Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Originally published In Press as doi:10.1074/jbc.M211062200 on December 19, 2002

J. Biol. Chem., Vol. 278, Issue 10, 7964-7972, March 7, 2003
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/10/7964    most recent
M211062200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jackson-Hayes, L.
Right arrow Articles by Park, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jackson-Hayes, L.
Right arrow Articles by Park, E. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

A Thyroid Hormone Response Unit Formed between the Promoter and First Intron of the Carnitine Palmitoyltransferase-Ialpha Gene Mediates the Liver-specific Induction by Thyroid Hormone*

Loretta Jackson-HayesDagger §, Shulan SongDagger , Eduard N. LavrentyevDagger , Michelle S. JansenDagger , F. Bradley Hillgartner, Liquin Tian||, Philip A. Wood||, George A. CookDagger , and Edwards A. ParkDagger **

From the Dagger  Department of Pharmacology, College of Medicine, University of Tennessee Health Science Center, Memphis, Tennessee 38163, the  Department of Biochemistry and Molecular Pharmacology, School of Medicine, West Virginia University, Morgantown, West Virginia, 26506-9142, and the || Department of Genetics, University of Alabama at Birmingham, Birmingham, Alabama 35294

Received for publication, October 29, 2002, and in revised form, December 16, 2002

    ABSTRACT
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
Results
DISCUSSION
REFERENCES

Carnitine palmitoyltransferase-I (CPT-I) catalyzes the rate-controlling step of fatty acid oxidation. CPT-I converts long-chain fatty acyl-CoAs to acylcarnitines for translocation across the mitochondrial membrane. The mRNA levels and enzyme activity of the liver isoform, CPT-Ialpha , are greatly increased in the liver of hyperthyroid animals. Thyroid hormone (T3) stimulates CPT-Ialpha transcription far more robustly in the liver than in non-hepatic tissues. We have shown that the thyroid hormone receptor (TR) binds to a thyroid hormone response element (TRE) located in the CPT-Ialpha promoter. In addition, elements in the first intron participate in the T3 induction of CPT-Ialpha gene expression, but the CPT-Ialpha intron alone cannot confer a T3 response. We found that deletion of sequences in the first intron between +653 and +744 decreased the T3 induction of CPT-Ialpha . Upstream stimulatory factor (USF) and CCAAT enhancer binding proteins (C/EBPs) bind to elements within this region, and these factors are required for the T3 response. The binding of TR and C/EBP to the CPT-Ialpha gene in vivo was shown by the chromatin immunoprecipitation assay. We determined that TR can physically interact with USF-1, USF-2, and C/EBPalpha . Transgenic mice were created that carry CPT-Ialpha -luciferase transgenes with or without the first intron of the CPT-Ialpha gene. In these mouse lines, the first intron is required for T3 induction as well as high levels of hepatic expression. Our data indicate that the T3 stimulates CPT-Ialpha gene expression in the liver through a T3 response unit consisting of the TRE in the promoter and additional factors, C/EBP and USF, bound in the first intron.

    INTRODUCTION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
Results
DISCUSSION
REFERENCES

Thyroid hormone (T3)1 has profound effects on various aspects of metabolism and development (1). The effects of T3 are mediated through the thyroid hormone receptor (TR). TR belongs to a class of nuclear receptors that includes the retinoic acid receptor, retinoid X receptor (RXR), vitamin D receptor, and peroxisomal proliferator-activated receptors (2). TR isoforms, TRalpha and TRbeta , are encoded by two separate genes (3). Generally, TR binds as a heterodimer with RXR and regulates transcription by binding to thyroid hormone response elements (TREs) located in the promoters of target genes. The T3 stimulation of gene expression involves the interaction of TR with other transcription factors bound to the promoter as well as the recruitment of coactivators such as SRC-1/p160, CBP/p300, and TRAP220/DRIP205/PBP to the liganded receptor (3).

Carnitine palmitoyltransferase-I (CPT-I) is a rate-controlling enzyme in the fatty acid oxidation pathway (4). CPT-I, which is located on the outer mitochondrial membrane, transfers the fatty-acyl moiety from acyl-CoA to carnitine (5). The acylcarnitine is transported across the mitochondrial inner membrane by carnitine acylcarnitine translocase and re-esterified to acyl-CoA by CPT-II (4, 5). Two isoforms of CPT-I have been identified: the "liver" isoform (CPT-Ialpha ) and the "muscle" isoform (CPT-Ibeta ). We have shown that expression of the CPT-Ialpha gene in the liver is elevated in hyperthyroidism, fasting, and diabetes (6, 7). T3 stimulates fatty acid oxidation in the liver. T3 up-regulates CPT-I alpha  mRNA levels 40-fold in the livers of hyperthyroid rats compared with hypothyroid rats (6). This increase in mRNA is accompanied by an elevation of CPT-Ialpha enzyme activity (6). The alpha -isoform is induced in the hearts of fasted or diabetic rats. However, CPT-Ialpha gene expression is increased far more in the liver than in the heart of hyperthyroid animals (8).

We have cloned and characterized the promoter of the CPT-Ialpha gene (9, 10). The transcriptional start site of the CPT-Ialpha gene is denoted +1, and the 5'-flanking DNA has been analyzed to nucleotide -6839. Exon 1 contains nucleotides +1 through +27, and exon 2 begins at nucleotide +1201. The CPT-Ialpha TRE consists of a direct repeat separated by four nucleotides (DR4) (11). The TRE is located in the promoter of the CPT-Ialpha gene between nucleotides -2938 and -2923. Mutation of this DR4 motif results in the complete loss of T3 responsiveness (11, 12). Interestingly, the first intron of the CPT-Ialpha gene is also necessary for full T3 induction (11). Removal of the first intron reduces the T3 induction by 80%. Induction of CPT-Ialpha -luciferase by T3 is more robust in HepG2 hepatoma cells compared with L6 myoblasts and cardiac myocytes. The first intron is required for the induction in transfected HepG2 hepatoma cells and not in L6 myoblasts and cardiac myocytes, suggesting that the intron contributes to the enhanced T3 induction in the liver (11). The goal of the present study was to examine more extensively the role of the first intron in liver-specific T3 induction of CPT-Ialpha . We identified regions within the first intron that are necessary to achieve the full T3 induction. Elements within these regions bind proteins that participate in the T3 response, including CCAAT enhancer-binding proteins (C/EBP) and upstream stimulatory factor (USF-1 and USF-2). TR physically interacts with USF-1, USF-2, and C/EBPalpha . Our data suggest that C/EBP is responsible for the liver-specific component of the induction of CPT-Ialpha by thyroid hormone. Our findings show that the TR in the promoter and C/EBP and USF bound in the first intron comprise a T3 response unit that mediates the liver-selective T3 induction of CPT-Ialpha .

