|
Originally published In Press as doi:10.1074/jbc.M210959200 on December 23, 2002
J. Biol. Chem., Vol. 278, Issue 10, 8006-8017, March 7, 2003
Mechanism of Minus Strand Strong Stop Transfer in HIV-1
Reverse Transcription*
Yan
Chen ,
Mini
Balakrishnan ,
Bernard P.
Roques§,
Philip J.
Fay , and
Robert A.
Bambara ¶
From the Department of Biochemistry and Biophysics
and the ¶ Cancer Center, University of Rochester, Rochester,
New York 14642 and the § Departement de Pharmacochimie
Moleculaire et Structurale, U266 INSERM, URA D1500 CNRS, UER des
Sciences Pharmaceutiques et Biologiques, 4 Avenue de l'Observatoire,
75270 Paris Cedex 06, France
Received for publication, October 28, 2002, and in revised form, December 20, 2002
 |
ABSTRACT |
Retrovirus minus strand strong stop transfer
(minus strand transfer) requires reverse transcriptase-associated RNase
H, R sequence homology, and viral nucleocapsid protein. The minus
strand transfer mechanism in human immunodeficiency virus-1 was
examined in vitro with purified protein and substrates.
Blocking donor RNA 5'-end cleavage inhibited transfers when template
homology was 19 nucleotides (nt) or less. Cleavage of the donor 5'-end occurred prior to formation of transfer products. This suggests that
when template homology is short, transfer occurs through a primer
terminus switch-initiated mechanism, which requires cleavage of the
donor 5' terminus. On templates with 26-nt and longer homology, transfer occurred before cleavage of the donor 5' terminus. Transfer was unaffected when donor 5'-end cleavages were blocked but was reduced
when internal cleavages within the donor were restricted. Based on the
overall data, we conclude that in human immunodeficiency virus-1, which
contains a 97-nt R sequence, minus strand transfer occurs through an
acceptor invasion-initiated mechanism. Transfer is initiated at
internal regions of the homologous R sequence without requiring
cleavage at the donor 5'-end. The acceptor invades at gaps created by
reverse transcriptase-RNase H in the donor-cDNA hybrid. The
fragmented donor is eventually strand-displaced by the acceptor,
completing the transfer.
 |
INTRODUCTION |
Reverse transcription, during which the single-stranded viral
genomic RNA is converted into the double-stranded DNA, is an essential
step in viral replication (see Ref. 1 and reference therein). This
process is catalyzed by the virus-encoded enzyme reverse transcriptase
(RT).1 RT has two enzymatic
activities, the DNA polymerase and the RNase H activities. Reverse
transcription is initiated by the partial annealing between the
cellular tRNALys3 primer and the viral primer binding site,
which is located near the 5'-end of the viral RNA. Synthesis proceeds
to the 5'-end of the genomic RNA, creating the minus strand strong stop
DNA ( sssDNA), which comprises all of the U5 and R sequences from the
5'-untranslated region. During minus strand synthesis, RT simultaneously cleaves the copied RNA using its RNase H activity. This
frees the sssDNA, enabling its transfer to the homologous R sequence
in the 3'-untranslated region and continuation of minus strand
synthesis. This step is called minus strand strong stop transfer (minus
strand transfer), and it is obligatory for reverse transcription and
viral replication. Extensive studies have identified the RT-RNase H
activity, R sequence homology, and viral nucleocapsid (NC) protein as
important components for minus strand transfer (see Ref. 2 and
references therein).
Viruses with defective RNase H fail to complete reverse transcription,
particularly the minus strand transfer step, indicating that RNase H is
required for the transfer event (3-8). HIV-1 RT has been shown to
partially cleave the template RNA during polymerization, leaving RNA
fragments annealed to the cDNA (9, 10). Since there are 50-100 RTs
and only two copies of the RNA genome in a viral particle (11), RTs not
involved in polymerization are available for cleaving these fragments.
The RNase H acts independently of polymerization in these reactions,
serving to clear off the partially degraded RNA fragments left after
the partial RNA removal associated with polymerization. Failure to
detect significant amounts of sssDNA in the infected cell cytoplasm
indicates that minus strand transfer is an efficient event in
vivo (12, 13).
Minus strand transfer utilizes the homologous R sequences at both ends
of the viral genome. In HIV-1, the R region is 97 nt long and contains
all of the TAR hairpin and part of the poly(A) hairpin. Studies with
mutations within the R segment indicate that transfers predominantly
take place after the DNA synthesis reaches the 5'-end of the genome
(14-19). Deletion and mutational analysis of the R region shows that
not all the R region is required for transfer in HIV-1. HIV-1 can still
effectively complete replication with an R homology much shorter than
97 nt (20). In murine leukemia virus, an R region with as little
as 12 or 14 nt does not affect transfer significantly (21, 22). In
addition to homology, RNA structure has also been implicated in the
minus strand transfer mechanism (17, 23, 24).
The viral NC protein has been shown to stimulate minus strand transfer
(see Ref. 1 and references therein and Ref. 2). The RNA genome in
retroviruses is coated with the NC protein, a proteolytic product of
the gag polyprotein. It is estimated that one molecule of NC protein
coats about 7 nt of genomic RNA in vivo (25, 26). NC is a
highly basic protein, containing one or two zinc fingers, which are
essential for its function (see Refs. 27-29; see Ref. 30 and
references therein). NC has been shown to function in several steps of
viral replication, including genomic RNA maturation, reverse
transcription, and integration. NC displays nucleic acid chaperone
activity, catalyzing the melting, reannealing, and folding of nucleic
acid into their most stable conformations (31-44). All of these have
important implications in strand transfer and reverse transcription. NC
protein noticeably stimulates transfer in reconstituted in
vitro systems. The strand annealing and chaperone activities of NC
plus its effects on RT-RNase H have been implicated in facilitating the
transfer reaction (34, 35, 39, 43-48). Analyses in vitro
have been used to show that NC inhibits the formation of dead end,
self-primed products from the sssDNA, allowing it to be used for
transfers (38, 49, 50). In addition, NC has been shown to stimulate
RT-RNase H activity, especially on a blunt-ended substrate (33, 43). Although direct interaction between NC and RT has been reported (51,
52), the nature of such interactions is unclear.
Two possible mechanisms can be envisioned for minus strand transfer
(Fig. 1). In the first, transfer primarily involves switching of the 3'
terminus of the fully extended strong stop DNA from the donor to the
acceptor. Here, the degradation of the genomic RNA, specifically at the
5'-end, is required to release the primer terminus such that it is free
to anneal to the acceptor. This is therefore referred to as the primer
terminus switch-initiated pathway. The second, referred to as acceptor
invasion-initiated pathway, proposes that RNase H cleavages within the
internal regions of the donor RNA are critical in facilitating the
transfer. The homologous acceptor RNA anneals to the cDNA at gaps
created within the donor RNA template and initiates the transfer well
behind the primer terminus. The acceptor template strand displaces the fragmented donor and captures the primer terminus, thereby completing the transfer.
Using a reconstituted HIV-1 R sequence-based transfer system, we set
out to test the primary pathway for minus strand transfer in HIV-1.
Templates with longer homology supported more transfers, and NC protein
further enhanced the efficiency. Inhibiting internal RNase H cleavages
within the donor reduced transfer with long homology. However,
inhibiting cleavages at the donor 5'-end specifically inhibited
transfers only for short (and not for long) homology template systems.
In long homology templates, in the presence of NC, transfer products
were formed before degradation of the donor 5'-end. The overall data
support that minus strand transfer in retroviruses with long R
sequences, such as HIV-1, occurs through an acceptor invasion-initiated
mechanism that does not require terminal cleavages at the 5'-end of R. Whereas DNA synthesis is completed to the 5'-end of the R sequence, the
transfer is initiated well behind the primer terminus and is promoted
through internal RNase H cleavages with the donor template and the
strand exchange and chaperone activities of NC.
 |
EXPERIMENTAL PROCEDURES |
Materials--
Purified HIV-1 reverse transcriptase (40,000 units/mg) was provided by Genetics Institute (Cambridge, MA). DNA
oligonucleotides were purchased from Integrated DNA Technologies, Inc.
(Coralville, IA). The 2'-O-methyl-modified RNAs and the
40-nt RNA were purchased from Dharmacon Research Inc. (Lafayette, CO).
Calf intestine phosphatase, dNTPs, rNTPs, DNase I, and polynucleotide
kinase were purchased from Roche Molecular Biochemicals. The Pfu
Turbo DNA polymerase was purchased from Stratagene (La Jolla, CA).
LITMUS 28 vector, T4 DNA ligase, and restriction endonucleases were
purchased from New England Biolabs (Beverly, MA). The 32P
isotope was purchased from PerkinElmer Life Sciences. The pNL4-3 molecular clone (from Dr. Malcom Martin) was obtained through the AIDS
Research and Reference Reagent Program (Division of AIDS, NIAID,
National Institutes of Health). HIV-1 NCp7 (72 amino acids) was
prepared by solid phase chemical synthesis as described by de
Rocquigny et al. (53). HIV-1 NCp7 (55 amino acids) was
generously provided by Dr. Robert J. Gorelick (AIDS Vaccine Program,
NCI-Frederick).
Plasmid Constructs--
Genomic sequences from the HIV-1 NL4-3
strain were amplified by PCR and cloned into LITMUS 28 to create the
donor and the acceptors constructs for generation of RNA templates. The
following PCR primers were used in the construction of the various
constructs. To generate the pNL-71D donor construct, primers
SpeI/1(+)DpNL4-3 (5'-GGACTAGTGGGTCTCTCTGGTTAGACCAGA) and
XhoI/71( )DpNL4-3
(5'-CTATCTCGAGGGCTTAAGCAGTGGGTTCCC) were used to
amplify a 71-nt segment (+1 to +71) from the 5'-end of the genome.
