modifying enzymes, N-glycosidase
F, and CompleteTM protease inhibitors were from Roche
Molecular Biochemicals, oligonucleotides were from MWG-Biotech
(Ebersberg, Germany), and Zymolyase-100T was from Seikagaku
(Tokyo, Japan). All other chemicals of analytical grade were from Sigma
or Merck. The following antibodies were used: monoclonal antibodies to
HA, clone 16B12 (Berkeley Antibody Co.), 3-phosphoglycerate
kinase, and carboxypeptidase Y (Molecular Probes, Leiden, The
Netherlands) and rabbit polyclonal antibody to green fluorescent
protein (GFP; Molecular Probes) and aminopeptidase I (24). Antiserum
against Kar2p, -1,6-mannose linkages, and Fox3p were generously
supplied from R. Schekman (University of California, Berkeley,
CA) and R. Erdmann (University of Berlin, Berlin, Germany),
respectively. As horseradish peroxidase-conjugated antibodies we used
goat anti-rabbit antiserum from Medac (Hamburg, Germany) and goat
anti-mouse antiserum from Dianova (Hamburg, Germany).
Immunoblotting--
Cells were grown as indicated, and 3 A600 units of cells were harvested, lysed, and
prepared for Western blotting. The samples were resuspended in Laemmli
buffer and incubated at 37 °C for 30 min with vigorous agitation.
Equal amounts of protein were loaded on each lane of standard 7.5 or
10% acrylamide gels, subjected to SDS-PAGE, and electroblotted on
polyvinylidene difluoride membranes (Amersham Biosciences). Proteins on
immunoblots were visualized by ECL detection (Amersham Biosciences)
according to the manufacturer's instructions.
Deglycosylation--
Thirty A600 units of
stationary phase cells were harvested and treated as described (15).
Immunoprecipitation was done with anti-HA antibody for 2 h at
4 °C followed by 1 h of incubation with protein A-Sepharose
(Amersham Biosciences). Deglycosylation was achieved by treating
samples with endoglycosidase H (Roche Molecular Biochemicals) at
37 °C for 1 h.
Protease Protection Experiment--
Fifty
A600 units of cells were spheroplasted in SB
buffer (1.4 M sorbitol, 50 mM
K2HPO4, 10 mM NaN3, 40 mM -mercaptoethanol, pH 7.5) containing 0.3 mg of
zymolyase-100T for 1 h at 30 °C. The spheroplasted cells were
gently lysed in lysis buffer (0.8 M sorbitol, 10 mM MOPS, 1 mM EDTA, pH 7.2) using a tissue
grinder. The lysate was cleared of the remaining cells and debris by
repeated centrifugation for 5 min at 2000 × g. The
cleared lysate was split into aliquots corresponding to 12.5 A600. From the time of lysis, all material was
kept on ice. Membranes were separated by 30 min of centrifugation at
20,000 × g at 4 °C. For protease treatment of the
pellet, trypsin was added to a final concentration of 0.5 mg/ml after
resuspension of the pellet in lysis buffer, and the samples were
incubated for 30 min on ice. If noted, Triton X-100 was present at 1%.
Digestions were stopped by adding trichloroacetic acid to a
concentration of 10%. The trichloroacetic acid pellets were
resuspended in Laemmli buffer and analyzed by SDS-PAGE and immunoblotting.
Indirect Immunofluorescence and Fluorescence
Microscopy--
Immunofluorescence was performed as described (15).
Cells were labeled with mouse anti-HA antibody; as secondary antibody Cy3-conjugated goat-anti-mouse immunoglobulin G (Dianova) was used. For
visualization of GFP fusions cells were grown to log phase, if not
otherwise mentioned, stained with FM4-64 (Molecular Probes) (25), and
viewed with a Zeiss Axioscope 2 Plus microscope equipped with an
Axiocam digital image system.
Measurement of Pexophagy--
The induction of peroxisomes was
done according to Hutchins et al. (26). Briefly,
logarithmically growing cells were shifted to synthetic glycerol medium
(0.67% yeast nitrogen base without amino acids, 50 mM MES, 50 mM MOPS, 3% glycerol, 0.1%
glucose, pH 5.5) for 12 h at 30 °C. After the addition of a
10× yeast extract/peptone solution to a final concentration of
1% yeast extract and 2% peptone, the cells were incubated for
additional 4 h. For peroxisome induction cells were then washed
and transferred to YTO (0.67% yeast nitrogen base without amino acids,
0.1% Tween 40, 0.1% oleic acid) for 19 h. To induce peroxisome
degradation cells were shifted to SD-N (0.17% yeast nitrogen base
without amino acids and ammonium sulfate, 2% glucose). Aliquots were
taken at the indicated times and either prepared for immunoblot
analysis using antibodies against Fox3p or directly analyzed in
fluorescence microscopy with GFP-SKL.
Electron Microscopy--
Electron microscopy after permanganate
fixation and Epon embedding was done as described (27).
 |
RESULTS |
Aut5p is targeted from the ER via the Golgi and the prevacuolar
compartment (late endosome) to the vacuolar lumen at 50-nm MVB vesicles
(15). In wild-type vacuoles the MVB vesicles carrying Aut5p are broken
down, resulting in a half-life of Aut5p of 50-70 min (14, 15). Our
previous indirect immunofluorescence microscopy indicated a significant
steady state level of Aut5p at the ER (15). We therefore speculated
that Aut5p might act at the ER probably by modifying specific lipids,
which after transport to autophagosomes render them competent for
intravacuolar lysis. If this is true, vacuolar transport would only
reflect the turnover of the protein and would be dispensable for its
function. Alternatively, Aut5p might function at the prevacuolar
compartment or inside the vacuole; in this scenario its vacuolar
targeting would be essential. To distinguish between these
possibilities, we wanted here to block the vacuolar targeting of Aut5p.
One idea was to look for vacuolar-targeting sequences within Aut5p.
Site-directed mutagenesis of such targeting sequences should then
prevent its vacuolar entry. We started our search for
vacuolar-targeting sequences with an evaluation of the Aut5p membrane topology.
At the ER the Amino Terminus of Aut5p Is Exposed to the Cytosol and
Its Carboxyl Terminus Points Inside the Lumen--
The molecular
function of vacuolar proteinase A and B in lysing the lipidous
membranes of autophagic bodies is enigmatic. It is tempting to
speculate that they might proteolytically activate Aut5p. Our previous
analysis of biologically active carboxyl- terminally HA-tagged Aut5p
(Aut5-HAp) did not suggest an amino-terminal processing of Aut5p (15).
We generated here an amino-terminally HA-tagged Aut5p (HA-Aut5p) and
expressed this under control of the inducible GAL1 promotor
to check for carboxyl- terminal processing. Complementation of the
proaminopeptidase I maturation defect of aut5 cells
indicated biological activity of HA-Aut5p (Fig.
1A, lane 3).