    EXPERIMENTAL PROCEDURES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
Results
DISCUSSION
REFERENCES

Electrophoretic Mobility Shift Assays-- CPT-Ialpha probes for electrophoretic mobility shift assays were created by labeling double-stranded oligonucleotides using Klenow enzyme and [alpha -32P]dCTP. The oligonucleotides contained sequences from the first intron and XbaI or MluI overhangs. Double-stranded unlabeled wild-type and mutant oligonucleotides were used as competitors (See Table I for oligomer sequences). Rat liver nuclear extract was prepared as described (13). The protein-DNA binding mixtures contained labeled probe (30,000 cpm) and proteins isolated from rat liver nuclei in 80 mM KCl, 25 mM Tris-HCl (pH 7.4), 0.1 mM EDTA, 1 mM dithiothreitol, and 10% glycerol (11). Poly(deoxyinosine-deoxycytidine) (double-stranded homopolymer) was added to each binding reaction as a nonspecific competitor. Antibodies for TRalpha /beta , USF-1, USF-2, Sp1, C/EBPalpha , C/EBPbeta , Oct-1, COUP-TF, and CREB (Santa Cruz) were added to binding reactions for supershift assays. Binding reactions were incubated at room temperature for 20 min and resolved on 5% non-denaturing acrylamide gels (80:1, acrylamide/bisacrylamide) in Tris-glycine running buffer (22 mM Tris and 190 mM glycine). Electrophoresis was carried out at 180 volts for 80 min at 4 °C (11). Sequence analysis of the intron for potential transcription factor binding sites was performed using the TESS transcription factor search.

Construction of Luciferase Vectors-- Regions of the CPT-Ialpha promoter and intron 1 were ligated into the pGL3-basic luciferase vector (Promega). Construction of -4495/+19 CPT-Ialpha -Luc, -4495/+1240 CPT-Ialpha -Luc, and Delta Sma -4495/+1240 has been described previously (11). Internal deletions within intron 1 were constructed by digesting -1653/+1240-Luc at +199 and +707 with SmaI, followed by ligation of PCR products that contained a SmaI restriction site at each end and decreasing lengths of intron 1 sequence. The forward primer corresponded to nucleotides -16/+6 (TCGGACTCAGCTCGCTCATTCCG). The reverse primers corresponded to nucleotides +282/+309 (5'-CACCCGGGGTTTTGGGGTCCTCATTACC-3'), +431/+459 (5'-CTTTTCCCGGGTCTTTCCATTCGCCATCC-3'), +680/+655 (5'-CAGTCCCGGGACACCCACCTGGCC-3'), and +700/+677 (5'-GGTCCCGGGGCGACCTTGAGCAG-3'). PCR products were ligated into pCR-4-TOPO cloning vector (Invitrogen). PCR products were removed from pCR-4-TOPO by digestion with SmaI. The CPT-Ialpha intron fragments were gel-purified and ligated into the SmaI sites within intron 1 in the -1653/+1240 CPT-Ialpha -luciferase vector. These deletion constructs and -4495/+1240 CPT-Ialpha -luciferase were digested with EcoRI and BglII, which cleaves at -1653 and at the 3'-end of CPT-Ialpha in the multicloning site of the luciferase vectors. Finally, the -1653/+1240 fragment containing a deletion was ligated into the EcoRI and BglII sites within -4495/+1240 CPT-Ialpha -luciferase.

Serial deletions from the 3'-end of intron 1 were constructed by digesting -4495/+1240 CPT-Ialpha -luciferase with MluI, which cuts at +130 and +1066, and BglII, which digests at the 3'-end of CPT-Ialpha in the multicloning site of the luciferase vectors. CPT-Ialpha intron fragments were made by PCR amplification using primers that correspond to regions within intron 1. The forward primer corresponded to nucleotides -16/+6 (TCGGACTCAGCTCGCTCATTCCG). The reverse primers contained BglII restriction sites and corresponded to nucleotides +1076/+1052 (5'-CTAAATACGAGATCTAAAAAGCTTC-3'), +1012/+990 (5'-GCAGTTTTCGACTAAAATCTGTC-3'), +864/+839 (5'-CGTGAGCATAGATCTGTGTTCTGTG-3'), and +803/+778 (5'-GGCTGTTAGGGCAGATCTGGGCTGC-3'). Each PCR reaction contained 1.0 mM MgCl2, 200 µM dNTPs, 1 µg of forward and reverse primers, 2.5 units of Amplitaq GoldTM polymerase (Roche Molecular Biochemicals), and 10 ng of -1653/+1240 CPT-Ialpha -luciferase template. PCR reactions were conducted in a Thermo Cycler 2400 (PerkinElmer Life Sciences). PCR products were digested with MluI and BglII and ligated into the MluI site at +130 in CPT-Ialpha and BglII at the 3'-end of CPT-Ialpha in the pGL3-basic luciferase multicloning site.

Gal4-SV40-luciferase vectors were constructed by digesting Gal4-SV40-luciferase vector and -1653/+1240 CPT-Ialpha -luciferase with SmaI (+707) and MluI (+1066). The +707/+1066 fragment was ligated into the SmaI and MluI sites within Gal4-SV40-luciferase. Site-directed mutations of protein binding sites were created within the -4495/+1240 CPT-Ialpha -luciferase vector using the QuikChange site-directed mutagenesis kit (Stratagene). Protein binding sites were mutated to NheI restriction enzyme sites for identification of mutated clones. The forward and reverse primers used in mutagenesis reactions corresponded to nucleotides +642/+683 (5'-GCCCGAGGTTCAAGGGCGCTAGCGGTGTCCAGAGACTTGCTC-3'), +656/+700 (5'-GGCCAGGTGGGTGTCCAGAGAGCTAGCCAAGGTCGCGCTGGGACC-3'), +659/+704 (5'-CAGGTGGGTGTCCAGAGACTTGCTGCTAGCCGCGCTGGGACCAGAG-3') and +710/+750 (5'-GAGGGTGGGGGTGTGCTAGCACCCGGCCTGAGTGAACTTGG-3'). Mutagenesis reactions were conducted using the +130/+1066 Gal4 SV40 vector as a template (11). After introduction of mutations into the +130/+1066 Gal4-SV40-luciferase vector, mutated vectors as well as the -4495/+1240 CPT-Ialpha -luciferase vector were digested with MluI, which digests the CPT-Ialpha gene at nucleotides +130 and +1066. The mutated +130/+1066 fragments were ligated into the +130 and +1066 sites within the -4495/+1240 CPT-Ialpha -luciferase vector. All mutations and deletions were confirmed by sequence analysis.

Transient Transfection of Luciferase Vectors-- CPT-Ialpha -luciferase constructs were transiently transfected into HepG2 cells by the calcium phosphate method (9). Transfections included 3 µg of CPT-Ialpha -luciferase vectors along with RSV-TRbeta and TK-renilla vectors. Cells were transfected in Dulbecco's modified Eagle's medium (DMEM) containing 5% calf serum/5% fetal calf serum and incubated overnight at 37 °C. Following two washes with phosphate-buffered saline, the medium was replaced by DMEM containing no serum. Cells were treated with 100 nM T3 for 24 h. After T3 treatment, cells were washed twice with phosphate-buffered saline and lysed in passive lysis buffer (Promega). Cell lysates were frozen and thawed to facilitate cell lysis. Luciferase assays were conducted on extracts from cells in serum-free media and cells treated with T3. Both luciferase and renilla activity was measured. Protein content in each lysate was determined by Bio-Rad protein assay (Bio-Rad). Luciferase activity was corrected for both protein content and renilla activity to account for cell density and transfection efficiency, respectively. Data are expressed as -fold induction of luciferase in cells exposed to T3 as compared with cells that received no hormone (Fig. 3) or relative induction of luciferase in mutant construct as compared with the induction of wild-type -4495/+1240 CPT-Ialpha -luciferase (Figs. 1, 4, and 6).