Restriction enzyme sites within the primers are underlined. PCR
fragments were digested with SpeI and XhoI and cloned into LITMUS 28. Acceptor constructs were generated using the
same approach. Primers SpeI/9056(+)ApNL4-3
(5'-CGACTAGTGCTGCTTTTTGCCTGTACTGGG) and
XhoI/9119( )LApNL4-3
(5'-TATACTCGAGGCCAGAGAGCTCCCAGGCTC) and primers
SpeI/9056(+)ApNL4-3 and XhoI/9100( )SApNL4-3
(5'-GGCACTCGAGCAGATCTGGTCTAACCAGAG) were used to amplify 64 nt (+9056 to +9119) and 45 nt (+9056 to +9100) segments from the 3'-end
of the genome to construct the pNL-A45h and pNL-A26h acceptor
constructs, respectively. All constructs were transformed into
E. coli DH5 cells and sequenced.
Generation of RNA Templates--
Donor RNA template D71 and
acceptor RNA templates A26h and A45h were generated by run-off
transcription in vitro from the corresponding linearized
plasmid constructs using the Ambion T7-MEGAshortscript kit (Austin, TX)
as per the manufacturer's protocol. The acceptor RNAs A19h and A12h
were transcribed in vitro from a synthetic double-stranded
DNA fragment containing the T7 promoter. The sequences of the templates
were
5'-GGATCCTAATACGACTCACTATAGGGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACC (for A19h) and
5'-GGATCCTAATACGACTCACTATAGGGCTGCTTTTTGCCTGTACTGGGTCTCTCTGG (for A12h)
and their complementary strands. The 5'-end
2'-O-methyl-modified 71-nt donor template, D71(OM4-14), was
generated by ligating a 31-nt 5'-oligomer containing the
2'-O-methyl modification to a 40-nt 3'-oligomer, using T4
DNA ligase as described previously (54). The 69-nt donor template with
internal 2'-O-methyl modification, D69(OM17-40), was
purchased from Dharmacon Research Inc. All RNAs used in the study were
PAGE-purified and resuspended in 10 mM Tris-HCl (pH 8.0), 1 mM EDTA buffer. RNAs were quantitated using the Ribogreen
assay (Molecular Probes, Inc., Eugene, OR).
Substrate Preparation--
DNA primers were 5'-end-labeled using
[ -32P]ATP (6000 Ci (222 TBq)/mmol) and
polynucleotide kinase. For transfer reactions, primer, donor, and
acceptor were mixed at a 1.5:1:1.5 ratio (1.5:1:3 for time course
assays and reactions with D69(OM17-40) donor), heated to 95 °C for
5 min, and slowly cooled to room temperature. Reaction mix contained 50 mM Tris-HCl (pH 8.0), 50 mM KCl, and 1 mM dithiothreitol. For use in RNase H assays, RNA templates were first dephosphorylated by calf intestine phosphatase and then
5'-end-labeled using [ -32P]ATP (6000 Ci (222 TBq)/mmol) and polynucleotide kinase. For polymerase-independent RNase
H assays, the labeled donor RNA was annealed to the DNA template at a
ratio of 1:3 as previously described (55).
Synthesis Assay--
Reactions were performed as described
previously (56) with slight modifications. Final reactions contained
2.5 nM primer-template, in 50 mM Tris-HCl (pH
8.0), 50 mM KCl, 1 mM dithiothreitol, 1 mM EDTA, and 32 nM HIV-1 RT. 3.75 nM (7.5 nM for time course assays and reactions
with D69(OM17-40) donor) acceptor RNA was included in the transfer
reactions. For reactions with NC protein, NC was added to the mix and
incubated at 37 °C for 5 min. RT was then allowed to prebind to
substrate before initiating reactions with MgCl2 and dNTPs
at a final concentration of 6 mM and 50 µM
respectively. Reactions were incubated at 37 °C and terminated at
the appropriate time using 2× termination dye (10 mM EDTA
(pH 8.0), 90% formamide (v/v), and 0.1% each of xylene cyanol and
bromphenol blue).
Synthesis Assay with the Internally Modified D69(OM17-40) Donor
RNA--
Reactions were performed as described above, with slight
modifications. The ratio of primer/donor/acceptor was 1.5:1:3.
Reactions contained 50 mM Tris-HCl (pH 8.8), 50 mM KCl, 1 mM dithiothreitol, 1 mM
EDTA, 48 nM HIV-1 RT, 7.8 mM MgCl2,
and 65 µM dNTPs.
RNase H Assay--
Reactions were performed as previously
described (43). Briefly, reactions contained 50 mM Tris-HCl
(pH 8.0), 50 mM KCl, 1 mM dithiothreitol, 1 mM EDTA, 4 nM substrate, and 32 nM
HIV-1 RT. The reaction mixture was incubated for 2 min at 37 °C to
allow prebinding of RT to substrate. Reactions were then started by the
addition of the MgCl2 at 6 mM final
concentration and incubated at 37 °C for the appropriate time.
 |
RESULTS |
Results from our laboratory and others have shown that during
sssDNA synthesis, cleavage of the genomic RNA at the 5'-end is
relatively inefficient, leaving a 14-15-nt fragment annealed to the
3'-end of the extended DNA (43, 57, 58). However, sequence analysis of
the transfer product suggests that most RT copies all of the 5' R
sequence before the transfer occurs (15-19). These observations led us
to hypothesize two possible transfer processes shown in Fig.
1. The primer terminus switch-initiated pathway predicts that the transfer is initiated through annealing of
the 3' terminal region (10-20 nt) of the fully extended sssDNA to
the acceptor template. In this mechanism, degradation of the 5'-end
genomic RNA fragments is important to allow the critical annealing
step. The acceptor invasion-initiated pathway, on the other hand, is
unaffected by the presence of the uncleaved 5'-end RNA fragments.
Instead, transfers would depend on initiation of DNA-acceptor template
interaction at a site internal to the primer terminus and a propagation
of that interaction to the 3' terminus of the strong stop DNA. RNA in
the path of the propagation, including the terminal segment, would be
presumably displaced. An efficient invasion mechanism would therefore
require an extended homology between the donor and acceptor
templates.

View larger version (18K):
[in this window]
[in a new window]
|
Fig. 1.
Two possible mechanisms of minus strand
strong stop transfer: primer terminus switch-initiated and acceptor
invasion-initiated pathways. RT copies to the 5'-end of 5' R
(donor) before switching to 3' R (acceptor). The primer terminus
switch-initiated pathway proposes that the donor RNA 5'-end needs to be
degraded to release the primer terminus such that it is free to anneal
to the acceptor and initiate transfer. The acceptor invasion-initiated
pathway proposes that the homologous acceptor RNA anneals to the
cDNA at gaps created within the donor RNA template and initiates
the transfer well behind the primer terminus. The acceptor template
strand displaces the fragmented donor and captures the primer terminus,
thereby completing the transfer. Patterned lines
represent donor RNA, gray lines represent
acceptor RNA, and black lines represent DNA. The
arrows in the DNA strands indicate the direction of
synthesis.
|
|
Cleavage at the 5'-End of the HIV-1 Genome after sssDNA Synthesis
Is Poor and Is Facilitated by NC Protein--
Characterization of
RT-RNase H cleavage shows that on RNA fragments annealed to a DNA
template, RT preferentially binds the RNA 5'-end, making a cut 18-19
nt from the RNA 5'-end (59-63). This initial fragment is further
processed into 8-10-nt-long smaller fragments, which can dissociate
from the template. We refer to the 18-19-nt and 8-10-nt cuts as the
primary and the secondary cuts, respectively, based on their rate of
formation (55). On blunt-ended hybrid substrates, where the RNA 5'-end
is flush with the DNA 3'-end, secondary cleavages are less efficient
and stimulated by NC protein (43). This was true for substrates
comprising nonviral or HIV-1 R sequences (43).
In the current study, we analyzed the role of the RNase H cleavages
during the course of minus strand DNA synthesis and transfer. A 71-nt
RNA template (D71) corresponding to the 5'-end of the HIV-1 genome was
used as the donor template, and minus strand DNA synthesis was
initiated using a DNA primer (Fig. 2,
A and B). Synthesis to the end of the donor RNA
would create a blunt-ended hybrid substrate. Overall RNA degradation of
the template (overall RNase H) and formation of the 5'-end 8-10-nt
cleavage product (secondary cut) were examined in the presence and
absence of NC (Fig. 2, A and B). For comparison,
RNase H cleavages were also examined on preformed blunt-ended and
recessed substrates (Fig. 2, C and D). For the
preformed substrates, D71 RNA was annealed to appropriate cDNAs to
generate blunt-ended and recessed substrates. In the absence of NC,
both the overall RNase H and secondary cut at the donor 5'-end were
lower when examined during synthesis than with the preformed
blunt-ended hybrid substrate (Fig. 2, compare A and
C with B and D). This is not
surprising, considering that in the synthesis reactions, the substrate
for RNase H cleavage had to be created during the reaction. The
presence of NC (at 200% coating; i.e. 1 NC/3.5 nt) during
minus strand DNA synthesis increased the overall RNase H cleavage by
50% (Fig. 2A) and the 8-10-nt cut at the RNA 5'-end by
100% (Fig. 2B). With the preformed substrates in the
absence of NC, the 8-10-nt terminal cut was slower for the blunt-ended
substrate as compared with the recessed substrate (Fig. 2D).