Interestingly, in immunoblots HA antibodies detected bands with lower
molecular mass than Aut5-HAp (Fig. 1A, lanes 3,
4, and 6), which were absent in glucose-grown
cells (Fig. 1A, lane 7). Identical bands were
detected with a polyclonal antibody against Aut5p (not shown),
confirming their identity with Aut5p species. After immunoprecipitation
with HA antibodies and subsequent deglycosylation with endoglycosidase
H in aut5 cells and in cells either deficient in vacuolar
proteinase A (pep4 ) or B (prb1 ), HA-Aut5p
did not show unambiguously different mobilities in Western blots (Fig.
1B, lanes 2-5). In pep4 cells the
HA-Aut5p band appeared broader, however, suggesting the presence of
higher molecular mass species (Fig. 1B, lane 4).
If this might indicate proteolytic processing at the carboxyl terminus
is unclear at the moment and must be the subject of further detailed
studies.

View larger version (38K):
[in this window]
[in a new window]
|
Fig. 1.
The amino terminus of Aut5p is located in the
cytosol, and its carboxyl terminus is located in the ER lumen.
A, Aut5p carrying an HA epitope at its amino terminus
(HA-Aut5p) is biologically active and heterogeneous in molecular mass.
aut5 or pep4 (lacking vacuolar proteinase
A) cells expressing Aut5-HAp from plasmid pUE7 (Aut5-HAp, expressed
with its native promotor; lanes 1, 2,
5) or HA-Aut5p from pUE41 (HA-Aut5p, expressed with a
GAL1-promotor; lanes 3, 4,
6, 7) were grown in glucose (Glc) or
galactose (Gal) medium as indicated and analyzed in
immunoblots with antibodies against HA and proaminopeptidase I. pAPI, proaminopeptidase I; mAPI, mature
aminopeptidase I. As loading control phosphoglycerate kinase
(PGK) is shown. B, the heterogeneity of HA-Aut5p
is mostly due to glycosylation. Lysates of galactose grown
aut5 , pep4 (lacking vacuolar proteinase A),
and prb1 (lacking vacuolar proteinase B) cells expressing
HA-Aut5p (pUE41) were immunoprecipitated with antibodies against HA and
after deglycosylation with endoglycosidase H, probed in immunoblots
with antibodies against HA. As controls glucose-grown
aut5 cells expressing Aut5-HA (pUE7) or carrying the
empty pYES2 vector were included. Further details are given
under "Results." C, HA-Aut5p is pelletable.
aut5 cells transformed with pUE7 (Aut5-HA) or pUE41
(GAL1::HA-AUT5) were grown in glucose
or galactose medium, respectively, spheroplasted, and lysed using a
tissue grinder. After removing cell debris and nonlysed spheroplasts,
the total lysate (T) was centrifuged at 13,000 rpm for 30 min to generate a pellet (P13) and supernatant
(S). Immunoblotting with HA antibodies identified the Aut5p
species. As the control the blot was reprobed with antibodies against
soluble, cytosolic phosphoglycerate kinase (PGK).
D and E, indirect immunofluorescence microscopy
of HA-Aut5p expressed in aut5 (D) or
pep4 (lacking vacuolar proteinase A) cells
(E). Cells were grown in galactose medium to stationary
growth phase and then fixed with formaldehyde followed by
spheroplasting with zymolyase. The spheroplasted cells were then
incubated with primary antibody against HA, and afterward, with
secondary Cy3-coupled antibody. Nuclear DNA was stained with
4,6-diamidino-2-phenylindole (DAPI). From left to
right, immunofluorescence (HA-Aut5p), Nomarski optics
(NOM), showing the vacuole, and nuclear staining with
4,6-diamidino-2-phenylindole. Note the typical ER staining pattern of
HA-Aut5p in D, i.e. a ring-like localization
around the nucleus and at regions near the plasma membrane, and of the
vacuole lumen in cells lacking vacuolar proteinase A
(pep4 ) (E). Bar, 10 µm.
F, proteinase protection experiment. Cells were lysed as
described under "Experimental Procedures." The cleared lysate
(Total) was divided into aliquots and centrifuged at
20,000 × g for 30 min. The supernatant
(Sup) was removed, and the pellets were resuspended in
buffer and either treated with 0.5 mg/ml Trypsin (Tryp) or
0.5 mg/ml Trypsin and 1% Triton X-100 (Tryp+Tx). After 30 min on ice the samples were trichloroacetic acid-precipitated and
prepared for Western blot analysis. Aut5p was detected using antibodies
to HA. As the control, the soluble ER lumenal protein Kar2p is
shown.
|
|
HA-Aut5p was pelletable in lysed spheroplasts (Fig. 1C),
indicating it was membrane-associated. We further confirmed in indirect immunofluorescence the localization of HA-Aut5p to the ER in
aut5 cells (Fig. 1D). As expected the typical
ring-like staining around the nucleus and staining near the plasma
membrane was seen. Accordingly, in cells lacking vacuolar proteinase A
(pep4 ) HA-Aut5p was detectable inside the vacuole (Fig.
1E, left), whose position is easily visible in
Nomarski optics (Fig. 1E, middle). To determine
the topology of Aut5p we made proteinase protection experiments using
the amino- and carboxyl- terminally HA-tagged Aut5p. In
aut5 cells, where Aut5p is located at the ER, HA-Aut5p
was proteinase-accessible even in the absence of the detergent Triton
X-100 (Fig. 1F, lanes 8-10), whereas Aut5-HAp
was proteinase-protected (Fig. 1F, lanes 3-5).
This suggests that the Aut5 amino terminus is located in the cytosol,
and the carboxyl terminus is located in the ER lumen.
Sorting of Aut5p via the MVB Pathway Does Not Depend on
Ubiquitination--
Sorting of procarboxypeptidase S (proCPS) via the
MVB pathway requires the ubiquitin ligase Tul1p. Tul1p ubiquitinates
the lysine residue 8 of proCPS, which is located in a 19-amino acid amino-terminal domain in the cytosol just preceding the proCPS transmembrane domain (16, 18). A lack of ubiquitination in tul1 cells leads to missorting of proCPS to the
vacuolar-limiting membrane (18) (Fig.
2B). Our proteinase protection
experiments now demonstrate a similar topology for Aut5p, which exposes
a 14-amino acid amino-terminal stretch to the cytosol followed by a
transmembrane domain (Fig.
