|
Originally published In Press as doi:10.1074/jbc.M211062200 on December 19, 2002
J. Biol. Chem., Vol. 278, Issue 10, 7964-7972, March 7, 2003
A Thyroid Hormone Response Unit Formed between the Promoter and
First Intron of the Carnitine Palmitoyltransferase-I Gene Mediates
the Liver-specific Induction by Thyroid Hormone*
Loretta
Jackson-Hayes §,
Shulan
Song ,
Eduard N.
Lavrentyev ,
Michelle S.
Jansen ,
F. Bradley
Hillgartner¶,
Liquin
Tian ,
Philip A.
Wood ,
George A.
Cook , and
Edwards A.
Park **
From the Department of Pharmacology, College of
Medicine, University of Tennessee Health Science Center, Memphis,
Tennessee 38163, the ¶ Department of Biochemistry and Molecular
Pharmacology, School of Medicine, West Virginia University,
Morgantown, West Virginia, 26506-9142, and the Department of
Genetics, University of Alabama at Birmingham,
Birmingham, Alabama 35294
Received for publication, October 29, 2002, and in revised form, December 16, 2002
 |
ABSTRACT |
Carnitine palmitoyltransferase-I (CPT-I)
catalyzes the rate-controlling step of fatty acid oxidation. CPT-I
converts long-chain fatty acyl-CoAs to acylcarnitines for translocation
across the mitochondrial membrane. The mRNA levels and enzyme
activity of the liver isoform, CPT-I , are greatly increased in the
liver of hyperthyroid animals. Thyroid hormone (T3) stimulates CPT-I transcription far more robustly in the liver than in non-hepatic tissues. We have shown that the thyroid hormone receptor (TR) binds to
a thyroid hormone response element (TRE) located in the CPT-I
promoter. In addition, elements in the first intron participate in the
T3 induction of CPT-I gene expression, but the CPT-I intron alone
cannot confer a T3 response. We found that deletion of sequences in the
first intron between +653 and +744 decreased the T3 induction of
CPT-I . Upstream stimulatory factor (USF) and CCAAT enhancer binding
proteins (C/EBPs) bind to elements within this region, and these
factors are required for the T3 response. The binding of TR and C/EBP
to the CPT-I gene in vivo was shown by the chromatin
immunoprecipitation assay. We determined that TR can physically
interact with USF-1, USF-2, and C/EBP . Transgenic mice were created
that carry CPT-I -luciferase transgenes with or without the first
intron of the CPT-I gene. In these mouse lines, the first intron is
required for T3 induction as well as high levels of hepatic expression.
Our data indicate that the T3 stimulates CPT-I gene
expression in the liver through a T3 response unit consisting of the
TRE in the promoter and additional factors, C/EBP and USF, bound in the
first intron.
 |
INTRODUCTION |
Thyroid hormone
(T3)1 has profound effects on
various aspects of metabolism and development (1). The effects of
T3 are mediated through the thyroid hormone receptor (TR). TR belongs
to a class of nuclear receptors that includes the retinoic acid
receptor, retinoid X receptor (RXR), vitamin D receptor, and
peroxisomal proliferator-activated receptors (2). TR isoforms, TR
and TR , are encoded by two separate genes (3). Generally, TR binds as a heterodimer with RXR and regulates transcription by binding to
thyroid hormone response elements (TREs) located in the promoters of
target genes. The T3 stimulation of gene expression involves the
interaction of TR with other transcription factors bound to the
promoter as well as the recruitment of coactivators such as SRC-1/p160,
CBP/p300, and TRAP220/DRIP205/PBP to the liganded receptor (3).
Carnitine palmitoyltransferase-I (CPT-I) is a rate-controlling enzyme
in the fatty acid oxidation pathway (4). CPT-I, which is located on the
outer mitochondrial membrane, transfers the fatty-acyl moiety from
acyl-CoA to carnitine (5). The acylcarnitine is transported across the
mitochondrial inner membrane by carnitine acylcarnitine translocase and
re-esterified to acyl-CoA by CPT-II (4, 5). Two isoforms of CPT-I have
been identified: the "liver" isoform (CPT-I ) and the
"muscle" isoform (CPT-I ). We have shown that expression of the
CPT-I gene in the liver is elevated in hyperthyroidism,
fasting, and diabetes (6, 7). T3 stimulates fatty acid oxidation in the
liver. T3 up-regulates CPT-I mRNA levels 40-fold in the livers
of hyperthyroid rats compared with hypothyroid rats (6). This increase
in mRNA is accompanied by an elevation of CPT-I enzyme activity
(6). The -isoform is induced in the hearts of fasted or
diabetic rats. However, CPT-I gene expression is increased far more
in the liver than in the heart of hyperthyroid animals (8).
We have cloned and characterized the promoter of the CPT-I gene (9,
10). The transcriptional start site of the CPT-I gene is denoted +1,
and the 5'-flanking DNA has been analyzed to nucleotide 6839. Exon 1 contains nucleotides +1 through +27, and exon 2 begins at nucleotide
+1201. The CPT-I TRE consists of a direct repeat separated by four
nucleotides (DR4) (11). The TRE is located in the promoter of the
CPT-I gene between nucleotides 2938 and 2923. Mutation of this
DR4 motif results in the complete loss of T3 responsiveness (11, 12).
Interestingly, the first intron of the CPT-I gene is also necessary
for full T3 induction (11). Removal of the first intron reduces the T3 induction by 80%. Induction of CPT-I -luciferase by T3 is more robust in HepG2 hepatoma cells compared with L6 myoblasts and cardiac
myocytes. The first intron is required for the induction in transfected
HepG2 hepatoma cells and not in L6 myoblasts and cardiac myocytes,
suggesting that the intron contributes to the enhanced T3 induction in
the liver (11). The goal of the present study was to examine more
extensively the role of the first intron in liver-specific T3 induction
of CPT-I . We identified regions within the first intron that are
necessary to achieve the full T3 induction. Elements within these
regions bind proteins that participate in the T3 response, including
CCAAT enhancer-binding proteins (C/EBP) and upstream stimulatory factor
(USF-1 and USF-2). TR physically interacts with USF-1, USF-2, and
C/EBP . Our data suggest that C/EBP is responsible for the
liver-specific component of the induction of CPT-I by thyroid
hormone. Our findings show that the TR in the promoter and C/EBP and
USF bound in the first intron comprise a T3 response unit that mediates
the liver-selective T3 induction of CPT-I .
 |
EXPERIMENTAL PROCEDURES |
Electrophoretic Mobility Shift Assays--
CPT-I probes for
electrophoretic mobility shift assays were created by labeling
double-stranded oligonucleotides using Klenow enzyme and
[ -32P]dCTP. The oligonucleotides contained sequences
from the first intron and XbaI or MluI
overhangs. Double-stranded unlabeled wild-type and mutant
oligonucleotides were used as competitors (See Table I for oligomer
sequences). Rat liver nuclear extract was prepared as described (13).
The protein-DNA binding mixtures contained labeled probe (30,000 cpm)
and proteins isolated from rat liver nuclei in 80 mM KCl,
25 mM Tris-HCl (pH 7.4), 0.1 mM EDTA, 1 mM dithiothreitol, and 10% glycerol (11).
Poly(deoxyinosine-deoxycytidine) (double-stranded homopolymer)
was added to each binding reaction as a nonspecific competitor.