This result was consistent with those observed previously with the
shorter 28- and 41-nt viral and nonviral substrates (43). In
comparison, NC stimulation of RNase H, in particular the 8-10-nt cut,
was more significant on preformed blunt-ended substrate as compared
with those during synthesis (Fig. 2, compare B and
D). At 200% NC coating, the 8-10-nt cut efficiency on the blunt-ended substrate was enhanced by 4-5-fold, making it comparable with that on the recessed substrate (Fig. 2D). NC did not
alter the specificity of RNase H cuts on any of the substrates tested (data not shown). This suggests that NC not only stimulates RT-RNase H
during synthesis but also specifically stimulates the 8-10-nt cut at
the blunt end of an RNA/DNA hybrid.

View larger version (21K):
[in this window]
[in a new window]
|
Fig. 2.
Effect of NC on RNA 5'-end cleavages.
Schematics of the substrates used are indicated, with RNA in
gray and DNA in black. An asterisk
indicates the position of the 32P label. A and
B, overall RNase H (A) and 8-10-nt secondary
cleavage (B) of the 5'-end-labeled D71 donor RNA were
examined during primer extension in the absence (black) and
presence of NC (gray, 200% coating level). C and
D, overall RNase H (C) and secondary cleavage
(D) were quantitated during polymerase-independent RNase H
on 5'-end-labeled recessed (RE, dashed
lines) or blunt-ended (BL, continuous
lines) D71 RNA, in the absence (black
lines) or presence (gray lines, 200%
coating level) of NC protein. Quantitation was based on at least three
independent experiments. Overall RNase H was determined as 100 × (1 radioactivity of the full-length RNA/radioactivity of the
whole lane), whereas the secondary cut was determined as 100 × (radioactivity of the 8-10-nt product/radioactivity of the whole
lane).
|
|
Effect of Homology on Transfer--
To determine the most likely
pathway for minus strand transfer in HIV-1, we designed a transfer
system in vitro using the HIV-1 R sequences (Fig.
3A). The 71-nt RNA derived
from the 5'-end of the HIV-1 genome was used as the donor template
(D71), whereas the acceptor templates were derived from the 3' R
region. All four acceptor templates (A12h, A19h, A26h, and A45h) shared
the same 5'-end but differed at the 3'-end, such that they generated 12, 19, 26, and 45 nucleotides of homology, respectively, with the
5'-end of the donor template (Fig. 3A). This ensured that the transfer product remained the same size (90 nt) irrespective of the
acceptor used.

View larger version (49K):
[in this window]
[in a new window]
|
Fig. 3.
Effect of template homology on minus strong
stop transfer. A, schematic of the minus strand
transfer system and sequences of the substrates used in the study.
Description of the schematic is the same as in Fig. 1. The
asterisk indicates the position of the 32P
label. DNA sequences are in italics. Length of homology
between the donor and acceptor RNA are indicated across
from each acceptor. B, extension assay were
performed in the absence of acceptor (lanes 1-5)
and in the presence of acceptors A12h (lanes
6-10), A19h (lanes 11-15), A26h
(lanes 16-20), and A45h (lanes
21-25). Reactions were performed in the absence of NC
(lanes 1, 6, 11,
16, and 21) or in the presence of 200%
(lanes 2, 7, 12,
17, and 22), 400% (lanes
3, 8, 13, 18, and
23), 800% (lanes 4, 9,
14, 19, and 24), and 1200%
(lanes 5, 10, 15,
20, and 25) NC protein. L, the 10-bp
DNA ladder. Transfer product (T), self-priming product
(SF), full-length donor extension product (FL),
and primer (P) are indicated. C, quantitation of
transfer efficiencies from assays with the D71 donors. Quantitation was
based on at least three independent experiments. Transfer efficiency
was defined as 100 × transfer product/(full-length product + self-priming product + transfer product).
|
|
Primer extension on the donor template resulted in a 71-nt full-length
donor extension product (Fig. 3B, lane
1). In addition, an 85-nt product was also detected,
resulting from self-priming of the full-length extension product. A
ladder of pause sites was observed from position 47 through 53. Analysis of the predicted secondary structure of this region suggested
that the pausing ladder was due to displacement synthesis through an
alternate hairpin structure formed from refolding of the template, as
shown previously (50).
We next examined transfers, using the four different acceptor RNA
templates (Fig. 3B). An expected 90-nt transfer product was
detected in all of the reactions with acceptor template. Similar synthesis profiles were observed with the donor extension and transfer
reactions, with respect to pausing sites, full-length donor extension,
and self-priming products. Quantitative values for the transfer
efficiencies are shown in Fig. 3C. In the absence of NC,
transfer products were almost undetectable, with the acceptor having
the shortest homology, A12h (Fig. 3B, compare
lane 6 with lanes 11,
16, and 21). Increasing the homology to 19 nt
(Fig. 3B, lane 11) resulted in a 1.9%
transfer efficiency (Fig. 3C), whereas both 26-nt (Fig.
3B, lane 16) and 45-nt (Fig.
3B, lane 21) homologies yielded
transfer efficiencies of 3.6 and 4.2%, respectively (Fig.
3C). Data indicate that within a certain range, increasing
the length of homology between donor and acceptor increased strand
transfer efficiency.
NC protein has been shown to stimulate strand transfer and inhibit
self-priming (3, 28, 33, 37-40, 47-50, 58, 64-76). We therefore
examined the effect of NC on transfers as template homology was
increased. The amount of NC was titrated to achieve from 100 to 1200%
coating of the substrates. The presence of NC did not alter the overall
extension profile in the absence or presence of acceptor (Fig.
3B). 100% NC coating had no obvious effect on transfer
efficiency and self-priming for the four substrates (data not shown).
As NC concentration was increased to 200% coating, a noticeable
increase in transfer product together with a slight decrease in
self-priming product was generally observed (Fig. 3B,
lanes 7, 12, 17, and
22). Subsequent increases in NC concentration further
enhanced transfer efficiency (Fig. 3, B and C).
With the 12-nt homology substrate, transfer efficiency increased
22-fold with 400 and 800% NC coating but decreased as NC was further
increased to 1200% coating. For longer homologies of 19, 26, and 45 nt, transfer efficiencies increased up to 39, 65, and 46%,
respectively, with 1200% NC coating (Fig. 3B
(lanes 15, 20, and 25) and
3C). The slight decrease of transfer efficiency from 26- to
45-nt homology will be discussed later. This set of reactions was also
performed using the 55-amino acid form of NC protein, and results with
the same trend were obtained (data not shown). Overall, NC was found to
increase transfer efficiency, while slightly decreasing self-priming, in a concentration-dependent manner.
Blocking Donor RNA 5'-End Cleavage Inhibits Transfer with Short but
Not Long Homology--
Although the enhancement in transfers observed
with increased donor-acceptor homology would support the
invasion-initiated pathway as the primary transfer mechanism, the
approach does not exclude transfers initiated via the primer terminus
switch. Therefore, to assess the contribution of the two pathways to
the transfer mechanism, we attempted to specifically block transfers
promoted via the primer terminus switch-initiated pathway. Since primer terminus transfer would require degrading the donor 5' terminus, inhibiting cleavages in this region should block transfer facilitated by this mode. Utilizing this idea, we created the 71-nt donor RNA
template, D71(OM4-14), containing 2'-O-methyl modifications from position 4 to 14 measured from the 5'-end of the RNA, while retaining the original sequence (Fig. 4).
To test the susceptibility of this RNA to RNase H cleavage, the
D71(OM4-14) RNA was 5'-end-labeled and annealed to the 71-nt cDNA,
to create the blunt-ended substrate and then subjected to the standard
cleavage assay. As expected, the 2'-O-methyl modification
inhibited RNase H cleavages from position 1 to 16 at the 5'-end of the
donor RNA, in contrast to the unmodified substrate, which sustained
normal cleavages (Fig. 4).

View larger version (53K):
[in this window]
[in a new window]
|
Fig. 4.
RNase H cleavage of D71(OM4-14) and D71
RNA. Polymerase-independent RNase H was assayed over time on the
unmodified D71 (left) or modified D71(OM4-14)
(right) RNA containing hybrid substrates. A schematic of the
substrate is presented at the top. Positions of the
2'-O-methyl modification (×) are highlighted at the 5'-end
of the RNA. The RNA was 5'-end-labeled and annealed to its cDNA to
generate the blunt-ended hybrid substrate. Assays were performed in the
absence of NC and terminated after 1, 4, 16, and 32 min of reaction.
Lane C, a control reaction without RT;
lane L, a 10-bp DNA ladder. RNA sizes are
determined by RNA hydrolysis and RNase T1 digestion. Sizes of the
cleavage products and the region of inhibition of cuts are
indicated.
|
|
We then performed strand transfer assays using the D71(OM4-14) RNA as
the donor template in combination with the four different acceptors
(Fig. 5). The 2'-O-methyl
modification did not interfere with synthesis significantly in this
substrate, and similar extension profiles were observed for both the
modified and unmodified substrates (Data not shown). Interestingly, the
2'-O-methyl modification greatly reduced the self-priming
product in both the donor extension and strand transfer reactions (data
not shown). This is not surprising, since the uncleaved 16-nt RNA
fragment would remain annealed to the 3'-end of cDNA and thereby
inhibit it from folding back and self-priming, as shown previously by
the Hughes group (50, 58, 77).

View larger version (36K):
[in this window]
[in a new window]
|
Fig. 5.