3A). As in the case of proCPS
the amino-terminal cytosolic domain of Aut5p contains two lysine
residues at positions 4 and 9 (Fig. 3A). We therefore
checked in indirect immunofluorescence whether sorting of Aut5-HAp to
the vacuolar lumen via the MVB pathway depends on Tul1p. Because
Aut5-HAp is rapidly degraded in the vacuole, we used tul1
pep4 cells lacking vacuolar proteinase A for this
experiment. Interestingly, in TUL1-deficient cells a
significant vacuolar pool of Aut5-HAp was detectable (Fig. 2A). As a control we confirmed mislocalization of GFP-CPS to
the vacuolar-limiting membrane in tul1 pep4
cells (Fig. 2B). Sna3p is another cargo of the MVB pathway,
but its sorting does not require ubiquitin conjugation (18, 19). As a
further control, we checked the localization of Sna3-GFP in
tul1 pep4 cells in direct fluorescence
microscopy. As expected, Sna3-GFP was correctly localized in
the vacuole lumen (Fig. 2C). Taken together, these results
suggest that the targeting of Aut5-HAp to the vacuole lumen does not
require Tul1p.

View larger version (75K):
[in this window]
[in a new window]
|
Fig. 2.
Vacuolar sorting of Aut5-HAp proceeds in
cells lacking the ubiquitin ligase Tul1p or the deubiquitinating enzyme
Doa4p. Indirect immunofluorescence microscopy of strains TVY614
(pep prb1 prc1 , lacking
vacuolar proteinases A, B, and Y) (D), YUE90
(tul1 pep4 ) (A), and DKY51
(doa4 pep prb1
prc1 ) (E) expressing Aut5-HA from a
centromeric plasmid (pUE13). Cells were processed as described in Fig.
1D. From left to right,
immunofluorescence (Aut5-HAp), Nomarski optics (NOM)
indicating the vacuole, and nuclear staining with
4,6-diamidino-2-phenylindole (DAPI) is shown. The GFP
fluorescence of cells expressing GFP-CPS or Sna3-GFP was
checked to make sure these proteins are localized to the vacuole lumen
(F and C) or the prevacuolar compartment and the
vacuolar limiting membrane (G and B). When
indicated vacuolar membranes were additionally stained with the
fluorescent dye FM4-64. Bar, 10 µm.
|
|

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 3.
The amino-terminal cytosolic domain of Aut5p
does not obviously affect its sorting and function. A,
schematic representation of the Aut5p and procarboxypeptidase S
amino-terminal cytosolic and transmembrane (TMD) domain.
B-D, indirect immunofluorescence microscopy of the
indicated mutated Aut5-HA species expressed in aut5
pep4 cells of the stationary growth phase. E
and F, immunoblot analysis of proaminopeptidase I maturation
(upper panel) in aut5 cells expressing mutated
Aut5-HA species from plasmids pUE26 (Aut5-K4R-HA), pUE27 (Aut5-K9R-HA),
pUE38 (Aut5-del2-12-HA), pUE7 (Aut5-HA), and pUE9 (Aut5-S332A-HA).
Cells were grown to stationary (stat.) phase (E)
or starved for 4 h in 1% potassium acetate (Ac)
(F). The blots were reprobed with antibodies against HA
(lower panel). G, light microscopic analysis of
intravacuolar autophagic body lysis. The strains listed in E
as well as aut5 with an empty pRS426 vector were starved
4 h in potassium acetate and viewed using Nomarski optics.
wt, wild type. DAPI,
4,6-diamidino-2-phenylindole; pAPI,
proaminopeptidase I; mAPI, mature aminopeptidase
I.
|
|
Doa4p is a protease that specifically releases ubiquitin from
ubiquitin-protein conjugates and, thus, replenishes the free ubiquitin
pool of the cells. A lack of Doa4p therefore affects all
ubiquitin-dependent processes (28). Consistently,
missorting of GFP-CPS to the vacuolar-limiting membrane occurred in
doa4 cells (Fig. 2G) (16, 19). To prevent
vacuolar degradation of Aut5-HAp we used cells deficient in the
vacuolar proteinases A, B, and Y (pep4 prb1
prc1 ). Indirect immunofluorescence microscopy indicated
that Aut5-HAp is targeted to the vacuole lumen irrespective of presence
of Doa4p (Fig. 2, D and E).
In proCPS the first lysine (position 8) of the cytosolic amino-terminal
stretch is the target site for ubiquitin conjugation (16) and, thus,
essential for proCPS targeting to MVB vesicles. Using site-directed
mutagenesis we replaced lysines 4 and 9 of Aut5-HAp with arginine. To
further evaluate, if there is any sorting signal within the 14 amino
acids of the amino-terminal cytosolic domain, we generated a truncated
Aut5-HA(del2-12)p lacking amino acids 2-12. We expressed these
constructs in aut5 cells. Indirect immunofluorescence
microscopy confirmed the normal ER localization of all these Aut5-HAp
species (not shown). In aut5 pep4 cells significant amounts of these mutant proteins were detectable in the
vacuole in addition to the ER localization (Fig. 3, B-D). These findings further argue against a
ubiquitination-dependent sorting of Aut5p as well as
against the presence of sorting determinants in the amino-terminal
cytosolic domain. Interestingly, these constructs complemented the
proaminopeptidase I maturation defect in aut5 cells both
under non-starvation conditions, where the Cvt pathway is active (Fig.
3E), and after starvation induction of autophagy (Fig.
3F). The constructs also complemented the defect in lysis of
autophagic bodies in aut5 cells (Fig. 3G).
Some aut5 cells expressing Aut5(K9R)-HAp exhibited few
autophagic bodies in their vacuoles (Fig. 3G), indicating
slightly retarded degradation. This might indicate a slightly reduced
activity of the mutated protein, since accumulation of autophagic
bodies is more sensitive in monitoring autophagy than proaminopeptidase
I maturation. Taken together our findings suggest that the sorting of
Aut5p is independent of ubiquitination and that the Aut5p
amino-terminal cytosolic domain contains no sorting information nor is
it essential for activity.
An Aut5-HA-HDEL Fusion Protein Suggests That Aut5p Does Not
Function at the ER--
To determine, if Aut5p functions at the ER or
if its vacuolar targeting via the MVB pathway is essential, we wanted
to block vacuolar targeting of Aut5-HA and check whether this
interferes with lysis of autophagic bodies. We therefore next analyzed
the biological activity and localization of Aut5-HAp in
vps23 and vps28 cells. In these Vps class E
mutants protein sorting via the MVB pathway is disturbed, leading to
accumulation of its cargoes at the prevacuolar compartment and their
mislocalization to the vacuolar membrane (16). To allow detection of a
vacuolar Aut5-HAp pool in these Vps class E mutants, we used cells
defective in the vacuolar proteinases A, B, and Y (pep4
prb1 prc1 ). Indirect immunofluorescence
confirmed localization of Aut5-HAp to the prevacuolar compartment and
the vacuolar-limiting membrane in vps23 and
vps28 cells. No significant amounts of intravacuolar
Aut5-HAp were detected (Fig.
4C and data not shown). In
immunoblots no significant accumulation of proaminopeptidase I was
detectable in these Vps class E mutants, neither when the Cvt pathway
is active (non-starved cells) nor after starvation induction of
autophagy (Fig. 4D). As mentioned, light microscopic
evaluation of autophagic body lysis is more sensitive than
proaminopeptidase I maturation. Because in our wild-type strain
vacuoles of starved cells are more readily visible in Nomarski optics,
we deleted VPS23 and VPS28 in WCG4a. Consistent with proaminopeptidase I maturation vps23 cells showed no
vacuolar accumulation of autophagic bodies after starvation (Fig.