Antibodies for TR / , USF-1, USF-2, Sp1, C/EBP , C/EBP ,
Oct-1, COUP-TF, and CREB (Santa Cruz) were added to binding
reactions for supershift assays. Binding reactions were incubated at
room temperature for 20 min and resolved on 5% non-denaturing
acrylamide gels (80:1, acrylamide/bisacrylamide) in Tris-glycine
running buffer (22 mM Tris and 190 mM glycine). Electrophoresis was carried out at 180 volts for 80 min at 4 °C (11). Sequence analysis of the intron for potential transcription factor binding sites was performed using the TESS transcription factor search.
Construction of Luciferase Vectors--
Regions of the CPT-I
promoter and intron 1 were ligated into the pGL3-basic luciferase
vector (Promega). Construction of 4495/+19 CPT-I -Luc, 4495/+1240
CPT-I -Luc, and Sma 4495/+1240 has been described previously
(11). Internal deletions within intron 1 were constructed by digesting
1653/+1240-Luc at +199 and +707 with SmaI, followed by
ligation of PCR products that contained a SmaI restriction
site at each end and decreasing lengths of intron 1 sequence. The
forward primer corresponded to nucleotides 16/+6
(TCGGACTCAGCTCGCTCATTCCG). The reverse primers corresponded to
nucleotides +282/+309 (5'-CACCCGGGGTTTTGGGGTCCTCATTACC-3'), +431/+459
(5'-CTTTTCCCGGGTCTTTCCATTCGCCATCC-3'), +680/+655
(5'-CAGTCCCGGGACACCCACCTGGCC-3'), and +700/+677
(5'-GGTCCCGGGGCGACCTTGAGCAG-3'). PCR products were ligated into
pCR-4-TOPO cloning vector (Invitrogen). PCR products were removed from
pCR-4-TOPO by digestion with SmaI. The CPT-I intron
fragments were gel-purified and ligated into the SmaI sites within intron 1 in the 1653/+1240 CPT-I -luciferase vector. These deletion constructs and 4495/+1240 CPT-I -luciferase were digested with EcoRI and BglII, which cleaves at 1653 and
at the 3'-end of CPT-I in the multicloning site of the luciferase
vectors. Finally, the 1653/+1240 fragment containing a deletion was
ligated into the EcoRI and BglII sites within
4495/+1240 CPT-I -luciferase.
Serial deletions from the 3'-end of intron 1 were constructed by
digesting 4495/+1240 CPT-I -luciferase with MluI, which cuts at +130 and +1066, and BglII, which digests at the
3'-end of CPT-I in the multicloning site of the luciferase vectors. CPT-I intron fragments were made by PCR amplification using primers that correspond to regions within intron 1. The forward primer corresponded to nucleotides 16/+6 (TCGGACTCAGCTCGCTCATTCCG). The
reverse primers contained BglII restriction sites and
corresponded to nucleotides +1076/+1052
(5'-CTAAATACGAGATCTAAAAAGCTTC-3'), +1012/+990
(5'-GCAGTTTTCGACTAAAATCTGTC-3'), +864/+839
(5'-CGTGAGCATAGATCTGTGTTCTGTG-3'), and +803/+778
(5'-GGCTGTTAGGGCAGATCTGGGCTGC-3'). Each PCR reaction contained 1.0 mM MgCl2, 200 µM dNTPs, 1 µg of
forward and reverse primers, 2.5 units of Amplitaq GoldTM
polymerase (Roche Molecular Biochemicals), and 10 ng of
1653/+1240 CPT-I -luciferase template. PCR reactions were conducted
in a Thermo Cycler 2400 (PerkinElmer Life Sciences). PCR products were digested with MluI and BglII and ligated into the
MluI site at +130 in CPT-I and BglII at the
3'-end of CPT-I in the pGL3-basic luciferase multicloning site.
Gal4-SV40-luciferase vectors were constructed by digesting
Gal4-SV40-luciferase vector and 1653/+1240 CPT-I -luciferase with SmaI (+707) and MluI (+1066). The +707/+1066
fragment was ligated into the SmaI and MluI sites
within Gal4-SV40-luciferase. Site-directed mutations of protein binding
sites were created within the 4495/+1240 CPT-I -luciferase vector
using the QuikChange site-directed mutagenesis kit (Stratagene).
Protein binding sites were mutated to NheI restriction enzyme sites for identification of mutated clones. The forward and
reverse primers used in mutagenesis reactions corresponded to
nucleotides +642/+683
(5'-GCCCGAGGTTCAAGGGCGCTAGCGGTGTCCAGAGACTTGCTC-3'), +656/+700
(5'-GGCCAGGTGGGTGTCCAGAGAGCTAGCCAAGGTCGCGCTGGGACC-3'), +659/+704 (5'-CAGGTGGGTGTCCAGAGACTTGCTGCTAGCCGCGCTGGGACCAGAG-3') and
+710/+750 (5'-GAGGGTGGGGGTGTGCTAGCACCCGGCCTGAGTGAACTTGG-3'). Mutagenesis reactions were conducted using the +130/+1066 Gal4 SV40
vector as a template (11). After introduction of mutations into the
+130/+1066 Gal4-SV40-luciferase vector, mutated vectors as well as the
4495/+1240 CPT-I -luciferase vector were digested with
MluI, which digests the CPT-I gene at nucleotides +130
and +1066. The mutated +130/+1066 fragments were ligated into the +130
and +1066 sites within the 4495/+1240 CPT-I -luciferase vector. All
mutations and deletions were confirmed by sequence analysis.
Transient Transfection of Luciferase
Vectors--
CPT-I -luciferase constructs were transiently
transfected into HepG2 cells by the calcium phosphate method (9).
Transfections included 3 µg of CPT-I -luciferase vectors along with
RSV-TR and TK-renilla vectors. Cells were transfected in Dulbecco's
modified Eagle's medium (DMEM) containing 5% calf serum/5% fetal
calf serum and incubated overnight at 37 °C. Following two washes
with phosphate-buffered saline, the medium was replaced by DMEM
containing no serum. Cells were treated with 100 nM T3 for
24 h. After T3 treatment, cells were washed twice with
phosphate-buffered saline and lysed in passive lysis buffer (Promega).
Cell lysates were frozen and thawed to facilitate cell lysis.
Luciferase assays were conducted on extracts from cells in serum-free
media and cells treated with T3. Both luciferase and renilla
activity was measured. Protein content in each lysate was determined by
Bio-Rad protein assay (Bio-Rad). Luciferase activity was corrected for
both protein content and renilla activity to account for cell density
and transfection efficiency, respectively. Data are expressed as -fold
induction of luciferase in cells exposed to T3 as compared with cells
that received no hormone (Fig. 3) or relative induction of luciferase in mutant construct as compared with the induction of wild-type 4495/+1240 CPT-I -luciferase (Figs. 1, 4, and 6).
GST-pull-down assays GST and GST·C/EBP were
prepared as described by Yin et al. (14).
35S-labeled chicken TR and human RXR were expressed
using TNT reticulocyte lysates (Promega). GST-pull down assays were
conducted as described (14). Bound proteins were eluted and resolved by SDS-PAGE and visualized by storage phosphor autoradiography.
GST·TR fusion protein was expressed in Escherichia coli
BL21(DE3) (Novagen) and purified using glutathione-Sepharose (Amersham
Biosciences) according to the manufacturer's protocol (14).