GST-pull-down assays GST and GST·C/EBPalpha were prepared as described by Yin et al. (14). 35S-labeled chicken TRalpha and human RXRalpha were expressed using TNT reticulocyte lysates (Promega). GST-pull down assays were conducted as described (14). Bound proteins were eluted and resolved by SDS-PAGE and visualized by storage phosphor autoradiography. GST·TRalpha fusion protein was expressed in Escherichia coli BL21(DE3) (Novagen) and purified using glutathione-Sepharose (Amersham Biosciences) according to the manufacturer's protocol (14). 35S-labeled USF-1 and USF-2 were expressed using PROTEINscript II reticulocyte lysates (Ambion). Bound proteins were eluted with 2.5 mM glutathione and resolved by SDS-PAGE.

Chromatin Immunoprecipitation Assays-- Rat hepatocytes were prepared as described previously (15). Chromatin immunoprecipitation assays were conducted with minor modification as described by Jurado et al. (16). PCR reactions were conducted in the iCycler (Bio-Rad) using ThermolAce DNA polymerase (Invitrogen), 1 µl of template, and 1 µg of each primer. The primers used for PCR corresponded to nucleotides -6473/-6450 (5'-CTCTGGTGTCCTGTAACCTGTGG-3'), -6076/-6099 (5'-GAAGGCTGGAATTACACTGGTCAG-3'), -3079/-3056 (5'-GACAGGCAGGGTACATTTCACAG-3'), -2802/-2825 (5'-GAAGGCA- GTGCTTTTCCCTAC-3'), +200/+220 (5'-GACGGGAGGAAAGATGCTTG-3'), and +750/+730 (5'-CCAAGTTCACTCAGGCCGGGTC). Cycling conditions were 95 °C for 3 min, followed by 25 cycles at 95 °C for 30 s, 60 °C for 30 s, and 74 °C for 1 min, followed by one final extension for 10 min at 74 °C. PCR products were resolved on ethidium bromide-stained 3% NuSeive-agarose gel.

Production and Characterization of CPT-Ialpha -Luc Transgenic Mouse Lines-- Restriction fragments containing -6938/+1240 or -6839/+19 CPT-Ialpha -Luc genes were isolated and injected into the pronuclei of one-cell C57BL/6J × SJL/JF2 hybrid (B6/SJL) mouse zygotes to produce transgenic mice (17, 18). The founders were bred with B6/SJL mates to obtain a second generation of transgenics. Mice containing the luciferase gene constructs were identified by Southern analysis of genomic DNA obtained from the tail (17). Two transgenic mouse lines of each CPT-Ialpha gene construct were selected for use in the T3 experiments based on initial characterization for transgene expression (data not shown). Mice were injected with 0.33 mg/Kg body weight of triiodothyronine (T3) 24 and 48 h prior to sacrifice (6). The mice were sacrificed, and pieces of the liver and heart were homogenized in luciferase assay buffer (Promega). Luciferase assays and protein determinations were conducted as described above.

    Results
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
Results
DISCUSSION
REFERENCES

Identification of Regions within the +199/+707 Region of the First Intron Required for the Full T3 Response-- Fig. 1 illustrates the -4495/+1240 CPT-Ialpha -luciferase vector containing 4495 base pairs of the promoter, exon 1, intron 1, and a segment of exon 2. Deletion of nucleotides between +199/+707 in the first intron reduced the T3 induction of CPT-Ialpha by 50% (Fig. 1). To define smaller regions in the intron that contribute to the T3 stimulation, additional internal deletions were made in the context of the -4495/+1240 CPT-Ialpha -Luc vector. Removal of the +515/+707 region decreased the T3 response ~50%, as did deletion of the 80-base pair +628/+707 region (Fig. 1). Deletion of the +628/+707 region did not alter the basal expression of the CPT-Ialpha -Luc vector (data not shown). These data indicate that sequences within the +628/+707 region are required for a full response to T3.


View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1.   Localization of regions within the first intron that enhance T3 responsiveness. HepG2 cells were transiently transfected with 3 µg of -4495/+1240 CPT-Ialpha -Luc constructs, 1 µg of RSV-TRbeta , and 1 µg of TK-renilla. The deleted sequences in the first intron are indicated by the symbol (Delta ). For hormone treatment, cells were incubated either in serum-free DMEM or DMEM containing 100 nM T3 for 24 h. All transfections were performed in duplicate and repeated four to six times. Luciferase and renilla assays were performed in the same tube. Luciferase activity was corrected for both protein content and renilla activity. Results are expressed as the relative induction by T3 ± S.E. by comparing the T3 induction of vectors with deletions to the wild type vector, which was assigned a value of one. *, p < 0.05 versus full-length -4495/+1240 CPT-Ialpha -luciferase.

Binding of Transcription Factors to the +628/+707 Region of the Intron-- Our next studies focused on the +628/+707 region of the first intron. Electrophoretic mobility shift assays were conducted using double-stranded oligonucleotides that corresponded to nucleotides +628/+655, +653/+682, and +674/+707 in the CPT-Ialpha gene. Only the +653/+683 and +674/+707 regions bound proteins isolated from rat liver nuclei (Fig. 2, A and B). A consensus E-box motif (CANNTG) was found at nucleotides +659/+664. The E-box motif binds a family of proteins that contain helix-loop-helix and leucine zipper dimerization domains, including c-Myc, sterol regulatory element binding protein (SREBP), and upstream stimulatory factor (19). Supershift assays were conducted using antibodies that recognize Sp1, C/EBPbeta , Oct-1, USF-1, and USF-2. Protein binding to the +653/+682 region was completely disrupted by USF-1 and USF-2 antibodies, whereas the other antibodies did not alter the binding of nuclear proteins (Fig. 2A). Western blot analysis confirmed that USF-1 and USF-2 are present in RLNE as well as in HepG2 cells, which was the cell type used in transient transfection experiments (data not shown). Competition analysis revealed that a 100-fold excess of unlabeled wild type +653/+682 oligomer completely competed for nuclear protein binding to the labeled probe, whereas an oligomer that contained a mutation in the E-box motif (Table I, Mut. #1) was unable to compete for protein binding (Fig. 2A). However, competition with unlabeled oligomer that contained a mutation 3' to the E-box (Mut. #2) reduced protein binding as effectively as the wild type oligomer. Our data show that USF-1 and USF-2 bind within intron 1 of CPT-Ialpha at the E-box motif located at +659/+664.


View larger version (54K):
[in this window]
[in a new window]
 
Fig. 2.   C/EBP and USF bind in the +653/+707 region. A and B, double-stranded oligonucleotides were constructed that encompassed the +653/+683 and +674/+707 regions of the intron. In the upper panels, the 32P-radiolabeled double-stranded oligomers were incubated with rat liver nuclear extract (RLNE) and the antibodies (Ab) indicated. Electrophoretic mobility shift assays were conducted as described under "Experimental Procedures." In the lower panels, competition assays were conducted using double-stranded unlabeled wild type (WT) and mutant (#) oligomers. A 100-fold excess of the competitor oligomers was added to the competition assays. The oligonucleotide sequences are given in Table I.