4E). Also, most of the vps28 cells accumulated
no autophagic bodies. Some cells accumulated few autophagic bodies in
each cell less than observed in aut5 cells (Fig.
4E). Also in vps28 pep4 cells indirect immunofluorescence microscopy confirmed that the bulk transport of Aut5-HAp to the vacuolar lumen is inhibited (not shown).
However, this does not exclude that the Aut5-HAp mislocalized to the
vacuolar-limiting membrane or the small amounts that might still reach
the vacuole lumen are sufficient for lysis of almost all autophagic
bodies.

View larger version (58K):
[in this window]
[in a new window]
|
Fig. 4.
Analysis of Aut5-HAp localization and
autophagic body lysis in Vps class E mutants. A-C,
indirect immunofluorescence microscopy of Aut5-HAp (pUE13) expressed in
wild-type (SEY6210) (A), TVY614 (B), and DKY61
(C) cells. The cells were processed as described in Fig.
1E. Note the localization of Aut5-HAp to the ER in wild-type
(WT) cells (A), to the vacuole lumen and the ER
in proteinase deficient cells (B), and to the ER, the
prevacuolar compartment, and the vacuolar membrane in
vps23 pep4 prb1
prc1 cells (C). DAPI,
4,6-diamidino-2-phenylindole. D, proaminopeptidase I
maturation was detected in immunoblots of crude extracts from cells of
the stationary phase (upper panels) or starved 4 h in
1% potassium acetate (Ac, lower panels).
pAPI, proaminopeptidase I; mAPI, mature
aminopeptidase I. The blots were reprobed with antibodies against
carboxypeptidase Y (CPY). E, to analyze
intravacuolar accumulation of autophagic bodies, YUE92
(vps23 ) and YUE94 (vps28 ) were starved for
4 h in 1% potassium acetate medium and visualized with Nomarski
optics. Wild-type (WCG) cells, accumulating no autophagic
bodies, and aut5 cells, defective in lysis of autophagic
bodies, are included. Note the absence of autophagic bodies in
vps23 cells and the presence of a few bodies in some
vps28 cells. Bar, 10 µm.
|
|
For a more detailed analysis, we therefore generated an Aut5-HAp
species carrying a HDEL motif at its carboxyl terminus (see "Experimental Procedures"). The HDEL motif in yeast functions as an
ER retention/retrieval signal, i.e. HDEL-proteins leaking to
the early Golgi are continuously retrieved back to the ER (29). Indirect immunofluorescence microscopy indeed confirmed ER localization of Aut5-HA-HDEL in aut5 pep4 cells and, if
any, detected only minor amounts in the vacuolar lumen (Fig.
5B). In yeast after linkage of
core N-glycan within the ER, further glycosylation in the
Golgi includes the addition of -1,6-mannose residues (30). Accordingly, Aut5-HA-HDEL exhibits compared with Aut5-HAp a
significantly enhanced -1,6-mannose glycosylation pattern due to its
repeated retrieval from the Golgi (Fig. 5C). As a control
the samples were further treated with N-glycosidase F and
endoglycosidase H (Fig. 5C); both enzymes are widely used to
release N-glycans from proteins. Taken together the findings
confirm ER retention/retrieval of Aut5-HA-HDEL. Interestingly,
Aut5-HA-HDEL expressed from a centromeric plasmid with its native
promotor only partly complemented the proaminopeptidase I
maturation defect in aut5 cells (Fig. 5D, lane 3). Overexpression of Aut5-HA-HDEL from a two micron
plasmid however lead to a more complete proaminopeptidase I maturation (Fig. 5D, lane 4). This dosage dependent
complementation is in agreement with the idea, that a small amount of
Aut5-HA-HDEL, which might still reach the vacuole is sufficient for
lysis of autophagic bodies. The MVB-sorting defect in
vps28 cells should further reduce the amount of
Aut5-HA-HDEL reaching the vacuolar lumen. Indeed, vps28
aut5 cells expressing Aut5-HA-HDEL from a centromeric
plasmid contained almost exclusively proaminopeptidase I (Fig.
5D, lane 6), and overexpression from a 2-µm
plasmid led to only partial proaminopeptidase I maturation (Fig.
5D, lane 7). The enhancement of the
proaminopeptidase I maturation defect in vps28 cells
further supports the idea that small amounts of Aut5-HA-HDEL are
sufficient to lyse autophagic bodies. Taken together our results do not
suggest a function of Aut5p at the ER, but at later stages of its
sorting pathway, namely at the prevacuolar compartment or the
vacuole.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 5.
Aut5-HA-HDEL expressing cells suggest that
Aut5p does not function at the ER. To retain/retrieve Aut5p at the
ER, a HDEL sequence was fused to the carboxyl terminus of Aut5-HA.
A and B, indirect immunofluorescence microscopy
of starved (4 h in 1% potassium acetate) aut5
pep4 cells expressing Aut5-HA (A) or
Aut5-HA-HDEL (B) from a centromeric plasmid. Cells were
treated as in Fig. 1E and analyzed with antibodies against
HA. Note the localization of Aut5-HA-HDEL to the ER (ring-like staining
around the nucleus and near the plasma membrane), whereas no
significant labeling is seen in the vacuole. Bar, 10 µm.
DAPI, 4,6-diamidino-2-phenylindole; NOM, Nomarski
optics. C, -1,6-mannose linkages were monitored in
immunoblots with specific antibodies. Crude extracts of stationary
cells expressing Aut5-HA (pUE35), Aut5-HA-HDEL (pUE37), or an empty
vector (pRS425) were immunoblotted and probed with antibodies against
-1,6-mannose linkages (upper panel) and HA (lower
panel). Samples were immunoprecipitated with HA antibodies and
either deglycosylated with endoglycosidase H or
N-glycosidase F or mock-treated. An asterisk
marks cross-reacting material. Aut5p* corresponds to
deglycosylated Aut5p species. D, Aut5-HA-HDEL shows a
dosage-dependent complementation of the proaminopeptidase I
maturation defect of aut5 cells. vps28
aut5 cells and aut5 cells expressing
Aut5-HA or Aut5-HA-HDEL from a centromeric (CEN) or 2-µm
plasmid (2µ) were grown to stationary phase and analyzed
in immunoblots with antibodies against proaminopeptidase I (upper
panel), against HA (middle), and cytosolic
phosphoglycerate kinase (PGK) (lower panel). An
asterisk marks cross-reacting material. After quantification
using ImageQuant, the amount of mature aminopeptidase I was expressed
as the percentage of the total amount of mature and proaminopeptidase I
present in the sample. pAPI, proaminopeptidase I;
mAPI, mature aminopeptidase I.
|
|
Aut5p Is Essential for Pexophagy--
Because our findings suggest
a function of Aut5p at the prevacuolar compartment or the vacuole, we
next analyzed whether breakdown of other vesicular intermediates in the
vacuole also depends on Aut5p. Growth of S. cerevisiae cells
in medium containing oleic acid as the sole carbon source induces
proliferation of peroxisomes. When these cells are shifted to nitrogen
starvation, peroxisomes are specifically targeted to and degraded in
the vacuole in a process called pexophagy (26). For morphological
analysis of pexophagy we used a plasmid encoded GFP-SKL fusion protein
(31). The carboxyl- terminal peroxisomal targeting signal 1 (SKL)
targets the GFP to peroxisomes, which thus become visible in
fluorescence microscopy as cytosolic green dots. In wild-type cells
vacuolar degradation of GFP-SKL-containing peroxisomes liberates a
quite proteolysis-resistant GFP into the vacuole lumen, yielding a
homogeneously fluorescent vacuole (Fig.