Synthesis with D71(OM4-14).
A, extension assays in the absence or presence of acceptor,
with different levels of NC coating, 0, 200, 400, 800, and 1200%.
Descriptions are the same as in Fig. 3B. Full-length
(FL) and transfer (T) products are indicated.
B, quantitation of transfer efficiencies from assays with
the modified D71(OM4-14) donors. Quantitation was based on at least
three independent experiments. Details are the same as in Fig.
3C.
|
|
For the short 12-nt homology, inhibiting donor 5'-end cleavage
completely blocked transfers even at high NC concentration (Fig.
5A, lanes 6-10). With the 19-nt
homology, transfers were detected only at high NC (800 and 1200%
coating), but transfer efficiency was generally lower than that
observed with the unmodified substrate (Fig. 5, A
(lanes 14 and 15) and B,
compared with Fig. 3C). This suggests the primer terminus
switch as the predominant pathway. For the 26-nt homology substrate
(Fig. 5A, lanes 16-20), transfer
products were detected beginning at 200% NC coating, at about 50% of
that observed with the unmodified substrate. At higher NC
concentration, transfer efficiencies were similar to those observed
with the unmodified templates (compare Fig. 5B with Fig.
3C). When the homology was further increased to 45 nt, the
modified and unmodified substrates showed very similar transfer efficiencies (Fig. 5, A (lanes 21-25)
and B; compare with Fig. 3C), suggesting that the
primer terminus switch-initiated pathway contributed minimally to
transfers in this system. Instead, transfers take place mainly via the
acceptor invasion-initiated pathway.
Taken together, the results indicate that when the homology between the
donor and acceptor is short (19 nt or less), transfers take place
mainly through the primer terminus switch-initiated pathway. When the
homology is longer, such as 45 nt, acceptor invasion-initiated pathway
is the major pathway for minus transfer.
Blocking Donor Internal Cleavages Inhibits Transfer with Long but
Not Short Homology Substrates--
The above results suggest that in
long homology substrates, cleavages well within the donor RNA create
invasion sites for the acceptor RNA. Blocking internal cleavages in the
donor RNA would then suppress transfers that are promoted through an
invasion-initiated mechanism but not a primer terminus switch-initiated
mechanism. To test this, we generated a 69-nt donor RNA from the 5'-end
of the HIV-1 genome, D69(OM17-40), containing a 2'-O-methyl
modification from position 17 to 40 from the 5'-end. RNase H assay with
D69(OM17-40) showed that internal cleavages from position 17 to 43 were blocked (Fig. 6A). In
addition, we also observed that the cleavage at the RNA 5'-end was
slightly enhanced compared with that observed from the unmodified RNA.
At 1 min, more 8-14-nt 5'-end cleavage products were detected from the
internal modified substrate than those from the unmodified substrate
(compare Fig. 6A with Fig. 4) (data not shown).

View larger version (56K):
[in this window]
[in a new window]
|
Fig. 6.
Synthesis and RNase H assay with
D69(OM17-40). A, polymerase-independent RNase H
cleavage with D69(OM17-40) RNA containing hybrid substrate. Details
are the same as in Fig. 4. The RNA was annealed to its cDNA to
create a blunt-ended hybrid. Assays were performed in the absence of NC
and terminated after 1, 2, 4, 16, and 32 min of reaction.
Lane C, a control reaction without NC;
lanes L, a 10-bp DNA ladder. B,
representative gels of extension assays with D69(OM17-40), showing
donor extension (lanes 1 and 2) and
transfer with A12h (lanes 3 and 4) in
the absence (lanes 1 and 3) or with
400% coating (lanes 2 and 4) of NC.
Reactions were performed under new conditions described under
"Experimental Procedures." C, quantitation of transfer
efficiencies with unmodified D71 and modified D69(OM17-40) donors,
under the new condition. Details are the same as in Fig. 3C.
Quantitation was based on at least three independent experiments.
|
|
When the DNA primer utilized above was used for synthesis, internal
modified D69(OM17-40) RNA should result in full-length extension
product and transfer product with the same length as those from the D71
donor RNA. The internal modifications within the D69(OM17-40) donor
template caused extensive pausing by RT during synthesis, resulting in
poor accumulation of full-length extension product. Reaction
conditions were therefore reoptimized for this substrate (see
"Experimental Procedures"). Both unmodified and modified donor
substrates were then tested using the 5'-end-labeled primer DNA. Fig.
6B shows an example of the synthesis reactions, in the
presence and absence of acceptor and NC protein. The internal 2'-O-methyl modifications resulted in more pausing between
positions 30 and 40 and a strong pause site around position 50 (compare Figs. 3B and 6B). With the unmodified donor, a
ladder of pausing was observed from position 47 to 53 (Fig.
3B). Self-priming products were absent, presumably because
uncleavable 2'-O-methyl internal fragments annealed to the
full-length extension product, preventing it from folding back. As with
the unmodified donor, NC also increased the transfer efficiency with
the modified donor.
Comparing transfer efficiencies between the internally modified
D69(OM17-40) donor system and the unmodified D71 donor, we observed an
inhibition with the longer homology acceptors, A26h and A45h (Fig.
6C). The inhibition was more pronounced (40-60%) with the
45-nt homology in the presence of NC. Interestingly, for transfers with
the A12h and A19h acceptors, transfer efficiencies with the
D69(OM17-40) donor were higher than those observed with the unmodified
donor D71 (Fig. 6C). This is most likely, because 5'-end
cleavages were slightly enhanced on the D69(OM17-40) donor (Fig.
6A). Such enhanced cleavages at the donor 5' terminus should improve primer annealing to the acceptor template. The finding that
blocking donor internal cleavages inhibits transfer only in the long
homology template systems supports our prediction that the long
homology transfers take place mainly via an acceptor invasion-initiated
pathway. Blocking donor internal cleavages may force the system to rely
only on the primer terminus switch-initiated pathway. We therefore
observe only a partial instead of a complete inhibition of transfers
with the 26- and 45-nt homology systems. Since short homology transfers
occur by primer terminus switch, blocking internal cleavages does not
affect transfers in these systems.
Time Course Analysis of the 45-nt Homology Transfer--
To
examine the sequence of events during the transfer process, we followed
the formation and accumulation of the various intermediates and end
products during the course of the reaction. Time course assays were
performed for the transfer and RNase H reactions using 5'-end-labeled
primer (Fig. 7A) and donor
(Fig. 7B), respectively. Reactions were performed at a
primer/donor/acceptor ratio of 1.5:1:3 under standard reaction
conditions in the absence of NC or at 400% NC coating. For transfer
reactions in the absence of NC, full-length donor extension product was
detectable within 15 s, followed by self-priming product at
30 s (Fig. 7A). Transfer product was not detected until
about 1 min (Fig. 7, A and C). In the presence of
NC, full-length extension product again was detected within 15 s
(Fig. 7A). Interestingly, the transfer product was now
detected as early as 30 s (Fig. 7, A and D),
whereas the self-priming product was not observed until 1 min (Fig.
7A). Formation of the self-priming product requires cleavage
and degradation of the donor RNA at its 5'-end (38, 50, 77). The
accumulation of transfer products before the formation of
self-priming product, in the presence of NC, suggests that transfer
occurred before the donor 5'-end fragment was cleaved. This argues that
the end cleavage is not required to facilitate the transfer.

View larger version (39K):
[in this window]
[in a new window]
|
Fig. 7.
Time course of strand transfer and donor
template cleavage with 45-nt homology acceptor. A, time
course of strand transfer with D71 donor RNA and A45h acceptor RNA, in
the absence (left, NC) or 400% coating
(right, +NC) of NC. Time points are indicated
above the lanes. Lane L,
10-bp DNA ladder. Transfer (T), full-length (FL),
and self-priming (SP) products are indicated. B,
RNase H cleavage of the D71 donor RNA during the course of transfer
reaction, in the absence ( NC) or with 400% coating
(+NC) of NC. Reactions were identical to those in
A except that 5'-end-labeled donor RNA and unlabeled primer
are used. Reaction conditions were the same as those in Figs. 3 and 5
except that the donor/acceptor ratio was changed from 1:1.5 to 1:3.
Time points (15 s, 30 s, 1 min, 2 min, 4 min, 8 min, 16 min, and
32 min) are indicated above the gel. C
and D, transfer efficiency (black
continuous lanes, left y
axis) and the 8-10-nt secondary cut efficiency (gray
dashed lines, right y axis)
were measured during the first 4 min of the transfer reaction.
Efficiencies were compared in the absence (C) or 400%
coating (D) of NC. Insets in C and
D show the efficiencies on the course of a 32-min
reaction.
|
|
When RNase H cleavage was followed during transfer reactions, the donor
template was almost completely degraded in reactions with NC (Fig.
7B). In the absence of NC, larger cleavage fragments accumulated at the earlier time points, which were degraded to smaller
fragments in time. The absence of such products in reactions with NC
suggests that NC enhances the overall RNase H efficiency. However, no
substantive differences in the cleavage site distribution were
observed. The 14-15-nt product was detected within 15 s, whereas
the 8-10-nt secondary cut product was not detected until 30 s or
1 min. In all, during earlier time points, no significant changes were
observed in the formation and accumulation of the 14-15- and 8-10-nt
fragments at the donor 5'-end, suggesting that NC does not influence
donor 5'-end cleavages significantly during the transfer reaction.