                              
View this table:
[in this window]
[in a new window]
 
Table I
Oligomers used in electrophoretic mobility shift assays
Oligomers corresponding to sequences within the +628/+707 region were constructed as listed for electromobility shift assays. XbaI restriction enzyme sites were introduced to provide for labeling with 32P and Klenow enzyme. Specific mutations are bold face. Oligomers corresponding to the +701/+744 and the +824/+842 regions were designed with XbaI and MluI restriction enzyme sites, respectively, to provide for labeling with 32P and Klenow enzyme.

Gel shift mobility assays were conducted with an oligomer representing the +674/+707 region. Several complexes were formed indicating that either multiple proteins or a family of proteins bind at this site (Fig. 2B). We analyzed the binding of nuclear factors to this site by the addition of antibodies to the gel shift assays. Antibodies to C/EBPalpha and C/EBPbeta disrupted the binding of nuclear factors (Fig. 2B). COUP-TF and TR antibodies did not alter protein binding. The +677/+689 region contains an AGGTCA-like motif that might interact with nuclear receptors. However, antibodies to hepatocyte nuclear factor-4, RXR, and peroximal proliferator-activated receptor alpha  did not alter the binding of nuclear proteins (data not shown). Our results indicated that C/EBP proteins could bind to this site. Competition analyses were conducted using unlabeled oligomers that corresponded to the wild type +674/+707 sequence as well as oligomers that contained mutations across the +674/+707 region. A 100-fold excess of wild type oligomer or an oligomer that contained a mutation in nucleotides +695/+700 (Mut. #7) competed effectively for protein binding to the labeled oligomer. However, oligomers that contained mutations in the +677/+682 (Mut. #3 and #5) and +684/+689 (Mut. #4 and #6) sites did not compete for protein binding. Therefore, we conclude that nucleotides within the +677/+689 element are necessary for protein binding within the +674/+707 region.

Contribution of the +628/+707 USF and C/EBP Binding Regions to the T3 Response-- To investigate the importance of elements within the +628/+707 region, we removed these sites from the -4495/+1240 CPT-Ialpha -luciferase vector by making Delta +680/+707 and Delta +653/+707 deletions within the intron. These vectors were transiently transfected into HepG2 cells along with RSV-TRbeta . Deletion of the +680/+707 and the +653/+707 regions caused a 35% reduction in the T3 induction (Fig. 3), which was identical to the Delta +628/+707 vector in this set of experiments (data not shown). These data demonstrated that the elements contributing to the T3 response are located in the +680/+707 region.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 3.   C/EBP and USF binding sites participate in the T3 induction. HepG2 cells were transiently transfected with 3 µg of CPT-Ialpha -Luc vector, 1 µg of RSV-TRbeta , and 1 µg of TK-renilla. The -4495/+1240 CPT-Ialpha -luciferase vectors contained deletions in the intron. Cells were treated for 24 h with 100 nM T3 and luciferase assays performed as described in Fig. 1. Experiments were conducted in duplicate and repeated four to six times. Results are expressed as-fold induction by T3 ± S.E. by comparing luciferase activity of untreated cells with that of cells exposed to hormone. dagger , p < 0.005 versus full-length -4495/+1240 CPT-Ialpha -luciferase.

Role of the +707/+1066 Region in T3 Induction of CPT-Ialpha -- In addition to the +653/+707 region, sequences between +707 and +1066 also participated in the T3 induction (Fig. 4). To assess the contribution of the 3'-end of the intron to the T3 induction of CPT-Ialpha , serial deletions were created from the second exon in the -4495/+1240 CPT-Ialpha -luciferase vector. These vectors were cotransfected with RSV-TRbeta into HepG2 cells and tested for T3 responsiveness (Fig. 4). The full T3 effect was maintained with deletion of nucleotides +803 to +1240. However, the T3 response decreased upon deletion of the additional nucleotides between +803 and +707. Deletion of the +707/+1240 region modestly decreased basal expression of the gene (data not shown). This stimulation was reduced further upon deletion of the intron to +199. An internal deletion of the +707/+1066 region also diminished the T3 response by 40%. These findings show that sequences between +707 and +803 of intron 1 are involved in the enhancement of T3 induction.


View larger version (13K):
[in this window]
[in a new window]
 
Fig. 4.   The +707/+1240 region contributes to the T3 response. HepG2 cells were transiently transfected with 3 µg of -4495/+1240 CPT-Ialpha -Luc or serial deletion constructs, 1 µg of RSV-TRbeta , and 1 µg of TK-renilla. The ovals represent elements that were previously identified as transcription factor binding sites by DNase I footprinting (11). Cells were treated with 100 nM T3 in serum-free DMEM for 24 h before cells were harvested. Luciferase assays were performed as described in the legend to Fig. 1. All transfections were conducted at least four times. Results are expressed as relative induction ± S.E. by comparing the T3 induction of the vectors containing deletions with the -4495/+1240 CPT-Ialpha Luc, which was assigned a value of one. *, p < 0.05 versus full-length -4495/+1240 CPT-Ialpha -luciferase.

We ligated the +707/+1066 sequences in front of the SV40 promoter driving the luciferase reporter gene. The reporter vector contained a Gal4 binding site. The Gal4-SV40-luciferase vectors were transfected with an expression vector for Gal4-TRbeta in which the DNA binding domain of the TRbeta was replaced with the DNA binding domain of Gal4 (20). Inclusion of the +707/+1066 region enhanced the T3 response 2.7-fold compared with Gal4-SV40-luciferase (Fig. 5A). Addition of the +707/+810 sequences allowed an additional 6.8-fold induction of the Gal4-SV40-luciferase vector. These results further demonstrate that factors binding in the +707/+810 region enhance the T3 induction of CPT-Ialpha .


View larger version (34K):
[in this window]
[in a new window]
 
Fig. 5.   Contribution of the +707/+810 region to the T3 induction. A, Gal4-SV40-Luc vectors were constructed that contained the +707/+1066 and the +707/+810 regions of the intron. HepG2 cells were cotransfected with 3 µg of Gal4-SV40-Luc, 100 ng of Gal4-TRbeta expression vector, and 1 µg of TK-renilla. Cells were treated for 24 h with 100 nM T3. Luciferase assays were conducted as described in the legend to Fig. 1. All transfections were repeated four times in duplicate. Results are expressed as relative induction by T3 ± S.E. compared with Gal4-SV40-Luc. *, p < 0.05 versus full-length. The Gal4-SV40-Luc was induced 7-fold by T3. B, electrophoretic mobility shift assays were conducted using 32P-labeled oligomers that corresponded to the +700/+744 and the +824/+842 regions of the intron. Oligomers were incubated with proteins isolated from rat liver nuclei (RLNE). Supershift assays were conducted using antibodies (Ab) to USF-1, USF-2, C/EBPalpha , C/EBPbeta , COUP-TF, and CREB.

Binding of USF within the +707/+810 Region of the Intron-- Our next experiments characterized the binding of nuclear proteins within the +707/+803 region of the first intron. We designed three oligomers that spanned this region of the gene. Using these oligomers in gel shift mobility assays, we found that only the oligomer corresponding to the +700/+744 region bound proteins from rat liver nuclear extract (Fig. 5B). This region contains an E-box element. Antibodies to USF-1 and USF-2 were able to supershift the binding to this site, indicating that USF proteins can bind to this element. Competition analysis using a 100-fold excess of unlabeled wild-type and mutant oligomer that contained an altered USF binding site at +724/+729 confirmed that this E-box motif is necessary for the binding of nuclear proteins (data not shown). Previously, we had identified three sites in the +800/+1066 region that bound nuclear proteins by DNase footprint analysis (11). The +824/+842 element was analyzed in gel shift mobility assays. Several factors were able to bind to this site (Fig. 5B). Addition of antibodies to C/EBPalpha and -beta to the binding reaction disrupted the binding of proteins to this element.