6B). In contrast, a defective
vacuolar breakdown of peroxisomes in pep4 cells lacking
vacuolar proteinase A results in vacuolar accumulation of green dots
(Fig. 6B). After induction of pexophagy,
aut5 cells expressing GFP-SKL clearly accumulated
distinct green dots in their vacuoles (Fig. 6B). This indicates vacuolar uptake of peroxisomes in aut5 cells
but a defective vacuolar breakdown. This is in agreement with the
defect of aut5 cells in lysing autophagic bodies. We
further confirmed the peroxisomal degradation defect in
aut5 cells in immunoblots using the peroxisomal matrix
protein Fox3p (3-ketoacyl-CoA thiolase) (26) as a marker. In wild-type
cells Fox3p levels were reduced during starvation, but this reduction
was not observed in aut5 or pep4 cells
(Fig. 6C).

View larger version (48K):
[in this window]
[in a new window]
|
Fig. 6.
During pexophagy
aut5 cells take up peroxisomes in their
vacuoles but fail to degrade them. Cells expressing the
peroxisomal marker protein GFP-SKL were grown in oleic acid medium (see
"Experimental Procedures") to induce peroxisomes, and the vacuolar
membrane was stained with the fluorescent dye FM4-64. Then the cells
were shifted to nitrogen-free starvation medium (SD-N), and after
0 h (A) and 4.5 h (B) of starvation
cells were checked by fluorescence microscopy. From left to
right GFP fluorescence (GFP-SKL), vacuolar
staining with FM4-64 (FM4-64), and Nomarski optics
(NOM) is shown. Wild-type (WCG) and
pep4 cells, lacking vacuolar proteinase A, are included.
During starvation (panel B) intact peroxisomes, visible as
distinct dots, accumulate in vacuoles of aut5 and
pep4 cells, whereas in wild-type (WCG) cells
the peroxisomes are degraded, leading to release of soluble GFP into
the vacuole lumen. Bar, 10 µm. C, cells were
treated as described in A, and after a shift to
nitrogen-free medium, aliquots were taken at the indicated times
and processed for immunoblotting using antibodies against the
peroxisomal marker protein Fox3p. The amounts of Fox3p were quantified
using ImageQuant and expressed as the percentage of the amount present
at time point 0.
|
|
Aut5p Affects Intravacuolar Lysis of MVB Vesicles--
Vacuolar
lysis of autophagic bodies requires Aut5p (15), (14), Aut4p (13), and
vacuolar proteinase B (12). In addition to autophagic bodies,
MVB vesicles are also disintegrated in the vacuole. The components
needed for lysing MVB vesicles have not been studied in detail so far.
We were especially interested in determining if Aut5p, located on the
MVB vesicles, is also involved in their disintegration. To
biochemically monitor the integrity of intravacuolar MVB vesicles we
used two marker proteins (i) GFP-CPS, a MVB cargo whose sorting
requires ubiquitination (16) and (ii) Sna3-GFP, which is
sorted independent of ubiquitin conjugation (19). As illustrated in
Fig. 7, both fusion proteins expose their
GFP moiety into the interior of intravacuolar MVB vesicles. Undigested
fusion proteins therefore indicate intact MVB vesicles. GFP-CPS can be
proteolytically cleaved closely after its transmembrane domain even if
the MVB vesicles are intact (Fig. 7, A and B). In
this case an intermediate sized GFP species (GFP*) is formed. When the
MVB vesicles are lysed from both fusion proteins, proteolysis resistant-free GFP is released. We analyzed logarithmically growing and
nitrogen-starved cells. Our analysis yielded similar results using
GFP-CPS or Sna3-GFP as markers. In growing wild-type and aut4 cells large amounts of free GFP indicated lysis of
MVB vesicles (Fig. 7, A and B, lanes 1 and 3). As expected, pep4 cells showed no
disintegration of MVB vesicles (Fig. 7, A and B,
lane 4). Interestingly, growing aut5 cells
exhibited a significantly reduced amount of free GFP (Fig. 7,
A and B, lane 2), indicating a reduced
lysis of MVB vesicles. Starved wild-type, aut4 , and
pep4 cells showed results similar to growing cells (Fig.
7). Starved aut5 cells contained a significant level of
undigested Sna3-GFP (Fig. 7A, lane 6)
and GFP* (Fig. 7B, lane 6). These findings
suggest a function of Aut5p in MVB vesicle lysis both in growing and
starved cells. To exclude the occurrence of proteolysis during cell
lysis, we confirmed the presence of proaminopeptidase I in the
aut5 extracts analyzed in Fig. 7, A and
B by immunoblotting with anti-aminopeptidase I antibodies
(not shown). To further exclude that the defects in MVB vesicle lysis
in aut5 cells are caused by missorting of the marker
proteins, we checked their localization by fluorescence microscopy.
Both GFP-CPS and Sna3-GFP localized to the vacuole lumen in
aut5 cells (Fig. 7, C and D).

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 7.
Aut5p is involved in intravacuolar lysis of
MVB vesicles. Schematic illustration of the membrane topology of
the MVB marker proteins GFP-CPS and Sna3-GFP.