To examine the effect of NC on transfers with the 45-nt homology system
in more detail, formation of the transfer product and 8-10-nt
secondary cut products during the transfer reaction were plotted
together as a function of time (Fig. 7, C and D). At 1 min, in the absence of NC secondary cut efficiency was 1.5%, whereas transfer efficiency was only 0.4% (Fig. 7C). The
overall time course showed a more rapid accumulation of 8-10-nt cut
products as compared with transfer products. In sharp contrast, in
reactions with NC, a 4% transfer efficiency was detectable as early as
30 s (Fig. 7D). The overall time course of reaction
with NC showed no significant change in the rate of formation of the
8-10-nt cut product, whereas transfer product was formed at almost
20-fold higher efficiency. In the presence of NC, transfer products
were formed even before the secondary cuts at the donor 5'-end were initiated, thereby suggesting that the secondary cut is not necessary for transfer. The overall data agree with our conclusion that for minus
strand transfer with 45-nt homology, transfer occurs mainly via the
acceptor invasion-initiated pathway. Most likely, the donor 5'-end
fragment is strand-displaced by the acceptor template during the
invasion process.
Time Course Analysis of the 19-nt Homology Transfer--
From our
results, we expected that transfers take place through the primer
terminus switch-initiated pathway in templates with short homologies
(12 and 19 nt). If so, cuts that remove the donor 5'-end fragments
should be detectable prior to the formation of transfer products. To
test this, we repeated the time course assays using the 12-nt (data not
shown) and 19-nt homology (Fig. 8)
acceptors in the presence and absence of NC. Transfer product formation
and donor RNA degradation were followed by using 5'-end-labeled primer
(Fig. 8A) and donor RNA (data not shown), respectively. In
the presence or absence of NC, full-length extension product was
detected in 15 s, whereas the self-priming product was detected at
30 s. Transfer product formation occurred more slowly, detected only by 2-4 min in the absence of NC and by 1-2 min in its presence. Therefore, although NC stimulated transfer, self-priming product was
always formed prior to formation of transfer product. This was the
converse order to that found with the 45-nt homology system. Cleavage
of the donor template during transfer was similar to that observed for
the 45-nt homology template (data not shown), where NC increased the
overall RNase H activity but did not alter the cleavage profile.
Formation of the donor 5'-end cleavage products (namely the 14-nt
fragment and the 8-10 nt secondary cut products) was similar to
that observed for the 45-nt homology template (see Fig.
7B).

View larger version (28K):
[in this window]
[in a new window]
|
Fig. 8.
Time course of strand transfer and donor
template cleavage with 19-nt homology acceptor. A, time
course of strand transfer with D71 donor RNA and A19h acceptor RNA in
the absence (left, NC) or 400% coating
(right, +NC) of NC. Time points are indicated
above the lanes. Transfer (T),
full-length (FL), and self-priming (SP) products
are indicated. B, RNase H cleavage of the D71 donor RNA
during the course of transfer reaction, in the absence
( NC) or with 400% coating (+NC) of NC.
Reactions were identical to those in A except that
5'-end-labeled donor RNA and unlabeled primer are used. Reaction
conditions were the same as those in Figs. 3 and 5 except that the
donor/acceptor ratio was changed from 1:1.5 to 1:3. Time points (15 s,
30 s, 1 min, 2 min, 4 min, 8 min, 16 min, and 32 min) are
indicated above the gel. C and
D, transfer efficiency (black
continuous lines, left y
axis) and the 8-10-nt secondary cut efficiency (gray
dashed lines, right y axis)
were measured during the first 4 min of the transfer reaction.
Efficiencies were compared in the absence (C) or with 400%
coating (D) of NC. Insets in C and
D show the efficiencies on the course of a 32-min
reaction.
|
|
Formation of the transfer product and the secondary cut products with
time is plotted in Fig. 8, B and C. Unlike
results with the A45h system, NC protein did not change the order of
formation of the products in the 19-nt homology system, although it
stimulated transfer rate. In the absence or presence of NC, full-length
extension product appeared within 15 s, followed by the 8-10-nt
cut product by 30 s to 1 min. Transfer products were formed only
by 1 min in the presence or 2 min in the absence of NC. At 2 min,
transfer efficiency was 1.5 and 0.3% with and without NC, whereas
secondary cut efficiency was about 5.5% in both cases (Fig. 8,
B and C). During the whole time course, although
NC stimulated transfers, the transfer efficiency was much lower than
the 8-10-nt secondary cut efficiency. The result that transfer product
was formed only after the 8-10-nt cut is consistent with the need to
remove the terminal RNA segment to allow transfer by the primer
terminus switch-initiated mechanism.
 |
DISCUSSION |
Understanding the mechanism of minus strand strong stop transfer,
an obligatory step in reverse transcription has been the focus of
numerous studies. The current study examines two possible pathways for
the transfer mechanism. Previous observations that the R 5'-end
fragment is cleaved inefficiently (43, 54, 59, 60) prompted us to
consider the "acceptor invasion-initiated pathway," where transfer
occurs independent of the terminal cleavage. In this pathway, transfer
is initiated through annealing of the acceptor at internal sites in the
cDNA. Strand exchange would proceed by a branch migration process,
displacing other RNA fragments including the one at the terminus. The
requirement for long homology for efficient transfers (20-22) supports
such an acceptor invasion-initiated mechanism. Additionally, the
ability of NC to promote strand exchange of the primer from the cleaved
donor template to the acceptor (34) could account for the stimulatory
effects of NC on transfer by this mechanism. Alternately, NC can
stimulate cleavage of the 14-16-nt 5'-end fragment (43), thereby
freeing the primer terminus. In such a scenario, transfer can occur
through a "primer terminus switch-initiated" mechanism (Fig. 1),
where the free primer terminus anneals to the acceptor and facilitates transfer.
We have designed a minus strand transfer system in vitro
using HIV-1 R sequences to examine features of primer terminus
switch-initiated and acceptor invasion-initiated pathways and to
determine which is the likely mechanism for minus strand transfer in
HIV-1. The role of RNase H cleavages at the 5'-end versus
internal regions of the donor template in the transfer mechanism were
verified using 2'-O-methyl modifications. The modification
specifically blocks RNase H cleavage at the modified site without
affecting DNA polymerization. Blocking donor 5'-end cleavages almost
completely inhibited transfers with the short homology (Fig. 5; 12 and
19 nt), confirming that for short homology, degrading the donor 5'-end is critical for transfer. The absence of transfer products even at
400% NC coating further suggests that the NC-induced transfers in
these templates do not occur by a simple, RNase H-independent, strand
exchange mechanism. In the long homology template system, blocking
5'-end cleavage did not interfere with transfers (Fig. 5). Instead,
transfers were reduced when internal cleavages within the donor
template were blocked (Fig. 6). Taken together, data suggest that the
primer terminus switch-initiated mechanism is not the primary pathway
for transfers in the long homology templates.
In templates with long homology, inhibition of internal cuts did not
completely block transfers. This was probably because alternate
pathways such as primer terminus transfer are activated when the
invasion pathway is blocked or because a portion of the transfers
always occurred through the terminus switch pathway. Some transfers may
also have resulted from NC-induced strand exchange with the partially
cleaved donor. Interestingly, 5'-end cleavages were slightly enhanced
in our system with the D69(OM17-40) donor (Fig. 6A), which
would explain the slight increase in transfer efficiencies with the
12-nt and 19-nt homology templates with the D69(OM17-40) donor (Fig.
6C).
Relevant to the simultaneous employment of both pathways is our
observation that the fate of the 5'-terminal RNA segment of the HIV-1
genome is different in a reaction in which sssDNA is simply made
versus a reaction in which it engages in transfer to an
acceptor RNA. Our initial analysis showed that NC stimulated the
8-10-nt cuts at the RNA 5'-end by 50-100% in donor extension reactions without acceptor (Fig. 2B) and by 4-5-fold on
preformed hybrid substrates without synthesis (Fig. 2D)
(43). In contrast, those same cuts at the donor 5'-end were not
stimulated by NC during transfer reaction, especially at early time
points. This was true for transfer systems with both short (19 nt; Fig.
8C) and long (45 nt; Fig. 7D) homologies. This
difference is probably due to many of the end fragments being displaced
by the acceptor during transfer and therefore no longer available for
cleavage. However, in donor extension reactions and in RNase H assays
in the absence of synthesis, the 14-18-nt 5'-end fragment remains annealed to the cDNA, and NC stimulates its cleavage. This raises an interesting issue concerning the 19-nt homology transfers. If the
19-nt homology transfer occurs through the end transfer mechanism but
NC does not stimulate donor 5'-end cleavages, then what is the
mechanism of NC stimulation of transfer in this situation? Although
cleavages out to 16 nucleotides were blocked in D71(OM4-14), very high
levels of NC stimulated transfer (Fig. 5, lane
15), presumably by promoting strand exchange. This indicates
that aspects of stimulation of strand exchange by NC are not related to
terminal cleavages. We believe that the low efficiency of cleavages at the donor 5'-end is in fact a limiting factor for transfers in the
19-nt homology system, making the end transfer mechanism less efficient. The same is also true for the 12-nt system, with the reduced
homology further exacerbating the situation. For short homologies, NC
very likely has a general stimulatory effect on both efficient
transfers from cleaved terminal regions and inefficient transfers from
uncleaved terminal regions.
Analysis of transfers with different lengths of homology between donor
and acceptor RNAs helped us to understand the structural features of
the substrates that promote one mechanism of transfer versus
the other. With the 45-nt homology transfer system, transfer products
accumulated at a faster rate than the 5'-end cleavage product (Fig. 7),
indicating that transfers do not depend on cleavage of the terminal
fragment. Furthermore, in the presence of NC, transfer products were
formed prior to formation of self-priming products (Fig.