35S-labeled USF-1 and USF-2 were expressed using
PROTEINscript II reticulocyte lysates (Ambion). Bound proteins were
eluted with 2.5 mM glutathione and resolved by
SDS-PAGE.
Chromatin Immunoprecipitation Assays--
Rat
hepatocytes were prepared as described previously (15). Chromatin
immunoprecipitation assays were conducted with minor modification as
described by Jurado et al. (16). PCR reactions were
conducted in the iCycler (Bio-Rad) using ThermolAce DNA polymerase (Invitrogen), 1 µl of template, and 1 µg of each primer. The
primers used for PCR corresponded to nucleotides 6473/ 6450
(5'-CTCTGGTGTCCTGTAACCTGTGG-3'), 6076/ 6099
(5'-GAAGGCTGGAATTACACTGGTCAG-3'), 3079/ 3056
(5'-GACAGGCAGGGTACATTTCACAG-3'), 2802/ 2825
(5'-GAAGGCA- GTGCTTTTCCCTAC-3'), +200/+220
(5'-GACGGGAGGAAAGATGCTTG-3'), and +750/+730
(5'-CCAAGTTCACTCAGGCCGGGTC). Cycling conditions were 95 °C for
3 min, followed by 25 cycles at 95 °C for 30 s, 60 °C for
30 s, and 74 °C for 1 min, followed by one final extension for
10 min at 74 °C. PCR products were resolved on ethidium
bromide-stained 3% NuSeive-agarose gel.
Production and Characterization of CPT-I -Luc Transgenic Mouse
Lines--
Restriction fragments containing 6938/+1240 or 6839/+19
CPT-I -Luc genes were isolated and injected into the pronuclei of one-cell C57BL/6J × SJL/JF2 hybrid (B6/SJL) mouse zygotes to
produce transgenic mice (17, 18). The founders were bred with B6/SJL mates to obtain a second generation of transgenics. Mice containing the
luciferase gene constructs were identified by Southern analysis of
genomic DNA obtained from the tail (17). Two transgenic mouse lines of
each CPT-I gene construct were selected for use in the T3
experiments based on initial characterization for transgene expression
(data not shown). Mice were injected with 0.33 mg/Kg body weight of
triiodothyronine (T3) 24 and 48 h prior to sacrifice (6). The mice
were sacrificed, and pieces of the liver and heart were homogenized in
luciferase assay buffer (Promega). Luciferase assays and protein
determinations were conducted as described above.
 |
Results |
Identification of Regions within the +199/+707 Region of
the First Intron Required for the Full T3 Response--
Fig.
1 illustrates the 4495/+1240
CPT-I -luciferase vector containing 4495 base pairs of the promoter,
exon 1, intron 1, and a segment of exon 2. Deletion of nucleotides
between +199/+707 in the first intron reduced the T3 induction of
CPT-I by 50% (Fig. 1). To define smaller regions in the intron that
contribute to the T3 stimulation, additional internal deletions were
made in the context of the 4495/+1240 CPT-I -Luc vector. Removal of the +515/+707 region decreased the T3 response ~50%, as did deletion of the 80-base pair +628/+707 region (Fig. 1). Deletion of the +628/+707 region did not alter the basal expression of the CPT-I -Luc vector (data not shown). These data indicate that sequences within the
+628/+707 region are required for a full response to T3.

View larger version (15K):
[in this window]
[in a new window]
|
Fig. 1.
Localization of regions within the first
intron that enhance T3 responsiveness. HepG2 cells were
transiently transfected with 3 µg of 4495/+1240 CPT-I -Luc
constructs, 1 µg of RSV-TR , and 1 µg of TK-renilla. The deleted
sequences in the first intron are indicated by the symbol ( ). For
hormone treatment, cells were incubated either in serum-free DMEM or
DMEM containing 100 nM T3 for 24 h. All transfections
were performed in duplicate and repeated four to six times. Luciferase
and renilla assays were performed in the same tube. Luciferase activity
was corrected for both protein content and renilla activity. Results
are expressed as the relative induction by T3 ± S.E. by comparing
the T3 induction of vectors with deletions to the wild type vector,
which was assigned a value of one. *, p < 0.05 versus full-length 4495/+1240 CPT-I -luciferase.
|
|
Binding of Transcription Factors to the +628/+707 Region
of the Intron--
Our next studies focused on the +628/+707 region of
the first intron. Electrophoretic mobility shift assays were conducted using double-stranded oligonucleotides that corresponded to nucleotides +628/+655, +653/+682, and +674/+707 in the CPT-I gene. Only the +653/+683 and +674/+707 regions bound proteins isolated from rat liver
nuclei (Fig. 2, A and
B). A consensus E-box motif (CANNTG) was found at
nucleotides +659/+664. The E-box motif binds a family of proteins that
contain helix-loop-helix and leucine zipper dimerization domains,
including c-Myc, sterol regulatory element binding protein (SREBP), and
upstream stimulatory factor (19). Supershift assays were conducted
using antibodies that recognize Sp1, C/EBP , Oct-1, USF-1, and
USF-2. Protein binding to the +653/+682 region was completely
disrupted by USF-1 and USF-2 antibodies, whereas the other antibodies
did not alter the binding of nuclear proteins (Fig. 2A).
Western blot analysis confirmed that USF-1 and USF-2 are present in
RLNE as well as in HepG2 cells, which was the cell type used in
transient transfection experiments (data not shown). Competition
analysis revealed that a 100-fold excess of unlabeled wild type
+653/+682 oligomer completely competed for nuclear protein binding to
the labeled probe, whereas an oligomer that contained a mutation in the
E-box motif (Table I, Mut. #1)
was unable to compete for protein binding (Fig. 2A).
However, competition with unlabeled oligomer that contained a mutation
3' to the E-box (Mut. #2) reduced protein binding as
effectively as the wild type oligomer. Our data show that USF-1 and
USF-2 bind within intron 1 of CPT-I at the E-box motif located at
+659/+664.

View larger version (54K):
[in this window]
[in a new window]
|
Fig. 2.
C/EBP and USF bind in the +653/+707
region. A and B, double-stranded
oligonucleotides were constructed that encompassed the +653/+683 and
+674/+707 regions of the intron. In the upper panels, the
32P-radiolabeled double-stranded oligomers were incubated
with rat liver nuclear extract (RLNE) and the antibodies
(Ab) indicated. Electrophoretic mobility shift assays were
conducted as described under "Experimental Procedures." In the
lower panels, competition assays were conducted using
double-stranded unlabeled wild type (WT) and mutant (#)
oligomers. A 100-fold excess of the competitor oligomers was added to
the competition assays. The oligonucleotide sequences are given in
Table I.
|
|
View this table:
[in this window]
[in a new window]
|
Table I
Oligomers used in electrophoretic mobility shift assays
Oligomers corresponding to sequences within the +628/+707 region were
constructed as listed for electromobility shift assays. XbaI
restriction enzyme sites were introduced to provide for labeling with
32P and Klenow enzyme. Specific mutations are bold face.
Oligomers corresponding to the +701/+744 and the +824/+842 regions were
designed with XbaI and MluI restriction enzyme
sites, respectively, to provide for labeling with 32P and
Klenow enzyme.
|
|
Gel shift mobility assays were conducted with an oligomer representing
the +674/+707 region. Several complexes were formed indicating that
either multiple proteins or a family of proteins bind at this site
(Fig. 2B). We analyzed the binding of nuclear factors to
this site by the addition of antibodies to the gel shift assays.