Logarithmically growing or 4-h starved (1% potassium acetate
(Ac)) cells expressing Sna3-GFP (A) or
GFP-CPS (B) were analyzed in immunoblots with antibodies
against GFP. WT, wild-type cells. Please note that GFP-CPS
can also be cleaved at its normal maturation site within the vacuolar
lumen (marked with an asterisk in the illustration),
yielding a GFP* species (B). C and D,
to exclude sorting defects of the MVB marker proteins, the vacuolar
localization of GFP-CPS (C) and Sna3-GFP
(D) was confirmed by fluorescence microscopy in
aut5 cells. Wild-type cells (WT, GFP-CPS, and
Sna3-GFP localize to the vacuole lumen) and
tul1 cells (GFP-CPS localizes to the vacuole membrane,
Sna3-GFP localizes to the vacuole lumen) are included as
controls. Bar, 10 µm. NOM, Nomarski
optics.
|
|
To further confirm that the GFP-CPS and Sna3-GFP
degradation defects are due to defects in MVB vesicle lysis, we
performed electron microscopy. Because in starved cells the large
number of accumulating autophagic bodies interferes with detection of the 50-nm MVB vesicles, we generated mutant strains also lacking the
autophagy protein Apg1/Aut3p. A lack of this serine/threonine protein
kinase selectively abolishes formation of Cvt vesicles and autophagic
bodies (22, 32). aut3 aut5
pep4 mutant cells accumulated 50-nm vesicles in their
vacuoles (Fig. 8C). This shows that Aut5p is not essential for formation of 50-nm vesicles. The electron microscopic analysis corroborated our biochemical study by
showing 50-nm vesicles in aut3 aut5 cells
(Fig. 8A). Compared with aut3
pep4 cells (Fig. 8B) aut3
aut5 cells (Fig. 8A) showed fewer but clearly
visible intravacuolar 50-nm vesicles.

View larger version (143K):
[in this window]
[in a new window]
|
Fig. 8.
Electron microscopy demonstrates accumulation
of 50-nm vesicles in the vacuoles of aut5
cells. Because accumulation of Cvt or autophagic bodies
would interfere with the detection of MVB vesicles, we here use
aut3 cells, which are deficient in biogenesis of Cvt
vesicles and autophagosomes. aut3 aut5
(A), aut3 pep4 (B),
and aut3 pep4 aut5
(C) cells were starved for 4 h in 1% potassium
acetate, fixed with permanganate, and processed for epon embedding and
electron microscopy. On the right magnified cutouts are
shown. Arrowheads point to vesicles within the vacuole.
Bars, 500 nm.
|
|
 |
DISCUSSION |
To learn more about the site of action of Aut5p, we wanted to
block its vacuolar targeting. We started with proteinase protection experiments (Fig. 1) using amino- and carboxyl-terminally HA-tagged Aut5p to evaluate the Aut5p topology. The experiments demonstrated a
cytosolic localization of the Aut5p amino terminus, with the carboxyl
terminus trapped in the ER lumen. This suggests a localization of the
lipase active site inside the ER and is consistent with the previously
observed glycosylation of this part of Aut5p (14, 15). Interestingly,
our findings now demonstrate the existence of an amino-terminal
14-amino acid-long cytosolic domain of Aut5p just before the
transmembrane domain. This is reminiscent to the topology of proCPS.
proCPS is targeted to MVB vesicles after Tul1p-dependent ubiquitination of lysine 8. Lysine 8 is located in a short cytosolic amino-terminal stretch preceding the transmembrane domain of proCPS (16, 18). Because of the topological similarities, we analyzed the two
lysines found in the cytosolic amino-terminal Aut5p domain for a
vacuolar-targeting function. However, in contrast to proCPS replacement
of lysines 4 and 9 of Aut5-HAp with arginine did not prevent its
vacuolar localization in indirect immunofluorescence microscopy (Fig.
3, B and C). In addition, the complete deletion of the Aut5 amino-terminal cytosolic domain (amino acids 2-12) did not
abolish its vacuolar localization nor its activity (Fig. 3,
D-G). Together with vacuolar targeting in
tul1 and in doa4 cells, this argues against
a ubiquitin-dependent targeting of Aut5p to MVB vesicles.
Aut5p in this respect resembles Sna3-GFP (19). This finding
is highly interesting; however, the lack of a specific sorting signal
in the amino-terminal cytosolic domain of Aut5p prevented us from using
the mutated Aut5p species to block its vacuolar targeting.
We therefore next analyzed Vps class E mutants, where Aut5-HAp is
retained at the prevacuolar compartment and partly mislocalized to the
vacuolar membrane (Fig. 4C). Under starvation and
non-starvation conditions the tested Vps class E mutants showed in
immunoblots mature aminopeptidase I, suggesting the occurrence of the
Cvt and autophagic pathway. Light microscopic examination of autophagic body lysis is more sensitive to detect autophagy defects than the
maturation of proaminopeptidase I. vps23 cells showed
wild-type like lysis of autophagic bodies. Some vps28
cells, however, accumulated a few autophagic bodies in their vacuoles,
but fewer than did aut5 cells (Fig. 4E). We
followed this first hint for a non-ER function by generating an
Aut5-HA-HDEL protein. We confirmed its retention/retrieval at the ER in
indirect immunofluorescence microscopy (Fig. 5B) and by
analyzing its glycosylation pattern (Fig. 5C). Most
interestingly, in aut5 cells expression of Aut5-HA-HDEL from a centromeric plasmid only partially complemented the
proaminopeptidase I maturation defect (Fig. 5D, lane
3), but overexpression from a 2-µm plasmid complemented almost
completely (Fig. 5D, lane 4). Although indirect
immunofluorescence microscopy did not detect a vacuolar pool of
Aut5-HA-HDEL, we hypothesized that small amounts of Aut5-HA-HDEL, which
might still leave the ER, might be responsible for lysis of autophagic
bodies. If this is true, combining the MVB-sorting defect of Vps class
E mutants with the ER retention/retrieval of Aut5-HA-HDEL should
further enhance the proaminopeptidase I maturation defect. Indeed,
centromeric expression of Aut5-HA-HDEL in aut5
vps28 cells resulted in almost no proaminopeptidase I
maturation (Fig. 5, lane 6), and overexpression of
Aut5-HA-HDEL in these cells only led to partial maturation. This
suggests that a small amount of Aut5p is sufficient for vesicle lysis,
consistent with the idea of an enzymatic function. Our findings further
suggest that Vps28-dependent sorting of Aut5p to MVB
vesicles is essential for its biological function.
Within the vacuolar lumen not only autophagic bodies but also numerous
MVB vesicles are lysed. We wanted to know whether Aut5p is also
involved in the lysis of these MVB vesicles. We used GFP-CPS (16) and
Sna3-GFP (18) with similar results as marker proteins to
monitor the integrity of MVB vesicles in immunoblots (Fig. 7,
A and B). Electron microscopy further confirmed
that the degradation defects observed with the GFP fusion proteins
correspond to defects in lysing the MVB vesicles (Fig. 8). Most
interestingly, in growing and starved cells lacking Aut5p a
significantly reduced breakdown of MVB vesicles was detected. This
points to an additional function of Aut5p in lysing these membranes. As
a control we checked in aut3 aut5
pep4 cells that Aut5p is not obviously needed for biogenesis of the MVB vesicles (Fig. 8C). In
agreement with the observed overlapping function of several proteins
between pexophagy and autophagy (26, 33), we could further demonstrate
(Fig. 6) that aut5 cells are able to take up peroxisomes
in their vacuoles but are defective in their breakdown. Taken together
our findings suggest a function of Aut5p at the prevacuolar compartment
(late endosome) or at the vacuole and point to a more general role of Aut5p in lysis of intravacuolar vesicles.