7A). Formation of self-priming products is an indication of
donor 5'-end cleavage (50, 58). The Hughes group proposed that the
uncleaved 14-nt 5'-end fragment serves to prevent the sssDNA from
folding back on itself and self-priming and that NC serves to keep the
terminal 14-nt fragment annealed to the donor template (50, 58). In
contrast, with the shorter 19-nt homology system, the bulk of transfers
occurred after substantial cleavage near the RNA 5'-end (Fig. 8), and
self-priming products were formed before and during formation of
transfer products (Fig. 8A). Peliska and Benkovic (57) found
that the 14-nt fragment at the genome 5'-end needs to be degraded to
facilitate transfer. Since their system was based on a 20-nt homology,
the results agree with our "primer terminus switch-initiated"
pathway. The overall data suggest that acceptor invasion rather than
the primer terminus switch drives strand transfer in retroviruses with
long terminal homologies such as HIV-1.
Recent studies in our laboratory have shown evidence for an acceptor
invasion-initiated mechanism for internal transfer events that lead to
recombination (56, 78). Transfers occur through a two-step "dock and
lock" mechanism, where the acceptor interacts (docks) with the
donor-cDNA complex at regions where RNase H cleavage is enhanced
(76, 78). The acceptor-cDNA hybrid propagates through branch
migration and ultimately catches up with the primer terminus, where
transfer of the primer terminus (lock) completes the event. The
acceptor invasion therefore appears to be the preferred pathway for
transfers during both minus strand transfers and internal transfers
leading to recombination, including repeat deletions. Minus strand
transfer is a special case of the dock and lock mechanism in which the
position of the lock step is determined by the termination of synthesis
at the 5'-end of the viral genome.
The viral NC is a well studied nucleic acid chaperone protein shown to
promote strand transfer (see Ref. 30 and references therein). As
observed in this study, NC stimulates specific steps in minus strand
transfer mechanism, two of which include 1) increasing RNase H
cleavages and 2) facilitating acceptor-cDNA interactions and strand
exchange. NC enhanced overall RNase H activity during minus strand
transfer, where full-length donor template and the large template
fragments formed early in the reaction were rapidly degraded (Fig.
7B), creating opportunities for acceptor-cDNA
interaction for long homology transfer. NC also stimulated transfers
with short and long homology templates. However, the efficiency of the
8-10-nt secondary cuts was not significantly affected by the homology
length or presence of NC. This suggests that NC-stimulated transfers
were not effected through the primer terminus transfer-initiated mechanism, involving cleavage of the donor 5'-end. The increased internal cleavages within the donor, together with the increased transfer efficiency and inefficient cleavage of the donor 5'-end suggest that NC stimulates transfers by facilitating acceptor-cDNA interactions followed by efficient strand exchange. The 5'-end fragment
is thus displaced and remains uncleaved. NC has been shown to promote
strand exchange (34) as well as accelerate the annealing between the
sssDNA and the HIV-1 3' R region by 3000-fold (35). Studies by
Negroni and Buc (76) show that NC coating of the acceptor, but not
donor, is important for recombination, suggesting that NC-induced
changes in the acceptor conformation contribute to the enhanced transfers.
Minus strand transfer is facilitated through the homologous repeat (R)
regions at both ends of the genome. Results of our study show that
transfers are more efficient in systems with longer homology, although
a low efficiency of transfers was still detectable with as little as
12-nt homology. This agrees with the observations of others that a
minimum homology is required (20-22). Moreover, the ability to
reconstitute minus strand transfers by substituting the viral R
sequence with nonviral sequences supports the argument that it is the
homology rather than the specific sequence that is important for
transfer (79). The reason why some retroviruses have evolved a shorter
homologous region for sssDNA transfer is not known, but the effects
of differences in homology length may be compensated by a myriad of
factors. Berkhout et al. (24) proposed that in addition to
homology, structural features of the HIV-1 repeat regions facilitate
minus strand transfer. They propose that "kissing interactions"
between the anti-TAR and anti-poly(A) hairpins in the sssDNA and the
TAR and poly(A) of the 3'-untranslated region (acceptor) initiate the
first interactions between the cDNA and acceptor. In addition,
studies have shown that template secondary structure, especially that
of the acceptor RNA, is important (72, 76, 78). The acceptor needs to
be accessible to invade and initiate transfer. In our study, although
sharing longer homology with the donor template than A26h, the A45h
acceptor forms a more stable secondary structure that apparently limits
accessibility for invasion, resulting in lower transfers. Studies show
that besides RT-RNase H activity, NC, and template homology, additional factors are also involved in facilitating minus strong stop transfer. Conformation of the dimeric RNA genome (23) as well as transient interactions between the tRNA and a
conserved sequence in the U3 region (74) have been implicated in
facilitating minus strand transfer in HIV-1. Topping et al.
(80) propose that a base pairing-independent mechanism functions in the
specific guidance of strong stop template switch to the U3/R junction
in Moloney murine leukemia virus.
Based on the overall data, we conclude that transfers can be
facilitated by two different mechanisms, depending on structure of the
polymer substrates. When the homology is relatively short, transfers
occur via the primer terminus switch-initiated pathway. This is likely
to be the major pathway for minus strand transfer in retroviruses such
as the mouse mammary tumor virus (15-nt R), type D viruses such as
Mason-Pfizer monkey virus (25-nt R), and avian type C viruses (21-nt
R), which have short repeat regions. In lentiviruses such as HIV
(98-174-nt R), spumaviruses (170-191-nt R), murine leukemia
virus (68-nt R), and the human T-cell leukemia virus/bovine leukemia
virus group of viruses (~230-nt R), which contain relatively
long R sequences, transfers are likely to occur predominantly through
an acceptor invasion-initiated mechanism. In the context of a long
homology R, it is not clear where the invasion is initiated and whether
the invasion initiates before or after the RT has copied to the end of
the donor. Such details are currently under investigation. In addition,
the templates used in this study are relatively short and simple
compared with the 10-kb genome in HIV-1. We are currently in the
process of testing the acceptor invasion-initiated pathway by utilizing
a more complete system to mimic the minus strand transfer in HIV-1.
 |
ACKNOWLEDGEMENTS |
We thank the Genetics Institute for
recombinant HIV-1 RT and Dr. Robert J. Gorelick for HIV-1 NC (55 amino
acids). We thank Drs. Judith Levin and Jianhui Guo for helpful
discussions and critical reading of the manuscript. We thank Drs. Eric
Phizicky, Baek Kim, and Yi-Tao Yu for critical reading of the
manuscript and Dr. Mark Hanson and Ricardo Roda for helpful discussions.
 |
FOOTNOTES |
*
This work was supported by National Institutes of Health
Grant 49573 (to R. A. B. and P. J. F.).The costs of publication of this
article were defrayed in part by the
payment of page charges. The article
must therefore be hereby marked
"advertisement" in accordance with 18 U.S.C. Section
1734 solely to indicate this fact.
To whom correspondence should be addressed: Dept. of
Biochemistry and Biophysics, Box 712, University of Rochester Medical Center, 601 Elmwood Ave., Rochester, NY 14642. Tel.: 585-275-2764; Fax:
585-271-2683; E-mail: robert_bambara@urmc.rochester.edu.
Published, JBC Papers in Press, December 23, 2002, DOI 10.1074/jbc.M210959200
 |
ABBREVIATIONS |
The abbreviations used are:
RT, reverse
transcriptase;
sssDNA, minus strand strong stop DNA;
NC, nucleocapsid;
HIV-1, human immunodeficiency virus, type 1;
nt, nucleootide(s).
 |
REFERENCES |
| 1.
|
Telesnitsky, A.,
and Goff, S. P.
(1997)
in
Retroviruses
(Coffin, J. M.
, Hughes, S. H.
, and Varmus, H. E., eds)
, pp. 121-160, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
|
| 2.
|
Telesnitsky, A.,
and Goff, S. P.
(1993)
in
Reverse Transcriptase
(Skalka, A. M.
, and Goff, S. P., eds)
, pp. 49-83, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 3.
|
Luo, G. X.,
and Taylor, J.
(1990)
J. Virol.
64,
4321-4328[Abstract/Free Full Text]
|
| 4.
|
Garces, J.,
and Wittek, R.
(1991)
Proc. R. Soc. Lond. B. Biol. Sci.
243,
235-239[Medline]
[Order article via Infotrieve]
|
| 5.
|
Tanese, N.,
Telesnitsky, A.,
and Goff, S. P.
(1991)
J. Virol.
65,
4387-4397[Abstract/Free Full Text]
|
| 6.
|
Telesnitsky, A.,
Blain, S. W.,
and Goff, S. P.
(1992)
J. Virol.
66,
615-622[Abstract/Free Full Text]
|
| 7.
|
Svarovskaia, E. S.,
Delviks, K. A.,
Hwang, C. K.,
and Pathak, V. K.
(2000)
J. Virol.
74,
7171-7178[Abstract/Free Full Text]
|
| 8.
|
Hwang, C. K.,
Svarovskaia, E. S.,
and Pathak, V. K.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
12209-12214[Abstract/Free Full Text]
|
| 9.
|
DeStefano, J. J.,
Buiser, R. G.,
Mallaber, L. M.,
Myers, T. W.,
Bambara, R. A.,
and Fay, P. J.
(1991)
J. Biol. Chem.
266,
7423-7431[Abstract/Free Full Text]
|
| 10.
|
Kati, W. M.,
Johnson, K. A.,
Jerva, L. F.,
and Anderson, K. S.