Antibodies to C/EBP and C/EBP disrupted the binding of nuclear
factors (Fig. 2B). COUP-TF and TR antibodies did not alter
protein binding. The +677/+689 region contains an AGGTCA-like motif
that might interact with nuclear receptors. However, antibodies to
hepatocyte nuclear factor-4, RXR, and peroximal
proliferator-activated receptor did not alter the binding of
nuclear proteins (data not shown). Our results indicated that C/EBP
proteins could bind to this site. Competition analyses were conducted
using unlabeled oligomers that corresponded to the wild type +674/+707
sequence as well as oligomers that contained mutations across the
+674/+707 region. A 100-fold excess of wild type oligomer or an
oligomer that contained a mutation in nucleotides +695/+700 (Mut.
#7) competed effectively for protein binding to the labeled
oligomer. However, oligomers that contained mutations in the +677/+682
(Mut. #3 and #5) and +684/+689 (Mut.
#4 and #6) sites did not compete for protein binding.
Therefore, we conclude that nucleotides within the +677/+689 element
are necessary for protein binding within the +674/+707 region.
Contribution of the +628/+707 USF and C/EBP
Binding Regions to the T3 Response--
To investigate the importance
of elements within the +628/+707 region, we removed these sites from
the 4495/+1240 CPT-I -luciferase vector by making +680/+707 and
+653/+707 deletions within the intron. These vectors were
transiently transfected into HepG2 cells along with RSV-TR . Deletion
of the +680/+707 and the +653/+707 regions caused a 35% reduction in
the T3 induction (Fig. 3), which was
identical to the +628/+707 vector in this set of experiments (data
not shown). These data demonstrated that the elements contributing to
the T3 response are located in the +680/+707 region.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 3.
C/EBP and USF binding sites participate in
the T3 induction. HepG2 cells were transiently transfected with 3 µg of CPT-I -Luc vector, 1 µg of RSV-TR , and 1 µg of
TK-renilla. The 4495/+1240 CPT-I -luciferase vectors contained
deletions in the intron. Cells were treated for 24 h with 100 nM T3 and luciferase assays performed as described in Fig.
1. Experiments were conducted in duplicate and repeated four to six
times. Results are expressed as-fold induction by T3 ± S.E. by
comparing luciferase activity of untreated cells with that of cells
exposed to hormone. , p < 0.005 versus
full-length 4495/+1240 CPT-I -luciferase.
|
|
Role of the +707/+1066 Region in T3 Induction of
CPT-I --
In addition to the +653/+707 region, sequences between
+707 and +1066 also participated in the T3 induction (Fig.
4). To assess the contribution of the
3'-end of the intron to the T3 induction of CPT-I , serial deletions
were created from the second exon in the 4495/+1240
CPT-I -luciferase vector. These vectors were cotransfected with
RSV-TR into HepG2 cells and tested for T3 responsiveness (Fig. 4).
The full T3 effect was maintained with deletion of nucleotides +803 to
+1240. However, the T3 response decreased upon deletion of the
additional nucleotides between +803 and +707. Deletion of the
+707/+1240 region modestly decreased basal expression of the gene (data
not shown). This stimulation was reduced further upon deletion of the
intron to +199. An internal deletion of the +707/+1066 region also
diminished the T3 response by 40%. These findings show that sequences
between +707 and +803 of intron 1 are involved in the enhancement of T3
induction.

View larger version (13K):
[in this window]
[in a new window]
|
Fig. 4.
The +707/+1240 region contributes to the T3
response. HepG2 cells were transiently transfected with 3 µg of
4495/+1240 CPT-I -Luc or serial deletion constructs, 1 µg of
RSV-TR , and 1 µg of TK-renilla. The ovals represent
elements that were previously identified as transcription factor
binding sites by DNase I footprinting (11). Cells were treated with 100 nM T3 in serum-free DMEM for 24 h before cells were
harvested. Luciferase assays were performed as described in the legend
to Fig. 1. All transfections were conducted at least four times.
Results are expressed as relative induction ± S.E. by comparing
the T3 induction of the vectors containing deletions with the
4495/+1240 CPT-I Luc, which was assigned a value of one. *,
p < 0.05 versus full-length 4495/+1240
CPT-I -luciferase.
|
|
We ligated the +707/+1066 sequences in front of the SV40 promoter
driving the luciferase reporter gene. The reporter vector contained a
Gal4 binding site. The Gal4-SV40-luciferase vectors were transfected
with an expression vector for Gal4-TR in which the DNA binding
domain of the TR was replaced with the DNA binding domain of Gal4
(20). Inclusion of the +707/+1066 region enhanced the T3 response
2.7-fold compared with Gal4-SV40-luciferase (Fig. 5A). Addition of the +707/+810
sequences allowed an additional 6.8-fold induction of the
Gal4-SV40-luciferase vector. These results further demonstrate that
factors binding in the +707/+810 region enhance the T3 induction of
CPT-I .

View larger version (34K):
[in this window]
[in a new window]
|
Fig. 5.
Contribution of the +707/+810 region to the
T3 induction. A, Gal4-SV40-Luc vectors were constructed
that contained the +707/+1066 and the +707/+810 regions of the intron.
HepG2 cells were cotransfected with 3 µg of Gal4-SV40-Luc, 100 ng of
Gal4-TR expression vector, and 1 µg of TK-renilla. Cells were
treated for 24 h with 100 nM T3. Luciferase assays
were conducted as described in the legend to Fig. 1. All transfections
were repeated four times in duplicate. Results are expressed as
relative induction by T3 ± S.E. compared with Gal4-SV40-Luc. *,
p < 0.05 versus full-length. The
Gal4-SV40-Luc was induced 7-fold by T3. B, electrophoretic
mobility shift assays were conducted using 32P-labeled
oligomers that corresponded to the +700/+744 and the +824/+842 regions
of the intron. Oligomers were incubated with proteins isolated from rat
liver nuclei (RLNE). Supershift assays were conducted
using antibodies (Ab) to USF-1, USF-2, C/EBP ,
C/EBP , COUP-TF, and CREB.
|
|
Binding of USF within the +707/+810 Region of the
Intron--
Our next experiments characterized the binding of nuclear
proteins within the +707/+803 region of the first intron. We designed three oligomers that spanned this region of the gene. Using these oligomers in gel shift mobility assays, we found that only the oligomer
corresponding to the +700/+744 region bound proteins from rat liver
nuclear extract (Fig. 5B). This region contains an E-box
element. Antibodies to USF-1 and USF-2 were able to supershift the
binding to this site, indicating that USF proteins can bind to this
element. Competition analysis using a 100-fold excess of unlabeled
wild-type and mutant oligomer that contained an altered USF binding
site at +724/+729 confirmed that this E-box motif is necessary for the
binding of nuclear proteins (data not shown). Previously, we had
identified three sites in the +800/+1066 region that bound nuclear
proteins by DNase footprint analysis (11). The +824/+842 element was
analyzed in gel shift mobility assays. Several factors were able to
bind to this site (Fig. 5B). Addition of antibodies to
C/EBP and - to the binding reaction disrupted the binding of
proteins to this element.