Several ways that Aut5p could mediate vesicle breakdown seem
conceivable. Based on the essential role of the active site motif characteristic for lipases and esterases, Aut5p might act as an unspecific hydrolase directly attacking membranes inside the vacuole. In this case it would be crucial for the cells to prevent untimely activation of Aut5p during its transit to the vacuole. Selective activation within the vacuolar lumen might be achieved by proteolytic maturation. So far, our analysis of amino-terminally (Fig. 1) and
carboxyl-terminally (15) HA-tagged Aut5p did not clearly detect a
matured Aut5p species; however, the observed broader band of HA-Aut5p
in cells lacking vacuolar proteinase A (pep4 ) needs
further detailed studies. Alternatively, Aut5p might be activated by
the acidic vacuolar pH. However, neither of these activation strategies
explains how lysis of the vacuolar limiting membrane is prevented.
Another possibility that explains the specificity would be an
activation of Aut5p by interaction with another protein such as a
colipase. To identify such a putative interacting protein, we made a
high copy suppressor screen using aut5 cells, but under the conditions used, this did not detect any suppressors. Also, in our hands a two-hybrid screen using Aut5p as bait did not result in
detection of a valuable interaction partner. Interestingly, a large
scale two-hybrid approach (34) pointed to the inositol phosphosphingolipid phospholipase C Isc1p (35, 36) as a putative Aut5p-interacting protein. We chromosomally deleted ISC1,
but under the conditions tested light microscopic examination did not
show vacuolar accumulation of autophagic bodies during starvation (not
shown). This does not support a direct involvement of Isc1p in lysis of
autophagic bodies. In general, the idea of Aut5p as a hydrolase with
low substrate specificity seems unlikely, since this demands
sophisticated mechanisms for controlling its activity. If Aut5p acts as
a hydrolase, a high specificity for molecules present only at its
target membranes would significantly limit its risk for the integrity
of the cell.
In an alternate scenario in the cytosol a multivesicular body,
i.e. a late endosome (prevacuolar compartment) filled with MVB vesicles, might fuse with an autophagosome. Within the resulting organelle the MVB vesicles then could fuse with the inner membrane layer of autophagosomes. This would deliver Aut5p to the inner membrane
of autophagosomes and, thus, to autophagic bodies. In this scenario
Aut5p would attack in the vacuolar lumen those membranes where it is
located. As discussed, a high substrate selectivity of Aut5p would also
be expected in this scenario. In mammalian cells indeed fusions between
endosomes and autophagosomes, resulting in the formation of
amphisomes, have been reported (37). One should also take into
account the possibility that Aut5p might function already at or inside
the multivesicular body. Because in all scenarios a high substrate
selectivity of Aut5p seems likely, it is a challenging task for future
work to identify such a putative Aut5p substrate.
 |
ACKNOWLEDGEMENTS |
We are grateful to S. D. Emr, R. Erdmann, H. R. Pelham, and R. Schekman for providing strains,
plasmids, and antibodies. We further thank D. H. Wolf, C. Taxis,
and R. Hitt for helpful discussions and support.
 |
FOOTNOTES |
*
This work was supported by grants of the Deutsche
Forschungsgemeinschaft and the Fond der Chemischen Industrie (to
M. T.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in
accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
¶
To whom correspondence should be addressed. E-mail:
thumm@ po.uni-stuttgart.de; Fax: 49-711-685-4392.
Published, JBC Papers in Press, December 22, 2002, DOI 10.1074/jbc.M209309200
 |
ABBREVIATIONS |
The abbreviations used are:
ER, endoplasmic
reticulum;
MVB, multivesicular body;
MES, 2-(N-morpholino)ethanesulfonic acid;
MOPS, 3-(N-morpholino)propanesulfonic acid;
SC, medium, synthetic
complete medium;
GFP, green fluorescent protein;
proCPS, procarboxypeptidase S.
 |
REFERENCES |
| 1.
|
Klionsky, D. J.,
and Ohsumi, Y.
(1999)
Annu. Rev. Cell Dev. Biol.
15,
1-32[CrossRef][Medline]
[Order article via Infotrieve]
|
| 2.
|
Thumm, M.
(2000)
Microsc. Res. Tech.
51,
563-572[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Tsukada, M.,
and Ohsumi, Y.
(1993)
FEBS Lett.
333,
169-174[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
Thumm, M.,
Egner, R.,
Koch, B.,
Schlumpberger, M.,
Straub, M.,
Veenhuis, M.,
and Wolf, D. H.
(1994)
FEBS Lett.
349,
275-280[CrossRef][Medline]
[Order article via Infotrieve]
|
| 5.
|
Harding, T. M.,
Hefner-Gravink, A.,
Thumm, M.,
and Klionsky, D. J.
(1996)
J. Biol. Chem.
271,
17621-17624[Abstract/Free Full Text]
|
| 6.
|
Scott, S. V.,
Hefner-Gravink, A.,
Morano, K. A.,
Noda, T.,
Ohsumi, Y.,
and Klionsky, D. J.
(1996)
Proc. Nat. Acad. Sci. U. S. A.
93,
12304-12308[Abstract/Free Full Text]
|
| 7.
|
Baba, M.,
Osumi, M.,
Scott, S. V.,
Klionsky, D. J.,
and Ohsumi, Y.
(1997)
J. Cell Biol.
139,
1687-1695[Abstract/Free Full Text]
|
| 8.
|
Suzuki, K.,
Kirisako, T.,
Kamada, Y.,
Mizushima, N.,
Noda, T.,
and Ohsumi, Y.
(2001)
EMBO J.
20,
5971-5981[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Kim, J.,
Huang, W. P.,
Stromhaug, P. E.,
and Klionsky, D. J.
(2001)
J. Biol. Chem.
277,
763-773[Medline]
[Order article via Infotrieve]
|
| 10.
|
Noda, T.,
Suzuki, K.,
and Ohsumi, Y.
(2002)
Trends Cell Biol.
12,
231-235[CrossRef][Medline]
[Order article via Infotrieve]
|
| 11.
|
Goebel, W.,
and Kuhn, M.
(2000)
Curr. Opin. Microbiol.
3,
49-53[CrossRef][Medline]
[Order article via Infotrieve]
|
| 12.
|
Takeshige, K.,
Baba, M.,
Tsuboi, S.,
Noda, T.,
and Ohsumi, Y.
(1992)
J. Cell Biol.
119,
301-311[Abstract/Free Full Text]
|
| 13.
|
Suriapranata, I.,
Epple, U. D.,
Bernreuther, D.,
Bredschneider, M.,
Sovarasteanu, K.,
and Thumm, M.
(2000)
J. Cell Sci.
113,
4025-4033[Abstract]
|
| 14.
|
Teter, S. A.,
Eggerton, K. P.,
Scott, S. V.,
Kim, J.,
Fischer, A. M.,
and Klionsky, D. J.