(1992)
J. Biol. Chem.
267,
25988-25997[Abstract/Free Full Text]
|
| 11.
|
Vogt, V. M.
(1997)
in
Retroviruses
(Coffin, J. M.
, Hughes, S. H.
, and Varmus, H. E., eds)
, pp. 27-69, Cold Spring Harbor Labortatory, Cold Spring Harbor, NY
|
| 12.
|
Varmus, H. E.,
Heasley, S.,
Kung, H. J.,
Oppermann, H.,
Smith, V. C.,
Bishop, J. M.,
and Shank, P. R.
(1978)
J. Mol. Biol.
120,
55-82[CrossRef][Medline]
[Order article via Infotrieve]
|
| 13.
|
Lee, Y. M.,
and Coffin, J. M.
(1991)
Mol. Cell. Biol.
11,
1419-1430[Abstract/Free Full Text]
|
| 14.
|
Lobel, L. I.,
and Goff, S. P.
(1985)
J. Virol.
53,
447-455[Abstract/Free Full Text]
|
| 15.
|
Ramsey, C. A.,
and Panganiban, A. T.
(1993)
J. Virol.
67,
4114-4121[Abstract/Free Full Text]
|
| 16.
|
Klaver, B.,
and Berkhout, B.
(1994)
Nucleic Acids Res.
22,
137-144[Abstract/Free Full Text]
|
| 17.
|
Kulpa, D.,
Topping, R.,
and Telesnitsky, A.
(1997)
EMBO J.
16,
856-865[CrossRef][Medline]
[Order article via Infotrieve]
|
| 18.
|
Yin, P. D.,
Pathak, V. K.,
Rowan, A. E.,
Teufel, R. J., II,
and Hu, W. S.
(1997)
J. Virol.
71,
2487-2494[Abstract]
|
| 19.
|
Ohi, Y.,
and Clever, J. L.
(2000)
J. Virol.
74,
8324-8334[Abstract/Free Full Text]
|
| 20.
|
Berkhout, B.,
van Wamel, J.,
and Klaver, B.
(1995)
J. Mol. Biol.
252,
59-69[CrossRef][Medline]
[Order article via Infotrieve]
|
| 21.
|
Dang, Q.,
and Hu, W. S.
(2001)
J. Virol.
75,
809-820[Abstract/Free Full Text]
|
| 22.
|
Pfeiffer, J. K.,
and Telesnitsky, A.
(2001)
J. Virol.
75,
11263-11274[Abstract/Free Full Text]
|
| 23.
|
Berkhout, B.,
Das, A. T.,
and van Wamel, J. L.
(1998)
Virology
249,
211-218[CrossRef][Medline]
[Order article via Infotrieve]
|
| 24.
|
Berkhout, B.,
Vastenhouw, N. L.,
Klasens, B. F.,
and Huthoff, H.
(2001)
RNA
7,
1097-1114[Abstract]
|
| 25.
|
Henderson, L. E.,
Bowers, M. A.,
Sowder, R. C., II,
Serabyn, S. A.,
Johnson, D. G.,
Bess, J. W., Jr.,
Arthur, L. O.,
Bryant, D. K.,
and Fenselau, C.
(1992)
J. Virol.
66,
1856-1865[Abstract/Free Full Text]
|
| 26.
|
You, J. C.,
and McHenry, C. S.
(1993)
J. Biol. Chem.
268,
16519-16527[Abstract/Free Full Text]
|
| 27.
|
Henderson, L. E.,
Copeland, T. D.,
Sowder, R. C.,
Smythers, G. W.,
and Oroszlan, S.
(1981)
J. Biol. Chem.
256,
8400-8406[Abstract/Free Full Text]
|
| 28.
|
Darlix, J. L.,
Vincent, A.,
Gabus, C.,
de Rocquigny, H.,
and Roques, B.
(1993)
C. R. Acad. Sci. III
316,
763-771[Medline]
[Order article via Infotrieve]
|
| 29.
|
Roques, B. P.,
Morellet, N.,
de Rocquigny, H.,
Demene, H.,
Schueler, W.,
and Jullian, N.
(1997)
Biochimie (Paris)
79,
673-680[CrossRef]
|
| 30.
|
Rein, A.,
Henderson, L. E.,
and Levin, J. G.
(1998)
Trends Biochem. Sci.
23,
297-301[CrossRef][Medline]
[Order article via Infotrieve]
|
| 31.
|
De Rocquigny, H.,
Gabus, C.,
Vincent, A.,
Fournie-Zaluski, M. C.,
Roques, B.,
and Darlix, J. L.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
6472-6476[Abstract/Free Full Text]
|
| 32.
|
Khan, R.,
and Giedroc, D. P.
(1992)
J. Biol. Chem.
267,
6689-6695[Abstract/Free Full Text]
|
| 33.
|
Peliska, J. A.,
Balasubramanian, S.,
Giedroc, D. P.,
and Benkovic, S. J.
(1994)
Biochemistry
33,
13817-13823[CrossRef][Medline]
[Order article via Infotrieve]
|
| 34.
|
Tsuchihashi, Z.,
and Brown, P. O.
(1994)
J. Virol.
68,
5863-5870[Abstract/Free Full Text]
|
| 35.
|
You, J. C.,
and McHenry, C. S.
(1994)
J. Biol. Chem.
269,
31491-31495[Abstract/Free Full Text]
|
| 36.
|
Feng, Y. X.,
Copeland, T. D.,
Henderson, L. E.,
Gorelick, R. J.,
Bosche, W. J.,
Levin, J. G.,
and Rein, A.
(1996)
Proc. Natl. Acad. Sci. U. S. A.
93,
7577-7581[Abstract/Free Full Text]
|
| 37.
|
Cameron, C. E.,
Ghosh, M.,
Le Grice, S. F.,
and Benkovic, S. J.
(1997)
Proc. Natl. Acad. Sci. U. S. A.
94,
6700-6705[Abstract/Free Full Text]
|
| 38.
|
Guo, J.,
Henderson, L. E.,
Bess, J.,
Kane, B.,
and Levin, J. G.
(1997)
J. Virol.
71,
5178-5188[Abstract]
|
| 39.
|
Guo, J.,
Wu, T.,
Anderson, J.,
Kane, B. F.,
Johnson, D. G.,
Gorelick, R. J.,
Henderson, L. E.,
and Levin, J. G.
(2000)
J. Virol.
74,
8980-8988[Abstract/Free Full Text]
|
| 40.
|
Johnson, P. E.,
Turner, R. B.,
Wu, Z. R.,
Hairston, L.,
Guo, J.,
Levin, J. G.,
and Summers, M. F.
(2000)
Biochemistry
39,
9084-9091[CrossRef][Medline]
[Order article via Infotrieve]
|
| 41.
|
Williams, M. C.,
Rouzina, I.,
Wenner, J. R.,
Gorelick, R. J.,
Musier-Forsyth, K.,
and Bloomfield, V. A.
(2001)
Proc. Natl. Acad. Sci. U. S. A.
98,
6121-6126[Abstract/Free Full Text]
|
| 42.
|
Williams, M. C.,
Gorelick, R. J.,
and Musier-Forsyth, K.
(2002)
Proc. Natl. Acad. Sci. U. S. A.
99,
8614-8619[Abstract/Free Full Text]
|
| 43.
|
Wisniewski, M.,
Chen, Y.,
Balakrishnan, M.,
Palaniappan, C.,
Roques, B. P.,
Fay, P. J.,
and Bambara, R. A.
(2002)
J. Biol. Chem.
277,
28400-28410[Abstract/Free Full Text]
|
| 44.
|
Hong, M. K.,
Harbron, E. J.,
O'Connor, D. B.,
Guo, J.,
Barbara, P. F.,
Levin, J. G.,
and Musier-Forsyth, K.
(2003)
J. Mol. Biol.
325,
1-10[CrossRef][Medline]
[Order article via Infotrieve]
|
| 45.
|
DeStefano, J. J.
(1996)
J. Biol. Chem.
271,
16350-16356[Abstract/Free Full Text]
|
| 46.
|
Werner, S.,
Vogel-Bachmayr, K.,
Hollinderbaumer, B.,
and Wohrl, B. M.
(2001)
J. Virol.
75,
10132-10138[Abstract/Free Full Text]
|
| 47.
|
Bernacchi, S.,
Stoylov, S.,
Piemont, E.,
Ficheux, D.,
Roques, B. P.,
Darlix, J. L.,
and Mely, Y.
(2002)
J. Mol. Biol.
317,
385-399[CrossRef][Medline]
[Order article via Infotrieve]
|
| 48.
|
Guo, J.,
Wu, T.,
Kane, B. F.,
Johnson, D. G.,
Henderson, L. E.,
Gorelick, R. J.,
and Levin, J. G.
(2002)
J. Virol.
76,
4370-4378[Abstract/Free Full Text]
|
| 49.
|
Lapadat-Tapolsky, M.,
Gabus, C.,
Rau, M.,
and Darlix, J. L.
(1997)
J. Mol. Biol.
268,
250-260[CrossRef][Medline]
[Order article via Infotrieve]
|
| 50.
|
Driscoll, M. D.,
and Hughes, S. H.
(2000)
J. Virol.
74,
8785-8792[Abstract/Free Full Text]
|
| 51.
|
Lener, D.,
Tanchou, V.,
Roques, B. P.,
Le Grice, S. F.,
and Darlix, J. L.
(1998)
J. Biol. Chem.
273,
33781-33786[Abstract/Free Full Text]
|
| 52.
|
Druillennec, S.,
Caneparo, A.,
de Rocquigny, H.,
and Roques, B. P.