To determine which sites in the +653/+850 region are
important for the T3 induction, we disrupted each by site-directed
mutagenesis. The sites were altered in the context of 4495/+1240
CPT-I -Luc by introducing the mutations that had been shown to
disrupt binding in gel shift mobility assays. Mutation of either USF
binding site and the +677/+689 C/EBP site decreased the T3 induction,
strongly suggesting that these factors contributed to the T3 induction (Fig. 6). Disruption of the +827/+842
C/EBP binding site did not alter the T3 induction, indicating that not
all C/EBP binding sites contribute to the response of the CPT-I gene
to T3. Our data show that USF and C/EBP are accessory factors in the T3
induction of the CPT-I gene.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 6.
Specific elements in intron 1 participate in
the T3 induction. HepG2 cells were transiently transfected with
4495/+1240 CPT-I -Luc vectors that contained mutations in the
protein binding sites located in the +653 to +744 region. The mutated
nucleotides are shown in Table I and are indicated at the top of the
figure. Cells were cotransfected with 3.0 µg of the luciferase
vector, 1 µg of RSV-TR , and 1.0 µg of TK-renilla. For hormone
treatment, cells were incubated for 24 h in serum-free DMEM or
with 100 nM T3. Transfections were performed in duplicate
and repeated four to six times. Data are expressed as relative
induction by T3 of mutant vectors compared with induction of wild-type
4495/+1240 CPT-I -luciferase ± S.E. *, p < 0.05 versus full-length 4495/+1240
CPT-I -luciferase.
|
|
Thyroid Receptor and C/EBP Interact in
Vitro--
Using glutathione S-transferase-linked TR and
C/EBP immobilized on glutathione-conjugated-Sepharose and
35S-labeled USF-1, USF-2, RXR , and TR , we determined
that TR can interact with USF-1, USF-2, and C/EBP (Fig.
7). These interactions occurred in the
presence and absence of ligand (Fig. 7, A and B).
To determine the TR motif through which the physical interaction with
C/EBP occurs, we conducted pull-down assays using truncated 35S-labeled TR proteins and GST·C/EBP . Removal of
the first 50 amino acids had no effect on the interaction between TR
and C/EBP (Fig. 7C). Further deletion of amino acids through
120 completely abolished binding to C/EBP . Isolated polypeptides
corresponding to amino acids 1-118 and 1-157 interacted with
C/EBP . However, removal of the residues 1-50 diminished its ability
to interact with C/EBP . Our results indicate that the interaction
between TR and C/EBP occurs through a region of the TR that
encompasses the DNA binding domain and is independent of T3. We have
also found that TR can interact with C/EBP (data not shown).
Physical interactions between TR and the accessory factors, USF and
C/EBP, may contribute to the T3 induction of the CPT-I gene.

View larger version (47K):
[in this window]
[in a new window]
|
Fig. 7.
TR interacts with USF and C/EBP.
A, pull-down assays were conducted using in
vitro-translated 35S-labeled
(35S) USF-1 and USF-2 and bacterially
expressed glutathione S-transferase (GST) and
GST·TR . GST proteins were immobilized on
glutathione-conjugated-Sepharose beads. Binding reactions were
conducted in the presence (+) or absence ( ) of 100 nM
thyroid hormone (T3). Eluted proteins and 10% of the
radiolabeled USF-1 or USF-2 used in each binding reaction (10%
Input) were resolved by SDS-PAGE and visualized by storage
phosphor autoradiography. B, pull-down assays were also
conducted with 35S-labeled TR or RXR and bacterially
expressed GST and GST·C/EBP fusion protein in the presence (+) or
absence ( ) of 1 µM T3 or 9-cis-retinoic acid.
C, additional pull-down assays were conducted using
truncated forms of 35S-labeled TR that were incubated with
GST and GST·C/EBP proteins immobilized to
glutathione-conjugated-agarose. On the left panel, 10% of
the 35S-TR in the binding reaction is shown. On the
right panel, the 35S-TR pulled down by GST or
GST·C/EBP is shown. Binding reactions were conducted in the
presence or absence of 1 µM T3. Bound proteins were
resolved by SDS-PAGE and visualized by storage phosphor
autoradiography.
|
|
In Vivo Binding of TR and C/EBP to the CPT-I
Gene--
Previously, we showed that TR binds to the CPT-I TRE
in vitro (11). To investigate if such binding occurs
in vivo we conducted chromatin immunoprecipitation (ChIP)
assays. Rat hepatocytes were treated with 1% formaldehyde to
cross-link DNA and proteins. Immunoprecipitations were performed using
an antibody that recognized both the TR and - isoforms as well as
antibodies to C/EBP and C/EBP . IgG was used as a control in these
experiments. PCR reactions were conducted using primer sets that
corresponded to nucleotides 6473/ 6450 and 6076/ 6099,
3079/ 3056 and 2802/ 2825 within the CPT-I promoter as well as
+200/+220 and +750/+730 within intron 1. The promoter primers
3079/ 3056 and 2802/-2825 encompassed the CPT-I TRE, which is
located at nucleotides 2938/ 2923. Antibodies to the TR, C/EBP ,
and C/EBP immunoprecipitated sequences in the promoter and
intron 1 (Fig. 8). IgG failed to pull
down promoter or intron sequence. The 6473/ 6450 and 6076/ 6099
primers, which were our upstream controls, produced no PCR product in
our experiments. Our results show that TR and C/EBP interact with
sequences within intron 1 of the CPT-I gene and the promoter at the
TRE region.

View larger version (32K):
[in this window]
[in a new window]
|
Fig. 8.
Binding of TR and C/EBP to the
CPT-I gene. Chromatin immunoprecipitation
assays were conducted in formaldehyde cross-linked hepatocytes as
described under "Experimental Procedures." A model of the gene and
location of the primer sets is shown at the top of the
figure. Immunoprecipitations were conducted using antibodies that
recognize C/EBP , C/EBP , and TR. Immunoprecipitations with IgG
were used as controls. Immunoprecipitated proteins were incubated with
protein A-Sepharose. Precipitated ChIP products were used in PCR
reactions. Input lanes contain PCR products from reactions
using total cross-linked DNA and protein as a template along with
specific primer sets. PCR products were resolved on ethidium
bromide-stained 3% NuSeive-agarose gels. Sequences of PCR primers are
listed under "Experimental Procedures." Experiments were performed
three times with identical results.
|
|
Regulation of CPT-I -Luciferase Genes in Transgenic Mice--
To
test whether the CPT-I intron was important for the T3 response
in vivo, we created transgenic mice that expressed either the 6839/+1240 or 6839/+19 CPT-I -Luc transgenes. We initially characterized five independent transgenic lines with the 6839/+1240 CPT-I -Luc transgenes and two lines with the 6839/+19 CPT-I -Luc transgenes for liver-specific expression of luciferase (data not shown). From the initial seven transgenic lines, we tested two independent transgenic mouse lines expressing each luciferase reporter
gene for the present studies. Several important observations were made
regarding the regulation of the CPT-I gene using these mice. First,
the expression of the 6839/+1240 CPT-I -Luc gene is at least
100-fold higher than the expression of 6839/+19 CPT-I -Luc transgenes that do not contain the intron. The basal expression of
lines one and two were 2.1 ± 0.3 and 1.1 ± 0.7 units/mg
protein, whereas lines three and four expressed 0.02 ± 0.02 and
0.01 ± 0.1 units/mg protein, respectively (Fig.