To determine which sites in the +653/+850 region are important for the T3 induction, we disrupted each by site-directed mutagenesis. The sites were altered in the context of -4495/+1240 CPT-Ialpha -Luc by introducing the mutations that had been shown to disrupt binding in gel shift mobility assays. Mutation of either USF binding site and the +677/+689 C/EBP site decreased the T3 induction, strongly suggesting that these factors contributed to the T3 induction (Fig. 6). Disruption of the +827/+842 C/EBP binding site did not alter the T3 induction, indicating that not all C/EBP binding sites contribute to the response of the CPT-Ialpha gene to T3. Our data show that USF and C/EBP are accessory factors in the T3 induction of the CPT-Ialpha gene.


View larger version (49K):
[in this window]
[in a new window]
 
Fig. 6.   Specific elements in intron 1 participate in the T3 induction. HepG2 cells were transiently transfected with -4495/+1240 CPT-Ialpha -Luc vectors that contained mutations in the protein binding sites located in the +653 to +744 region. The mutated nucleotides are shown in Table I and are indicated at the top of the figure. Cells were cotransfected with 3.0 µg of the luciferase vector, 1 µg of RSV-TRbeta , and 1.0 µg of TK-renilla. For hormone treatment, cells were incubated for 24 h in serum-free DMEM or with 100 nM T3. Transfections were performed in duplicate and repeated four to six times. Data are expressed as relative induction by T3 of mutant vectors compared with induction of wild-type -4495/+1240 CPT-Ialpha -luciferase ± S.E. *, p < 0.05 versus full-length -4495/+1240 CPT-Ialpha -luciferase.

Thyroid Receptor and C/EBPalpha Interact in Vitro-- Using glutathione S-transferase-linked TRalpha and C/EBPalpha immobilized on glutathione-conjugated-Sepharose and 35S-labeled USF-1, USF-2, RXRalpha , and TRalpha , we determined that TRalpha can interact with USF-1, USF-2, and C/EBPalpha (Fig. 7). These interactions occurred in the presence and absence of ligand (Fig. 7, A and B). To determine the TR motif through which the physical interaction with C/EBPalpha occurs, we conducted pull-down assays using truncated 35S-labeled TRalpha proteins and GST·C/EBPalpha . Removal of the first 50 amino acids had no effect on the interaction between TR and C/EBP (Fig. 7C). Further deletion of amino acids through 120 completely abolished binding to C/EBPalpha . Isolated polypeptides corresponding to amino acids 1-118 and 1-157 interacted with C/EBPalpha . However, removal of the residues 1-50 diminished its ability to interact with C/EBPalpha . Our results indicate that the interaction between TRalpha and C/EBPalpha occurs through a region of the TR that encompasses the DNA binding domain and is independent of T3. We have also found that TRbeta can interact with C/EBPalpha (data not shown). Physical interactions between TR and the accessory factors, USF and C/EBP, may contribute to the T3 induction of the CPT-Ialpha gene.


View larger version (47K):
[in this window]
[in a new window]
 
Fig. 7.   TR interacts with USF and C/EBP. A, pull-down assays were conducted using in vitro-translated 35S-labeled (35S) USF-1 and USF-2 and bacterially expressed glutathione S-transferase (GST) and GST·TRalpha . GST proteins were immobilized on glutathione-conjugated-Sepharose beads. Binding reactions were conducted in the presence (+) or absence (-) of 100 nM thyroid hormone (T3). Eluted proteins and 10% of the radiolabeled USF-1 or USF-2 used in each binding reaction (10% Input) were resolved by SDS-PAGE and visualized by storage phosphor autoradiography. B, pull-down assays were also conducted with 35S-labeled TRalpha or RXRalpha and bacterially expressed GST and GST·C/EBPalpha fusion protein in the presence (+) or absence (-) of 1 µM T3 or 9-cis-retinoic acid. C, additional pull-down assays were conducted using truncated forms of 35S-labeled TR that were incubated with GST and GST·C/EBPalpha proteins immobilized to glutathione-conjugated-agarose. On the left panel, 10% of the 35S-TR in the binding reaction is shown. On the right panel, the 35S-TR pulled down by GST or GST·C/EBPalpha is shown. Binding reactions were conducted in the presence or absence of 1 µM T3. Bound proteins were resolved by SDS-PAGE and visualized by storage phosphor autoradiography.

In Vivo Binding of TR and C/EBP to the CPT-Ialpha Gene-- Previously, we showed that TR binds to the CPT-Ialpha TRE in vitro (11). To investigate if such binding occurs in vivo we conducted chromatin immunoprecipitation (ChIP) assays. Rat hepatocytes were treated with 1% formaldehyde to cross-link DNA and proteins. Immunoprecipitations were performed using an antibody that recognized both the TRalpha and -beta isoforms as well as antibodies to C/EBPalpha and C/EBPbeta . IgG was used as a control in these experiments. PCR reactions were conducted using primer sets that corresponded to nucleotides -6473/-6450 and -6076/-6099, -3079/-3056 and -2802/-2825 within the CPT-Ialpha promoter as well as +200/+220 and +750/+730 within intron 1. The promoter primers -3079/-3056 and -2802/-2825 encompassed the CPT-Ialpha TRE, which is located at nucleotides -2938/-2923. Antibodies to the TR, C/EBPalpha , and C/EBPbeta immunoprecipitated sequences in the promoter and intron 1 (Fig. 8). IgG failed to pull down promoter or intron sequence. The -6473/-6450 and -6076/-6099 primers, which were our upstream controls, produced no PCR product in our experiments. Our results show that TR and C/EBP interact with sequences within intron 1 of the CPT-Ialpha gene and the promoter at the TRE region.


View larger version (32K):
[in this window]
[in a new window]
 
Fig. 8.   Binding of TR and C/EBP to the CPT-Ialpha gene. Chromatin immunoprecipitation assays were conducted in formaldehyde cross-linked hepatocytes as described under "Experimental Procedures." A model of the gene and location of the primer sets is shown at the top of the figure. Immunoprecipitations were conducted using antibodies that recognize C/EBPalpha , C/EBPbeta , and TR. Immunoprecipitations with IgG were used as controls. Immunoprecipitated proteins were incubated with protein A-Sepharose. Precipitated ChIP products were used in PCR reactions. Input lanes contain PCR products from reactions using total cross-linked DNA and protein as a template along with specific primer sets. PCR products were resolved on ethidium bromide-stained 3% NuSeive-agarose gels. Sequences of PCR primers are listed under "Experimental Procedures." Experiments were performed three times with identical results.