(2001)
J. Biol. Chem.
276,
2083-2087[Abstract/Free Full Text]
|
| 15.
|
Epple, U. D.,
Suriapranata, I.,
Eskelinen, E. L.,
and Thumm, M.
(2001)
J. Bacteriol.
183,
5942-5955[Abstract/Free Full Text]
|
| 16.
|
Katzmann, D. J.,
Babst, M.,
and Emr, S. D.
(2001)
Cell
106,
145-155[CrossRef][Medline]
[Order article via Infotrieve]
|
| 17.
|
Odorizzi, G.,
Babst, M.,
and Emr, S. D.
(1998)
Cell
95,
847-858[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Reggiori, F.,
and Pelham, H. R.
(2002)
Nat. Cell Biol.
4,
117-123[CrossRef][Medline]
[Order article via Infotrieve]
|
| 19.
|
Reggiori, F.,
and Pelham, H. R.
(2001)
EMBO J.
20,
5176-5186[CrossRef][Medline]
[Order article via Infotrieve]
|
| 20.
|
Ausubel, F. M.,
Brent, R.,
Kingston, R. E.,
and Moore, D. D.
(1987)
Current Protocols in Molecular Biology
, Greene Publishing Associates, New York
|
| 21.
|
Güldener, U.,
Heck, S.,
Fielder, T.,
Beinhauer, J.,
and Hegemann, J. H.
(1996)
Nucleic Acids Res.
24,
2519-2524[Abstract/Free Full Text]
|
| 22.
|
Straub, M.,
Bredschneider, M.,
and Thumm, M.
(1997)
J. Bacteriol.
179,
3875-3883[Abstract/Free Full Text]
|
| 23.
|
Longtine, M. S.,
McKenzie, A., III,
Demarini, D. J.,
Shah, N. G.,
Wach, A.,
Brachat, A.,
Philippsen, P.,
and Pringle, J. R.
(1998)
Yeast
14,
953-961[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Barth, H.,
and Thumm, M.
(2001)
Gene
274,
151-156[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Vida, T. A.,
and Emr, S. D.
(1995)
J. Cell Biol.
128,
779-792[Abstract/Free Full Text]
|
| 26.
|
Hutchins, M. U.,
Veenhuis, M.,
and Klionsky, D. J.
(1999)
J. Cell Sci.
112,
4079-4087[Abstract]
|
| 27.
|
Lang, T.,
Schaeffeler, E.,
Bernreuther, D.,
Bredschneider, M.,
Wolf, D. H.,
and Thumm, M.
(1998)
EMBO J.
17,
3597-3607[CrossRef][Medline]
[Order article via Infotrieve]
|
| 28.
|
Swaminathan, S.,
Amerik, A. Y.,
and Hochstrasser, M.
(1999)
Mol. Biol. Cell
10,
2583-2594[Abstract/Free Full Text]
|
| 29.
|
Pelham, H. R.
(2000)
Methods Enzymol.
327,
279-283[Medline]
[Order article via Infotrieve]
|
| 30.
|
Munro, S.
(2001)
FEBS Lett.
498,
223-227[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Lametschwandtner, G.,
Brocard, C.,
Fransen, M.,
Van Veldhoven, P.,
Berger, J.,
and Hartig, A.
(1998)
J. Biol. Chem.
273,
33635-33643[Abstract/Free Full Text]
|
| 32.
|
Kamada, Y.,
Funakoshi, T.,
Shintani, T.,
Nagano, K.,
Ohsumi, M.,
and Ohsumi, Y.
(2000)
J. Cell Biol.
150,
1507-1513[Abstract/Free Full Text]
|
| 33.
|
Kim, J.,
and Klionsky, D. J.
(2000)
Annu. Rev. Biochem.
69,
303-342[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Ito, T.,
Chiba, T.,
Ozawa, R.,
Yoshida, M.,
Hattori, M.,
and Sakaki, Y.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
4569-4574[Abstract/Free Full Text]
|
| 35.
|
Sawai, H.,
Okamoto, Y.,
Luberto, C.,
Mao, C.,
Bielawska, A.,
Domae, N.,
and Hannun, Y. A.
(2000)
J. Biol. Chem.
275,
39793-39798[Abstract/Free Full Text]
|
| 36.
|
Betz, C.,
Zajonc, D.,
Moll, M.,
and Schweizer, E.
(2002)
Eur. J. Biochem.
269,
4033-4039[Medline]
[Order article via Infotrieve]
|
| 37.
|
Fengsrud, M.,
Erichsen, E. S.,
Berg, T. O.,
Raiborg, C.,
and Seglen, P. O.
(2000)
Eur J. Cell Biol.
79,
871-882[CrossRef][Medline]
[Order article via Infotrieve]
|
| 38.
|
Wurmser, A. E.,
and Emr, S. D.
(1998)
EMBO J.
17,
4930-4942[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Sikorski, R. S.,
and Hieter, P.
(1989)
Genetics
122,
19-27[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. Huang, F. Reggiori, and D. J. Klionsky
The Transmembrane Domain of Acid Trehalase Mediates Ubiquitin-independent Multivesicular Body Pathway Sorting
Mol. Biol. Cell,
July 1, 2007;
18(7):
2511 - 2524.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Yang, J. Huang, J. Geng, U. Nair, and D. J. Klionsky
Atg22 Recycles Amino Acids to Link the Degradative and Recycling Functions of Autophagy
Mol. Biol. Cell,
December 1, 2006;
17(12):
5094 - 5104.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Reggiori and D. J. Klionsky
Atg9 sorting from mitochondria is impaired in early secretion and VFT-complex mutants in Saccharomyces cerevisiae
J. Cell Sci.,
July 15, 2006;
119(14):
2903 - 2911.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Meiling-Wesse, U. D. Epple, R. Krick, H. Barth, A. Appelles, C. Voss, E.-L. Eskelinen, and M. Thumm
Trs85 (Gsg1), a Component of the TRAPP Complexes, Is Required for the Organization of the Preautophagosomal Structure during Selective Autophagy via the Cvt Pathway
J. Biol. Chem.,
September 30, 2005;
280(39):
33669 - 33678.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Klionsky
The molecular machinery of autophagy: unanswered questions
J. Cell Sci.,
January 1, 2005;
118(1):
7 - 18.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Meiling-Wesse, H. Barth, C. Voss, E.-L. Eskelinen, U. D. Epple, and M. Thumm
Atg21 Is Required for Effective Recruitment of Atg8 to the Preautophagosomal Structure during the Cvt Pathway
J. Biol. Chem.,
September 3, 2004;
279(36):
37741 - 37750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. W. Thorpe, C. S. Fong, N. Alic, V. J. Higgins, and I. W. Dawes
Cells have distinct mechanisms to maintain protection against different reactive oxygen species: Oxidative-stress-response genes
PNAS,
April 27, 2004;
101(17):
6564 - 6569.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|