9). These data suggest that the intron is
important for the basal expression of the gene in the liver. Also, the
expression of the 6839/+1240 CPT-I -Luc gene is much greater in the
liver than in the heart (data not shown). Second, both of the lines
expressing CPT-I -Luc genes containing the intron responded to T3.
Line one was induced 3-fold, whereas line two was increased 9-fold
(Fig. 9). However, the expression of the 6839/+19 gene was so low in
lines 3 and 4 that the extent of the T3 induction was difficult to
evaluate. These data are consistent with the concept that sequences
within the intron are vital for hepatic expression of the CPT-I gene
in vivo.

View larger version (10K):
[in this window]
[in a new window]
|
Fig. 9.
CPT-I -luciferase
genes are stimulated by T3 in the livers of transgenic mice.
Transgenic mice containing either the 6839/+1240 (lines 1 and 2) or 6839/+19 (lines 3 and 4)
CPT-I -Luc genes were injected with 0.33 mg/Kg body weight T3 for 2 days. The mouse livers were harvested and the luciferase activity
assessed. The data are expressed as luciferase activity corrected for
protein content ± S.E. Each data point represents 4 to 6 euthyroid and 4 to 6 T3-treated mice. Each transgenic line is shown
independently. On the right panel, mouse lines 3 and 4 are
shown on a different scale.
|
|
 |
DISCUSSION |
In this study, we have examined the mechanisms by which T3 induces
the CPT-I gene. We show that the first intron is required for the
basal expression and T3 induction of CPT-I in the liver. We
determined that the CPT-I gene contains a T3 response unit consisting of a TRE at nucleotides 2938/ 2923 in the promoter, USF
binding sites at +659/+664 and +724/+729, and a C/EBP binding site at
677/+689. Each of these binding sites is independently required to
obtain a full T3 response. The importance of accessory factors in the
hormonal regulation of gene expression is becoming increasingly
apparent (21). Accessory factors may contribute to the control of gene
expression by modulating the actions of liganded receptors, recruiting
coactivators to the promoter, and in the case of the CPT-I gene
enhancing the T3 induction of CPT-I in the liver.
The first component of the T3 response unit is the CPT-I -TRE. We
have found that this TRE contains a DR4 motif which binds purified
TR-RXR heterodimers (11). In the current studies, we have used the ChIP
assay to show that TR is associated with the CPT-I gene in
vivo. Utilizing the ChIP assay, Fondell and coworkers have
demonstrated that the TR is associated with the TREs of genes in the
presence and absence of T3 (22). The addition of ligand leads to
association of coactivators with the TR (22). The CPT-I -TRE is
contained within a DNase I hypersensitive site in the CPT-I promoter, indicating that the TRE is in a transcriptionally active region (23). Louet and et al. (23) identified a CREB binding site immediately adjacent to the TRE. In addition, there is a DR1
element located within 100 base pairs of the TRE that binds both
peroxisomal proliferator-activated receptor and HNF-4 (23, 24).
Also, they identified a C/EBP binding site within the hypersensitive region (24). In the liver, the TR is more highly expressed than
TR (25). To determine whether the TR was more effective than
TR in mediating a T3 induction, we cotransfected CPT-I -Luc with
expression vectors for both TR and TR . Both TR isoforms induced
CPT-I -Luc to a similar extent, indicating that the greater induction
of CPT-I by T3 in the liver than in the heart is not due to the
preponderance of the TR isoform (data not shown).
The second component of the CPT-I T3 response unit is C/EBP. Two
isoforms of C/EBP ( and ) are expressed in a variety of tissues
including liver, lung, adipose, and intestine (26, 27). C/EBP is not
expressed in the heart, and C/EBP is expressed only at low levels
(26). Both C/EBP isoforms contribute to the regulation of gene
expression by a variety of hormones including T3, glucocorticoids,
cAMP, and insulin (16, 21, 28, 29). Previously, we have found that both
C/EBP and - participate in the T3 induction of the PEPCK gene
(16). It has been shown that C/EBP is important for the T3 induction
of malic enzyme (30). These results raise the possibility that C/EBP
proteins are accessory factors for multiple hepatic genes that are
stimulated by T3. T3 induces C/EBP gene expression, and
there is a TRE in the promoter of the C/EBP gene (31).
C/EBP is essential for the tissue-selective induction of
CPT-I in the liver. However, we believe that T3 stimulates
CPT-I in association with C/EBP proteins that are already bound to
the intron of the CPT-I gene.
C/EBP proteins have a crucial role in the regulation of
gluconeogenesis. C/EBP null mice die at birth from hypoglycemia and other complications (32). The C/EBP null mice have a complicated phenotype in which 50% die shortly after birth and the remaining mice
survive to adulthood (33). Our data indicates that C/EBP proteins
regulate some aspects of CPT-I gene expression and suggest that as
in gluconeogenesis C/EBPs may contribute to the regulation of hepatic
ketogenesis because CPT-I is a rate-controlling step in this process.
The third component of the CPT-I T3 response unit is USF-1 and
USF-2. These factors are expressed ubiquitously (35). F. B. Hillgartner
and associates (34) reported that COUP-TF and E-box-binding proteins
enhance the T3 responsiveness of the malic enzyme gene in avian
hepatocytes. However, the authors did not find that USF proteins were
binding to the E-box in the malic enzyme gene. Previous groups have
identified USF as an important component of glucose response complexes
in the L-type pyruvate kinase (PK) gene and the glucagon receptor gene,
although others have reported that carbohydrate response
element-binding protein rather than USF-1 is important in the glucose
stimulation of gene expression (35, 36, 37). USF-1 and USF-2 have also
been shown to participate in the regulation of the fatty acid synthase and acetyl-CoA carboxylase- genes by insulin (38). To our knowledge, our studies are the first indicating that USF proteins are involved in
T3 responsiveness.
Although our analysis of the CPT-I gene indicates that C/EBP and USF
factors are involved in T3 induction, other factors can serve as
accessory factors in the stimulation of gene expression by T3. The
sterol regulatory element-binding protein-1 (SREBP-1C) interacts with
the TR to enhance acetyl-CoA carboxylase (ACC-I) transcription in
hepatocytes (14). Furthermore, the homeodomain proteins, PBX and MEIS1,
are accessory factors that enhance T3 induction of malic enzyme gene
expression in hepatocytes (39). In the liver, NF-Y binds near the start
site of transcription and is required for the stimulation of S14 gene
transcription (40). The S14 TREs are located far upstream between
nucleotides 2700 and 2500 (41). In the heart, myocyte-specific
enhancer factor 2 (MEF2) contributes to the T3 induction of the
-cardiac myosin heavy chain ( -MHC) gene (42). The induction of
human placental lactogen B (hCS-B) and rGH genes by T3 is dependent on the pituitary factor, Pit-1 (43, 44). Accessory factors function in a gene- and tissue-specific manner to modulate hormone responses.
A unique aspect of the CPT-I gene is that the accessory factors are
located in the first intron, whereas the hormone response element is
located in the promoter. One question raised by our studies is how the
accessory factors located 3,600 base pairs from the TR bound to the TRE
cooperate in the T3 induction. In these studies, we have demonstrated
that the TR can physically interact with USF-1 and USF-2 as well as
with C/EBP through the DNA binding domain of TR. We also show by
ChIP assay that TR interacts with sequences within intron 1, which
suggests that the DNA loops so that the TR can interact with USF and
C/EBP in the intron. Previously, we have ligated a Gal4 site in front
of several C/EBP binding sites. The inclusion of C/EBP binding sites
enhanced the induction by T3 and a Gal4-TR protein that does not
have the TR DNA binding domain (16). However, these observations do not rule out direct physical interactions between the TR and C/EBP. We do
not know if multiple USF sites can potentiate T3-mediated transcriptional induction out of the context of the CPT-I gene.