Regulation of CPT-Ialpha -Luciferase Genes in Transgenic Mice-- To test whether the CPT-Ialpha intron was important for the T3 response in vivo, we created transgenic mice that expressed either the -6839/+1240 or -6839/+19 CPT-Ialpha -Luc transgenes. We initially characterized five independent transgenic lines with the 6839/+1240 CPT-Ialpha -Luc transgenes and two lines with the -6839/+19 CPT-Ialpha -Luc transgenes for liver-specific expression of luciferase (data not shown). From the initial seven transgenic lines, we tested two independent transgenic mouse lines expressing each luciferase reporter gene for the present studies. Several important observations were made regarding the regulation of the CPT-Ialpha gene using these mice. First, the expression of the -6839/+1240 CPT-Ialpha -Luc gene is at least 100-fold higher than the expression of -6839/+19 CPT-Ialpha -Luc transgenes that do not contain the intron. The basal expression of lines one and two were 2.1 ± 0.3 and 1.1 ± 0.7 units/mg protein, whereas lines three and four expressed 0.02 ± 0.02 and 0.01 ± 0.1 units/mg protein, respectively (Fig. 9). These data suggest that the intron is important for the basal expression of the gene in the liver. Also, the expression of the -6839/+1240 CPT-Ialpha -Luc gene is much greater in the liver than in the heart (data not shown). Second, both of the lines expressing CPT-Ialpha -Luc genes containing the intron responded to T3. Line one was induced 3-fold, whereas line two was increased 9-fold (Fig. 9). However, the expression of the -6839/+19 gene was so low in lines 3 and 4 that the extent of the T3 induction was difficult to evaluate. These data are consistent with the concept that sequences within the intron are vital for hepatic expression of the CPT-Ialpha gene in vivo.


View larger version (10K):
[in this window]
[in a new window]
 
Fig. 9.   CPT-Ialpha -luciferase genes are stimulated by T3 in the livers of transgenic mice. Transgenic mice containing either the -6839/+1240 (lines 1 and 2) or -6839/+19 (lines 3 and 4) CPT-Ialpha -Luc genes were injected with 0.33 mg/Kg body weight T3 for 2 days. The mouse livers were harvested and the luciferase activity assessed. The data are expressed as luciferase activity corrected for protein content ± S.E. Each data point represents 4 to 6 euthyroid and 4 to 6 T3-treated mice. Each transgenic line is shown independently. On the right panel, mouse lines 3 and 4 are shown on a different scale.


    DISCUSSION
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
Results
DISCUSSION
REFERENCES

In this study, we have examined the mechanisms by which T3 induces the CPT-Ialpha gene. We show that the first intron is required for the basal expression and T3 induction of CPT-Ialpha in the liver. We determined that the CPT-Ialpha gene contains a T3 response unit consisting of a TRE at nucleotides -2938/-2923 in the promoter, USF binding sites at +659/+664 and +724/+729, and a C/EBP binding site at 677/+689. Each of these binding sites is independently required to obtain a full T3 response. The importance of accessory factors in the hormonal regulation of gene expression is becoming increasingly apparent (21). Accessory factors may contribute to the control of gene expression by modulating the actions of liganded receptors, recruiting coactivators to the promoter, and in the case of the CPT-Ialpha gene enhancing the T3 induction of CPT-Ialpha in the liver.

The first component of the T3 response unit is the CPT-Ialpha -TRE. We have found that this TRE contains a DR4 motif which binds purified TR-RXR heterodimers (11). In the current studies, we have used the ChIP assay to show that TRbeta is associated with the CPT-Ialpha gene in vivo. Utilizing the ChIP assay, Fondell and coworkers have demonstrated that the TR is associated with the TREs of genes in the presence and absence of T3 (22). The addition of ligand leads to association of coactivators with the TR (22). The CPT-Ialpha -TRE is contained within a DNase I hypersensitive site in the CPT-Ialpha promoter, indicating that the TRE is in a transcriptionally active region (23). Louet and et al. (23) identified a CREB binding site immediately adjacent to the TRE. In addition, there is a DR1 element located within 100 base pairs of the TRE that binds both peroxisomal proliferator-activated receptor alpha  and HNF-4 (23, 24). Also, they identified a C/EBP binding site within the hypersensitive region (24). In the liver, the TRbeta is more highly expressed than TRalpha (25). To determine whether the TRbeta was more effective than TRalpha in mediating a T3 induction, we cotransfected CPT-Ialpha -Luc with expression vectors for both TRalpha and TRbeta . Both TR isoforms induced CPT-Ialpha -Luc to a similar extent, indicating that the greater induction of CPT-Ialpha by T3 in the liver than in the heart is not due to the preponderance of the TRbeta isoform (data not shown).

The second component of the CPT-Ialpha T3 response unit is C/EBP. Two isoforms of C/EBP (alpha  and beta ) are expressed in a variety of tissues including liver, lung, adipose, and intestine (26, 27). C/EBPalpha is not expressed in the heart, and C/EBPbeta is expressed only at low levels (26). Both C/EBP isoforms contribute to the regulation of gene expression by a variety of hormones including T3, glucocorticoids, cAMP, and insulin (16, 21, 28, 29). Previously, we have found that both C/EBPalpha and -beta participate in the T3 induction of the PEPCK gene (16). It has been shown that C/EBPalpha is important for the T3 induction of malic enzyme (30). These results raise the possibility that C/EBP proteins are accessory factors for multiple hepatic genes that are stimulated by T3. T3 induces C/EBPalpha gene expression, and there is a TRE in the promoter of the C/EBPalpha gene (31). C/EBP is essential for the tissue-selective induction of CPT-Ialpha in the liver. However, we believe that T3 stimulates CPT-Ialpha in association with C/EBP proteins that are already bound to the intron of the CPT-Ialpha gene.

C/EBP proteins have a crucial role in the regulation of gluconeogenesis. C/EBPalpha null mice die at birth from hypoglycemia and other complications (32). The C/EBPbeta null mice have a complicated phenotype in which 50% die shortly after birth and the remaining mice survive to adulthood (33). Our data indicates that C/EBP proteins regulate some aspects of CPT-Ialpha gene expression and suggest that as in gluconeogenesis C/EBPs may contribute to the regulation of hepatic ketogenesis because CPT-Ialpha is a rate-controlling step in this process.

The third component of the CPT-Ialpha T3 response unit is USF-1 and USF-2. These factors are expressed ubiquitously (35). F. B. Hillgartner and associates (34) reported that COUP-TF and E-box-binding proteins enhance the T3 responsiveness of the malic enzyme gene in avian hepatocytes. However, the authors did not find that USF proteins were binding to the E-box in the malic enzyme gene. Previous groups have identified USF as an important component of glucose response complexes in the L-type pyruvate kinase (PK) gene and the glucagon receptor gene, although others have reported that carbohydrate response element-binding protein rather than USF-1 is important in the glucose stimulation of gene expression (35, 36, 37). USF-1 and USF-2 have also been shown to participate in the regulation of the fatty acid synthase and acetyl-CoA carboxylase-alpha genes by insulin (38). To our knowledge, our studies are the first indicating that USF proteins are involved in T3 responsiveness.