(1999)
J. Biol. Chem.
274,
11283-11288[Abstract/Free Full Text]
|
| 53.
|
de Rocquigny, H.,
Ficheux, D.,
Gabus, C.,
Fournie-Zaluski, M. C.,
Darlix, J. L.,
and Roques, B. P.
(1991)
Biochem. Biophys. Res. Commun.
180,
1010-1018[CrossRef][Medline]
[Order article via Infotrieve]
|
| 54.
|
Wisniewski, M.,
Balakrishnan, M.,
Palaniappan, C.,
Fay, P. J.,
and Bambara, R. A.
(2000)
J. Biol. Chem.
275,
37664-37671[Abstract/Free Full Text]
|
| 55.
|
Wisniewski, M.,
Balakrishnan, M.,
Palaniappan, C.,
Fay, P. J.,
and Bambara, R. A.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
11978-11983[Abstract/Free Full Text]
|
| 56.
|
Balakrishnan, M.,
Fay, P. J.,
and Bambara, R. A.
(2001)
J. Biol. Chem.
276,
36482-36492[Abstract/Free Full Text]
|
| 57.
|
Peliska, J. A.,
and Benkovic, S. J.
(1992)
Science
258,
1112-1118[Abstract/Free Full Text]
|
| 58.
|
Driscoll, M. D.,
Golinelli, M. P.,
and Hughes, S. H.
(2001)
J. Virol.
75,
672-686[Abstract/Free Full Text]
|
| 59.
|
Gopalakrishnan, V.,
Peliska, J. A.,
and Benkovic, S. J.
(1992)
Proc. Natl. Acad. Sci. U. S. A.
89,
10763-10767[Abstract/Free Full Text]
|
| 60.
|
Ben-Artzi, H.,
Zeelon, E.,
Amit, B.,
Wortzel, A.,
Gorecki, M.,
and Panet, A.
(1993)
J. Biol. Chem.
268,
16465-16471[Abstract/Free Full Text]
|
| 61.
|
Champoux, J. J.
(1993)
in
Reverse Transcriptase
(Skalka, A. M.
, and Goff, S. P., eds)
, pp. 103-117, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
|
| 62.
|
DeStefano, J. J.,
Mallaber, L. M.,
Fay, P. J.,
and Bambara, R. A.
(1993)
Nucleic Acids Res.
21,
4330-4338[Abstract/Free Full Text]
|
| 63.
|
Palaniappan, C.,
Fuentes, G. M.,
Rodriguez-Rodriguez, L.,
Fay, P. J.,
and Bambara, R. A.
(1996)
J. Biol. Chem.
271,
2063-2070[Abstract/Free Full Text]
|
| 64.
|
Allain, B.,
Lapadat-Tapolsky, M.,
Berlioz, C.,
and Darlix, J. L.
(1994)
EMBO J.
13,
973-981[Medline]
[Order article via Infotrieve]
|
| 65.
|
Rodriguez-Rodriguez, L.,
Tsuchihashi, Z.,
Fuentes, G. M.,
Bambara, R. A.,
and Fay, P. J.
(1995)
J. Biol. Chem.
270,
15005-15011[Abstract/Free Full Text]
|
| 66.
|
Wu, W.,
Palaniappan, C.,
Bambara, R. A.,
and Fay, P. J.
(1996)
Nucleic Acids Res.
24,
1710-1718[Abstract/Free Full Text]
|
| 67.
|
Kim, J. K.,
Palaniappan, C.,
Wu, W.,
Fay, P. J.,
and Bambara, R. A.
(1997)
J. Biol. Chem.
272,
16769-16777[Abstract/Free Full Text]
|
| 68.
|
Allain, B.,
Rascle, J. B.,
de Rocquigny, H.,
Roques, B.,
and Darlix, J. L.
(1998)
J. Mol. Biol.
277,
225-235[CrossRef][Medline]
[Order article via Infotrieve]
|
| 69.
|
Guo, J.,
Wu, T.,
Bess, J.,
Henderson, L. E.,
and Levin, J. G.
(1998)
J. Virol.
72,
6716-6724[Abstract/Free Full Text]
|
| 70.
|
Jeeninga, R. E.,
Huthoff, H. T.,
Gultyaev, A. P.,
and Berkhout, B.
(1998)
Nucleic Acids Res.
26,
5472-5479[Abstract/Free Full Text]
|
| 71.
|
Gabbara, S.,
Davis, W. R.,
Hupe, L.,
Hupe, D.,
and Peliska, J. A.
(1999)
Biochemistry
38,
13070-13076[CrossRef][Medline]
[Order article via Infotrieve]
|
| 72.
|
Negroni, M.,
and Buc, H.
(1999)
J. Mol. Biol.
286,
15-31[CrossRef][Medline]
[Order article via Infotrieve]
|
| 73.
|
Wu, T.,
Guo, J.,
Bess, J.,
Henderson, L. E.,
and Levin, J. G.
(1999)
J. Virol.
73,
4794-4805[Abstract/Free Full Text]
|
| 74.
|
Brule, F.,
Bec, G.,
Keith, G.,
Le Grice, S. F.,
Roques, B. P.,
Ehresmann, B.,
Ehresmann, C.,
and Marquet, R.
(2000)
Nucleic Acids Res.
28,
634-640[Abstract/Free Full Text]
|
| 75.
|
Hsu, M.,
Rong, L.,
de Rocquigny, H.,
Roques, B. P.,
and Wainberg, M. A.
(2000)
Nucleic Acids Res.
28,
1724-1729[Abstract/Free Full Text]
|
| 76.
|
Negroni, M.,
and Buc, H.
(2000)
Proc. Natl. Acad. Sci. U. S. A.
97,
6385-6390[Abstract/Free Full Text]
|
| 77.
|
Golinelli, M. P.,
and Hughes, S. H.
(2001)
Virology
285,
278-290[CrossRef][Medline]
[Order article via Infotrieve]
|
| 78.
|
Roda, R. H.,
Balakrishnan, M.,
Kim, J. K.,
Roques, B. P.,
Fay, P. J.,
and Bambara, R. A.
(2002)
J. Biol. Chem.
277,
46900-46911[Abstract/Free Full Text]
|
| 79.
|
Cheslock, S. R.,
Anderson, J. A.,
Hwang, C. K.,
Pathak, V. K.,
and Hu, W. S.
(2000)
J. Virol.
74,
9571-9579[Abstract/Free Full Text]
|
| 80.
|
Topping, R.,
Demoitie, M. A.,
Shin, N. H.,
and Telesnitsky, A.
(1998)
J. Mol. Biol.
281,
1-15[CrossRef][Medline]
[Order article via Infotrieve]
|
Copyright © 2003 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
M. Song, V. P. Basu, M. N. Hanson, B. P. Roques, and R. A. Bambara
Proximity and Branch Migration Mechanisms in HIV-1 Minus Strand Strong Stop DNA Transfer
J. Biol. Chem.,
February 8, 2008;
283(6):
3141 - 3150.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Purohit, B. P. Roques, B. Kim, and R. A. Bambara
Mechanisms That Prevent Template Inactivation by HIV-1 Reverse Transcriptase RNase H Cleavages
J. Biol. Chem.,
April 27, 2007;
282(17):
12598 - 12609.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. J. Operario, M. Balakrishnan, R. A. Bambara, and B. Kim
Reduced dNTP Interaction of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Promotes Strand Transfer
J. Biol. Chem.,
October 27, 2006;
281(43):
32113 - 32121.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Lanciault and J. J. Champoux
Pausing during Reverse Transcription Increases the Rate of Retroviral Recombination
J. Virol.,
March 1, 2006;
80(5):
2483 - 2494.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Cruceanu, M. A. Urbaneja, C. V. Hixson, D. G. Johnson, S. A. Datta, M. J. Fivash, A. G. Stephen, R. J. Fisher, R. J. Gorelick, J. R. Casas-Finet, et al.
Nucleic acid binding and chaperone properties of HIV-1 Gag and nucleocapsid proteins
Nucleic Acids Res.,
January 30, 2006;
34(2):
593 - 605.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
V. Purohit, M. Balakrishnan, B. Kim, and R. A. Bambara
Evidence That HIV-1 Reverse Transcriptase Employs the DNA 3' End-directed Primary/Secondary RNase H Cleavage Mechanism during Synthesis and Strand Transfer
J. Biol. Chem.,
December 9, 2005;
280(49):
40534 - 40543.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chen, M. Balakrishnan, B. P. Roques, and R. A. Bambara
Acceptor RNA Cleavage Profile Supports an Invasion Mechanism for HIV-1 Minus Strand Transfer
J. Biol. Chem.,
April 15, 2005;
280(15):
14443 - 14452.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Lanciault and J. J. Champoux
Effects of Unpaired Nucleotides within HIV-1 Genomic Secondary Structures on Pausing and Strand Transfer
J. Biol. Chem.,
January 28, 2005;
280(4):
2413 - 2423.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Heilman-Miller, T. Wu, and J. G. Levin
Alteration of Nucleic Acid Structure and Stability Modulates the Efficiency of Minus-Strand Transfer Mediated by the HIV-1 Nucleocapsid Protein
J. Biol. Chem.,
October 15, 2004;
279(42):
44154 - 44165.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chen, M. Balakrishnan, B. P. Roques, and R. A. Bambara
Steps of the Acceptor Invasion Mechanism for HIV-1 Minus Strand Strong Stop Transfer
J. Biol. Chem.,
October 3, 2003;
278(40):
38368 - 38375.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 2003 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|