It is possible that coactivator proteins are involved in the
interactions between the accessory factors and the TR . Recent studies have shown that there is a sequential order of coactivator recruitment to the liganded TR (21). First SRC-1 and CBP/p300 are
recruited to the liganded receptor followed by the recruitment of the
TRAP/mediator complex. The accessory factors may help to recruit or
stabilize the coactivators that are associated with the CPT-I gene.
C/EBP interacts with p300 through its amino terminus and the E1A
binding region of p300 (45). We have found that overexpression of CBP,
the functional homologue of p300, modestly increases the basal
expression of the CPT-I gene (data not shown). We have recently
reported that CBP enhances the T3 induction of the PEPCK gene (16). In
addition, we have observed weak physical interactions between C/EBP
and CBP, although these interactions might be stabilized in the context
of the CPT-I gene (16). Furthermore, hepatocyte nuclear factor-4 can
interact with SRC-1, so other proteins adjacent to the CPT-I -TRE as
well as those in the intron may assist in the recruitment of
coactivators (46).
Our studies have established the necessity of intron 1 in the
transcriptional regulation of the CPT-I gene. The present work has
defined a unique regulatory arrangement for thyroid hormone involving
cooperation between transcription factors in the intron and promoter.
The interaction of TR with sequences in the intron and its ability to
physically interact with C/EBP and USF present a novel model for
cooperation in gene induction between nuclear receptors and accessory
factors. Coactivators may also participate by providing a physical link
between the TR in the promoter and accessory factors in intron 1. Future studies will investigate the role of coactivators in this regulation.
 |
FOOTNOTES |
*
This work was supported by grants from the Juvenile Diabetes
Research Foundation (to E. A. P.) and the American Heart Association (to E. A. P.) and by National Institutes of Health Grants HL66924 (to
G. A. C.) and RR02599 (to P. A. W.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
§
Supported by a National Institutes of Health training grant.
**
To whom correspondence should be addressed: Dept. of Pharmacology,
University of Tennessee, College of Medicine, 874 Union Ave., Memphis,
TN 38163. Tel.: 901-448-4779; Fax: 901-448-7206; E-mail:
epark@utmem.edu.
Published, JBC Papers in Press, December 19, 2002, DOI 10.1074/jbc.M211062200
 |
ABBREVIATIONS |
The abbreviations used are:
T3, thyroid hormone;
TR, thyroid hormone receptor;
TR , isoform of T3 receptor;
TRE, thyroid hormone response element;
RXR, retinoid X receptor;
GST, glutathione S-transferase;
COUP-TF, chicken ovalbumin
upstream promoter transcription factor;
CPT, carnitine
palmitoyltransferase;
CPT-I, mitochondrial outer membrane CPT;
CPT-II, mitochondrial inner membrane CPT;
CPT-I , liver isoform of CPT-I;
DR, direct repeat;
C/EBP, CCAAT enhancer binding protein;
USF, upstream
stimulatory factor;
CREB, cAMP-response element-binding protein;
luc, luciferase;
DMEM, Dulbecco's modified Eagle's medium;
ChIP, chromatin
immunoprecipitation;
PEPCK, phosphoenolpyruvate carboxykinase.
 |
REFERENCES |
| 1.
|
Heimberg, M.,
Olubadewo, J. O.,
and Wilcox, H. G.
(1985)
Endocr. Rev.
6,
590-607[Abstract/Free Full Text]
|
| 2.
|
Mangelsdorf, D. J.,
and Evans, R. M.
(1995)
Cell
83,
841-850[CrossRef][Medline]
[Order article via Infotrieve]
|
| 3.
|
Zhang, J.,
and Lazar, M. A.
(2000)
Annu. Rev. Physiol.
62,
439-466[CrossRef][Medline]
[Order article via Infotrieve]
|
| 4.
|
McGarry, J. D.,
and Evans, N. F.
(1997)
Eur. J. Biochem.
244,
1-14[Medline]
[Order article via Infotrieve]
|
| 5.
|
Indiveri, C.,
Iacobazzi, V.,
Giangregorio, N.,
and Palmier, F.
(1997)
Biochem. J.
321,
713-719
|
| 6.
|
Mynatt, R. L.,
Park, E. A.,
Thorngate, F. E.,
Das, H. K.,
and Cook, G. A.
(1994)
Biochem. Biophys. Res. Comm.
201,
932-937[CrossRef][Medline]
[Order article via Infotrieve]
|
| 7.
|
Park, E. A.,
Mynatt, R. L.,
Cook, G. A.,
and Kashfi, K.
(1995)
Biochem. J.
310,
853-858
|
| 8.
|
Cook, G. A.,
Edwards, T. L.,
Jansen, M. S.,
Bahouth, S. W.,
Wilcox, H.,
and Park, E. A.
(2001)
J. Mol. Cell. Cardiol.
33,
317-329[CrossRef][Medline]
[Order article via Infotrieve]
|
| 9.
|
Park, E. A.,
Steffen, M. L.,
Song, S.,
Park, V. M.,
and Cook, G. A.
(1998)
Biochem. J.
329,
217-224
|
| 10.
|
Steffen, M. L.,
Harrison, W. R.,
Elder, F. F.,
Cook, G. A.,
and Park, E. A.
(1999)
Biochem. J.
340,
425-432
|
| 11.
|
Jansen, M. S.,
Cook, G. A.,
Song, S.,
and Park, E. A.
(2000)
J. Biol. Chem.
275,
34989-34997[Abstract/Free Full Text]
|
| 12.
|
Barrero, M. J.,
Marrero, P. F.,
and Haro, D.
(2000)
Biochem. Biophys. Res. Comm.
279,
81-88[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Gorski, K.,
Carneiro, M.,
and Schibler, U.
(1986)
Cell
47,
767-776[CrossRef][Medline]
[Order article via Infotrieve]
|
| 14.
|
Yin, L.,
Zhang, Y.,
and Hillgartner, F. B.
(2002)
J. Biol. Chem.
277,
19554-19565[Abstract/Free Full Text]
|
| 15.
| Deng, X., Cagen, L. M., Wilcox, H. G., Park, E. A.,
Raghow, R., and Elam, M. B. Biochem. Biophys. Res.
Comm. 290, 256-262
|
| 16.
|
Jurado, L. A.,
Song, S.,
Roesler, W. M.,
and Park, E. A.
(2002)
J. Biol. Chem.
277,
27606-27612[Abstract/Free Full Text]
|
| 17.
|
Disch, D. L.,
Rader, T. A.,
Cresci, S.,
Leone, T. C.,
Barger, P. M.,
Vega, R.,
Wood, P. A.,
and Kelly, D. P.
(1996)
Mol. Cell. Biol.
16,
4043-4051[Abstract]
|
| 18.
|
Polites, H. G.,
and Pinkert, C. A.
(1993)
in
Transgenic Animal Technology: A Laboratory Handbook.
(Pinkert, C. A., ed)
, pp. 15-68, Academic Press, San Diego
|
| 19.
|
Vaulont, S.,
and Kahn, A.