Although our analysis of the CPT-Ialpha gene indicates that C/EBP and USF factors are involved in T3 induction, other factors can serve as accessory factors in the stimulation of gene expression by T3. The sterol regulatory element-binding protein-1 (SREBP-1C) interacts with the TR to enhance acetyl-CoA carboxylase (ACC-I) transcription in hepatocytes (14). Furthermore, the homeodomain proteins, PBX and MEIS1, are accessory factors that enhance T3 induction of malic enzyme gene expression in hepatocytes (39). In the liver, NF-Y binds near the start site of transcription and is required for the stimulation of S14 gene transcription (40). The S14 TREs are located far upstream between nucleotides -2700 and -2500 (41). In the heart, myocyte-specific enhancer factor 2 (MEF2) contributes to the T3 induction of the alpha -cardiac myosin heavy chain (alpha -MHC) gene (42). The induction of human placental lactogen B (hCS-B) and rGH genes by T3 is dependent on the pituitary factor, Pit-1 (43, 44). Accessory factors function in a gene- and tissue-specific manner to modulate hormone responses.

A unique aspect of the CPT-Ialpha gene is that the accessory factors are located in the first intron, whereas the hormone response element is located in the promoter. One question raised by our studies is how the accessory factors located 3,600 base pairs from the TR bound to the TRE cooperate in the T3 induction. In these studies, we have demonstrated that the TRalpha can physically interact with USF-1 and USF-2 as well as with C/EBPalpha through the DNA binding domain of TR. We also show by ChIP assay that TR interacts with sequences within intron 1, which suggests that the DNA loops so that the TR can interact with USF and C/EBP in the intron. Previously, we have ligated a Gal4 site in front of several C/EBP binding sites. The inclusion of C/EBP binding sites enhanced the induction by T3 and a Gal4-TRbeta protein that does not have the TR DNA binding domain (16). However, these observations do not rule out direct physical interactions between the TR and C/EBP. We do not know if multiple USF sites can potentiate T3-mediated transcriptional induction out of the context of the CPT-Ialpha gene.

It is possible that coactivator proteins are involved in the interactions between the accessory factors and the TRbeta . Recent studies have shown that there is a sequential order of coactivator recruitment to the liganded TR (21). First SRC-1 and CBP/p300 are recruited to the liganded receptor followed by the recruitment of the TRAP/mediator complex. The accessory factors may help to recruit or stabilize the coactivators that are associated with the CPT-Ialpha gene. C/EBPbeta interacts with p300 through its amino terminus and the E1A binding region of p300 (45). We have found that overexpression of CBP, the functional homologue of p300, modestly increases the basal expression of the CPT-Ialpha gene (data not shown). We have recently reported that CBP enhances the T3 induction of the PEPCK gene (16). In addition, we have observed weak physical interactions between C/EBPalpha and CBP, although these interactions might be stabilized in the context of the CPT-Ialpha gene (16). Furthermore, hepatocyte nuclear factor-4 can interact with SRC-1, so other proteins adjacent to the CPT-Ialpha -TRE as well as those in the intron may assist in the recruitment of coactivators (46).

Our studies have established the necessity of intron 1 in the transcriptional regulation of the CPT-Ialpha gene. The present work has defined a unique regulatory arrangement for thyroid hormone involving cooperation between transcription factors in the intron and promoter. The interaction of TR with sequences in the intron and its ability to physically interact with C/EBP and USF present a novel model for cooperation in gene induction between nuclear receptors and accessory factors. Coactivators may also participate by providing a physical link between the TR in the promoter and accessory factors in intron 1. Future studies will investigate the role of coactivators in this regulation.

    FOOTNOTES

* This work was supported by grants from the Juvenile Diabetes Research Foundation (to E. A. P.) and the American Heart Association (to E. A. P.) and by National Institutes of Health Grants HL66924 (to G. A. C.) and RR02599 (to P. A. W.).The costs of publication of this article were defrayed in part by the payment of page charges. The article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§ Supported by a National Institutes of Health training grant.

** To whom correspondence should be addressed: Dept. of Pharmacology, University of Tennessee, College of Medicine, 874 Union Ave., Memphis, TN 38163. Tel.: 901-448-4779; Fax: 901-448-7206; E-mail: epark@utmem.edu.

Published, JBC Papers in Press, December 19, 2002, DOI 10.1074/jbc.M211062200

    ABBREVIATIONS

The abbreviations used are: T3, thyroid hormone; TR, thyroid hormone receptor; TRbeta , beta isoform of T3 receptor; TRE, thyroid hormone response element; RXR, retinoid X receptor; GST, glutathione S-transferase; COUP-TF, chicken ovalbumin upstream promoter transcription factor; CPT, carnitine palmitoyltransferase; CPT-I, mitochondrial outer membrane CPT; CPT-II, mitochondrial inner membrane CPT; CPT-Ialpha , liver isoform of CPT-I; DR, direct repeat; C/EBP, CCAAT enhancer binding protein; USF, upstream stimulatory factor; CREB, cAMP-response element-binding protein; luc, luciferase; DMEM, Dulbecco's modified Eagle's medium; ChIP, chromatin immunoprecipitation; PEPCK, phosphoenolpyruvate carboxykinase.

    REFERENCES
TOP
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
Results
DISCUSSION
REFERENCES