(1994)
FASEB J.
8,
28-35[Abstract]
|
| 20.
|
Baniahmad, A.,
Ha, I.,
Reinberg, D.,
Tsai, S.,
and Tsai, M.
(1993)
Proc. Natl. Acad. Sci. U. S. A.
90,
8832-8836[Abstract/Free Full Text]
|
| 21.
|
Roesler, W. J.
(2001)
Annu. Rev. Nutr.
21,
141-165[CrossRef][Medline]
[Order article via Infotrieve]
|
| 22.
|
Sharma, D.,
and Fondell, J. D.
(2000)
Mol. Endocrinol.
14,
2001-2009[Abstract/Free Full Text]
|
| 23.
|
Louet, J.,
Hayhurst, G.,
Gonzalez, F. J.,
Girard, J.,
and Decaux, J.
(2002)
J. Biol. Chem.
277,
37991-38000[Abstract/Free Full Text]
|
| 24.
|
Louet, J. F.,
Chatelain, F.,
Decaux, J. F.,
Park, E. A.,
Kohl, C.,
Pineau, T.,
Girard, J.,
and Pegorier, J. P.
(2001)
Biochem. J.
354,
189-197[CrossRef][Medline]
[Order article via Infotrieve]
|
| 25.
|
Rodd, C.,
Schwartz, H. L.,
Strait, K. A.,
and Oppenheimer, J. H.
(1992)
Endocrinology
131,
2559-2564[Abstract/Free Full Text]
|
| 26.
|
Cao, Z.,
Umek, R. M.,
and McKnight, S. L.
(1991)
Genes Dev.
5,
1538-1552[Abstract/Free Full Text]
|
| 27.
|
Lekstrom-Himes, J.,
and Xanthopoulos, K. G.
(1998)
J. Biol. Chem.
273,
28545-28548[Abstract/Free Full Text]
|
| 28.
|
Tae, H. J.,
Zhang, S.,
and Kim, K. H.
(1995)
J. Biol. Chem.
270,
21487-21494[Abstract/Free Full Text]
|
| 29.
|
Yamada, K.,
Duong, D. T.,
Scott, D. K.,
Wang, J. C.,
and Granner, D. K.
(1999)
J. Biol. Chem.
274,
5880-5887[Abstract/Free Full Text]
|
| 30.
|
Chung, S. S.,
MacPhee, K. G.,
and Goodridge, A. G.
(1999)
Arch. Biochem. Biophys.
364,
30-41[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
Menendez-Hurtado, A.,
Santos, A.,
and Perez-Castillo, A.
(2000)
Endocrinology.
141,
4164-4170[Abstract/Free Full Text]
|
| 32.
|
Wang, N. D.,
Finegold, M. J.,
Bradley, A.,
Ou, C. N.,
Abdelsayed, S. V.,
Wilde, M. D.,
Taylor, L. R.,
Wilson, D. R.,
and Darlington, G. J.
(1995)
Science
269,
1108-1112[Abstract/Free Full Text]
|
| 33.
|
Croniger, C. M.,
Midward, C.,
Yang, J.,
Kawai, Y.,
Arinze, I. J.,
Liu, S.,
Harada-Shiba, M.,
Chakravarty, K.,
Friedman, J. E.,
Poli, V.,
and Hanson, R. W.
(2001)
J. Biol. Chem.
276,
629-638[Abstract/Free Full Text]
|
| 34.
|
Wang, Y.,
Zhang, Y.,
and Hillgartner, F. B.
(2002)
Biochem. J.
361,
391-400[CrossRef][Medline]
[Order article via Infotrieve]
|
| 35.
|
Lefrançois-Martinez, A.,
Martinez, A.,
Antoine, B.,
Raymondjean, M.,
and Kahn, A.
(1995)
J. Biol. Chem.
270,
2540-2643
|
| 36.
|
Portois, L.,
Tastenoy, M.,
Violet, B.,
and Svoboda, M.
(2002)
Biochim. Biophys. Acta
1574,
175-186[Medline]
[Order article via Infotrieve]
|
| 37.
|
Sul, H. S.,
Latasa, M.,
Moon, Y.,
and Kim, K.
(2000)
J. Nutr.
130 Suppl. 2S,
315S-320S[Abstract/Free Full Text]
|
| 38.
|
Travers, M.,
Vallance, A. J.,
Gourlay, H. T.,
Gill, C. A.,
Klein, I.,
Bottema, C.,
and Barber, M. C.
(2001)
Biochem. J.
359,
273-284[CrossRef][Medline]
[Order article via Infotrieve]
|
| 39.
|
Wang, Y.,
Yin, L.,
and Hillgartner, F. B.
(2001)
J. Biol. Chem.
276,
23838-23848[Abstract/Free Full Text]
|
| 40.
|
Jump, D. B.,
Badin, M. V.,
and Thelen, A.
(1997)
J. Biol. Chem.
272,
27778-27786[Abstract/Free Full Text]
|
| 41.
|
Liu, H. C.,
and Towle, H. C.
(1994)
Mol. Endocrinol.
8,
1021-1037[Abstract/Free Full Text]
|
| 42.
|
Lee, Y.,
Nadal-Ginard, B.,
Mahdavi, V.,
and Izumo, S.
(1997)
Mol. Cell. Biol.
17,
2745-2755[Abstract]
|
| 43.
|
Voz, M. L.,
Peers, B.,
Weidig, M. J.,
Jacquemin, P.,
Belayew, A.,
and Martial, J. A.
(1992)
Mol. Cell. Biol.
12,
3991-3997[Abstract/Free Full Text]
|
| 44.
|
Schaufele, F.,
West, B. L.,
and Baxter, J. D.
(1992)
Mol. Endocrinol.
6,
656-665[Abstract/Free Full Text]
|
| 45.
|
Mink, S.,
Haenig, B.,
and Klempnauer, K.
(1997)
Mol. Cell. Biol.
17,
6609-6617[Abstract]
|
| 46.
|
Wang, J. C.,
Stafford, J. M.,
and Granner, D. K.
(1998)
J. Biol. Chem.
273,
30847-30850[Abstract/Free Full Text]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
B. Desvergne, L. Michalik, and W. Wahli
Transcriptional Regulation of Metabolism
Physiol Rev,
April 1, 2006;
86(2):
465 - 514.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Prieur, T. Huby, H. Coste, F. G. Schaap, M. J. Chapman, and J. C. Rodriguez
Thyroid Hormone Regulates the Hypotriglyceridemic Gene APOA5
J. Biol. Chem.,
July 29, 2005;
280(30):
27533 - 27543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhang, K. Ma, S. Song, Marshall. B. Elam, G. A. Cook, and E. A. Park
Peroxisomal Proliferator-activated Receptor-{gamma} Coactivator-1{alpha} (PGC-1{alpha}) Enhances the Thyroid Hormone Induction of Carnitine Palmitoyltransferase I (CPT-I{alpha})
J. Biol. Chem.,
December 24, 2004;
279(52):
53963 - 53971.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-h. Shih, S.-L. Chen, C.-C. Yen, Y.-H. Huang, C.-d. Chen, Y.-S. Lee, and K.-h. Lin
Thyroid Hormone Receptor-Dependent Transcriptional Regulation of Fibrinogen and Coagulation Proteins
Endocrinology,
June 1, 2004;
145(6):
2804 - 2814.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|