1. Heimberg, M., Olubadewo, J. O., and Wilcox, H. G. (1985) Endocr. Rev. 6, 590-607[Abstract/Free Full Text]
2. Mangelsdorf, D. J., and Evans, R. M. (1995) Cell 83, 841-850[CrossRef][Medline] [Order article via Infotrieve]
3. Zhang, J., and Lazar, M. A. (2000) Annu. Rev. Physiol. 62, 439-466[CrossRef][Medline] [Order article via Infotrieve]
4. McGarry, J. D., and Evans, N. F. (1997) Eur. J. Biochem. 244, 1-14[Medline] [Order article via Infotrieve]
5. Indiveri, C., Iacobazzi, V., Giangregorio, N., and Palmier, F. (1997) Biochem. J. 321, 713-719
6. Mynatt, R. L., Park, E. A., Thorngate, F. E., Das, H. K., and Cook, G. A. (1994) Biochem. Biophys. Res. Comm. 201, 932-937[CrossRef][Medline] [Order article via Infotrieve]
7. Park, E. A., Mynatt, R. L., Cook, G. A., and Kashfi, K. (1995) Biochem. J. 310, 853-858
8. Cook, G. A., Edwards, T. L., Jansen, M. S., Bahouth, S. W., Wilcox, H., and Park, E. A. (2001) J. Mol. Cell. Cardiol. 33, 317-329[CrossRef][Medline] [Order article via Infotrieve]
9. Park, E. A., Steffen, M. L., Song, S., Park, V. M., and Cook, G. A. (1998) Biochem. J. 329, 217-224
10. Steffen, M. L., Harrison, W. R., Elder, F. F., Cook, G. A., and Park, E. A. (1999) Biochem. J. 340, 425-432
11. Jansen, M. S., Cook, G. A., Song, S., and Park, E. A. (2000) J. Biol. Chem. 275, 34989-34997[Abstract/Free Full Text]
12. Barrero, M. J., Marrero, P. F., and Haro, D. (2000) Biochem. Biophys. Res. Comm. 279, 81-88[CrossRef][Medline] [Order article via Infotrieve]
13. Gorski, K., Carneiro, M., and Schibler, U. (1986) Cell 47, 767-776[CrossRef][Medline] [Order article via Infotrieve]
14. Yin, L., Zhang, Y., and Hillgartner, F. B. (2002) J. Biol. Chem. 277, 19554-19565[Abstract/Free Full Text]
15. Deng, X., Cagen, L. M., Wilcox, H. G., Park, E. A., Raghow, R., and Elam, M. B. Biochem. Biophys. Res. Comm. 290, 256-262
16. Jurado, L. A., Song, S., Roesler, W. M., and Park, E. A. (2002) J. Biol. Chem. 277, 27606-27612[Abstract/Free Full Text]
17. Disch, D. L., Rader, T. A., Cresci, S., Leone, T. C., Barger, P. M., Vega, R., Wood, P. A., and Kelly, D. P. (1996) Mol. Cell. Biol. 16, 4043-4051[Abstract]
18. Polites, H. G., and Pinkert, C. A. (1993) in Transgenic Animal Technology: A Laboratory Handbook. (Pinkert, C. A., ed) , pp. 15-68, Academic Press, San Diego
19. Vaulont, S., and Kahn, A. (1994) FASEB J. 8, 28-35[Abstract]
20. Baniahmad, A., Ha, I., Reinberg, D., Tsai, S., and Tsai, M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 8832-8836[Abstract/Free Full Text]
21. Roesler, W. J. (2001) Annu. Rev. Nutr. 21, 141-165[CrossRef][Medline] [Order article via Infotrieve]
22. Sharma, D., and Fondell, J. D. (2000) Mol. Endocrinol. 14, 2001-2009[Abstract/Free Full Text]
23. Louet, J., Hayhurst, G., Gonzalez, F. J., Girard, J., and Decaux, J. (2002) J. Biol. Chem. 277, 37991-38000[Abstract/Free Full Text]
24. Louet, J. F., Chatelain, F., Decaux, J. F., Park, E. A., Kohl, C., Pineau, T., Girard, J., and Pegorier, J. P. (2001) Biochem. J. 354, 189-197[CrossRef][Medline] [Order article via Infotrieve]
25. Rodd, C., Schwartz, H. L., Strait, K. A., and Oppenheimer, J. H. (1992) Endocrinology 131, 2559-2564[Abstract/Free Full Text]
26. Cao, Z., Umek, R. M., and McKnight, S. L. (1991) Genes Dev. 5, 1538-1552[Abstract/Free Full Text]
27. Lekstrom-Himes, J., and Xanthopoulos, K. G. (1998) J. Biol. Chem. 273, 28545-28548[Abstract/Free Full Text]
28. Tae, H. J., Zhang, S., and Kim, K. H. (1995) J. Biol. Chem. 270, 21487-21494[Abstract/Free Full Text]
29. Yamada, K., Duong, D. T., Scott, D. K., Wang, J. C., and Granner, D. K. (1999) J. Biol. Chem. 274, 5880-5887[Abstract/Free Full Text]
30. Chung, S. S., MacPhee, K. G., and Goodridge, A. G. (1999) Arch. Biochem. Biophys. 364, 30-41[CrossRef][Medline] [Order article via Infotrieve]
31. Menendez-Hurtado, A., Santos, A., and Perez-Castillo, A. (2000) Endocrinology. 141, 4164-4170[Abstract/Free Full Text]
32. Wang, N. D., Finegold, M. J., Bradley, A., Ou, C. N., Abdelsayed, S. V., Wilde, M. D., Taylor, L. R., Wilson, D. R., and Darlington, G. J. (1995) Science 269, 1108-1112[Abstract/Free Full Text]
33. Croniger, C. M., Midward, C., Yang, J., Kawai, Y., Arinze, I. J., Liu, S., Harada-Shiba, M., Chakravarty, K., Friedman, J. E., Poli, V., and Hanson, R. W. (2001) J. Biol. Chem. 276, 629-638[Abstract/Free Full Text]
34. Wang, Y., Zhang, Y., and Hillgartner, F. B. (2002) Biochem. J. 361, 391-400[CrossRef][Medline] [Order article via Infotrieve]
35. Lefrançois-Martinez, A., Martinez, A., Antoine, B., Raymondjean, M., and Kahn, A. (1995) J. Biol. Chem. 270, 2540-2643
36. Portois, L., Tastenoy, M., Violet, B., and Svoboda, M. (2002) Biochim. Biophys. Acta 1574, 175-186[Medline] [Order article via Infotrieve]
37. Sul, H. S., Latasa, M., Moon, Y., and Kim, K. (2000) J. Nutr. 130 Suppl. 2S, 315S-320S[Abstract/Free Full Text]
38. Travers, M., Vallance, A. J., Gourlay, H. T., Gill, C. A., Klein, I., Bottema, C., and Barber, M. C. (2001) Biochem. J. 359, 273-284[CrossRef][Medline] [Order article via Infotrieve]
39. Wang, Y., Yin, L., and Hillgartner, F. B. (2001) J. Biol. Chem. 276, 23838-23848[Abstract/Free Full Text]
40. Jump, D. B., Badin, M. V., and Thelen, A. (1997) J. Biol. Chem. 272, 27778-27786[Abstract/Free Full Text]
41. Liu, H. C., and Towle, H. C. (1994) Mol. Endocrinol. 8, 1021-1037[Abstract/Free Full Text]
42. Lee, Y., Nadal-Ginard, B., Mahdavi, V., and Izumo, S. (1997) Mol. Cell. Biol. 17, 2745-2755[Abstract]
43. Voz, M. L., Peers, B., Weidig, M. J., Jacquemin, P., Belayew, A., and Martial, J. A. (1992) Mol. Cell. Biol. 12, 3991-3997[Abstract/Free Full Text]
44. Schaufele, F., West, B. L., and Baxter, J. D. (1992) Mol. Endocrinol. 6, 656-665[Abstract/Free Full Text]
45. Mink, S., Haenig, B., and Klempnauer, K. (1997) Mol. Cell. Biol. 17, 6609-6617[Abstract]
46. Wang, J. C., Stafford, J. M., and Granner, D. K. (1998) J. Biol. Chem. 273, 30847-30850[Abstract/Free Full Text]


Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.
Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Physiol. Rev.Home page
B. Desvergne, L. Michalik, and W. Wahli
Transcriptional Regulation of Metabolism
Physiol Rev, April 1, 2006; 86(2): 465 - 514.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Prieur, T. Huby, H. Coste, F. G. Schaap, M. J. Chapman, and J. C. Rodriguez
Thyroid Hormone Regulates the Hypotriglyceridemic Gene APOA5
J. Biol. Chem., July 29, 2005; 280(30): 27533 - 27543.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zhang, K. Ma, S. Song, Marshall. B. Elam, G. A. Cook, and E. A. Park
Peroxisomal Proliferator-activated Receptor-{gamma} Coactivator-1{alpha} (PGC-1{alpha}) Enhances the Thyroid Hormone Induction of Carnitine Palmitoyltransferase I (CPT-I{alpha})
J. Biol. Chem., December 24, 2004; 279(52): 53963 - 53971.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
C.-h. Shih, S.-L. Chen, C.-C. Yen, Y.-H. Huang, C.-d. Chen, Y.-S. Lee, and K.-h. Lin
Thyroid Hormone Receptor-Dependent Transcriptional Regulation of Fibrinogen and Coagulation Proteins
Endocrinology, June 1, 2004; 145(6): 2804 - 2814.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow All Versions of this Article:
278/10/7964    most recent
M211062200v1
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jackson-Hayes, L.
Right arrow Articles by Park, E. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jackson-Hayes, L.
Right arrow Articles by Park, E. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement